Fish and Shell sh Immunology 157 (2025) 110092
Contents lists available at ScienceDirect
Fish and Shellfish Immunology
journal homepage: www.elsevier.com/locate/fsi
CRISPR/Cas9-induced knockout of tumor necrosis factor-alpha-type I
augments viral infection in zebrafish
Arthika Kalaichelvan a,1 , Kishanthini Nadarajapillai a,1, Sarithaa Raguvaran Sellaththurai a ,
U.P.E. Arachchi a , Myoung-Jin Kim c , Sumi Jung a,b,** , Jehee Lee a,b,*
a
b
c
Department of Marine Life Sciences & Center for Genomic Selection in Korean Aquaculture, Jeju National University, Jeju, 63243, Republic of Korea
Marine Life Research Institute, Gidang Marine Research Institute, Jeju National University, Jeju, 63333, Republic of Korea
Nakdonggang National Institute of Biological Resources, Sangju-si, Gyeongsangbuk-do, 37242, Republic of Korea
A R T I C L E I N F O
A B S T R A C T
Keywords:
TNF-α1
Zebrafish
CRISPR/Cas9
VHSV
Antiviral immunity
Tumor necrosis factor-alpha (TNF-α) is a pleiotropic cytokine with critical roles in inflammation, cell survival,
and defense. As a member of the TNF superfamily, it exerts its effects by binding to transmembrane receptors and
triggering various downstream signaling pathways. Although TNF-α′s involvement in antiviral responses in
mammals is well-established, its role in teleost remains poorly understood. This study investigated the contri­
bution of TNF-α1 to antiviral immunity in zebrafish using a tnf-α1(− /− ) knockout (KO) line. We challenged both
wild-type and tnf-α1(− /− ) zebrafish with viral hemorrhagic septicemia virus (VHSV) at both embryonic and adult
stages. Mortality was observed at 4 days post-infection (dpi) in tnf-α1-deficient adult fish challenged with 5 × 106
TCID50 (VHSV) and at 5 dpi in adult wild fish challenged with the same concentration. In addition, tnf-α1(− /− )
KO adult fish reached the maximum mortality of 100 % at 20 dpi, whereas wild adult fish reached 54 % mortality
at the same time point. This increased susceptibility to early mortality was associated with a higher viral burden
and altered expression of key immune genes, including the pro-inflammatory cytokines il-6 and il-1β, the antiinflammatory cytokine il-10, and interferon-related genes such as irf1 and ifn-γ. Our findings demonstrate the
crucial role of TNF-α1 in antiviral defense mechanisms in zebrafish and provide valuable insights into the
functional conservation of TNF-α signaling across vertebrate species. This knowledge may contribute to the
development of strategies to combat viral diseases in fish.
1. Introduction
Tumor necrosis factor-alpha (TNF-α) is a pro-inflammatory cytokine
that is mainly produced by macrophages, monocytes, T cells, and nat­
ural killer cells in response to pathogen invasions [1]. It was initially
identified for its cytotoxic effects on tumor cells in rabbits and mice
following endotoxin injection [2,3]. TNF-α, a member of the TNF su­
perfamily, plays a pivotal role in regulating a multitude of cellular
functions, including cell proliferation, differentiation, survival, and
death [4]. Its production depends on the involvement of multiple re­
ceptors, including Toll-like and T-cell receptors, amongst others [5]. It is
normally produced as a transmembrane protein (tmTNF) and converted
to a soluble form (sTNF) by TNF-converting enzyme (TACE) [6]. Once
sTNF binds to TNF receptor type 1 (TNFR1), it activates key signaling
pathways such as nuclear factor kappa B (NF-κB), nuclear factor of
activated T-cells (NFAT), and activator protein 1 (including c-Jun and
Fos) [7].
These signaling pathways contribute to the diverse functions of TNFα, including its role in antiviral immunity. Compelling evidence in­
dicates that TNF-α is crucial for combating a range of viruses in mam­
mals. For instance, human TNF-α has been shown to inhibit the
replication of RNA viruses such as encephalomyocarditis virus (EMCV)
and vesicular stomatitis virus (VSV) [8]. Furthermore, TNF-α exhibits
antiviral activity against VSV and herpes simplex virus (HSV) infections
in human cell lines [9]. Additionally, TNF-α inhibition facilitates the
advancement or reactivation of several significant viral infections,
including human immunodeficiency, varicella-zoster and Epstein-Barr
viruses, cytomegalovirus, and human papillomavirus, in patients
* Corresponding author. Marine Molecular Genetics Lab, Jeju National University, 102 Jejudaehakno, Jeju, 63243, Republic of Korea.
** Corresponding author. Marine Molecular Genetics Lab, Jeju National University, 102 Jejudaehakno, Jeju, 63243, Republic of Korea.
E-mail addresses: tnal1004u@jejunu.ac.kr (S. Jung), jehee@jejunu.ac.kr (J. Lee).
1
These authors contributed equally to this work.
https://doi.org/10.1016/j.fsi.2024.110092
Received 9 September 2024; Received in revised form 2 December 2024; Accepted 20 December 2024
Available online 21 December 2024
1050-4648/© 2024 Elsevier Ltd. All rights are reserved, including those for text and data mining, AI training, and similar technologies.
A. Kalaichelvan et al.
Fish and Shell sh Immunology 157 (2025) 110092
2.3. VHSV challenge experiment to WT and tnf-α1(− /− ) larvae
undergoing TNF-α blocking therapy [10]. Moreover, TNF-α has
demonstrated robust antiviral efficacy against avian, swine, and human
influenza viruses [11].
Conversely, some studies have proposed that TNF-α may play a role
in viral pathogenesis, whereby viruses can manipulate cellular ma­
chinery to evade the immune response and facilitate infection dissemi­
nation [12]. Notably, a previous study on zebrafish indicated that TNF-α
is involved in the in vitro replication of the spring viremia of carp virus
(SVCV) and increases the in vivo susceptibility of zebrafish to the virus
while simultaneously increasing mRNA expression of antiviral genes
[13]. Furthermore, although TNF-α produced by dendritic cells has been
shown to regulate influenza virus infection, its excessive production can
result in pathogenesis [14]. Thus, the dual role of TNF-α in antiviral
immunity appears to either support viral clearance or exacerbate
immunopathology, depending on the context [15]. Consequently,
further research is required to elucidate its precise function in the
context of viral pathogenesis.
Viral hemorrhagic septicemia virus (VHSV) is a negative-stranded
virus of the genus Novirhabdovirus that is highly infectious to a wide
range of freshwater and marine fish species [16]. To date, VHSV isolates
have been obtained from more than 82 different freshwater and marine
species in Europe, North America, and North Asia [17]. Therefore,
research on VHSV is crucial for developing effective defense mecha­
nisms against viral threats in aquaculture. Investigating antiviral genes
in fish can provide insights into immunity and disease resistance, which
is vital for enhancing fish health and optimizing aquaculture practices.
This knowledge could also significantly mitigate the economic impact of
disease outbreaks in the industry.
We have previously successfully generated a tnf-α1(− /− ) zebrafish
model and demonstrated its effect on Edwardsiella piscicida infection
[18]. To further investigate the role of TNF-α in antiviral immunity,
particularly in teleosts, this study investigated the impact of TNF-α1
deficiency in a tnf-α1(− /− ) zebrafish model challenged with VHSV. By
examining the effects of TNF-α1 deletion at embryonic and adult stages,
we aimed to elucidate its role in antiviral defense and enhance our un­
derstanding of immune responses in fish.
In total, 100 embryos were selected and incubated at 28 ◦ C for 3 days
to evaluate the antiviral immune response in WT and tnf-α1(− /− ) larvae.
At 4 days post fertilization (dpf), the larvae were separated into 2
groups. The rVHSV and 1 X PBS were prepared with dextran, tetrame­
thylrhodamine (Invitrogen, Thermo Fisher Scientific). One group was
injected with a concentration of ~300 TCID50 rVHSV/larva using a
micro-injector, transferred to an incubator, and maintained at 18 ◦ C. The
control group was injected with the same volume of 1 X PBS. Larval
viability was recorded every 12 h post-infection (hpi). Fluorescence
microscopy (40X, Leica Microsystems, Germany) was used to capture
images, which were processed using Leica Application Suite X software
(version 3.3). Larvae from each group were collected at 24 and 48 hpi,
washed three times with 1 X PBS, snap-frozen in liquid nitrogen, and
stored at − 80 ◦ C for RNA extraction.
2.4. Cumulative mortality percentage of WT and tnf-α1(− /− ) adult
zebrafish upon VHSV injection
WT and tnf-α1(− /− ) zebrafish were acclimatized at 15 ◦ C for 7 days
prior to the analysis of mortality rates [21]. Three-month-old WT and
mutant zebrafish, with an average standard length of 3 cm, were divided
into three groups of 22 fish each. Group 1 received 5 μL 1 X PBS, whereas
groups 2 and 3 received 5 μL VHSV (5 × 106 TCID50 and 1 × 106 TCID50,
respectively) by intraperitoneal injection using a 36-gauge needle
(HAMILTON, USA). Fish were maintained at 15 ◦ C after injection, and
daily mortality was recorded.
2.5. VHSV copy number analysis
To quantify VHSV replication, we measured the expression of the
viral nucleocapsid (N) protein gene using qPCR. RNA was extracted from
the internal organs of VHSV-infected zebrafish using TRIzol reagent
(Thermo Fisher Scientific, USA) and reverse-transcribed into cDNA with
random hexamer primers (TaKaRa, Japan). The resulting cDNA was
diluted five-fold before qPCR analysis. N gene expression of VHSV was
quantified by quantitative PCR (qPCR) using a Dice™ TP950 Real-Time
Thermal Cycler System (Takara, Japan) using TB Green Premix Ex TaqII
(Takara Bio Inc.) and specific primers. The qPCR mixture (20 μL) was
prepared in nuclease-free water, consisting of 10 μL of TB Green Premix
Ex TaqII (Takara Bio Inc.), 3 μL cDNA, and 0.3 μL of each forward and
reverse primer. The VHSV copy number was calculated in 1 μg of total
RNA using a standard curve as previously described [22]. The mean
VHSV copy number for five individuals at each time point was then
plotted.
2. Methodology
2.1. Zebrafish husbandry
Wild-type (WT) and tnf-α1(− /− ) zebrafish were maintained as
described previously [19]. The water used in the tanks was maintained
at a constant pH (pH 6.8–7.5), conductivity (500–800 μS), and tem­
perature (28 ± 0.5 ◦ C) throughout the rearing period. The light/dark
cycle of the zebrafish facility was 14:10 h. The fish were provided with
the artemia diet at three intervals throughout the day. This study was
reviewed and approved by the Animal Ethics Committee of Jeju Na­
tional University, Republic of Korea.
2.6. Cytokine and regulatory gene dynamics in WT and tnf-α1(− /− ) adult
zebrafish upon VHSV injection
To analyze the transcriptional regulation of downstream genes, 3month-old WT and tnf-α1(− /− ) zebrafish were acclimatized at 15 ◦ C
and subjected to the following injections. The WT and mutant zebrafish
were divided into three groups. Group 1 was maintained as an unin­
fected control, whereas groups 2 and 3 were injected with 5 μL 1 X PBS
and 5 μL VHSV (5 × 105 TCID50), respectively. Internal organs (spleen,
intestine, liver and kidney) were collected from each group (7 fish per
group) at 1, 3, 5, 7, and 9 dpi. Tissues from each fish were immediately
snap-frozen in liquid nitrogen and stored at − 80 ◦ C until RNA
extraction.
2.2. Virus stock preparation
The genotype IVa VHSV (FWando05, NCBI- FJ811900. 2) from
infected olive flounder kidney tissue and recombinant VHSV-ΔNV-EGFP
(donated by the Department of Aquatic Life Medicine and the Depart­
ment of Marine Biomaterials & Aquaculture, Pukyong National Uni­
versity, Busan, Republic of Korea) was cultured in fathead minnow
(FHM) cells using Leibovitz L-15 medium (L-15; Sigma, USA) supple­
mented with 10 % fetal bovine serum (FBS) and 1 % penicillin/strep­
tomycin (Gibco, USA). Virus-treated cells were maintained at 20 ◦ C until
cytopathic effects (CPE) reached approximately 80–90 %. Subsequently,
the cell supernatant was collected, subjected to three cycles of freezethawing, and filtered through a 20 μm filter. The virus titer was deter­
mined using the TCID50 technique described by Lei et al. [20]. Virus
stocks were then stored at − 80 ◦ C until required.
2.7. RNA extraction, cDNA synthesis, and RT-qPCR
RNA was extracted from frozen tissues and larvae using TRIzol re­
agent (Thermo Fisher Scientific, USA). RNA concentrations were
measured using a Multiskan GO microplate spectrophotometer (Thermo
2
Fish and Shell sh Immunology 157 (2025) 110092
A. Kalaichelvan et al.
Fisher Scientific, USA) at 260 nm. cDNA from each sample was prepared
using 3 μg of RNA and a PrimeScript™ II 1st Strand cDNA Synthesis Kit
(Takara, Japan). The cDNA samples were diluted 30-fold and stored at
− 20 ◦ C for PCR and qPCR analysis.
The qPCR primers (Table 1) for gene expression analysis were
designed according to the Guidelines for the Publication of Quantitative
Real-Time PCR Experiments (MIQE) [23]. A 10 μL reaction mixture was
prepared, containing 4 μL of cDNA template, 1 μL of a primer mixture
with forward and reverse primers (10 pmol/μL each), and 5 μL of
TaKaRa Ex Taq SYBR premix (2 × ). The RT-qPCR Dice™ TP950
Real-Time Thermal Cycler System (Takara, Japan) was used to analyze
gene expression patterns. The qPCR consisted of initial denaturation at
95 ◦ C for 10 s, followed by 45 PCR cycles of denaturation at 95 ◦ C for 5 s,
annealing at 58 ◦ C for 10 s, and extension at 72 ◦ C for 20 s. A melting
curve analysis was performed with a cycle of 95 ◦ C for 15 s, 60 ◦ C for 30
s, and 95 ◦ C for 15 s. Gene expression data were analyzed using the Livak
(2− ΔΔCt) method [24].
VHSV migration was examined by fluorescence microscopy at 36, 42,
and 48 h post-injection in groups injected with rVHSV-ΔNV-EGFP
(Fig. 1C). No significant differences were observed between groups at
24 h post-injection (data not shown). The observed mortality corre­
sponded to a significantly high rVHSV replication in the tnf-α1(− /− )
group at 42 and 48 h post-injection. GFP fluorescence was detected in
the spleen, kidney, heart, gastrointestinal tract, and ocular mucosa of
both WT and tnf-α1(− /− ) larvae. Morphological changes were also
observed at later times.
3.2. Difference in cumulative percentage mortality of WT and tnf-α1(− /− )
adult zebrafish following VHSV injection
WT and tnf-α1(− /− ) mutant fish were injected intraperitoneally with
different concentrations of VHSV, and mortality was recorded daily to
investigate the role of Tnf-α1 during viral infection. As shown in Fig. 2,
the tnf-α1(− /− ) mutant and WT fish began to die at 4 and 5 dpi,
respectively, when a high concentration (5 × 106 TCID50) of VHSV was
injected intraperitoneally. At the high concentration of VHSV at 20 dpi,
tnf-α1(− /− ) and WT fish achieved 100 % and 54 % mortality, respec­
tively. The maximum mortality rate at 1 × 106 TCID50 VHSV was 54 %
for the tnf-α1(− /− ) mutant fish and 27 % for WT fish. However, the
mortality rate of the tnf-α1(− /− ) mutant with a low concentration of
VHSV was higher than the mortality rate of the WT with a high con­
centration of VHSV at 18 dpi, which persisted in later days as well. Both
WT and tnf-α1(− /− ) fish survived when injected with 1 X PBS as a
negative control. Although both types of fish showed no symptoms up to
3 dpi after VHSV injection, on 4 dpi, the VHSV-infected fish began to die
and showed characteristic signs of VHSV infection such as bleeding and
protruding eyes. The severity of the infection was greater in the tnf-α1(− /
− )
mutant than in the WT, as evidenced by the hemorrhaging. This may
be because the tnf-α1(− /− ) mutant fish were unable to clear the virus as
quickly as the WT fish. This finding is consistent with a previous study in
which TNF-α-deficient mice infected with an adenovirus (Ad) gene
transfer vector showed a reduced humoral immune response to viral
infection [25]. Similarly, another study using TNF-α-deficient mice
concluded that TNF-α is essential for the expression of adhesion mole­
cules and the recruitment of leukocytes to sites of inflammation during
viral myocarditis and that its absence results in an inability to effectively
clear infectious agents [26].
2.8. Statistical analysis
Results are presented as the means of triplicate experiments. Stu­
dent’s t-tests were used to assess statistical significance in the down­
stream gene analysis. One-way analysis of variance (ANOVA) was used
to analyze tissue-specific expressions. Significance was determined
using a threshold of p < 0.05. Graphs were generated using GraphPad
Prism software (version 8.0.2, GraphPad Software, Inc., CA, USA).
3. Results and discussion
3.1. VHSV injection into WT and tnf-α1(− /− ) zebrafish larvae
The lack of an adaptive immune response in zebrafish larvae makes
them an ideal model for studying innate immunity. Therefore, we
administered 300 TCID50 rVHSV/larva into the yolk sacs of WT and tnfα1(− /− ) zebrafish larvae and monitored mortality every 12 h. No deaths
occurred in the PBS-injected control groups, whereas both WT and tnfα1(− /− ) larvae started to show mortality at 60 h after rVHSV injection.
However, tnf-α1(− /− ) mutants exhibited significantly higher mortality,
reaching 80 % compared to 58 % in WT larvae by the end of the
experiment (Fig. 1A).
Viral copy numbers were determined 24 and 48 h after injection. The
tnf-α1(− /− ) mutants had significantly higher viral copy numbers than
WT larvae (Fig. 1B). These results are consistent with the increased
mortality observed in the tnf-α1(− /− ) mutants, suggesting a correlation
between increased viral replication and increased mortality in the
absence of Tnf-α mediated immunity.
3.3. VHSV copy number analysis in WT and tnf-α1(− /− ) adult zebrafish
upon VHSV injection
To assess the impact of Tnf-α1 on VHSV infection in adult zebrafish,
we measured VHSV copy numbers in tnf-α1(− /− ) and WT adult zebrafish
following the VHSV challenge. The results demonstrated a significant
difference in VHSV copy numbers between the groups (Fig. 3). The
VHSV copy number in WT fish remained relatively stable from 3 dpi to 9
dpi and was consistently lower than that in tnf-α1(− /− ) mutants
throughout this period. In contrast, the VHSV copy number in tnf-α1(− /
− )
fish increased steadily from 1 dpi to 7 dpi. A significant peak in VHSV
copy number was observed on 9 dpi in the tnf-α1(− /− ) group, indicating a
substantial increase in viral replication at this later stage.
Table 1
Primer sequences used in this study.
Gene (Accession No)
Primer Sequence (5′-3′)
Application
il-6 (NP_001248378.1)
GTGAAGACACTCAGAGACGAGCAG
GGTTTGAGGAGAGGAGTGCTGATC
qPCR- F
qPCR-R
il-1β (AAQ16563.1)
TGGACTTCGCAGCACAAAATG
GTTCACTTCACGCTCTTGGATG
qPCR- F
qPCR-R
il-10
(NP_001018621.2)
GCGGGATATGGTGAAATGCAAGAGG
TGAGGTGTGCCATAACGCAGTAGA
qPCR- F
qPCR-R
irf-1
(NM_001040352.1)
CTGCAGCACAAACACAGAGAAACTCC
AGTCCTTCATCAGTCCAGCAGACG
qPCR- F
qPCR-R
ifn-γ
(NM_001040352.1)
AGAGCTCAGGACGTATGCAGAAACG
TATAGACACGCTTCAGCTCAAACAAAGCC
qPCR- F
qPCR-R
VHSV nucleocapsid
protein (KF477302)
TGTCTCAGATCAGTGGGAAGTACGC
GGACCTCAGCGACAAGTTCGG
qPCR- F
qPCR- R
ef-1α (NP_571338.1)
CTCCTCTTGGTCGCTTTGCT
CCGATTTTCTTCTCAACGCTCT
qPCR- F
qPCR-R
3.4. Cytokine and regulatory gene dynamics in WT and tnf-α1(− /− ) adult
zebrafish upon VHSV injection
To assess the impact of TNF-α1 on the immune response to VHSV, we
analyzed cytokine and regulatory gene dynamics in WT and tnf-α1(− /− )
zebrafish (Fig. 4). Our findings indicate that TNF-α1 knockout dysre­
gulates the immune response, leading to altered expression of pro- and
anti-inflammatory cytokines and interferon-related genes. This dysre­
gulation likely contributes to the increased susceptibility to VHSV
infection observed in the tnf-α1(− /− ) fish.
Focusing on pro-inflammatory cytokines, we observed dynamic
3
A. Kalaichelvan et al.
Fish and Shell sh Immunology 157 (2025) 110092
Fig. 1. Injection of VHSV into zebrafish larvae. (A) Zebrafish larvae at 4 dpf were injected with VHSV at York, and mortality was observed at 12 h intervals after
injection. (B) VHSV copy number was measured in infected WT and tnf-α1(− /− ) larvae at different time points after injection. (C) A-I, A-II, and A-III represent different
time points to observe virus tropism in WT larvae (36, 42, and 48 hpi, respectively). B-I, B-II, and B-III represent different time points for the observation of virus
tropism in tnf-α1(− /− ) larvae (36, 42, and 48 hpi, respectively). Red indicates the distribution of dextran tetramethylrhodamine, and green indicates the migration of
rVHSV. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
changes in the expression of il-6 and il-1β. While both cytokines were
upregulated following VHSV infection in the mutant fish, their temporal
expression patterns differed significantly from those in WT fish. In WT
zebrafish, il-6 was upregulated from 3 days post-infection (dpi) and
peaked at 7 dpi. In contrast, tnf-α1(− /− ) mutants exhibited an earlier and
continuous upregulation of il-6, starting at 1 dpi. This suggests a
compensatory mechanism attempting to counteract the absence of TNFα. However, this compensatory response may be inadequate because of
the lack of TNF-α′s priming effect on other immune pathways essential
for effective antiviral defense. This observation highlights the multi­
faceted role of TNF-α in not only triggering an acute inflammatory
response but also priming the immune system for a robust antiviral
response. Furthermore, the interplay between TNF-α and IL-6 is welldocumented, as they induce each other’s production, thereby ampli­
fying the expression of pro-inflammatory genes [27,28].
The expression of the pro-inflammatory cytokine il-1β also showed
distinct patterns in WT and tnf-α1(− /− ) fish. In WT fish, il-1β was upre­
gulated at 3 and 7 dpi but downregulated at 5 and 9 dpi, suggesting a
dynamic regulation of its expression during VHSV infection. In contrast,
tnf-α1(− /− ) mutants exhibited a continuous upregulation of il-1β from 1
dpi, reaching its peak at 9 dpi. This sustained upregulation may result
from an altered signaling environment in the absence of TNF-α1,
potentially favoring the activation of inflammasomes, particularly the
NLRP3 inflammasome, which processes IL-1β into its mature form [29].
It is important to note that IL-1β signaling plays a complex role in the
immune response. Although it contributes to host protection against
viral infections, excessive or prolonged IL-1β signaling can also promote
inflammation and immunopathology. Low levels of IL-1β signaling may
favor viral persistence, whereas high levels can enhance pathogenic
IL-17A-producing CD4+ T helper cell (Th17) responses [30]. For
instance, research has demonstrated that IL-1β is a critical mediator of
lung inflammation and damage during influenza infection in mice [31].
Therefore, the persistent upregulation of il-1β observed in tnf-α1(− /− )
mutants may exacerbate inflammation and contribute to their increased
mortality during VHSV infection.
To further investigate the potential imbalance in immune regulation
4
A. Kalaichelvan et al.
Fish and Shell sh Immunology 157 (2025) 110092
Fig. 2. Percentage mortality of WT and tnf-α1(− /− ) adult zebrafish during VHSV infection. After intraperitoneal injection of WT and tnf-α1(− /− ) zebrafish with
VHSV at two different doses (5 × 106 and 1 × 106 TCID50), the death rates were examined up to 20 dpi. To confirm that the VHSV spread caused the mortality of the
WT and tnf-α1(− /− ) zebrafish, PBS-injected control groups were maintained.
Fig. 3. VHSV copy number in WT and tnf-α1(− /− ) adult zebrafish following VHSV infection. An experimental setup in which WT and tnf-α1(− /− ) adult zebrafish
were injected with 5 μL of VHSV at a concentration of 5 × 105 TCID50 per fish. VHSV N-protein was quantified by qPCR, and VHSV copy number was calculated for 1
μg of RNA isolated from each VHSV-injected zebrafish. Error bars represent the standard deviation of VHSV copy numbers of five zebrafish from the same group at
the same time point.
suggested by the pro-inflammatory cytokine data, we examined the
expression of the anti-inflammatory cytokine il-10. Its expression in WT
zebrafish was significantly upregulated from 3 to 5 dpi, indicating a
response to viral infection. However, il-10 upregulation was observed in
tnf-α1(− /− ) mutants as early as 1-day post-infection, with a pronounced
increase at 9 dpi. The abrupt increase in il-10 expression in the mutants
at 9 dpi may represent a compensatory mechanism to control inflam­
mation, consistent with the well-established anti-inflammatory role of
IL-10. Although IL-10 can help control inflammation and prevent
excessive tissue damage, it can also create an environment conducive to
the survival of pathogens. This duality is highlighted by a previous study
suggesting that elevated levels of IL-10 support mycobacterial survival
in the host [32]. In addition, our study found an abrupt increase in virus
copy number in tnf-α1(− /− ) mutants at 9 dpi, which correlates with the
observed increase in IL-10 expression. This correlation suggests a
potential link between elevated il-10 levels and viral replication in the
absence of Tnf-α1 signaling.
Given the interplay between TNF-α1 and interferon signaling, we
subsequently analyzed the expression of irf1, a critical transcription
factor in the antiviral response. irf1 expression was upregulated from 1
dpi and reached its maximum level at 9 dpi in both WT and mutants.
However, at 9 dpi, irf1 expression levels were higher in WT fish
compared to the tnf-α1(− /− ) mutants, indicating a more robust response
in the presence of Tnf-α1. Additionally, irf1 expression in tnf-α1(− /− )
mutants remained at its basal level from 1 to 5 dpi. The limited IRF1
induction in tnf-α1(− /− ) mutants likely reflects the lack of TNF-α1
signaling. This could lead to a suboptimal antiviral response, as IRF1 is a
crucial transcription factor that regulates interferon production and
other immune responses [33].
Following our analysis of irf1, we next examined the expression of
5
A. Kalaichelvan et al.
Fish and Shell sh Immunology 157 (2025) 110092
Fig. 4. Transcriptional modulation of antiviral genes following VHSV challenge in WT and tnf-α1(− /− ) adult zebrafish. The relative transcription of each gene
was normalized to the respective PBS-injected control group and ef-1α of zebrafish. The relative transcription of genes following VHSV injection was represented as
the fold value of the respective non-injected group. The error bars show the SD (n = 3) of three triplicates.
ifn-γ, another crucial component of the antiviral response. Throughout
the experiment, WT fish exhibited a fluctuating upregulation of ifn-γ.
This reached a 50-fold increase in expression at 9 dpi compared to basal
levels. Conversely, upregulation was observed in tnf-α1(− /− ) mutants
from 3 dpi, reaching its maximum level at 9 dpi, albeit with a 10-fold
expression compared to basal levels. In addition, no significant differ­
ence was observed in basal expression between WT and tnf-α1(− /− )
mutants (data not shown). These results indicate that ifn-γ expression is
significantly higher and sustained in WT fish compared to tnf-α1(− /− )
mutants. Antigen-presenting cells, such as dendritic cells and
macrophages, process viral antigens and present them to T cells [34,35].
This process may stimulate T cells to produce IFN-gamma, contributing
to the increased expression observed at later stages in WT fish. Conse­
quently, this sustained high expression of ifn-γ in WT fish may
contribute to a more effective antiviral response compared to mutants
lacking tnf-α1 signaling.
The reduced production of IFN-γ in the absence of Tnf-α1 is consis­
tent with previous findings that TNF-α and IFN-γ can synergistically
enhance antiviral responses, such as by upregulating the expression of
interferon-stimulated genes [9]. A previous study has highlighted that
6
A. Kalaichelvan et al.
Fish and Shell sh Immunology 157 (2025) 110092
TNF-α and IFN-γ together can activate the signaling molecule, signal
transducer, and activator of transcription 1 (STAT1) and increase the
expression, DNA binding, and activity of the transcription factor –
interferon regulatory factor 1 (IRF1) [36]. This synergy results in
increased expression of interferon-stimulated genes, contributing to a
more robust antiviral response. Taken together, these findings provide
valuable insights into the immune response and the role of specific cy­
tokines and interferons in the context of VHSV infection in zebrafish,
particularly in the absence of tnf-α1 signaling.
This could have broader implications for understanding the patho­
genesis of viral diseases and the development of therapeutic strategies
targeting TNF-α1 pathways. However, additional research is necessary
to clarify the exact role of TNF-α1, especially considering the high
mortality observed in tnf-α1(− /− ) mutant fish despite the activation of
various immune-related genes in zebrafish. Further studies are also
needed to explore the potential interplay between TNF-α1 and other
immune pathways in the context of viral infections.
[3] N. Matthews, J.F. Watkins, Tumour-necrosis factor from the rabbit. I. Mode of
action, specificity and physicochemical properties, Br. J. Cancer 38 (1978)
302–309, https://doi.org/10.1038/bjc.1978.202.
[4] M.S. Kim, K.H. Kim, The role of viral hemorrhagic septicemia virus (VHSV) NV
gene in TNF-α- and VHSV infection-mediated NF-κB activation, Fish Shellfish
Immunol. 34 (2013) 1315–1319, https://doi.org/10.1016/j.fsi.2013.02.026.
[5] T. Duan, Y. Du, C. Xing, H.Y. Wang, R.-F. Wang, Toll-like receptor signaling and its
role in cell-mediated immunity, Front. Immunol. 13 (2022) 812774, https://doi.
org/10.3389/fimmu.2022.812774.
[6] D.-I. Jang, A.-H. Lee, H.-Y. Shin, H.-R. Song, J.-H. Park, T.-B. Kang, S.-R. Lee, S.H. Yang, The role of tumor necrosis factor alpha (TNF-α) in autoimmune disease
and current TNF-α inhibitors in therapeutics, Int. J. Mol. Sci. 22 (2021) 2719,
https://doi.org/10.3390/ijms22052719.
[7] A. Yarilina, K. Xu, J. Chen, L.B. Ivashkiv, TNF activates calcium–nuclear factor of
activated T cells (NFAT)c1 signaling pathways in human macrophages, Proc. Natl.
Acad. Sci. 108 (2011) 1573–1578, https://doi.org/10.1073/pnas.1010030108.
[8] G.H.W. Wong, D.V. Goeddel, Tumour necrosis factors α and β inhibit virus
replication and synergize with interferons, Nature 323 (1986) 819–822, https://
doi.org/10.1038/323819a0.
[9] E. Bartee, M.R. Mohamed, G. McFadden, Tumor necrosis factor and interferon:
cytokines in harmony, Curr. Opin. Microbiol. 11 (2008) 378–383, https://doi.org/
10.1016/j.mib.2008.05.015.
[10] S.Y. Kim, D.H. Solomon, Tumor necrosis factor blockade and the risk of viral
infection, Nat. Rev. Rheumatol. 6 (2010) 165–174, https://doi.org/10.1038/
nrrheum.2009.279.
[11] S.H. Seo, R.G. Webster, Tumor necrosis factor alpha exerts powerful anti-influenza
virus effects in lung epithelial cells, J. Virol. 76 (2002) 1071–1076, https://doi.
org/10.1128/JVI.76.3.1071-1076.2002.
[12] C.A. Benedict, C.F. Ware, Virus targeting of the tumor necrosis factor superfamily,
Virology 289 (2001) 1–5, https://doi.org/10.1006/viro.2001.1109.
[13] F.J. Roca, I. Mulero, A. López-Muñoz, M.P. Sepulcre, S.A. Renshaw, J. Meseguer,
V. Mulero, Evolution of the inflammatory response in vertebrates: fish TNF-α is a
powerful activator of endothelial cells but hardly activates phagocytes,
J. Immunol. 181 (2008) 5071–5081, https://doi.org/10.4049/
jimmunol.181.7.5071.
[14] J.R. Aldridge Jr., C.E. Moseley, D.A. Boltz, N.J. Negovetich, C. Reynolds, J. Franks,
S.A. Brown, P.C. Doherty, R.G. Webster, P.G. Thomas, TNF/iNOS-producing
dendritic cells are the necessary evil of lethal influenza virus infection, Proc. Natl.
Acad. Sci. 106 (2009) 5306–5311, https://doi.org/10.1073/pnas.0900655106.
[15] B.T. Rouse, S. Sehrawat, Immunity and immunopathology to viruses: what decides
the outcome? Nat. Rev. Immunol. 10 (2010) 514–526, https://doi.org/10.1038/
nri2802.
[16] N. Lorenzen, N.J. Olesen, C. Koch, Immunity to VHS virus in rainbow trout,
Aquaculture 172 (1999) 41–61, https://doi.org/10.1016/S0044-8486(98)004438.
[17] M. Cieslak, S.S. Mikkelsen, H.F. Skall, M. Baud, N. Diserens, M.Y. Engelsma, O.L.
M. Haenen, S. Mousakhani, V. Panzarin, T. Wahli, N.J. Olesen, H. Schütze,
Phylogeny of the viral hemorrhagic septicemia virus in European aquaculture,
PLoS One 11 (2016) e0164475, https://doi.org/10.1371/journal.pone.0164475.
[18] K. Nadarajapillai, S. Jung, S. Sellaththurai, S. Ganeshalingam, M.-J. Kim, J. Lee,
CRISPR/Cas9-mediated knockout of tnf-α1 in zebrafish reduces disease resistance
after Edwardsiella piscicida bacterial infection, Fish Shellfish Immunol. 144 (2024)
109249, https://doi.org/10.1016/j.fsi.2023.109249.
[19] A. Avdesh, M. Chen, M.T. Martin-Iverson, A. Mondal, D. Ong, S. Rainey-Smith,
K. Taddei, M. Lardelli, D.M. Groth, G. Verdile, R.N. Martins, Regular care and
maintenance of a zebrafish (Danio rerio) laboratory: an introduction, J. Vis. Exp. 18
(2012) e4196, https://doi.org/10.3791/4196.
[20] C. Lei, J. Yang, J. Hu, X. Sun, On the calculation of TCID50 for quantitation of virus
infectivity, Virol. Sin. 36 (2021) 141–144, https://doi.org/10.1007/s12250-02000230-5.
[21] B. Novoa, A. Romero, V. Mulero, I. Rodríguez, I. Fernández, A. Figueras, Zebrafish
(Danio rerio) as a model for the study of vaccination against viral haemorrhagic
septicemia virus (VHSV), Vaccine 24 (2006) 5806–5816, https://doi.org/10.1016/
j.vaccine.2006.05.015.
[22] J.-O. Kim, W.-S. Kim, S.-W. Kim, H.-J. Han, J.W. Kim, M.A. Park, M.-J. Oh,
Development and application of quantitative detection method for viral
hemorrhagic septicemia virus (VHSV) genogroup IVa, Viruses 6 (2014)
2204–2213, https://doi.org/10.3390/v6052204.
[23] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller,
T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE
Guidelines: minimum information for publication of quantitative real-time PCR
experiments, Clin. Chem. 55 (2009) 611–622, https://doi.org/10.1373/
clinchem.2008.112797.
[24] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method, Methods 25 (2001) 402–408,
https://doi.org/10.1006/meth.2001.1262.
[25] K.B. Elkon, C.-C. Liu, J.G. Gall, J. Trevejo, M.W. Marino, K.A. Abrahamsen,
X. Song, J.-L. Zhou, L.J. Old, R.G. Crystal, E. Falck-Pedersen, Tumor necrosis factor
α plays a central role in immune-mediated clearance of adenoviral vectors, Proc.
Natl. Acad. Sci. 94 (1997) 9814–9819, https://doi.org/10.1073/pnas.94.18.9814.
[26] H. Wada, K. Saito, T. Kanda, I. Kobayashi, H. Fujii, S. Fujigaki, N. Maekawa,
H. Takatsu, H. Fujiwara, K. Sekikawa, M. Seishima, Tumor necrosis factor-α (TNFα) plays a protective role in acute viral myocarditis in mice: a study using mice
lacking TNF-alpha, Circulation 103 (2001) 743–749, https://doi.org/10.1161/01.
CIR.103.5.743.
4. Conclusion
This study investigated the role of zebrafish Tnf-α1 during VHSV
infection. In vivo experiments showed that Tnf-α1 is critical for survival,
as tnf-α1(− /− ) fish had significantly lower survival rates as early as 4 dpi
and a higher viral load compared to WT fish. Therefore, tnf-α1(− /− ) fish
experienced more severe inflammation and mortality, likely due to
impaired viral clearance. Additionally, the expression patterns of
downstream genes following viral infection varied between WT and tnfα1(− /− ) fish. These findings highlight the critical role of Tnf-α1 in the
immune response to viral infections and underscore its conserved
function across vertebrate species. This knowledge not only enhances
our understanding of TNF-α signaling in vertebrate immunity but also
provides valuable insights for developing therapeutic strategies in
aquaculture to combat infectious diseases.
CRediT authorship contribution statement
Arthika Kalaichelvan: Writing – original draft. Kishanthini
Nadarajapillai: Conceptualization, Methodology, Investigation. Sar­
ithaa Raguvaran Sellaththurai: Methodology, Investigation. U.P.E.
Arachchi: Writing – review & editing. Myoung-Jin Kim: Methodology,
Investigation, Conceptualization. Sumi Jung: Writing – review & edit­
ing, Methodology, Investigation, Conceptualization. Jehee Lee: Writing
– review & editing, Supervision, Resources, Project administration,
Funding acquisition.
Acknowledgement
This research was supported by the Basic Science Research Program
of the National Research Foundation of Korea (NRF), funded by the
Ministry of Education (2019R1A6A1A03033553), and the Korea Insti­
tute of Marine Science and Technology Promotion (KIMST) funded by
the Ministry of Oceans and Fisheries (RS-2022-KS221670).
Data availability
Data will be made available on request.
References
[1] B. Beutler, D. Greenwald, J.D. Hulmes, M. Chang, Y.C. Pan, J. Mathison,
R. Ulevitch, A. Cerami, Identity of tumor necrosis factor and the macrophagesecreted factor cachectin, Nature 316 (1985) 552–554, https://doi.org/10.1038/
316552a0.
[2] E.A. Carswell, L.J. Old, R.L. Kassel, S. Green, N. Fiore, B. Williamson, An
endotoxin-induced serum factor that causes necrosis of tumors, Proc. Natl. Acad.
Sci. 72 (1975) 3666–3670, https://doi.org/10.1073/pnas.72.9.3666.
7
A. Kalaichelvan et al.
Fish and Shell sh Immunology 157 (2025) 110092
central orchestrators of cytokine amplification during influenza virus infection,
Cell 146 (2011) 980–991, https://doi.org/10.1016/j.cell.2011.08.015.
[32] Y.V.N. Cavalcanti, M.C.A. Brelaz, J.K. de A. Lemoine Neves, J.C. Ferraz, V.R.
A. Pereira, Role of TNF-alpha, IFN-gamma, and IL-10 in the development of
pulmonary tuberculosis, pulm, Med 2012 (2012) 745483, https://doi.org/
10.1155/2012/745483.
[33] K. Honda, T. Taniguchi, IRFs: master regulators of signalling by Toll-like receptors
and cytosolic pattern-recognition receptors, Nat. Rev. Immunol. 6 (2006) 644–658,
https://doi.org/10.1038/nri1900.
[34] R.M. Steinman, Linking innate to adaptive immunity through dendritic cells, in:
Innate Immun. To Pulm. Infect., 2006, pp. 101–113, https://doi.org/10.1002/
9780470035399.ch9.
[35] S. Yona, S. Gordon, From the reticuloendothelial to mononuclear phagocyte system
– the unaccounted years, Front. Immunol. 6 (2015) 328, https://doi.org/10.3389/
fimmu.2015.00328.
[36] C.M. Robinson, K.A. Shirey, J.M. Carlin, Synergistic transcriptional activation of
indoleamine dioxygenase by IFN-γ and tumor necrosis factor-α, J. Interf. Cytokine
Res 23 (2003) 413–421, https://doi.org/10.1089/107999003322277829.
[27] C. Lee, J.-I. Oh, J. Park, J.-H. Choi, E.-K. Bae, H.J. Lee, W.J. Jung, D.S. Lee, K.S. Ahn, S.-S. Yoon, TNF α mediated IL-6 secretion is regulated by JAK/STAT
pathway but not by MEK phosphorylation and AKT phosphorylation in U266
multiple myeloma cells, BioMed Res. Int. 2013 (2013) 580135, https://doi.org/
10.1155/2013/580135.
[28] G.K. Wollenberg, L.E. DeForge, G. Bolgos, D.G. Remick, Differential expression of
tumor necrosis factor and interleukin-6 by peritoneal macrophages in vivo and in
culture, Am. J. Pathol. 143 (1993) 1121–1130.
[29] P. Halfmann, L. Hill-Batorski, Y. Kawaoka, The induction of IL-1β secretion through
the NLRP3 inflammasome during ebola virus infection, J. Infect. Dis. 218 (2018)
S504–S507, https://doi.org/10.1093/infdis/jiy433.
[30] B.S. Kim, Y.-H. Jin, L. Meng, W. Hou, H.S. Kang, H.S. Park, C.-S. Koh, IL-1 signal
affects both protection and pathogenesis of virus-induced chronic CNS
demyelinating disease, J. Neuroinflammation 9 (2012) 217, https://doi.org/
10.1186/1742-2094-9-217.
[31] J.R. Teijaro, K.B. Walsh, S. Cahalan, D.M. Fremgen, E. Roberts, F. Scott,
E. Martinborough, R. Peach, M.B.A. Oldstone, H. Rosen, Endothelial cells are
8