ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2011, p. 1088–1096
0066-4804/11/$12.00 doi:10.1128/AAC.01181-10
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 55, No. 3
Novel Bacterial NAD⫹-Dependent DNA Ligase Inhibitors with
Broad-Spectrum Activity and Antibacterial Efficacy In Vivo䌤†
Scott D. Mills,* Ann E. Eakin, Ed T. Buurman, Joseph V. Newman, Ning Gao, Hoan Huynh,
Kenneth D. Johnson, Sushmita Lahiri, Adam B. Shapiro, Grant K. Walkup,
Wei Yang, and Suzanne S. Stokes
Infection Discovery, AstraZeneca R&D Boston, Waltham, Massachusetts 02451
Received 26 August 2010/Returned for modification 11 November 2010/Accepted 16 December 2010
monella enterica serovar Typhimurium, and Escherichia coli
(12, 18, 23, 31, 33).
NAD⫹-dependent DNA ligase has attracted interest as a
prospective broad-spectrum antibacterial target because it is
indispensable for DNA replication, conserved among bacterial
pathogens, and distinctly different from the eukaryotic DNA
ligases (5, 6, 9, 10, 15, 23, 25). X-ray crystal structures have
facilitated a better understanding of substrate binding and the
catalytic mechanism of DNA ligases (14, 16, 28; S. Lahiri and
S. D. Mills, U.S. patent application 2008/0262811). DNA ligase
structures have also stimulated efforts to design small-molecule
inhibitors of LigA activity. Novel inhibitors of LigA with selective antibacterial activity have been reported, but none of
the studies have validated the target of the inhibitors in vivo by
demonstrating efficacy in animal models of infection (6, 23).
Here we describe the discovery of novel substituted adenosine analogs that are selective inhibitors of NAD⫹-dependent
DNA ligases from a broad spectrum of pathogenic bacteria. In
vitro mode-of-inhibition and mode-of-action studies, as well as in
vivo efficacy data, support the potential therapeutic value of LigA
as an antibacterial target. To our knowledge, this is the first
example of in vivo validation of LigA as an antibacterial target.
(This material was presented in part at the 49th Interscience
Conference on Antimicrobial Agents and Chemotherapy, San
Francisco, CA, 11 to 15 September 2009 [8, 13, 30, 39].)
DNA ligases join adjacent 3⬘-hydroxyl and 5⬘-phosphoryl
termini to form a phosphodiester bond in duplex DNA (22,
38). DNA ligases function in DNA replication, by joining Okazaki fragments on the lagging strand of DNA, and are involved
in several DNA repair pathways (e.g., nucleotide excision repair). DNA ligation proceeds in three nucleotidyl transfer
steps. The first step involves the formation of a covalent DNA
ligase-adenylate intermediate. In the second step, AMP is
transferred from DNA ligase to the 5⬘ phosphate of nicked
DNA through a pyrophosphate bond. In the third step, a phosphodiester bond is formed to join adjacent polynucleotides,
and AMP is released (22, 38).
DNA ligases are grouped into two families based on the
substrate (NAD⫹ or ATP) used to form the DNA ligaseadenylate intermediate. The bacterial NAD⫹-dependent DNA
ligases belong to a distinct, highly conserved phylogenetic cluster of enzymes. In contrast, the ATP-dependent DNA ligases
of mammals, fungi, and viruses form a loosely defined cluster
of associated enzymes (32, 41). The bacterial NAD⫹-dependent DNA ligases are essential for viability in all Gram-positive
and Gram-negative bacteria tested to date, including Bacillus
subtilis, Staphylococcus aureus, Streptococcus pneumoniae, Sal-
* Corresponding author. Mailing address: AstraZeneca R&D Boston, 35 Gatehouse Drive, Waltham, MA 02451. Phone: (781) 839-4619.
Fax: (781) 839-4570. E-mail: Scott.Mills@astrazeneca.com.
† Supplemental material for this article may be found at http://aac
.asm.org/.
䌤
Published ahead of print on 28 December 2010.
MATERIALS AND METHODS
Strains and compounds. The strains, plasmids, and DNA primers used in this
study are described in Table 1. All commercially available antibiotics were
obtained from Sigma-Aldrich, Inc. (St. Louis, MO). Adenosine analogs (Fig. 1)
1088
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
DNA ligases are indispensable enzymes playing a critical role in DNA replication, recombination, and repair in
all living organisms. Bacterial NADⴙ-dependent DNA ligase (LigA) was evaluated for its potential as a broadspectrum antibacterial target. A novel class of substituted adenosine analogs was discovered by target-based
high-throughput screening (HTS), and these compounds were optimized to render them more effective and selective
inhibitors of LigA. The adenosine analogs inhibited the LigA activities of Escherichia coli, Haemophilus influenzae,
Mycoplasma pneumoniae, Streptococcus pneumoniae, and Staphylococcus aureus, with inhibitory activities in the
nanomolar range. They were selective for bacterial NADⴙ-dependent DNA ligases, showing no inhibitory activity
against ATP-dependent human DNA ligase 1 or bacteriophage T4 ligase. Enzyme kinetic measurements demonstrated that the compounds bind competitively with NADⴙ. X-ray crystallography demonstrated that the adenosine
analogs bind in the AMP-binding pocket of the LigA adenylation domain. Antibacterial activity was observed
against pathogenic Gram-positive and atypical bacteria, such as S. aureus, S. pneumoniae, Streptococcus pyogenes, and
M. pneumoniae, as well as against Gram-negative pathogens, such as H. influenzae and Moraxella catarrhalis. The
mode of action was verified using recombinant strains with altered LigA expression, an Okazaki fragment accumulation assay, and the isolation of resistant strains with ligA mutations. In vivo efficacy was demonstrated in a
murine S. aureus thigh infection model and a murine S. pneumoniae lung infection model. Treatment with the
adenosine analogs reduced the bacterial burden (expressed in CFU) in the corresponding infected organ tissue as
much as 1,000-fold, thus validating LigA as a target for antibacterial therapy.
NOVEL BACTERIAL NAD⫹-DEPENDENT DNA LIGASE INHIBITORS
VOL. 55, 2011
1089
TABLE 1. Strains, plasmids, and primers
Genotype, phenotype, use, or sequencea
Strain, plasmid, or primer
Strains
E. coli
W3110; ATCC 27325
ARC523
MG1655; ATCC 700926
TOP10
BL21(DE3)
B
S. pneumoniae
D39; NCTC 7466
Rx1
R6; ATCC BAA-255
SPN100
SPN101
SPN102
SPN103
S. aureus RN4220
ATCC, Manassas, VA
AstraZeneca culture collection
ATCC, Manassas, VA
Invitrogen Corp., Carlsbad, CA
Invitrogen Corp., Carlsbad, CA
Used to propagate T4 DNA according to ATCC protocol (11303-B4) ATCC, Manassas, VA
W3110 ⌬tolC::Tn10
F⫺ ␭⫺ IlvG⫺ rfb-50 rph-1
ATCC, Manassas, VA
Wild-type parent
Rd KW20 ⌬acrB::cat; Cmr
Rd KW20 ⌬acrB::aph3-A; Kmr
Rd KW20 ⌬acrB::aph3-A ⌬ompP1::cat; Kmr Cmr
Rd KW20 ⌬acrB::aph3-A ⌬ompP1::ligA ⫹ cat; Kmr Cmr
Unencapsulated transformable derivative of R36
Unencapsulated transformable derivative of R36
Rx1 ⌬galU::ermR; Ermr
Rx1 ⌬galU::T4 lig ⫹ ermR; Ermr
Rx1 ⌬galU::T4 lig ⫹ ermR ⌬ligA::aph3-A; Ermr Kmr
Spontaneous D39 mutant, resistant to compound 4; amino acid
substitution in LigA (L75F)
Restriction-deficient mutant of strain 8325-4
AstraZeneca culture collection
This study
This study
This study
2
34
17
This study
This study
This study
This study
20
M. pneumoniae
M129; ATCC 29342
FH; NCTC 10119
ATCC, Manassas, VA
NCTC, Salisbury, United Kingdom
Candida albicans B2630
35
H. sapiens A549; ATCC CCL185
Plasmids and DNA
E. coli bacteriophage T4
H. sapiens cDNA
pGEM-T
pCR4-TOPO
pET21b
pET30
pET28
pUC18K
pASK4
pASK5
pBA467
pWY375
pLP109
pWY473
pLP112
pT4-lig
pHIN-LigA
pSPN-LigA
pECO-LigA
pMPN-LigA
pSAU-LigA
Human lung carcinoma cell line
ATCC, Manassas, VA
ATCC 11303-B4
ATCC, Manassas, VA
Human Universal QUICK-Clone cDNA; catalog no. 7109-1; lot no.
1050696
TA cloning vector; Apr
TOPO TA cloning vector; Kmr
Protein expression vector
Protein expression vector
Protein expression vector
Source of nonpolar aph3-A gene in pUC18; Apr Kmr
Source of 1,238-bp cat cassette in pGEM-T: Apr Cmr
Plasmid used for site-directed integration and expression of selected
genes at H. influenzae ompP1 (HI0401) locus of Rd KW20;
Apr Cmr
Plasmid used for site-directed integration and expression of selected
genes at galU (spr1903) locus of S. pneumoniae R6; Apr Ermr
pGEM-T containing H. influenzae acrB (HI0895) deletion and
insertion of 840 bp of nonpolar aph3-A cassette; Apr Kmr
pASK5 containing H. influenzae ligA (HI1100) subcloned as NdeISalI fragment from pHIN-LigA; Apr Cmr
pBA467 containing T4 lig subcloned as NdeI-SalI fragment from
pT4-lig; Apr Ermr
pGEM-T containing S. pneumoniae ligA (spr1024) deletion and
insertion of 840 bp of nonpolar aph3-A cassette; Apr Kmr
pCR4-TOPO containing T4 lig; Kmr
H. influenzae LigA expression plasmid; pET30a; Kmr
S. pneumoniae LigA expression plasmid; pET30a; Kmr
E. coli LigA expression plasmid; pET30a; Kmr
M. pneumoniae LigA expression plasmid; pET30a; Kmr
S. aureus LigA expression plasmid; pET30a; Kmr
Clontech, Mountain View, CA
Promega Corp., Madison, WI
Invitrogen Corp., Carlsbad, CA
EMD4Biosciences, San Diego, CA
EMD4Biosciences, San Diego, CA
EMD4Biosciences, San Diego, CA
24
36, 40
36
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
Continued on following page
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
H. influenzae
Rd KW20; ATCC 51907
ARM158
HIN100
HIN101
HIN102
Source or reference(s)
1090
MILLS ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
TABLE 1—Continued
Strain, plasmid, or primer
pHSA-LIGI
Expression of other ligases
T4 lig-F (NdeI)
T4 lig-R (SalI)
H. sapiens lig-F (SacI)
H. sapiens lig-R (SalI)
a
Source or reference
H. sapiens LIGI expression plasmid (N-terminal truncation and T7
tag); pET21b; Apr
This study
GCATTGATGGTGCCATATGGAATCAATCG
CGTATTGGCTATTTCAGTCGACTGC
CCGAGAATCATATGACAAATATTCAAACTCAAC
GCCTGTCGACCCTGTCACACCAAGCGTCGG
CCTACATATGGCAAAGGTCGCACAAATTCG
GCATGTCGACTTAGGTCCAAATTGGTTC
GGATTAAGCCATGGCTGATTTATCG
CGACGTCGACCTCTAACTATTTAATTC
GGTCTTATGAATAAACATATGAATGAGTTAGTCGCTTTGC
CTCTGTCGACAAACGATCCATTACAAACTTTCTAGCC
MG1655
MG1655
KW20
KW20
M129
M129
RN4220
RN4220
R6
R6
GCGCATATGATTCTTAAAATTCTGAACG
CTTGTCGACTCATAGACCAGTTACCTC
GAGGAGAGCTCGGCTCCAGGAAAGGAGGGAGCTGCTGAGG
GATCGTCGACTTAGTAGGTATCTTCAGGGTCAGAGCCTGA
GTCC
Bacteriophage T4
Bacteriophage T4
H. sapiens
H. sapiens
Restriction enzyme sites in primer sequences are in boldface italics.
were prepared at AstraZeneca R&D Boston as previously described (M. CaveroTomas, M. Gowravaram, H. Huynh, H. Ni, and S. Stokes, 20 April 2006, international patent application WO/2006/040558). T4 DNA ligase was purchased
from New England BioLabs (Ipswich, MA).
Recombinant DNA methods. The recombinant DNA methods and reagents
used have been described previously (36). The DNAs of all PCR-generated
clones and selected PCR-generated DNA fragments were sequenced using an
ABI Prism genetic analyzer, model 3100, after the preparation of ABI Prism
BigDye Terminator (version 3.1) cycle sequencing reactions according to the
manufacturer’s instructions (Life Technologies Corp., Carlsbad, CA). The resulting DNA sequence chromatographs were assembled and analyzed with Sequencher software (version 4.7; Gene Codes Corporation, Ann Arbor, MI). The
strains, plasmids, and primers used for the overexpression of DNA ligases and
for the characterization of the mode of action can be found in Table 1. The
conditions for growth, cell preparation, and transformation are described in the
supplemental material.
Cloning and expression of bacterial NADⴙ-dependent DNA ligase isozymes.
DNA fragments containing the ligA gene were PCR amplified using primers and
template genomic DNA isolated from Haemophilus influenzae Rd KW20, S.
pneumoniae R6, S. aureus RN4220, Mycoplasma pneumoniae M129, and E. coli
MG1655 (Table 1). The ligA-containing PCR fragments were ligated into
pGEM-T (Promega, Madison, WI) according to the manufacturer’s instructions.
The cloned DNA containing ligA from each strain listed above was sequenced
and analyzed relative to the published gene sequence for each strain. The ligAcontaining DNA from each organism was subcloned into pET30a or pET28b
(EMD4Biosciences, San Diego, CA). LigA isozymes were overexpressed in E.
coli BL21(DE3) (Invitrogen, Carlsbad, CA) for purification and activity assay
development. The primers, template DNA, and plasmids used to make the
overexpression plasmids are listed in Table 1.
Cloning and expression of Homo sapiens DNA ligase 1. The Homo sapiens
DNA ligase 1 gene, encoding amino acid residues 250 to 919 of the full-length
protein, was PCR amplified from H. sapiens cDNA (Clontech, Mountain View,
CA), and was cloned into pGEM-T as described previously (19). Once the
sequence of the cloned DNA was verified, the truncated H. sapiens DNA ligase
1 gene was subcloned as a SacI-to-SalI fragment into pET21b to create an
in-frame N-terminal fusion with the T7 tag for expression in E. coli BL21(DE3).
The overexpressed T7-tagged protein was extracted and purified. The primers,
template DNA, and plasmids used to make this overexpression plasmid are listed
in Table 1.
Construction of strains for LigA mode-of-action studies. H. influenzae strains
for assessment of the mode of action against LigA were constructed in an
efflux-negative (⌬acrB::aph3-A) mutant of strain KW20 (HIN100). H. influenzae
HIN101 (⌬acrB::aph3-A ⌬ompP1::cat) was constructed to serve as an isogenic
control strain, and H. influenzae HIN102 (⌬acrB::aph3-A ⌬ompP1::ligA ⫹ cat)
was constructed to overexpress LigA as the experimental strain for assessment of
the mode of action in H. influenzae. In HIN102, the ligA gene was under the
transcriptional control of the strong, constitutively active ompP1 promoter (26,
27, 36). The supplemental material describes the construction of HIN101 and
HIN102 (see Fig. S1).
Likewise, S. pneumoniae SPN100 (⌬galU::ermR) was constructed to serve as an
isogenic control strain, and S. pneumoniae SPN102 (⌬galU::T4 lig ⫹ ermR
⌬ligA::aph3-A) was constructed to express T4 ligase in a ⌬ligA::aph3-A genetic
background, as the experimental strain for assessment of the mode of action
against S. pneumoniae LigA. The supplemental material describes the construction of SPN100 and SPN102 (see Fig. S2).
Purification of DNA ligases from H. influenzae, S. pneumoniae, E. coli, S.
aureus, M. pneumoniae, and H. sapiens. The conditions for the expression and
purification of DNA ligase isozymes are described in the supplemental material.
FIG. 1. Chemical structures of the adenosine analogs discussed in this study. The 2-position of the adenine ring and the 5⬘ position of the ribose
are indicated for compound 1.
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
Primers
LigA protein expression
E. coli ligA-F (NdeI)
E. coli ligA-R (SalI)
H. influenzae ligA-F (NdeI)
H. influenzae ligA-R (SalI)
M. pneumoniae ligA-F (NdeI)
M. pneumoniae ligA-R (SalI)
S. aureus ligA-F (NcoI)
S. aureus ligA-R (SalI)
S. pneumoniae ligA-F (NdeI)
S. pneumoniae ligA-R (SalI)
Genotype, phenotype, use, or sequencea
VOL. 55, 2011
NOVEL BACTERIAL NAD⫹-DEPENDENT DNA LIGASE INHIBITORS
X-ray cocrystallography of the H. influenzae LigA adenylation domain. The
X-ray cocrystal structure of an H. influenzae LigA adenylation domain fragment
(amino acid residues 1 to 324) containing AMP covalently bound to a conserved
lysine residue (K116) and NAD⫹ bound to adenylation subdomain 1a has been
reported previously (13; Lahiri and Mills, U.S. patent application 2008/0262811).
Susceptibility and cytotoxicity assays. MICs were determined using broth
microdilution and in vitro killing kinetics according to the guidelines of the
Clinical and Laboratory Standards Institute (formerly NCCLS) (11, 29).
Cytotoxicity was assessed in the human lung carcinoma cell line A549 by using
the CellTiter 96 AQueous One Solution cell proliferation assay with MTS [3-(4,5dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt] from Promega Corp. (Madison, WI). A549 cells were grown
at 37°C under 5% CO2 in RPMI 1640 medium supplemented with 10% fetal
bovine serum and 1 mM glutamine (Invitrogen, Carlsbad, CA). Cytotoxicity was
quantified by determining the lowest compound concentration at which transmission was increased by 50%. Puromycin and amphotericin B served as controls.
Isolation of resistant mutants. Mutants of S. pneumoniae D39 were isolated as
described previously (7). Briefly, 107 to 108 CFU was spread onto blood agar
plates (BAPs) containing 2-fold serial dilutions of compound 4 and was incubated for 24 h at 37°C. Mutants were isolated from BAPs that contained the
compound at concentrations 4 times the agar dilution MIC or more and were
purified on BAPs with the same compound concentration. Mutants were stored
in growth medium containing 25% (vol/vol) glycerol at ⫺80°C.
Okazaki fragment accumulation assay. The procedure for determination of
cellular Okazaki fragment accumulation in H. influenzae was adapted from the
method described by Dermody et al. for E. coli (12). A description of the adapted
method is in the supplemental material.
Murine infection models. The animals used for the murine infection models
were maintained in accordance with the criteria of the American Association for
Accreditation of Laboratory Animal Care. All animal studies were carried out
according to protocols approved by the Institutional Animal Care and Use
Committee at AstraZeneca R&D Boston.
(i) Neutropenic mouse thigh model. Six-week-old specific-pathogen-free female CD-1 Swiss mice (Charles River Laboratories, MA) weighing 18 to 22 g
were used for all studies. Mice were rendered neutropenic by intraperitoneal
injection of cyclophosphamide (Sigma-Aldrich, St. Louis, MO) 4 days (150 mg/kg
of body weight) and 1 day (100 mg/kg) before experimental infection (1). Two
hours prior to infection, mice received a single oral administration of aminobenzotriazole (ABT) at 100 mg/kg to inhibit cytochrome P450 (CYP450) activity (4).
A frozen stock of S. aureus ARC516 was thawed and diluted to a concentration
of 7 ⫻ 106 CFU/ml. Mice were infected to achieve a target inoculum of 5 ⫻ 105
CFU/thigh. Groups of five animals each received an intraperitoneal injection of
5, 15, 30, or 45 mg/kg of body weight of compound 4, prepared with 0.75%
hydroxypropylmethyl cellulose (HPMC), on a q.i.d., q3 (4 times a day, every 3 h)
regimen starting 2 h after infection. An additional group of 10 mice received the
vehicle alone (0.75% HPMC) on the same regimen. Efficacy was determined 24 h
after the start of treatment. Thigh tissue was homogenized with an Omni TH
homogenizer (Omni International, Warrenton, VA), and 100 ␮l of homogenate
was serially diluted in tryptic soy broth and was plated onto tryptic soy agar plates
for CFU determination (21). Plates were incubated at 37°C overnight.
(ii) Immunocompetent mouse lung model. Six-week-old specific-pathogen-free
female CD-1 Swiss mice (Charles River Laboratories, MA) weighing 18 to 22 g
were used for all studies. Two hours prior to infection, mice received a single oral
administration of 100 mg/kg ABT as described above. A frozen stock of S.
pneumoniae isolate D39 was thawed and diluted to a concentration of 2 ⫻ 106
CFU/ml. Animals were anesthetized by isoflurane inhalation and were then
infected with 105 CFU by delivery of 50 ␮l of diluted culture directly into the
trachea of each mouse. Groups of 10 mice received an intraperitoneal injection
of 2, 15, or 45 mg/kg of body weight of compound 4, prepared with 0.75%
HPMC, on a q.i.d., q3 regimen starting 18 h after infection. An additional group
of 10 mice received the vehicle (0.75% HPMC) on the same regimen. Efficacy
was determined 24 h after the start of treatment (3). Lung tissue was homogenized and diluted as described above. Dilutions were spread onto blood agar
plates for CFU determination. Plates were incubated overnight at 37°C under
5% CO2.
Protein structure accession number. The coordinates of a refined cocrystallographic structure of compound 1 bound to the H. influenzae LigA adenylation
domain, and the associated methods for protein preparation, have been deposited in the Protein Data Bank (PDB) under accession code 3PN1.
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
DNA ligase assay. A fluorescence resonance energy transfer (FRET) assay was
developed for measuring the DNA ligase activity of H. influenzae LigA by using
a format similar to that previously described (5, 9). The DNA substrate in the
reaction mixture was created by annealing three synthetic oligonucleotides (Eurofins MWG Operon, Huntsville, AL). The longest oligonucleotide (32-mer) was
modified with a fluorescent carboxyfluorescein (FAM) label at its 5⬘ end. The
shortest oligonucleotide (11-mer) was modified with a 5⬘ phosphate and a tetramethyl carboxyrhodamine (TAMRA) acceptor label at its 3⬘ end. The third
oligonucleotide (18-mer) was unlabeled. The sequences for the three oligonucleotides were as follows: for the 32-mer, 5⬘-FAM-TGGATTGATGACTGGG
CTGAATACTGACCTTA-3⬘; for the 11-mer (complementary to the 5⬘ end of
the 32-mer with a single mismatch), 5⬘-PO4-CAGTCATCTAT-TAMRA-3⬘; and
for the 18-mer (complementary to the 3⬘ end of the 32-mer), 5⬘-TAAGGTCA
GTATTCAGCC-3⬘.
The three oligonucleotides were hybridized to form a DNA duplex with a nick
in one strand and fluorophores on the 5⬘ and 3⬘ ends of opposite strands.
Ligation of the nick in this substrate DNA resulted in the formation of a ligated
full-length DNA duplex. The ligated product was resistant to denaturation by 4
M urea at pH 10, whereas the unligated substrate was denatured. In the ligated
product, the fluorophores were in close proximity, such that upon excitation of
FAM, FRET occurred from the FAM donor to the TAMRA acceptor, resulting
in enhanced TAMRA fluorescence and reduced FAM fluorescence (e.g.,
quenching). The extent to which FRET persisted after denaturation reported the
fraction of the DNA substrate that was ligated.
Assays for H. influenzae LigA were performed in 96-well black polystyrene
flat-bottom plates in 100-␮l reaction mixtures containing the following: 20%
glycerol, 30 mM potassium chloride, 30 mM ammonium sulfate, 10 mM
dithiothreitol, 1 mM EDTA, 0.002% Brij 35, 50 mM morpholinepropanesulfonic acid (MOPS; pH 7.5), 100 nM bovine serum albumin, 1 ␮M NAD⫹, 40
nM DNA substrate, 16 mM magnesium chloride, and 0.15 nM H. influenzae
LigA. The assay reaction mixtures were incubated at room temperature for
approximately 20 min before the reactions were terminated by the addition of
30 ␮l Quench reagent (8 M urea, 1 M Trizma base, 20 mM EDTA in water)
to denature any remaining unligated substrate DNA. Plates were read in a
Tecan Ultra plate reader monitoring the ratio of fluorescence intensities at
two emission wavelengths (the TAMRA acceptor at 595 nm and the FAM
donor at 535 nm) upon excitation of the FAM donor at 485 nm. The larger
the ratio of 595- to 535-nm emission values, the larger the fraction of ligated
DNA in the reaction.
Data were initially expressed as a ratio of the 595-nm emission values to the
535-nm emission values, and percentages of inhibition were calculated using
0.2% dimethyl sulfoxide (no compound) as the 0% inhibition control and 50 mM
EDTA-containing reaction mixtures as 100% inhibition controls. For the highthroughput screening (HTS) campaign, the assay described above was performed
in a 384-well format (30 ␮l) with a single test compound per well at a final
concentration of 10 ␮M. For hit follow-up and subsequent structure-activity
relationship (SAR) analysis, compound potency was based on measurements of
the 50% inhibitory concentration (IC50) in reactions performed as described
above but in the presence of 10 different compound concentrations.
Assays for the other bacterial LigA isozymes, human DNA ligase 1, and T4
DNA ligase were performed as described above for H. influenzae LigA, with the
following changes in order to optimize enzyme performance and normalize
substrate concentrations relative to the individual isozymes’ Km values. S. aureus
LigA reaction mixtures contained 0.15 nM enzyme, 72 nM DNA, and 94 ␮M
NAD⫹. S. pneumoniae LigA reaction mixtures contained 0.1 nM enzyme, 24
nM DNA, and 6.8 ␮M NAD⫹. E. coli LigA reaction mixtures contained 0.1 nM
enzyme, 22 nM DNA, and 5.3 ␮M NAD⫹, with potassium chloride and ammonium sulfate concentrations adjusted to 40 mM and 5 mM, respectively. M.
pneumoniae LigA reaction mixtures contained 0.15 nM enzyme, 24 nM DNA,
and 0.13 ␮M NAD⫹, with potassium chloride and ammonium sulfate concentrations adjusted to 5 mM each. Human ligase 1 reaction mixtures contained 0.5
nM enzyme, 50 nM DNA, and 3 ␮M ATP (replacing NAD⫹), with no potassium
chloride and 12 mM ammonium sulfate. T4 bacteriophage DNA ligase reaction
mixtures contained 2 U enzyme, 100 nM DNA, and 100 ␮M ATP (replacing
NAD⫹), with potassium chloride and ammonium sulfate concentrations adjusted
to 30 mM each.
To determine the apparent Ki of compound 1, the H. influenzae LigA FRET
assay was performed in the presence of increasing concentrations of the compound (0 to 2.6 ␮M) in reaction mixtures with a range of concentrations of the
NAD⫹ substrate (0.5 to 3.5 ␮M) and a fixed concentration (60 nM) of the DNA
substrate. Nonlinear regression analysis of the resulting data was performed
using GraFit (Erithacus Software Limited, Surrey, United Kingdom).
1091
1092
MILLS ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
TABLE 2. Inhibition of bacterial DNA ligase enzymes by the
adenosine analogsa
IC50 (␮M) for DNA ligase from:
Compound
H. influenzae E. coli S. pneumoniae S. aureus M. pneumoniae
1
2
3
4
5
a
0.507
0.076
0.112
0.106
0.082
1.27
0.158
0.370
0.320
0.180
0.136
0.052
0.076
0.039
0.038
0.081
0.063
0.117
0.158
0.060
0.075
0.021
0.019
⬍0.010
0.062
The chemical structures of the adenosine analogs are shown in Fig. 1.
RESULTS
FIG. 2. Enzyme mode of inhibition for compound 1. The activity of
H. influenzae LigA was measured using a FRET assay in the presence
of rising concentrations of compound 1 (0 to 2.6 ␮M) and NAD⫹ (0.5
to 3.5 ␮M), with a fixed concentration (60 nM) of the nicked DNA
substrate. As represented in the double-reciprocal plot, the resulting
data are consistent with competitive binding between compound 1 and
NAD⫹. The apparent Ki for compound 1 was determined to be 110 nM
by nonlinear regression analysis of the data.
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
Discovery of LigA inhibitors and progression to antibacterial activity. An HTS campaign was carried out to identify
inhibitors of H. influenzae LigA by using a FRET-based DNA
ligation assay and compounds from the AstraZeneca corporate
library. After confirmation of IC50s against H. influenzae LigA
and compound filtering based on physicochemical properties
such as ClogP and solubility, 517 compounds were selected for
testing for selectivity and spectrum of inhibition. IC50s against
NAD⫹-dependent DNA ligases from E. coli, S. aureus, S. pneumoniae, and M. pneumoniae, in addition to the enzyme from H.
influenzae, were determined. Selectivity for NAD⫹-dependent
DNA ligases was determined by measuring the IC50s of selected hits against the ATP-dependent ligases human DNA
ligase 1 and bacteriophage T4 ligase.
Several distinct chemotypes were identified from the HTS
campaign, including a cluster of adenosine analogs, exemplified by compound 1 (Fig. 1). Compound 1 had an IC50 of 0.5
␮M against H. influenzae LigA and displayed broad-spectrum
biochemical potency for all LigA isozymes tested (Table 2) but
was inactive (IC50, ⬎200 ␮M) against human DNA ligase 1
and T4 bacteriophage ligase. Compound 1 also possessed favorable physical properties for an initial hit from HTS, including equilibrium solubility greater than 4 mM at pH 7.4, a
logD7.4 (logD measured at pH 7.4) value of 1.24, and a free
fraction (fu) in human plasma greater than 0.3.
Kinetics studies using the H. influenzae LigA FRET assay
demonstrated that compound 1 was competitive with NAD⫹
with an apparent Ki of 110 nM (Fig. 2).
The binding mode for compound 1 in the X-ray crystal
structure of the adenylation domain fragment of H. influenzae LigA is shown in Fig. 3A. The crystallographic data
revealed interactions between the adenine ring and the side
chains of Glu-114 and Lys-291, as well as the backbone of
Pro-115 and Leu-117, and also revealed an interaction between the 3⬘ hydroxyl of the ribose ring and the side chain
of Glu-174. The X-ray crystal structure provided the foundation for an iterative structure-based medicinal chemistry
effort to improve biochemical potency and achieve antibacterial activity, ultimately leading to compounds for in vivo
efficacy studies.
Adenosine analogs that inhibited the activities of DNA ligase enzymes from a broad spectrum of bacterial species were
synthesized; they are exemplified by compounds 2 to 5, with
IC50s ranging from ⬍0.010 ␮M to 1.27 ␮M (Table 2). Structure-activity relationships pertaining to the potency of enzyme
inhibition led to changes at the 2-position of the adenine ring
and the 5⬘ position on the ribose ring (Fig. 1). The cocrystal
structure of compound 1 bound to the H. influenzae LigA
AMP-binding pocket helped to define a hydrophobic tunnel
predicted to accommodate the butanethiol at the 2-position of
the adenine ring (Fig. 3B). This tunnel was explored in order to
increase biochemical potency. The butanethiol at the 2-position of compound 1 was changed to a cycloalkoxy substituent in
compounds 2 to 5, and the 5⬘-hydroxyl of compound 1 was
replaced by either a fluorine (compounds 2 and 4) or a hydride
(compounds 3 and 5). The resulting potencies of inhibition
increased for enzymes from Gram-negative organisms and
were essentially equipotent for enzymes from Gram-positive
species. Any changes to the nitrogens of the adenine ring
resulted in reduced potency; this is in agreement with the
proposed binding mode in which hydrogen bonds to the residues mentioned above are important for the binding of the
adenosine analogs to the active site of LigA.
Compound 1 exhibited modest antibacterial activity, with
MIC values of 32 ␮g/ml against S. pneumoniae and activity
against an efflux mutant of H. influenzae lacking the AcrB
subunit of its main efflux pump (37). The lack of activity against
the parental H. influenzae strain suggested that compound 1
was subject to active efflux out of the cell, poor penetration into
the cell, or a combination of efflux and poor penetration. Antibacterial activities for compounds 2 to 5 were significantly
improved against the Gram-positive pathogens S. pneumoniae
and S. aureus, atypical M. pneumoniae, and mutants of the
Gram-negative pathogens H. influenzae and E. coli that lacked
components of the major AcrAB-TolC efflux pumps (Table 3).
Although these compounds displayed modest antibacterial activity (MICs, 8 to 64 ␮g/ml) against the wild-type H. influenzae
strain, they were inactive against the wild-type E. coli strain.
Compound 5 displayed potent, broad-spectrum MIC values of
8, 4, 1, 1, and 2 ␮g/ml against wild-type H. influenzae, Moraxella
catarrhalis, S. pneumoniae, Streptococcus pyogenes, and S. aureus, respectively. Additional examples of adenosine analogs,
with corresponding IC50s and MICs, can be found in Table S1
in the supplemental material.
Selectivity for the bacterial target over eukaryotic targets was
maintained for these compounds, as demonstrated by IC50s of
NOVEL BACTERIAL NAD⫹-DEPENDENT DNA LIGASE INHIBITORS
VOL. 55, 2011
1093
FIG. 3. (A) X-ray cocrystal structure of compound 1 bound to the
AMP-binding site of H. influenzae LigA. Predicted hydrogen bonds between the inhibitor and the enzyme are shown as dashed lines. Enzyme
residues proposed to make key interactions with the compound are labeled. (B) Surface representation of the hydrophobic tunnel of the binding pocket containing compound 1. The surface of L82 (corresponding to
L75 in S. pneumoniae LigA) is shown in cyan.
⬎200 ␮M against human DNA ligase and bacteriophage T4 ligase. General cytotoxicity was not observed for these compounds,
as shown by 50% effective concentrations (EC50s) of ⬎64 ␮g/ml
for the lysis of intact sheep red blood cells, as well as MIC values
of ⬎64 ␮g/ml for the proliferation of the human cell line A549
and the fungus Candida albicans.
Compounds 2 to 5 maintained favorable physical properties
(solubility, ⬎1 mM; logD7.4, ⬍2; fu in human plasma, ⬎0.3)
such that they were amenable to in vivo dosing and efficacy.
Cellular characterization of LigA inhibitors and confirmation of a DNA ligase-specific mode of action. The killing kinetics of compound 4 at multiples of the MIC was assessed
against S. pneumoniae D39. When compound 4 was added at
concentrations equal to 8 and 32 times the MIC, a 3-log10 drop
in viability (CFU) was observed within 7 h, demonstrating that
the adenosine analogs are rapidly bactericidal to S. pneumoniae (Fig. 4).
In order to determine whether DNA ligase was inhibited in
bacteria, intracellular levels of Okazaki fragments in H. influenzae were measured by fractionating DNA pools on sucrose
gradients upon exposure to adenosine analogs (compounds 2
and 4). DNA extracted from H. influenzae grown in the absence of antibiotics led to a fractionated sucrose gradient profile with a single broad peak (spanning fractions 9 to 12) representing ligated genomic DNA (Fig. 5A to C, open circles).
Incubation with ciprofloxacin (CIP) also led to the detection of
TABLE 3. Antimicrobial activities of adenosine analogs against selected pathogenic bacteria
MIC (␮g/ml) for:
Compound
1
2
3
4
5
a
b
c
H. influenzae
E. coli
KW20
ARM158a
W3110
ARC523b
S. pneumoniae
D39
S. aureus
ARC516
M. pneumoniae
FH
⬎64
8
16
64
8
32
2
4
2
2
⬎64
⬎64
⬎64
⬎64
⬎64
⬎64
4
8
4
4
32
2
4
1
1
⬎64
8
16
2
2
NDc
1
2
0.2
ND
A KW20 efflux mutant with an acrB deletion.
A W3110 efflux mutant with a Tn10 insertion in tolC.
ND, not determined.
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
FIG. 4. Time-kill study. Shown are the effects of increasing concentrations of compound 4 (multiples of the MIC) on the viability of S.
pneumoniae (measured as CFU/ml).
1094
MILLS ET AL.
a single peak, corresponding to ligated DNA, that became less
abundant as the CIP concentration was increased to a level
above the MIC (Fig. 5A). In this case, CIP predictably inhibited thymidine incorporation but did not cause an accumulation of Okazaki fragments. Incubation with adenosine analogs
at concentrations close to their MICs against H. influenzae
ARM158 resulted in the accumulation of low-molecularweight DNA fragments consistent with Okazaki fragments
(12). These data strongly suggested that the adenosine analogs
inhibit DNA ligase in H. influenzae.
A strain of H. influenzae (HIN102) was constructed in which
H. influenzae LigA expression was controlled by the ompP1
promoter. This promoter is much stronger than the native
LigA promoter (27), and as a result, it significantly increased
the expression level of H. influenzae LigA as determined by
Western blot analysis (see Fig. S2 in the supplemental material). It was predicted that the elevated levels of LigA in
HIN102 would lead to elevated MIC values only if the antibacterial activity of the adenosine analogs was mediated by
inhibition of LigA. The control inhibitors levofloxacin (LVX)
and linezolid (LZD) did not have elevated MICs for HIN102,
whereas the MIC values of compounds 1 to 4 for HIN102 were
at least 16-fold higher than those for the parent strain, HIN101
(Table 4). These data demonstrate that the antibacterial activity of the adenosine analogs was mediated by inhibition of H.
influenzae NAD⫹-dependent DNA ligase.
Since there is precedent for antibacterial compounds with
widely different modes of action against Gram-positive and
Gram-negative pathogens (7), mode-of-action studies were
also performed with S. pneumoniae. A strain of S. pneumoniae
was constructed in which the S. pneumoniae ligA gene was
replaced with the ATP-dependent T4 lig gene (SPN102). ATPdependent T4 lig fully compensated for the loss of bacterial
ligA in SPN102. No difference in growth was observed when
SPN102 and the isogenic strain SPN100 were compared. By
virtue of the replacement of S. pneumoniae ligA with T4 lig in
SPN102, it was expected that compounds inhibiting growth by
acting on the native S. pneumoniae LigA would have MICs
higher than those for the isogenic strain SPN100, since the
adenosine analogs had been shown to be inactive against T4
DNA ligase in vitro. Negative-control inhibitors (LVX and
LZD) showed no change in the MIC for SPN102 relative to the
MIC for the parent strain, SPN100. The MIC values of the
adenosine analogs (compounds 1 to 4) were at least 64-fold
higher for SPN102 than for SPN100. These data supported the
premise that the antibacterial mode of action for the adenosine
analog series was LigA inhibition (Table 4).
Finally, spontaneous resistant mutants of S. pneumoniae
D39 were isolated on agar plates containing compound 4.
Sequencing of the ligA gene from independently obtained mutants, including SPN103, revealed a mutation in the hydrophobic tunnel of the adenosine analog binding pocket (L75F)
associated with an elevated MIC (64 ␮g/ml). The corresponding leucine residue in H. influenzae (L82) LigA is mapped
(cyan surface) to the cocrystal structure shown in Fig. 3B.
These data further supported LigA inhibition as the mode of
action in S. pneumoniae.
In vivo efficacy. Mice received a single oral administration of
100 mg/kg ABT 2 h prior to infection in order to maximize the
potential exposure of bacteria to the compound in the efficacy
experiments by reducing the high hepatic clearance of the
adenosine analogs in rodents (data not shown). At the start of
therapy, mice were colonized with 6.4 ⫾ 0.1 log10 CFU/thigh of
S. aureus ARC516 or 5.0 ⫾ 0.07 log10 CFU/lung of S. pneumoniae D39. The organisms grew by 3.3 ⫾ 0.5 log10 CFU/lung
and 2.9 ⫾ 0.2 log10 CFU/thigh after 24 h in untreated control
mice in the respective models (Fig. 6). Escalating doses of
compound 4 resulted in concentration-dependent killing of
both strains in the respective tissue compartments. The highest
doses studied reduced the organism burden by 1.8 ⫾ 0.3 log10
TABLE 4. DNA ligase mode-of-action confirmation using
recombinant expression strains
MICb
H. influenzae
Compounda
LVX
LZD
1
2
3
4
a
b
HIN101
HIN102
0.01
4
32
4
8
2
0.01
4
512
⬎64
⬎64
32
S. pneumoniae
Fold
increase
16
⬎16
⬎8
16
SPN100
SPN102
0.5
0.5
ND
2
2
1
0.5
0.5
ND
⬎64
⬎64
⬎64
Fold
increase
⬎32
⬎32
⬎64
LVX, levofloxacin; LZD, linezolid.
MICs for strains are given in micrograms per milliliter. ND, not determined.
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
FIG. 5. Accumulation of Okazaki fragments (OF) in [methylH]thymidine-labeled DNA isolated from H. influenzae ARM158 cells
treated with increasing concentrations of CIP (0, 2, 8, and 31 ng/ml)
(A), compound 2 (0, 16, 250, and 1,000 ng/ml) (B), or compound 4 (0,
63, 500, and 2,000 ng/ml) (C). Symbols represent the absence of the
compound (open circles) or increasing concentrations from lowest to
highest (filled circles, open squares, and filled squares, respectively).
The amount of radioactivity (cpm) was measured in 23 fractions (x
axis) obtained from alkaline sucrose gradients. Okazaki fragments
typically appeared in fraction 4, whereas high-molecular-weight DNA
peaked in fractions 9 to 12.
3
ANTIMICROB. AGENTS CHEMOTHER.
NOVEL BACTERIAL NAD⫹-DEPENDENT DNA LIGASE INHIBITORS
VOL. 55, 2011
S. aureus CFU/thigh and 2.9 ⫾ 0.06 log10 S. pneumoniae CFU/
lung from the inocula (input) administered to the mice at the
beginning of the studies (Fig. 6). No adverse reactions were
observed in the mice dosed with compound 4 in efficacy experiments.
DISCUSSION
DNA ligases are essential in all organisms. Bacterial NAD⫹dependent DNA ligases are distinct from eukaryotic and viral
ATP-dependent ligases and therefore represent a potentially
selective target for the discovery and development of novel
antibacterial agents (38).
The adenosine analog series discovered and further elaborated in this report is attractive from the standpoint of physical
properties as well as potency. The adenosine analogs retained
good physical properties (solubility, ⬎1 mM; logD7.4, ⬍2; fu in
human plasma, ⬎0.3) throughout the medicinal chemistry efforts to improve potency. Compounds 2 to 5 showed broadspectrum enzyme inhibition of LigA with similar IC50s. In
general, the adenosine analogs were more potent against LigA
from Gram-positive species than against LigA from Gramnegative species. The boundaries of the hydrophobic tunnel
(depicted in Fig. 3B) were explored and found to accommodate both large and small nonaromatic hydrophobic substituents at the 2-position of the adenine ring. The cyclic alkoxides
appeared either to fit more favorably in the binding pocket or
to be less flexible, and therefore more entropically favored,
than the linear side chains and had improved IC50s. Compounds 1 to 5 were all selective for the bacterial DNA ligases
over human and bacteriophage T4 DNA ligases.
Antibacterial activity was improved significantly by replacement of the 5⬘ hydroxyl with fluorine or hydride. This was
presumably due to improved permeation of the bacterial cell
envelope, resulting from the higher lipophilicity of compounds
2 to 5 than of compound 1. Optimization of the 2-position
cycloalkoxy substituent led to compounds with improved antibacterial activity, especially against the Gram-positive organisms S. pneumoniae and S. aureus.
The adenosine analogs exhibited bactericidal activity. Inhibition of S. pneumoniae NAD⫹-dependent DNA ligase resulted in concentration-independent bactericidal activity,
based on the time-kill experiment performed in this study (Fig.
4). Brötz-Oesterhelt et al. similarly demonstrated that pyridochromanone LigA inhibitors were rapidly bactericidal for S.
aureus, although the activity was concentration dependent (6).
Further, the antibacterial activity of the adenosine analogs was
selective in that they displayed no cytotoxic activity against the
fungus C. albicans or the human cell line A549.
Several lines of evidence indicated that the adenosine analogs represented by compounds 1 to 5 specifically inhibit the
target enzyme, NAD⫹-dependent DNA ligase, in the bacteria.
Addition of adenosine analogs to growth medium inhibited the
incorporation of radiolabeled thymidine into DNA and promoted the accumulation of polynucleotide fragments of a size
consistent with Okazaki fragments (Fig. 5). Overexpression of
LigA in H. influenzae or replacement of ligA with T4 lig in S.
pneumoniae desensitized the bacteria to the growth-inhibitory
action of the adenosine analogs (Table 4). Furthermore, selection for spontaneous resistance to the adenosine analogs resulted in the consistent isolation of an S. pneumoniae mutant
strain with a ligA target-based mutation (L75F) in the inhibitor-binding pocket of LigA. Modeling with the phenylalanine
residue in place of leucine (L82F) in the H. influenzae structure
predicts that the cycloalkoxy substituents at the 2-position of
the adenine ring would be occluded or altered in binding (Fig.
3B; data not shown).
The in vivo efficacy of the adenosine analogs was evaluated
in murine models of infection. Compound 4 was efficacious in
a neutropenic-mouse model of S. aureus thigh infection and an
immunocompetent-mouse model of S. pneumoniae lung infection. In both models of infection, the compounds caused a
dose-dependent decrease in CFU over 24 h, with maximal
responses occurring at 120 mg/kg/day and 60 mg/kg/day, respectively. We believe this is the first publication to demonstrate in vivo efficacy with a bacterial DNA ligase inhibitor.
Ultimately, to attain clinically relevant in vivo efficacy with the
adenosine analog series, further optimization of potency and in
vivo pharmacokinetic properties is required.
In summary, the target-based drug discovery approach described was successful in identifying a novel series of adenosine
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
FIG. 6. In vivo activity of compound 4 on infection. (A) S. aureus
ARC516 in the thighs of neutropenic mice; (B) S. pneumoniae D39 in
the lungs of immunocompetent mice. Results are plotted as means; the
error bars represent the standard errors of the means. Dosing regimens are given in milligrams per kilogram per day. q.i.d., 4 times per
day; q3, every 3 h.
1095
1096
MILLS ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
analogs that exhibited selective inhibition of bacterial NAD⫹dependent DNA ligase. The inhibition of cellular growth by
the adenosine analogs was mediated by inhibition of NAD⫹dependent DNA ligase. Furthermore, LigA was validated in
vivo with the demonstration of efficacy in a murine S. aureus
thigh infection model and a murine S. pneumoniae lung infection model. These data support the potential use of NAD⫹dependent DNA ligase as a target for antibiotic therapy.
ACKNOWLEDGMENTS
REFERENCES
1. Andes, D., and W. A. Craig. 1998. In vivo activities of amoxicillin and
amoxicillin-clavulanate against Streptococcus pneumoniae: application to
breakpoint determinations. Antimicrob. Agents Chemother. 42:2375–2379.
2. Avery, O. T., C. M. MacLeod, and M. McCarty. 1944. Studies on the chemical nature of the substance inducing transformation of pneumococcal types.
J. Exp. Med. 79:137–157.
3. Azoulay-Dupuis, E., et al. 1991. Antipneumococcal activity of ciprofloxacin,
ofloxacin and temafloxacin in an experimental mouse pneumonia model at
various stages of the disease. J. Infect. Dis. 163:319–324.
4. Balani, S. K., et al. 2004. Effective dosing regimen of 1-aminobenzotriazole
for inhibition of antipyrine clearance in guinea pigs and mice using serial
sampling. Drug Metab. Dispos. 32:1092–1095.
5. Benson, E. L., et al. 2004. A high-throughput resonance energy transfer assay
for Staphylococcus aureus DNA ligase. Anal. Biochem. 324:298–300.
6. Brötz-Oesterhelt, H., et al. 2003. Specific and potent inhibition of NAD⫹dependent DNA ligase by pyridochromanones. J. Biol. Chem. 278:39435–
39442.
7. Buurman, E. T., K. D. Johnson, R. K. Kelly, and K. MacCormack. 2006.
Different modes of action of naphthyridones in Gram-positive and Gramnegative bacteria. Antimicrob. Agents Chemother. 50:385–387.
8. Buurman, E. T., et al. 2009. Adenosine analogs mediating antibacterial
activity via inhibition of NAD-dependent DNA ligase, poster F1-1982. Abstr.
49th Intersci. Conf. Antimicrob. Agents Chemother.
9. Chen, X. C., et al. 2002. Development of a fluorescence resonance transfer
assay for measuring the activity of Streptococcus pneumoniae DNA ligase, an
enzyme essential for DNA replication, repair and recombination. Anal.
Biochem. 309:232–240.
10. Ciarrocchi, G., D. G. MacPhee, L. W. Deady, and L. Tilley. 1999. Specific
inhibition of the eubacterial DNA ligase by arylamino compounds. Antimicrob. Agents Chemother. 43:2766–2772.
11. Clinical and Laboratory Standards Institute. 2009. Methods for dilution
antimicrobial susceptibility tests for bacteria that grow aerobically; approved
standard, 9th ed. M07–A8, vol. 29, no. 2. Clinical and Laboratory Standards
Institute, Wayne, PA.
12. Dermody, J. J., G. T. Robinson, and R. Sternglanz. 1979. Conditional-lethal
deoxyribonucleic acid ligase mutant of Escherichia coli. J. Bacteriol. 139:701–
704.
13. Eakin, A. E., et al. 2009. Discovery of novel adenosine analogs that selectively inhibit bacterial NAD⫹-dependent DNA ligase, poster F1-1981. Abstr.
49th Intersci. Conf. Antimicrob. Agents Chemother.
14. Gajiwala, K. S., and C. Pinko. 2004. Structural rearrangement accompanying
NAD⫹ synthesis within a bacterial DNA ligase crystal. Structure 12:1449–
1459.
15. Gul, S. R., et al. 2004. Staphylococcus aureus DNA ligase: characterization of
its kinetics of catalysis and development of a high-throughput screening
compatible chemiluminescent hybridization protection assay. Biochem. J.
383:551–559.
Downloaded from http://aac.asm.org/ on September 2, 2016 by guest
We thank the AstraZeneca R&D Boston Susceptibility Group for
MIC testing and the Drug Metabolism and Pharmacokinetics (DMPK)
Group for analyses associated with in vivo efficacy studies. We specifically thank Robert Albert, Teresa Conneely, Lena Grosser, Irene
Karantzeni, Val Laganas, Ce Feng Liu, Kathy MacCormack, Bob
McLaughlin, Art Patten, Hongming Wang, and Maria Uria-Nickelsen
for their technical expertise in supporting this study. We thank Tom
Dougherty and Boudewijn deJonge for critical reading of the manuscript.
16. Han, S., J. S. Chang, and M. Griffor. 2009. Structure of the adenylation
domain of NAD⫹-dependent DNA ligase from Staphylococcus aureus. Acta
Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 65:1078–1082.
17. Hoskins, J., et al. 2001. Genome of the bacterium Streptococcus pneumoniae
strain R6. J. Bacteriol. 183:5709–5717.
18. Kaczmarek, F. S., et al. 2001. Cloning and functional characterization of an
NAD⫹-dependent DNA ligase from Staphylococcus aureus. J. Bacteriol.
183:3016–3024.
19. Kodama, K., D. E. Barnes, and T. Lindahl. 1991. In vitro mutagenesis and
functional expression in Escherichia coli of a cDNA encoding the catalytic
domain of human DNA ligase I. Nucleic Acids Res. 19:6093–6099.
20. Kreiswirth, B., et al. 1983. The toxic shock syndrome exotoxin structural
gene is not detectably transmitted by a prophage. Nature 305:709–712.
21. Leggett, J. E., S. Ebert, B. Fantin, and W. A. Craig. 1990. Comparative
dose-effect relations at several dosing intervals for beta-lactam, aminoglycoside and quinolone antibiotics against Gram-negative bacilli in murine thighinfection and pneumonitis models. Scand. J. Infect. Dis. Suppl. 74:179–184.
22. Lehman, I. R. 1974. DNA ligase: structure, mechanism and function. Science
186:790–797.
23. Meier, T. I., et al. 2008. Identification and characterization of an inhibitor
specific to bacterial NAD⫹-dependent DNA ligases. FEBS J. 275:5258–5271.
24. Ménard, R., P. J. Sansonetti, and C. Parsot. 1993. Nonpolar mutagenesis of
the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri
entry into epithelial cells. J. Bacteriol. 175:5899–5906.
25. Miesel, L., et al. 2007. A high-throughput assay for the adenylation reaction
of bacterial DNA ligase. Anal. Biochem. 366:9–17.
26. Munson, R., Jr., and S. Grass. 1988. Purification, cloning, and sequence of
outer membrane protein P1 of Haemophilus influenzae type b. Infect. Immun. 56:2235–2242.
27. Munson, R., Jr., and A. Hunt. 1989. Isolation and characterization of a
mutant of Haemophilus influenzae type b deficient in outer membrane protein P1. Infect. Immun. 57:1002–1004.
28. Nandakumar, J., P. A. Nair, and S. Shuman. 2007. Last stop on the road to
repair: structure of E. coli DNA ligase bound to nicked DNA-adenylate.
Mol. Cell 26:257–271.
29. National Committee for Clinical Laboratory Standards. 1999. Methods for
determining bactericidal activity of antimicrobial agents; approved guideline.
M26-A, vol. 19, no. 18. National Committee for Clinical Laboratory Standards, Wayne, PA.
30. Newman, J. V., T. O’Shea, L. Grosser, H. Hu, and S. D. Mills. 2009. Adenosine analogs: pharmacokinetics and in vivo efficacy in Gram-positive infection models, poster F1-1983. Abstr. 49th Intersci. Conf. Antimicrob. Agents
Chemother.
31. Park, U. E., B. M. Olivera, K. T. Hughes, J. R. Roth, and D. R. Hillyard.
1989. DNA ligase and the pyridine nucleotide cycle in Salmonella typhimurium. J. Bacteriol. 171:2173–2180.
32. Pascal, J. M. 2008. DNA and RNA ligases: structural variations and shared
mechanisms. Curr. Opin. Struct. Biol. 18:96–105.
33. Petit, M. A., and S. D. Ehrlich. 2000. The NAD-dependent ligase encoded by
yerG is an essential gene of Bacillus subtilis. Nucleic Acids Res. 28:4642–
4648.
34. Ravin, A. W. 1959. Reciprocal capsular transformations of pneumococci. J.
Bacteriol. 77:296–309.
35. Ryley, J. F., R. G. Wilson, and K. J. Barrett-Bee. 1984. Azole resistance in
Candida albicans. Sabouraudia 22:53–63.
36. Saeed-Kothe, A., W. Yang, and S. D. Mills. 2004. Use of the riboflavin
synthase gene (ribC) as a model for development of an essential gene disruption and complementation system for Haemophilus influenzae. Appl. Environ. Microbiol. 70:4136–4143.
37. Sánchez, L., W. Pan, M. Vinas, and H. Nikaido. 1997. The acrAB homolog
of Haemophilus influenzae codes for a functional multidrug efflux pump. J.
Bacteriol. 179:6855–6857.
38. Shuman, S. 2009. DNA ligases: progress and prospects. J. Biol. Chem.
284:17365–17369.
39. Stokes, S. S., et al. 2009. Adenosine analogs: synthesis and SAR of novel
inhibitors of bacterial NAD⫹-dependent DNA ligase, poster F1-1980. Abstr.
49th Intersci. Conf. Antimicrob. Agents Chemother.
40. Whitby, P. W., D. J. Morton, and T. L. Stull. 1998. Construction of antibiotic
resistance cassettes with multiple paired restriction sites for insertional mutagenesis of Haemophilus influenzae. FEMS Microbiol. Lett. 158:57–60.
41. Wilkinson, A., J. Day, and R. Bowater. 2001. Bacterial DNA ligases. Mol.
Microbiol. 40:1241–1248.