University of Texas at Tyler
Scholar Works at UT Tyler
Biology Theses
Biology
Fall 12-9-2022
DIFFERENTIAL EXPRESSION OF PHOTOSYNTHETIC GENES IN
CRYPTOPHYTE ALGAE (HEMISELMIS CRYPTOCHROMATICA
CCMP 1181)
Chastity D. Aguilar
Follow this and additional works at: https://scholarworks.uttyler.edu/biology_grad
Part of the Biology Commons
Recommended Citation
Aguilar, Chastity D., "DIFFERENTIAL EXPRESSION OF PHOTOSYNTHETIC GENES IN CRYPTOPHYTE
ALGAE (HEMISELMIS CRYPTOCHROMATICA CCMP 1181)" (2022). Biology Theses. Paper 72.
http://hdl.handle.net/10950/4131
This Thesis is brought to you for free and open access by
the Biology at Scholar Works at UT Tyler. It has been
accepted for inclusion in Biology Theses by an authorized
administrator of Scholar Works at UT Tyler. For more
information, please contact tgullings@uttyler.edu.
DIFFERENTIAL EXPRESSION OF PHOTOSYNTHETIC GENES IN CRYPTOPHYTE
ALGAE (HEMISELMIS CRYPTOCHROMATICA CCMP 1181)
by
CHASTITY AGUILAR
A thesis submitted in partial fulfillment of
the requirements for the degree of
Master of Science in Biology
Department of Biology
Matthew Greenwold, Ph.D., Committee Chair
College of Arts & Sciences
The University of Texas at Tyler
December 2022
The University of Texas at Tyler
Tyler, Texas
This is to certify that the Master’s Thesis of
CHASTITY AGUILAR
has been approved for the thesis requirement on
October 28th, 2022 for
the Master of Biology degree
© Copyright by Chastity Deseray Aguilar 2022
All rights reserved
Acknowledgements
I would like to thank the Department of Energy Joint Genome Institute for sequencing the
transcriptome for H. cryptochromatica (CCMP 1181). Dr. Tammi Richardson, at the University
of South Carolina, for her previous work and knowledge that set the ground work for this study. I
would also like thank Dr. Joseph Glavy and Dr. Joshua Banta for serving on my committee and
being constant motivation to complete this project. Thank you to the University of Texas at Tyler
Biology Department and everyone within it for their constant encouragement and wonderful
atmosphere to study and grow. A special thank you to Jessica Coleman for always being there to
answer questions and encourage me during the stressful times. She has provided me with so
many opportunities and experiences that I will always be grateful for!
Lastly, I would like to give a huge thank you to Dr. Matthew Greenwold! He provided
me with the opportunity to continue my education and get my Master’s degree. He was always
there to answer every question I had and to encourage me to be able to find the answers on my
own. His knowledge and expertise guided me through this project and I wouldn’t have been able
to do it without his support. I am incredibly grateful for this experience and everything he has
taught me. The University of Texas at Tyler has a wonderful Biology Department and I’m
thankful for being able to attend this university and everyone I’ve met while here.
Table of Contents
List of Tables ............................................................................................................................... III
List of Figures ............................................................................................................................... IV
Abstract .......................................................................................................................................... V
Chapter One: Introduction ............................................................................................................. 1
Introduction to Cryptophyte Algae ..................................................................................... 1
Cryptophyte Phycobiliproteins (PBPs) ............................................................................... 2
The α and β subunits ........................................................................................................... 4
The Chromophores (Bilins) ............................................................................................... 5
Oxidoreductases involved in Biosynthesis of Bilins .......................................................... 5
Lyases involved in Binding Bilins ...................................................................................... 6
Cryptophyte of Interest: Hemiselmis cryptochromatica CCMP 1181 ................................ 7
Phenotypic Plasticity ........................................................................................................... 8
Research Focus & Genes of Interest ................................................................................... 9
Chapter Two: Materials and Methods ........................................................................................... 12
Medium Preparation.......................................................................................................... 12
Stock Cultures ................................................................................................................... 12
Study Design ..................................................................................................................... 12
Cell Counts........................................................................................................................ 15
RNA Extraction ............................................................................................................... 16
Primer Design .................................................................................................................. 20
Primer Optimization.......................................................................................................... 22
RT-qPCR.......................................................................................................................... 23
Statistical Analysis ............................................................................................................ 23
I
Chapter Three: Results .................................................................................................................. 25
Growth Rates ................................................................................................................... 25
RT-qPCR Statistical Analysis ........................................................................................... 26
Repeated Measures ANOVA: Green-Light and Red-Light .................................. 26
Univariate ANOVA: β subunit in green-light ....................................................... 27
Univariate ANOVA: CPES in green-light ............................................................ 27
Univariate ANOVA: PebA in green-light ............................................................ 28
Univariate ANOVA: PebB in green-light ............................................................. 28
Univariate ANOVA: β subunit in red-light.......................................................... 29
Univariate ANOVA: CPES in red-light ................................................................ 29
Univariate ANOVA: PebA in red-light................................................................ 29
Univariate ANOVA: PebB in red-light ................................................................. 29
Chapter Four: Discussion ............................................................................................................. 31
Do changes in gene expression of photosynthetic genes stabilize after the acclimation
period in different light environments? ........................................................................... 32
Do the β-subunit, CPES, PebA, and PebB genes play a role in H. cryptochromatica’s
(CCMP 1181) ability to shift its maximum wavelength absorption under different light
environments? ................................................................................................................... 33
An alternative hypothesis for the PBP double peak .......................................................... 37
Future Directions ............................................................................................................. 38
Conclusion ....................................................................................................................... 38
Literature Cited .............................................................................................................................. 40
II
List of Tables
Table 1.
List of Phycobiliproteins and their absorption ranges ............................................ 3
Table 2.
Concentration and purity levels for RNA samples used in RT-qPCR .................. 18
Table 3.
Forward and Reverse primer sequences for genes of interest from H.
cryptochromatica (CCMP 1181) ..........................................................................21
Table 4.
Results of primer optimization for each gene with the concentration level that
each set was run at ............................................................................................... 22
Table 5.
Repeated measures of natural log-transformed data normalized to full-light gene
expression for green and red-light environments .................................................. 26
III
List of Figures
Figure 1.
Wavelength absorption peaks of H. cryptochromatica (CCMP 1181) under
different light environments from previous studies ................................................ 8
Figure 2.
Wavelength of light in Percival incubator under full-light ................................... 13
Figure 3.
Wavelength of light in Percival incubator under green-light ................................ 13
Figure 4.
Wavelength of light in Percival incubator under red-light ................................... 14
Figure 5.
Study design setup of six bottles under green and red-light environments .......... 15
Figure 6.
Growth rate of H. cryptochromatica (CCMP 1181) under green-light and redlight .......................................................................................................................26
Figure 7.
Change in gene expression in the β-subunit, CPES, PebA, and PebB in green-light
over time .............................................................................................................. 28
Figure 8.
Change in gene expression in the β-subunit, CPES, PebA, and PebB in red-light
over time .............................................................................................................. 30
IV
Abstract
Differential Expression of Photosynthetic Genes in Cryptophyte Algae (Hemiselmis
cryptochromatica (CCMP 1181))
Chastity Aguilar
Thesis Chair: Matthew J. Greenwold, Ph.D.
The University of Texas at Tyler
December 2022
Cryptophytes are a group of freshwater algae that have acquired photosynthesis through
secondary endosymbiosis with a red alga and an unknown eukaryote heterotroph. Cryptophytes
possess photosynthetic pigment-protein structures called phycobiliproteins (PBPs). Cryptophyte
phycobiliproteins are composed of α and β-protein subunits and four chromophores (bilins).
There are nine classes of cryptophyte PBPs that absorb different wavelengths of light based on
the type of bilins covalently bound to the protein subunits. Three cryptophyte PBPs are
phycoerythrins that give the algae a red appearance and six are phycocyanins that give the algae
a blue to green appearance. Hemiselmis cryptochromatica (CCMP 1181) is a strain of
cryptophyte algae that has demonstrated the ability to shift its PBP maximum absorption peak
under different light conditions suggesting its PBP absorption is a plastic phenotype. This unique
characteristic is what brought our attention to this strain. The research questions addressed here
are, (1) Do changes in gene expression of photosynthetic genes stabilize after the acclimation
period (four weeks) in green- or red-light environments? And (2) Do the β-subunit, CPES, PebA,
and PebB genes play a role in H. cryptochromatica’s (CCMP 1181) ability to shift its PBP
V
maximum peak wavelength absorption under different light environments? To address these
questions, gene expression was examined using RNA-seq data and RT-qPCR. Cultures of H.
cryptochromatica (CCMP 1181) were grown under green-light and red-light environments for –
six to eight weeks to determine how gene expression of photosynthetic related genes is altered in
these environments. For question one, we found that gene expression does not change after the
four weeks acclimation period in the red-light environment up to six weeks, but in the green-light
environment, we found that significant changes in gene expression occur at eight weeks for three
of the four genes. For question two, we found that the β-subunit and PebB do not play a role in
this phenotypic plasticity response. However, CPES and PebA may be partially responsible for
the shift of its maximum wavelength absorption peak to 625nm under red-light. Both of these
genes were upregulated in the red-light environment. PebA is the oxidoreductase responsible for
producing the bilin DBV and CPES is an S/U type lyase that can only bind DBV and PEB bilins
to the β-subunit. This suggests that an increase in DBV production and attachment to the βsubunit is likely needed for the shift in absorption under red-light. Furthermore, this leads us to
think that another bilin is responsible for the dominant peak at 569nm under green-light that is
currently unknown. These data indicate that the oxidoreductase that produces this unknown bilin
needs to be determined, as well as the lyase that binds the bilin. Therefore, an in-depth RNA-seq
experiment and characterization of the bilins of H. cryptochromatica (CCMP 1181) in different
light environments will be necessary to fully understand phenotypic plasticity in cryptophytes.
VI
Chapter 1
Introduction
Introduction to Cryptophyte Algae
Cryptomonads, also known as cryptophytes, are a phylum of mostly photosynthetic and
motile algae. The first cryptomonad species were described as having flattened asymmetric cells,
a distinct swimming motion, refractile ejectosomes, and a distinct ultrastructure by C.G.
Ehrenberg in 1832 (Ehrenberg, 1832; Hoef-Emden and Archibald, 2016). They are unicellular
eukaryotes that can be found in marine, brackish, and freshwater environments (Kim et al.,
2017). These algae can be found in almost every aquatic environment, including cold, temperate,
and tropical habitats; in rock pools, tide pools, ponds, rain barrels, and even puddles (HoefEmden and Archibald, 2016). They often move vertically along the water column from the
anoxic environments at night, to the epilimnion during the day (Hoef-Emden and Archibald,
2016). Their ability to survive in a wide range of light environments makes them an important
primary producer within their habitats. Cryptophyte phycobiliproteins absorb light in the region
of the visible light spectrum that is not covered by chlorophyll pigments, which may allow these
algae to survive in a wide range of environments (Hoef-Emden and Archibald, 2016).
Cryptophytes acquired their ability to perform photosynthesis through secondary
endosymbiosis (Glazer and Wedemeyer, 1995). Secondary endosymbiosis is when a eukaryotic
organism engulfs another unrelated organism (Hoef-Emden and Archibald, 2016). The first
endosymbiotic event occurred when a eukaryote engulfed a cyanobacteria that was later reduced
to a chloroplast (Douglas, 1992; Glazer and Wedemeyer, 1995; McFadden, 2022). This first
event is believed to have led to the evolution of red and green algae (Douglas, 1992; Glazer and
Wedemeyer, 1995; McFadden, 2022). The second endosymbiotic event that led to cryptophytes,
was the phagocytosis of a red algal ancestor by an unknown eukaryote (Douglas, 1992; Glazer
1
and Wedemeyer, 1995; McFadden, 2022). This sequence of events resulted in the presence of
four membranes surrounding the cryptophyte’s chloroplast and the presence of a second nuclear
genome, the nucleomorph (Glazer and Wedemeyer, 1995). Therefore, most cryptophytes now
contain four genomes, including the host-derived nuclear and mitochondrial genomes, and
symbiont derived nucleomorph and plastid genomes (Kim et al., 2017).
What scientists have been specifically interested in, is the plastid found within these
organisms that allow them to absorb light and produce energy through photosynthesis (HoefEmden and Archibald, 2016). The plastids in cryptomonads contain chlorophyll-a and
chlorophyll-c2 (Kim et al., 2017). They also contain alloxanthin and α-carotene pigments, as well
as one form of phycobiliprotein (PBP) that is used in the light-harvesting complex (Bogorad,
1975; Gieskes and Kraay, 1983; Jeffrey and Vesk, 1997; Heidenreich and Richardson, 2020).
Different strains of cryptomonads contain different phycobiliproteins that absorb different
wavelengths of light for energy production.
Cryptophyte Phycobiliproteins (PBPs)
Cryptophyte phycobiliproteins (PBPs) are located in the thylakoid lumen and, unlike their
red algal ancestor, are not assembled into phycobilisomes (PBS) (Ludwig and Gibbs, 1989;
Gantt et al., 1971; Gould et al., 2007). Phycobilisomes are large light capturing complexes that
can be found in cyanobacteria and red algae (MacColl, 1998; Sidler, 1994; Adir, 2005; Chang et
al., 2015). In cyanobacteria and red algae, the phycobilisome is made up of the three types of
PBPs (phycoerythrin, phycocyanin, and allophyocyanin) and are attached to the thylakoid
membrane (Gantt and Conti, 1966; Richardson, 2022). However, in cryptophytes, the
phycobilisome have disappeared and the PBPs now form αα’ββ heterodimers and can be found
in the thylakoid lumen (Hoef-Emden and Archibald, 2016; Gantt et al., 1971; Glazer and
2
Wedemayer, 1995; Vesk et al., 1992; Richardson, 2022). There are nine different PBP’s found
in cryptophytes; six of which are cryptophyte phycocyanins (Cr-PC) and three are cryptophyte
phycoerythrins (Cr-PE) (Hill and Rowan, 1989; Hoef-Emden and Archibald, 2016; Heidenreich
and Richardson, 2020; Magalhães et al., 2021) Cryptophyte phycoerythrins give the algae a red
or pinkish appearance and cryptophyte phycocyanins give the algae a green or blue appearance
(Heidenreich and Richardson, 2020). Each PBP class absorbs light at different wavelengths and
is named for the wavelength of peak maximum absorption (Table 1) (Hill and Rowan, 1989;
Hoef-Emden and Archibald, 2016; Heidenreich and Richardson, 2020). The ‘Cr’ prefix indicates
that these proteins belong to cryptophytes, which is then followed by either ‘PE’ or ‘PC’ to
indicate either phycoerythrin or phycocyanin (Glazer and Wedemayer, 1995). Lastly, the final
descriptor is the number that indicates that maximum absorption peak for each phycobiliprotein
(Glazer and Wedemayer, 1995). For example, Cr-PE 545 indicates the protein is a red-colored
cryptophyte phycobiliprotein with a maximum absorption at 545 nm (Glazer and Wedemayer,
1995).
Table 1. List of Phycobiliproteins. Cr = Cryptophyte, PE = Phycoerythrin, PC = Phycocyanin, # indicates maximum
wavelength absorption. (Table 1 information from Glazer and Wedemayer, 1995 and Magalhães et al., 2021).
Biliproteins
Absorption Range (nm)
Cr-PE 545
538-551
Cr-PE 555
553-556
Cr-PE 566
563-567
Cr-PC 569
568-569
Cr-PC 564
557-620
Cr-PC 577
576-578
Cr-PC 612
612-615
Cr-PC 630
625-630
3
Cr-PC 645
641-650
Each PBP is made up of 2 types of protein subunits, the α-subunit and β-subunit (Glazer
and Wedemayer, 1995). The α and β-subunits have different amino acid sequences, and they
combine with the chromophores (bilins) to form the pigment-protein complex. Bilins are linear
tetrapyrrole molecules that are also referred to as chromophores (Kronfel et al., 2013). Each
PBP complex has two α-subunits and two β-subunits, as well as four bilins that are bound to the
α and β-subunits (Glazer and Wedemayer, 1995; Apt et al., 1995; Greenwold et al., 2019).
The α and β subunits
The α-subunit differs from the β-subunit in a few ways, the first is that the α-subunit is a
short polypeptide that binds to only one of the four bilins within the PBP (Harrop et al., 2014).
The gene encoding the α-subunit is found in the nuclear genome and has become highly
diversified through gene duplication (Glazer and Wedemayer, 1995; Jenkins et al., 1990; Gould
et al., 2007; Kieselbach et al., 2018; Greenwold et al., 2019). The α-subunits likely evolved from
linker proteins that can be found in phycobilisomes in red algae, as they contain many copies of a
cryptophyte-α like domain (Rathbone et al., 2021). The α-subunit has also been found to be able
to switch the PBP complex from open to closed state, which is essentially when the two
chromophores attached to the β50/60 cysteines are in physical contact (closed) and when they are
separated by a water-filled channel (open) (Harrop et al., 2014). On the other hand, three of the
four bilins attach to the β-subunit which is encoded by a gene found in the plastid genome and is
highly conserved and orthologous to genes found in cyanobacteria and red algae (Harrop et al.,
2014; Greenwold et al., 2019). The α and β-subunits are orthologous to genes found within red
algae indicating they were inherited directly from the red algal symbiont (Glazer and
4
Wedemayer, 1995; Douglas et al., 2001; Kim et al., 2015; Greenwold et al., 2019; Rathbone,
2021).
The Chromophores (Bilins)
Each cryptophyte phycobiliprotein class has four bilins that are bound to the α and βprotein subunits. The α-subunit has one bilin attached at to a cysteine (α-Cys) at the 18th (or 19th)
amino acid position, while the β-subunit has three bilins attached at the β-Cys 50,61, β-Cys 82,
and β-Cys 158 positions (Glazer and Wedemayer, 1995). There are six chromophores that are
known to be able to bind to the protein subunits within cryptophyte PBPs (Glazer and
Wedemayer, 1995; Apt et al., 1995; Greenwold et al., 2019). Four of these chromophores can
only be found within cryptophyte species and the other two chromophores can also be found in
red algae (Glazer and Wedemayer, 1995; Greenwold et al., 2019). The six bilins that compose
cryptophyte phycobiliproteins are: phycocyanobilin (PCB), phycoerythrobilin (PEB),
mesobiliverdin (MBV), 15,16-dihydrobiliverdin (DBV), bilin 618, and bilin 584 (Wedemayer et
al., 1991, 1992; Wemmer et al., 1993; Glazer and Wedemayer, 1995). Before the bilins can be
bound to the α and β-subunits, they must first undergo a biosynthesis process that is similar to a
process used by cyanobacteria (Overkamp et al., 2014).
Oxidoreductases involved in Biosynthesis of Bilins
The biosynthesis process of bilins begins with an oxygenolytic cleavage of heme
ferredoxin-dependent HO which results in the open-chain tetrapyrrole biliverdin IXα, also
known as BV IXα (Frankenberg et al., 2001; Frankenberg-Dinkel, 2004; Wilks, 2002; Overkamp
et al., 2014). Biliverdin IXα (BV IXα) is then reduced further by ferredoxin-dependent bilin
reductases (FDBR) which result in PCB, PEB and phytochromobilin (Frankenberg et al., 2001;
5
Chen et al., 2012; Dammeyer et al., 2008; Overkamp et al., 2014). The two oxidoreductases
involved with this synthesis process in the cryptophyte Guillardia theta are 15,16DHBV:ferredoxin oxidoreductase, or PebA, and PEB:ferredoxin oxidoreductase, or PebB
(Overkamp et al., 2014). For PEB production, PebA converts BV IXα into the intermediate
DBV, and PebB further reduces DBV into PEB (Frankenberg et al., 2001; Dammeyer and
Frankenberg-Dinkel, 2006; Overkamp et al., 2014). Each bilin will follow a similar biosynthesis
process before they are bound to the protein subunits by a lyase enzyme.
Lyases involved in Binding Bilins
After the bilin has been biosynthesized, it is bound to the protein subunits at specific
cysteine positions by an enzyme known as a lyase (Böhm et al., 2007; Kupka et al., 2009; Scheer
and Zhao, 2008; Overkamp et al., 2014). There are three different classes of PBP lyases, which
are E/F-, S/U-, and T-type (Blot et al., 2009; Shukla et al., 2012; Zhao et al., 2000; Overkamp et
al., 2014). E/F lyases provide attachment of bilins PCB or PEB to the α-subunits in phycocyanins
(PCs), phycoerythrins (PEs), and phycoerythrocyanins (PECs), while S/U and T-type lyases
attach bilins to the β-subunits (Fairchild and Glazer, 1994; Fairchild et al., 1992; Kahn, et al.,
1997; Zhao et al., 2000; Blot et al., 2009; Shukla et al., 2012; Zhao et al., 2017). The difference
between the S/U and T-type lyases is the site of attachment for the bilins. S/U lyases attach bilins
to the Cys-81 site in allophycocyanins and Cys-84 site in PCs, PEs, and PECs, while T-type
lyases attach bilins to the Cys-155 site in PBPs (Zhao et al., 2007; Zhao et al., 2006; Saunée et
al., 2008; Kronfel et al., 2013; Overkamp et al., 2014; Shen et al., 2006; Zhao et al., (2)2007;
Zhou et al., 2014; Zhao et al., 2017) These PBP lyase types are known to have high site
attachment specificity. However, they haven’t been widely studied in cryptophytes (Scheer and
Zhao, 2008; Overkamp et al., 2014). Prior to Overkamp et al. (2014), only one PBP lyase within
6
cryptophytes had been identified in the strain Guillardia theta, and it is GtCPET (Bolte et al.,
2008; Overkamp et al., 2014). GtCPET is classified as a T-type lyase, has low substrate
specificity, and plays a role in attaching the PEB bilin to the Cys-β158 position in cryptophyte
phycobiliproteins (Bolte et al., 2008; Overkamp et al., 2014). The first cryptophyte S/U-type
lyase was identified in 2014 by Overkamp et al. (2014) in G. theta. This lyase is known as
GtCPES and has high position specificity for bilins and low specificity for apoproteins
(Overkamp et al., 2014). GtCPES is homodimeric and binds only to DHBV, 3E-, and 3(Z)-PEB,
and cannot bind to BV IXα or PCB (Overkamp et al., 2014). This demonstrates that lyases
involved in binding the bilins to the α and β-subunits are highly specific and play an important
role in the process of assembling functional cryptophyte phycobiliproteins.
Cryptophyte of Interest: Hemiselmis cryptochromatica CCMP 1181
Cryptophytes are composed of at least 200 species and generally strains of the same
genus are found in the same phylogenetic clade (Hoef-Emden, 2008; Hoef-Emden and
Archibald, 2016; Cunningham et al., 2019; Heidenreich and Richardson, 2020). Many genera
only have one type of phycobiliprotein (Hoef-Emden, 2008; Hoef-Emden and Archibald, 2016;
Cunningham et al., 2019; Heidenreich and Richardson, 2020). However, there are several genera
that have a variety of phycobiliprotein types, such as Chroomonas and Hemiselmis (HoefEmden, 2008; Hoef-Emden and Archibald, 2016; Cunningham et al., 2019; Heidenreich and
Richardson, 2020). Hemiselmis cryptochromatica CCMP 1181 is a strain that has recently been
found to shift the peak maximum wavelength absorption under different light environments
(Lane and Archibald, 2008; Cunningham et al., 2019; Heidenreich and Richardson, 2020). In
Heidenreich and Richardson (2020) H. cryptochromatica (CCMP 1181) had two peak
absorptions at 569 nm and 625 nm, depending on the light environment. Each peak observed
7
shifted towards the incident of light (Figure 1) (Heidenreich and Richardson, 2020). This
suggests that the maximum absorption peak corresponds to the light environment. Under the
green-light, the 569 nm peak was dominant and under the red-light, the 625 nm peak dominated
(Figure 1) (Heidenreich and Richardson, 2020). These changes in peak absorption demonstrate
an ability to acclimate to different light environments by H. cryptochromatica (CCMP 1181).
However, the mechanism responsible for this phenotypic plasticity response is not known.
Figure 1. Maximum peak wavelength absorption of H. cryptochromatica (CCMP 1181) under different light
environments, with each dashed line representing a different light environment. The green dashed line represents
green-light, the red dashed line represents red-light, the black dashed line represents full-spectrum, and the blue
dashed line represents blue-light. Modified from Figure 5. of Heidenreich and Richardson (2020).
Phenotypic Plasticity
Phenotypic plasticity is defined as the ability for the same organism to express different
characteristics in different environmental conditions (Xue and Leibler, 2018). Phenotypic
plasticity is interesting because it allows organisms to acclimate to different environments by
changing some aspect of their morphology, physiology, or behavior (Xue and Leibler, 2018).
This allows organisms to adjust to environmental changes much quicker than genetic changes
(evolution; Xue and Leibler, 2018). For example, butterflies emerge from their cocoons with
8
different color patterns depending on the season and spadefoot toad tadpoles enter
metamorphosis earlier when their environment is drying out (Xue and Leibler, 2018). Phenotypic
plasticity relies on environmental cues that may be sensed during development to help prepare
the organism to survive in their environment in adulthood or when an organism encounters a new
environment (Xue and Leibler, 2018). While these shifts in phenotype expression have been
observed, the mechanism behind phenotypic plasticity in the spadefoot toad and butterflies is not
yet known; much like the changes observed in PBP maximum peak wavelength absorption in H.
cryptochromatica (CCMP 1181).
Research Focus & Genes of Interest
The main objective of this study it to determine the mechanism responsible for the
observed phenotypic plasticity in the cryptophyte alga Hemiselmis cryptochromatica (CCPM
1881). As previously mentioned, the idea is that this mechanism is due to differential gene
expression in H. cryptochromatica (CCMP 1181). Therefore, this study will determine if
changes in gene expression of four different photosynthetic genes of H. cryptochromatica
(CCMP 1181) occurs when the light environment is shifted from full-light to green-light and
from full-light to red-light. There are two research questions being asked with this study. The
first question is (1) Do changes in gene expression of photosynthetic genes stabilize after the
acclimation period (four weeks) in different light environments? We hypothesize that gene
expression will stabilize after the acclimation period of four weeks. The second research question
is 2) Do the β-subunit, CPES, PebA, and PebB genes play a role in H. cryptochromatica’s
(CCMP 1181) ability to shift its PBP maximum peak wavelength absorption under different light
environments? The genes chosen for this study have been previously shown to be important to
the biosynthesis of cryptophyte phycobiliproteins. The genes of interest are: 1) the β-subunit, 2)
9
PebA, 3) PebB, and 4) CPES. Based on function of these genes from previous studies (Spangler
et al., 2022; Overkamp et al., 2014), we have developed specific hypotheses for each gene:
•
The β-subunit was chosen due to the work completed by Spangler et al. (2022). They
found that in Proteomonas sulcata’s PBP, PE545, and Hemiselmis pacifica’s PBP,
PC577, the shift in the absorption peak was found to be associated with the β subunit
(Spangler et al., 2022). However, Spangler et al., 2022 suggested that the ability to shift
maximum absorption peaks is likely due to a change in one or more of the chromophores,
or bilins, bound to the β-subunit Therefore, it is hypothesized that the β-subunit will not
demonstrate differential gene expression when H. cryptochromatica (CCMP 1181) is
shifted to new light environments.
•
CPES, was also chosen based off results obtained from Overkamp et al. (2014). In the
cryptophyte Guillardia theta, CPES was found to cause a higher, more distinct maximum
wavelength absorption peak (Overkamp et al., 2014). Therefore, it is hypothesized that
differential gene expression of CPES will occur when H. cryptochromatica (CCMP
1181) is shifted to a new light environment.
•
PebA was chosen due to the work that was completed by Overkamp et al. (2014). They
found that when PebA was supplied to intermediates in bilin synthesis reaction in the
cryptophyte Guillardia theta, it formed inactive aggregates. Therefore, it is hypothesized
that PebA will not demonstrate differential gene expression when H. cryptochromatica
(CCMP 1181) is moved to either a green-light or red-light environment.
•
PebB was also chosen due to the work that was completed by Overkamp et al. (2014).
They found that PebB was able to bind to an intermediate (bilin) and subsequently alter
the wavelength of light absorption in the cryptophyte Guillardia theta (Overkamp et al.,
10
2014). Therefore, it is hypothesized that PebB will demonstrate differential gene
expression when H. cryptochromatica (CCMP 1181) is shifted to a new light
environment.
In summary, this study will examine differential gene expression in H. cryptochromatica
(CCMP 1181) to determine if changes in gene expression of the β-subunit, PebA, PebB, or CPES
are responsible for its ability to shift its maximum peak wavelength absorption under different
light environments. H. cryptochromatica (CCMP 1181) will be grown under full light then
shifted to either a green-light or red-light environment for at least six weeks to answer the
following research questions: (1) Do changes in gene expression of photosynthetic genes
stabilize after the acclimation period in different light environments? And (2) Do the β-subunit,
CPES, PebA, and PebB genes play a role in H. cryptochromatica’s (CCMP 1181) ability to shift
its maximum peak wavelength absorption under different light environments? Acclimation has
been observed to occur between two and four weeks after being moved into a different light
environment, therefore, the gene expression at the four-week point will be used to answer both
research questions as that is also the time point that the phenotype data was measured (PBP
absorption spectra; Figure 1; Heidenreich and Richardson, 2020; Spangler et al., 2022;
Richardson 2022).
11
Chapter 2
Materials and Methods
Medium Preparation
Filtered sea water, Imagitarium Pacific Ocean Water, was obtained from the local pet
store and used to prepare the medium. The medium was prepared following the L1 + NH4Cl
instructions of the National Center for Marine Algae Microbiota (NCMA) at Bigelow Laboratory
(Guillard and Hargraves, 1993; Hallegraeff et al., 2003).
Stock Cultures
Stock cultures were grown in a Percival incubator at 15.0°C on a 12:12 hour light:dark
cycle of ~30 µmol photons · m-2 · s-1 photosynthetically active radiation (PAR) as measured by a
StellarNet BLACK-Comet UV-VIS Spectrometer (Tampa, FL; www.stellarnet.us). All stock
cultures were grown in 100 mL screwcap bottles with 60mL of culture in each and were swirled
by hand every other day. Transfers were done every two weeks (14 days).
Study Design
There were two different light environments being compared to full-spectrum: green-light
and red-light. Full-spectrum light (~400-700nm) (Figure 2), green-light (~500-600nm) (Figure
3), and red-light (~600-700nm) (Figure 4) environments were setup in a Percival AL-30L2C8
algae chamber with SB4X LED lighting.
12
Figure 2. Wavelength of light in Percival incubator under full-light
Figure 3. Wavelength of light in Percival incubator under green-light
13
Figure 4. Wavelength of light in Percival incubator under red-light
Algae cultures were grown in full-light and then shifted to green-light or red-light. Before
experimental cultures were started, a cell count was performed to determine the beginning cell
count for each bottle. A total of 65,000 cells were transferred for each replicate grown in a
250mL screwcap bottle with 150ml of algae culture. There were six replicates grown under full
spectrum light for two weeks and were then transferred to the green-light environment for eight
weeks with transfers occurring every two weeks. Two weeks after the green-light environment
experiment was completed, a new set of six replicates was started in full spectrum light for two
weeks and then moved to the red-light environment for six weeks. The red-light replicates were
transferred at the same time points as they were in the green-light environment. All light
environments were kept at a temperature of ~15.0°C on a 12:12 hour light:dark cycle of ~30
µmol photons · m-2 · s-1 PAR that was measured with a StellarNet BLACK-Comet UV-VIS
Spectrometer. All replicates for each light environment were swirled by hand every other day to
minimize self-shading.
14
Figure 5. Setup of 6 replicates of H. cryptochromatica CCMP 1181 for the green- and red-light environments.
Top shelf with full spectrum light are stock cultures.
Cell Counts
Cells counts were performed every two weeks before each culture transfer. To obtain the
average cell count, two MKT-7.5.3-L-120|Rev| hemocytometer slides were used, which resulted
in 4 grids being used to obtain an average cell count. Therefore, 15µL of algae culture was
collected from 4 of the 6 bottles of algae, each bottle chosen at random, to place onto each grid.
Once each grid was loaded with 15µL of algae culture the slides were left to sit for 30 minutes to
allow the algae to stop moving. Then, algae cells were counted using 500x magnification and a
LSM 5 Pascal microscope. This was repeated for the three remaining grids. After each grid was
counted, an average of the total number of cells was calculated and multiplied by 10,000. This
number was used to determine how much algae culture needed to be transferred for the starting
cell count to be 65,000. To calculate growth rate, the following formula was used:
μ = ln(N2/N1)/(t 2 − t 1), with N2 and N1 are the cell concentrations at time point one (t1) and time
point two (t2), respectively (Krzemińska et al., 2014). The natural log of the starting
concentration of cells divided by the concentration taken after two weeks was calculated, and
then divided by the number of days that the second count was taken minus the number of days
15
the first count was taken, which was essentially 14 (days) for each equation (the number of days
between each cell count).
RNA Extraction
The method of RNA extraction was developed for cryptophytes in the Dudycha lab by
Rachel Schomaker at the University of South Carolina and is detailed below (Schomaker, 2022).
Step 1: Preparing the Pellets
Prior to each RNA extraction, 100% isopropyl alcohol, chloroform, 75% EtOH, and
DEPC Treated Water were all prepared and placed on the work bench. A heat bath was set to
56°C and an incubator was set to 40°C. Each replicate had a portion of algae culture transferred
to new media that was placed back into the Percival incubator and the remaining culture was
used for the RNA extraction. The first step was to transfer the algae culture into 150mL
centrifuge bottles and to spin them down in a Beckman Coulter Allegra™ 25R Centrifuge with a
TA-10.250 rotor at 6,000 RPM and 15°C for 30 minutes. While this was running, six empty
microcentrifuge tubes were weighed using a precision balance. Once the bottles were finished
spinning, the excess media was drained, and the remaining media and the pellet were transferred
into pre-weighed microcentrifuge tubes. These tubes were then spun down at 5,000 RPM and
15°C for 10 minutes using an Eppendorf Centrifuge 5430 R with a FA-45-24-11-HS rotor. After
this was complete, the tubes were kept on ice as the excess media was drained and the
microcentrifuge tubes were reweighed to obtain the weight of the pellet. This was done by
subtracting the initial weight of the tube from the weight taken with the pellet.
16
Step 2: Homogenizing
Next, 1,000µL of Trizol/Purezol reagent was added to each tube where the pellet
weighed more than 50mg, or 500µL of Trizol/Purezol reagent was added to each tube where the
pellet weighed less than 50mg. The pellet was then lysed in the Trizol/Purezol reagent by gently
pipetting up and down until the pellet was broken down.
Step 3: Phase Separation
Tubes were then incubated for five minutes at room temperature. After the five minutes,
200µL of chloroform was added to each tube per 1,000µL of Trizol/Purezol reagent that was
previously added. If only 500µL of Trizol/Purezol reagent was added, only 100µL of chloroform
was added. Each tube was then closed and mixed by inversion, and then allowed to incubate at
room temperature for another five minutes. Tubes were then centrifuged at 12,000 RPM at 4°C
for 15 minutes. Once this was complete, there was a clear aqueous layer at the top of the tube
that was carefully removed and placed into a new microcentrifuge tube.
Step 4: RNA Precipitation
Once the aqueous layer was transferred from the tube, 500µL of 100% isopropanol was
added to each tube, per 1,000µL of Trizol/Purezol reagent. If only 500µL of Trizol/Purezol
reagent was added, only 250µL of 100% isopropanol was added. Tubes were closed, mixed by
inversion, and then incubated at room temperature for 10 minutes. Following the 10-minute
incubation, the tubes were centrifuged at 12,000 RPM at 4°C for 15 minutes once again.
Step 5: RNA Wash
The next step taken was washing the RNA pellet. For each tube, the excess supernatant
was removed. Next, 1,000µL of 75% EtOH was quickly added to the tube per 1,000µL of
17
Trizol/Purezol reagent that was previously added. If only 500µL of Trizol/Purezol reagent was
added, only 500µL of 75% EtOH was added. The pellet was dislodged from the tube wall by
tapping the tube. All tubes were then centrifuged at 7,500 RPM at 4°C for five minutes. After
this first cycle was complete, the supernatant was once again removed and 75% EtOH was then
added again for a second wash. For the second wash, the tubes were centrifuged for seven
minutes instead of five minutes. After the second wash was done, the supernatant was removed
from each tube, leaving only the pellet, and the tubes were placed in a 40°C incubator for 10
minutes to dry the pellet. If the pellet was not dry with a slightly translucent color after 10
minutes, it was placed back into the incubator at two-minute intervals until it was dry.
Step 6: RNA Suspension
Once the pellets were dry, they were removed from the incubator and 40µL of
RNase/nuclease free water was added to each tube and the pellet was gently resuspended in the
water by pipetting up and down. After the pellets were resuspended, they were placed in a 56°C
heat bath to incubate for 5 minutes or until the pellet was thoroughly mixed in with the
RNase/nuclease free water. If the pellet was still mostly solid after 5 minutes, the tube was
placed back into the heat bath to incubate at five-minute intervals until the desired state.
Step 7: Nanodrop Test for Purity
After all tubes were removed from the heat bath, they were each tested on a nanodrop to
determine concentration and 260/280 and 260/230 purity. Purity values of 1.7 or higher were
classified as usable samples. All usable samples were then placed into a -80°C freezer (Table 2).
Table 2. Concentration and purity levels for RNA samples used in RT-qPCR.
Sample ID
Light Environment
Concentration (ng/µL)
18
A260/280 A260/230
Weeks in Light Environments
29
Full
164
1.95
2.05
2
30
Full
213
1.99
1.85
2
32
Full
103
2.08
2.15
2
33
Full
103
1.97
1.91
2
41
Green
163
1.92
1.92
2
43
Green
78.7
1.87
1.95
2
44
Green
130
1.95
1.94
2
46
Green
96
1.92
2.12
2
53
Green
159
1.97
1.84
4
54
Green
143
1.96
2.11
4
55
Green
145
1.95
2.19
4
58
Green
129
1.94
2.17
4
66
Green
144
1.94
2.07
6
68
Green
139
1.94
2.02
6
69
Green
128
1.99
1.82
6
70
Green
84.7
1.93
2.03
6
77
Green
189
1.95
1.98
8
79
Green
127
1.94
1.87
8
81
Green
189
1.98
1.96
8
19
89
Full
206
1.98
1.97
2
91
Full
305
2.04
2.19
2
92
Full
252
2
2.39
2
93
Full
353
2.04
2.32
2
101
Red
219
1.96
1.76
2
102
Red
185
1.95
1.98
2
103
Red
271
2.02
2.19
2
106
Red
254
1.96
1.99
2
113
Red
210
1.94
1.95
4
114
Red
183
1.94
1.9
4
115
Red
173
1.97
2.1
4
118
Red
160
1.95
2.12
4
122
Red
175
1.93
1.93
6
123
Red
97.3
1.95
2.09
6
124
Red
88.7
1.91
1.96
6
Primer Design
The genes of interest, the PBP β-subunit, oxidoreductases PebA and PebB, and lyase
CPES, were chosen from previous studies (Overkamp et al., 2014; Spangler et al. 2022) with
Guillardia theta. A manual search for amino acid sequences was conducted on NCBI using key
20
words and taxonomic classification. After locating and downloading the amino acid sequences
from NCBI for the genes of interest, we performed NCBI BLAST (National Center for
Biotechnology Information, 2022) searches of H. cryptochromatica (CCMP 1181)
transcriptomes sequenced by the Department of Energy (DOE) Joint Genome Institute (JGI). We
searched four transcriptome assemblies. The transcriptome data consisted of RNA samples
extracted in the Dudycha lab at The University of South Carolina from H. cryptochromatica
(CCMP 1181) after spending four weeks in full-light, red-light, green-light, and blue-light. DOE
Joint Genome Institute assembled a transcriptome based on al RNA samples using Trinity
(Grabherr et al., 2011). We also assembled separate transcriptomes from the full-light, red-light,
and green-light using RNASPADES (Bushmanova et al., 2019). Identified transcripts were
extracted and then verified using online NCBI BLAST and the nonredundant protein database to
ensure that they matched the target genes. Once this was completed, primers were designed using
the nucleotide sequences and the IDT primer tool online (https://www.idtdna.com/pages; Table
3).
Table 3. Forward and Reverse primer pair sequences for genes of interest observed in RT-qPCR.
Target
β-Subunit
CPES
5’ – 3’ Sequence
Primer
Beta_Full_NODE_2745 FWD
GTTGGTGGTGCTGACTTACA
Beta_Full_NODE_2745 REV
ACCAGAAACAGCGTCAGATAC
Lyase_Green_NODE_20 FWD
TAGTCGGTCTGGAGGATGAAT
Lyase_Green_NODE_20 REV
GAGACAACGGGTAGGCTTTAC
PEBa_Reductase_Isos FWD
CAAGCCAGGAGTGATTGAGAG
21
PebA
PebB
PEBa_Reductase_Isos REV
CCGAGGGTATATAACGCAGTTG
PEBb_reductase FWD
GGTGCTCAACTTTGTCATGTTC
PEBb_reductase REV
GATGGTCGATGACGATCAGATG
Primer Optimization
All primers were optimized using the following thermal cycling protocol: polymerase
activation was set at 95°C for 30 seconds, denaturation was set to 95°C for 15 seconds, and
annealing temperature was set to 60 - 63° annealing temperature for 30 seconds. The annealing
temperature was adjusted for each gene based on the melt curve: PebB and the β-subunit had a
60° annealing temperature, while CPES and PebA had a 63° annealing temperature. Primers
were classified as optimized when the efficiency fell between 90 - 110% and the R2 value was ≥
0.98. PebB and the β-protein subunit were optimized using a 5-fold dilution series, while CPES
and PebA were optimized using a 3-fold dilution series. It should be noted that PebA had two
series that only had two replicates. Primer concentrations, efficiencies, and R2 values were
recorded and listed in Table 4.
Table 4. Results of primer optimization for each gene with the concentration level that each set was run at.
Gene Target
F/R Primer Concentration (µM)
Efficiency (%)
R2
β subunit
75µM
94.2
0.991
CPES
325
104.2
0.992
PebA
350
95.1
0.993
22
PebB
375
102.3
0.996
RT-qPCR
Following primer optimization, all RNA samples were converted to cDNA. In order to
standardize concentration of RNA samples being used for RT-qPCR, all RNA samples were
measured using Qubit RNA Broad Range (BioRad; Hercules, California) and then diluted to 25
ng/µL before being converted into cDNA. All RNA samples were converted into cDNA using
iScript cDNA Synthesis Kit (BioRad; Hercules, California). After all RNA samples were
converted to cDNA, each gene was run on a separate 96 well plate. There were four biological
replicates used for each time point (two weeks in full light, two weeks in green-light, four weeks
in green-light, six weeks in green-light, and eight weeks in green-light), with four technical
replicates per biological replicate. Each plate was set up the same way, but with the different
primers depending on which gene was being targeted. Lastly, RT-qPCR was completed using a
EvaGreen® Dye, 20X in Water mix (Biotium; Fremont, California) and a BioRad CFX96 RealTime PCR Detection System. All plates were run with the following thermal cycling protocol:
polymerase activation was set at 95°C for 30 seconds, denaturation was set to 95°C for 15
seconds, and annealing temperature was set to 60 - 62° annealing temperature for 30 seconds.
This was repeated for 40 cycles and then a melt curve was performed to ensure no off-target
amplification occurred during the reaction.
Statistical Analysis
To study changes in gene expression, ΔCT values for each gene under each light
environment were calculated using the full-light ΔCT values. All data was transformed using
23
Log10 + 4.5 for statistical analyses. IBM SPSS Statistics (IBM 28.0.1.1 (15)) was used to run a
repeated measures ANOVA for the combined light environments and genes to determine if there
was a significant difference in gene expression over time between light environments. A
univariate ANOVA on each gene from each light environment was performed to determine how
gene expression changed between time periods. A Kolmogorov-Smirnov was used to test
normality and a Levene’s test was used to test homogeneity of error variance. The significance of
time was determined by a test of between-subjects effects, with a p-value less than or equal to
p=.005 demonstrating time had a significant impact on gene expression. In the repeated measures
ANOVA for green-light, PebB had a Levene’s p-value greater than p=.05, however, time had a
significance level of p=.001, suggesting that a type 1 error is not likely occurring in this
situation. Lastly, a Bonferroni Post Hoc test was used to test if there was any significant
difference between gene expression at each time point and under the different light
environments, with a p-value less than or equal to 0.05 showing a significant difference in gene
expression.
24
Chapter Three
Results
Growth Rates
Growth rates were calculated using the starting cell count and the cell count after two
weeks (14 days). For the green-light environment cultures, we found that after growing in full
light for two weeks the growth rate was -0.0007, after growing in green-light for two weeks the
growth rate was 0.0567, after four weeks days in green-light the growth rate was -0.0369, and
after six weeks days in green-light the growth rate was -0.1039. This demonstrates that there was
a spike in growth after being introduced into the green-light environment and around the four
week time point the growth began to decline (Figure 6). During the red-light experiment, the
growth rate was a bit abnormal and was not what was expected to be observed. After growing in
full light for two weeks the growth rate was -0.0042, after being moved and grown in red-light
for two weeks the growth rate was -0.0147, after four weeks in the red-light the growth rate was 0.0155, and after six weeks in red-light the growth rate was 0.0076. This demonstrates that after
the initial move from full-light to red-light, the algae experienced a decline in cell growth that
continued to decline past the acclimation period of four weeks and does not appear to increase
until after eight weeks in red-light (Figure 6).
25
Average Cell Counts of H. cryptochromatica
Under Green and Red Light
Average Cell Count
250
200
150
Green Light
100
Red Light
50
0
-50
0
2
4
Weeks
6
8
Figure 6. Cell growth of H. cryptochromatica (CCMP 1181) throughout green-light and red-light experiments. 0
weeks is the day algae cultures were moved from full-light to green or red-light environments.
RT-qPCR Statistical Analysis
Repeated Measures ANOVA: Green and Red-Light
The Tests of Between-Subjects Effects demonstrated that there was a significant effect
between gene expression and time for both the green and red-light environments (Table 5). The
Bonferroni Post Hoc test demonstrated there was a statistical difference in gene expression
between two weeks and four weeks, between four weeks and eight weeks, and between six
weeks and eight weeks while under green-light. For the red-light environment, there was
significant difference in gene expression between two weeks and four weeks and between two
weeks and six weeks. This shows that the β-subunit, CPES, PebA, and PebB are collectively
important because their gene expression changed over time under both light environments.
Table 5. Repeated measures of natural log-transformed data normalized to full-light for green and red-light
environments.
Source
df
26
MS
F
P
Green-Light Environment
(A) Between-Subject Effects
Intercept
Time
(B) Within-Subjects Effects
Sphericity Assumed
Greenhouse-Geisser
Huynh-Feldt
Lower-bound
1
3
19.456
.083
3312.377
14.114
< .001
.001
3
1.790
3
1
.359
.602
.359
1.078
118.426
118.426
118.426
118.426
< .001
< .001
< .001
< .001
1
2
10.601
.171
471.882
7.598
< .001
.023
3
1.238
1.920
1
.121
.294
.190
.364
26.547
26.547
26.547
26.547
< .001
< .001
< .001
.002
Red-Light Environment
(A) Between-Subject Effects
Intercept
Time
(B) Within-Subjects Effects
Sphericity Assumed
Greenhouse-Geisser
Huynh-Feldt
Lower-bound
Univariate ANOVA: β subunit in green-light
The β-subunit has an initial increase in expression after two weeks, but then decreases in
expression after four weeks (Figure 7a). Expression can be seen to slightly increase again after
six weeks, and expression is significantly higher after eight weeks (Figure 7a). There was a
significant difference in expression of the β-subunit between four weeks and eight weeks and
between six weeks and eight weeks under red-light (Figure 7a).
Univariate ANOVA: CPES in green-light
CPES initially decreased in expression after two weeks and continued to decrease after
four weeks (Figure 7b). Expression then began to increase after six weeks and continued to
increase after eight weeks (Figure 7b). There was a significant difference in expression of CPES
between two weeks and four weeks and between four weeks and eight weeks (Figure 7b).
27
Univariate ANOVA: PebA in green-light
Gene expression of PebA had an initial increase after two weeks and then was seen to
decrease after four weeks (Figure 7c). Expression slightly increased after six weeks and
continued to increase after eight weeks (Figure 7c). However, there was no significant change in
gene expression between any of the time points.
Univariate ANOVA: PebB in green-light
PebB had an initial increase in expression after two weeks, but then significantly
decreased after four weeks (Figure 7d). After six weeks, expression was increased and continued
to increase after eight weeks (Figure 7d). There was a significant difference in gene expression
between two weeks and four weeks, between four weeks and six weeks, and between four weeks
and eight weeks (Figure 7d).
Figure 7. Change in gene expression over time for (a) β-subunit, (b) CPES, (c) PebA, and (d) PebB in green-light,
normalized from full-light.
signifies time points with significant change and * signifies level of significance,
where * is p ≤ 0.05 and ** is p ≤ 0.01.
28
Univariate ANOVA: β subunit in red-light
The β-subunit has an initial decrease in gene expression after two weeks in red-light and
then it started to increase after four weeks and continued to increase at six weeks (Figure 8a).
However, there was no significant change in gene expression between each time point (Figure
8a).
Univariate ANOVA: CPES in red-light
Gene expression was down after two weeks in red-light but was majorly increased after
four weeks in red-light (Figure 8b). Expression can then be seen to begin to decrease again after
six weeks (Figure 8b). The change in gene expression was significant between two weeks and
four weeks and between two weeks and six weeks (Figure 8b).
Univariate ANOVA: PebA in red-light
PebA expression had an initial decrease after two weeks but was significantly increased
after four weeks (Figure 8c). Gene expression continued to increase after six weeks (Figure 8c).
There was a significant change in PebA expression occurred two weeks and four weeks and
between two weeks and six weeks (Figure 8c).
Univariate ANOVA: PebB in red-light
PebB can be seen to initially decrease expression after two weeks, but then expression
began to increase after four weeks before decreasing again after six weeks (Figure 8d). However,
there was no significant change in gene expression between time points (Figure 8d).
29
Figure 8. Change in gene expression over time for (a) β-subunit, (b) CPES, (c) PebA, and (d) PebB in red-light,
normalized from full-light.
signifies time points with significant change and * signifies level of significance,
where * is p ≤ 0.05 and ** is p ≤ 0.01.
30
Chapter Four
Discussion
Phenotypic plasticity is known to be the ability of one genotype to express a variety of
phenotypes in different environments (Gratani, 2013). These variations in phenotypes can be
seen in an organism’s behavior, morphology, or physiology (Price et al., 2003; Gratani, 2013). It
is also known that phenotypic plasticity responses can be considered a continuous response or a
discrete switch response (Roff, 1996; Windig et al., 2004; Whitman and Agrawal, 2009). Many
phenotypic plasticity responses that are induced by environmental changes are active, meaning
there are multiple genes involved in the process that act at different levels (Whitman and
Agrawal, 2009). Therefore, it is important to look at multiple different genes when studying
phenotypic plasticity responses and understand that more than one gene is likely responsible. In
this study, the change in gene expression of the β-subunit, CPES, PebA, and PebB were observed
to determine what role, if any, they play in this response in green and red-light environments.
Hemiselmis cryptochromatica (CCMP 1181) is a strain of algae that has been shown to
display a phenotypic plastic response when exposed to different light environments (Heidenreich
and Richardson, 2020; Richardson, 2022). This response is a shift in its maximum peak
wavelength absorption (Figure 1). The purpose of this study was to answer the following two
questions: (1) Do changes in gene expression of photosynthetic genes stabilize after the
acclimation period in different light environments? (2) Is the change in maximum peak
wavelength absorption due to the change in expression of these four photosynthetic genes (βsubunit, CPES, PebA, and PebB)? The repeated measures ANOVA tests were used to answer
question one, while the univariate ANOVA tests were used to answer question two.
31
Do changes in gene expression of photosynthetic genes stabilize after the acclimation period in
different light environments?
The acclimation period for cryptophytes introduced into a new light environment has
been observed to be between two and four weeks (Spangler et al., 2022; Richardson, 2022).
Therefore, we were interested in understanding if gene expression changes over time, up to and
after the acclimation period. Does gene expression have an initial change that then stabilizes over
time, or does it continue to change even after the acclimation period? The phenotype data we
have for H. cryptochromatica (CCMP 1181) is based on characterization of the PBP absorption
after four weeks in a different light environment. Therefore, to answer this question, the change
in gene expression leading up to and after four weeks was analyzed in this study. The original
hypothesis was that the change in gene expression of the four photosynthetic genes being studied
would not be continuous after the acclimation period. Therefore, it was expected that gene
expression levels measured after four weeks would have little or no change. In the case of H.
cryptochromatica (CCMP 1181), the gene expression stabilized in the red-light environment, but
not the green-light environment. The repeated measures ANOVA showed there was a significant
difference in gene expression of all four photosynthetic genes from four weeks to eight weeks,
and from six weeks to eight weeks while under green-light. This demonstrates that there was a
significant change in gene expression occurring after the acclimation period of four weeks under
green-light. While under red-light, there was not a statistically significant difference in gene
expression of any of the four genes from four to six weeks. This demonstrates that the change in
gene expression was not statistically significant after the acclimation period of four weeks while
growing under red-light. Together, these data suggests that the change in gene expression of
32
photosynthetic genes over time under different light environments in H. cryptochromatica
(CCMP 1181) does not stabilize after the acclimation period, rejecting the original hypothesis. A
future study to expand on this question, could be to characterize H. cryptochromatica’s (CCMP
1181) phenotype (PBP absorption) every two weeks and up to at least eight weeks followed by a
shift back into a full-light environment.
Do the β-subunit, CPES, PebA, and PebB genes play a role in H. cryptochromatica’s (CCMP
1181) ability to shift its maximum peak wavelength absorption under different light
environments?
The hypothesis for the β-subunit was that it would not demonstrate a change in gene
expression when H. cryptochromatica (CCMP 1181) was moved to new light environments. This
study found that while in the red-light environment, the β-subunit doesn’t appear to have an
important role in the shift in maximum peak wavelength absorption. There was no significant
change in gene expression between any of the time points throughout the experiment (Figure 5a).
However, in the green-light environment, the β-subunit did show a significant change in gene
expression between four weeks and eight weeks and six weeks and eight weeks (Figure 4a). The
increased gene expression after four weeks demonstrates that there is an upregulation of the βsubunit necessary for H. cryptochromatica (CCMP 1181) long-term acclimation to the greenlight environment. Gene expression begins to increase at two weeks, but is not significantly
different from gene expression at four weeks, indicating that acclimation was completed between
two to four weeks. This corresponds with Spangler et al. (2022) and Heidenreich and Richardson
(2020) observing a shift in wavelength absorption in H. pacifica and H. cryptochromatica
(CCMP 1181), respectively, after two to four weeks. Gene expression continue to increase up to
the end of the experiment at eight weeks (Figure 4a). This suggests that H. cryptochromatica
33
(CCMP 1181) may require an increase in PBPs to sustain the pronounced peak wavelength
absorption at 569nm observed in green-light (Heidenreich and Richardson, 2020; Richardson,
2022). This is supported by the increase in PBP concentration found in P. sulcata and H. pacifica
by Spangler et al. (2022) supports this data. These data reject the initial hypothesis that the βsubunit would not demonstrate a change in gene expression when moved to different light
environments.
For CPES, the hypothesis stated that it would demonstrate a change in gene expression
when H. cryptochromatica (CCMP 1181) was moved to new light environments. CPES, as
previously stated, is an S/U type lyase involved in binding bilins to the β-subunit. We know that
the three sites on the β-subunit that bilins bind to are Cys-50,61, Cys-82, and Cys-158
(Richardson 2022). It is likely that the site CPES is binding bilins to is Cys-82, because S/U type
lyases are known to bind bilins to the Cys-84 site on β-subunits (Zhao et al., 2007; Zhao et al.,
2006; Saunée et al., 2008; Kronfel et al., 2013; Overkamp et al., 2014; Zhao et al., 2017). This
can also be supported by a study that hypothesized that CPES in G. theta likely binds PEB to the
Cys-82 site (Weithaus et al., 2010; Tomazic et al., 2021). In this study, CPES had a significant
change in gene expression under both red and green-light environments. In the red-light
environment, CPES had an initial decrease in expression after two weeks but was observed to be
upregulated after four weeks, which demonstrates that increased CPES expression may be
important for acclimation (Figure 5b). On the other hand, in the green-light environment CPES
was observed to be downregulated after two weeks and continued to decrease in expression until
the four-week acclimation point (Figure 4b). It has been observed that under red-light H.
cryptochromatica (CCMP 1181) has two peaks of wavelength absorption, with the dominant
peak being at 625nm. Therefore, the data suggests that CPES is the lyase needed to bind bilins to
34
their appropriate attachment site (β-Cys-82) to produce the maximum absorption peak at 625nm
due to the upregulation observed under red-light but is not the lyase needed to produce the peak
at 569nm in green-light. Furthermore, the data also indicates that H. cryptochromatica (CCMP
1181) could have two types of lyases involved with attaching bilins to their necessary sites and
the lyase needed to produce the peak at 569nm is still unknown. CPES has opposite expression
changes under green and red-light, this may be due to a proportion of CPES is associated with
the 625nm peak being secondary in green-light and dominant in red-light. These data support the
initial hypothesis that CPES would demonstrate a change in gene expression when moved to
different light environments.
The PebA gene was hypothesized to not demonstrate a change in gene expression when
H. cryptochromatica (CCMP 1181) was moved to new light environments. This study showed
that the change in PebA expression was only significant in the red-light environment. Under the
green-light PebA gene expression fluctuated between each time point before returning to the
initial increase in expression seen at two weeks but didn’t have any significant change at four
weeks or beyond that (Figure 4c). However, under red-light PebA was observed to decrease
expression after two weeks before being significantly upregulated at the acclimation mark of
four weeks (Figure 5c). We know that PebA is an oxidoreductase that produces bilin DBV,
which has an absorption range of 605-670nm (Frankenberg et al., 2001; Dammeyer and Dinkel,
2006; Overkamp et al., 2014). Since DBV has an absorption range of 605-670nm, this suggests
that more DBV bilins would be needed to produce the dominant maximum absorption peak of
625nm in H. cryptochromatica (CCMP 1181) under red-light. This also is further supported by
the observation that there was no change in expression of PebA at four weeks observed in the
green-light environment. We know that H. cryptochromatica (CCMP 1181) has a dominant
35
absorption peak at 569nm under green-light, so there would not be a need for more DBV to be
produced because it doesn’t absorb within the same wavelength range. Based on this data, we
can reject our hypothesis that PebA would not demonstrate change in gene expression under
different light environments.
Lastly, PebB had an initial hypothesis that it would demonstrate a change in gene
expression when H. cryptochromatica (CCMP 1181) was moved to new light environments. In
this study, PebB demonstrated a significant change in gene expression under green-light, but not
under red-light. Under red-light PebB had an initial drop in expression at two weeks and then
slightly increased at the acclimation mark of four weeks, but it is still downregulated from fulllight (Figure 5d). This could be because the bilin PebB is producing may not be needed for the
second peak at 625nm. However, there is not significant change occurring over time in red-light.
Whereas, in green-light PebB expression was seen to increase after two weeks, but then
decreases expression at four weeks to approximately full-light expression values (Figure 4d).
Under green-light the absorption peak for H. cryptochromatica (CCMP 1181) is 569nm, which is
the same dominant peak while under full-light, however it is much more dominant under greenlight (Figure 1) (Heidenreich and Richardson, 2019). This data suggests that PebB is likely not a
key player in the shift in maximum wavelength peak absorption in green light at the four-week
mark (acclimation period). PebB is an oxidoreductase that converts DHBV into bilin PEB in
cryptophyte Guillardia theta (Frankenberg et al., 2001; Dammeyer and Dinkel, 2006; Overkamp
et al., 2014). While it has been suggested that H. cryptochromatica (CCMP 1181) contains PBP
Cr-PC 569 or Cr-PC 630, the PBP bilins for H. cryptochromatica (CCMP 1181) has still not
been characterized (Richardson, 2022). Therefore, the presence of bilin PEB and the purpose of
PebB in H. cryptochromatica (CCMP 1181) is not yet known. Therefore, this data does not
36
support the initial hypothesis that PebB would demonstrate a change in gene expression when
moved to different light environments.
An alternative hypothesis for the PBP double peak
Another potential explanation for the two maximum peak wavelength absorptions
observed in H. cryptochromatica (CCMP) is that it may contain more than one PBP type. It has
been previously suggested that cryptophytes have only one form of the phycobiliproteins (PBP)
that is used in the light-harvesting complex (Bogorad, 1975; Gieskes and Kraay, 1983; Jeffrey
and Vesk, 1997; Heidenreich and Richardson, 2020). However, it has been suggested that
because the bonds between bilins and the cysteine attachments sites are very strong, it would be
very difficult to break them to replace the bilin that is attached (B. Green, communicated to
Richardson; Richardson, 2022). Furthermore, a study completed by Rathbone et al. (2021)
isolated proteins that make up the light harvesting antenna of Hemiselmis andersenii to
determine their high-resolution crystal structure. They found that there were three spectrotypes
with peaks, the first was a dominant peak at 551±2 nm, the second was a peak at 562±2 nm, and
a third was a small secondary peak at 645±2 nm (Rathbone, 2021; Richardson, 2022). These
findings suggest that there may be more than one PBP present in cryptophytes of the genus
Hemiselmis (Richardson, 2022). Therefore, H. cryptochromatica (CCMP) may have two PBPs,
one that is responsible for the peak at 569nm under full and green-light and a second that is
responsible for the peak at 625nm and the proportion of the two PBPs change in different light
environments.
37
Future Directions
Although, we suggest that CPES and PebA are likely driving the shift in absorption in
red-light, the genes responsible for the pronounced peak in green-light are still be unknown in H.
cryptochromatica (CCMP 1181). In order to further the study of phenotypic plasticity in
cryptophytes we suggest four future avenues of inquiry. The first avenue of inquiry could be to
determine if there are any other lyases involved with binding bilins to the β-subunits and the
other genes involved in biosynthesis of bilins. The first step in identifying other lyases and
oxidoreductases could begin by performing an in-depth RNAseq experiment. Second, because
the bilins in H. cryptochromatica (CCMP 1181) haven’t been characterized, it’s important to
determine which bilins are attached at each site. Furthermore, it would be important to determine
characterize the bilins that are bound to the three β-subunits sites while under full-light, red-light
and green-light environments. Thirdly, repeating this experiment for a longer time period
because of the continued change in expression observed after eight weeks in green-light. Lastly,
a future avenue to continue this work would be to collaborate with Dr. Tammi Richardson at the
University of South Carolina to produce absorbance spectra for H. cryptochromatica (CCMP
1181) and other cryptophytes for every two weeks for at least eight weeks while performing
RNA seq to determine what the other genes are involved in phenotypic plasticity. Concurrently,
a collaboration with a researcher who can characterize the bilins would enable us to fully
understand this phenotypic plasticity response in cryptophyte algae.
Conclusion
The changes in gene expression of the photosynthetic genes in this study were generally
found to be static between four and six weeks, but at eight weeks (green-light) significant
changes occur suggesting that the phenotype may be more variable than what is currently known
38
for H. cryptochromatica (CCMP 1181). The β-subunit and PebB are likely not responsible for
the shift in the dominant maximum peak wavelength absorption demonstrated by H.
cryptochromatica (CCMP 1181). The increase in the β-subunit in green-light is likely due to an
increase in PBP concentration needed for acclimation to new light environment, similar to the
findings from Spangler et al. (2022). As for PebB, there was no change in expression from fulllight to green-light, indicating that no change is needed for H. cryptochromatica (CCMP 1181)
to acclimate to green-light. While under red-light, PebB had no significant change between any
time periods during H. cryptochromatica’s (CCMP 1181) acclimation to red-light. CPES and
PebA, on the other hand, appear to be important to the shift in absorption under red-light. Based
on the expression presented here, we suggest that CPES is upregulated to bind DBV to site Cys82 on the β-subunit to produce the dominant peak at 625nm. This specific binding of CPES is
supported by Overkamp et al. (2014) that found that S/U type lyases only bind DBV and PEB
bilins to chromophores and Richardson (2022) that pointed out that DBV is conserved at the
position of site Cys-50,61 on the β-subunit in all characterized PBPs in the genus Hemiselmis.
Here we suggest that PebA is upregulated in red-light to produce more DBV and that the peak at
625nm is due to CPES binding DBV to both the Cys-82 and Cys-50,61 sites of the β-subunit.
Furthermore, DBV has an absorption range between 605-670nm, which better matches a redlight environment. While the dominant absorption peak under green-light is the same wavelength
for full-light, this peak is much more pronounced and the genes responsible lay outside the scope
of this study. We conclude that the shift in green-light, requires another lyase and
oxidoreductase.
39
Literature Cited
Adir, N. (2005). Elucidation of the molecular structures of components of the phycobilisome:
reconstructing a giant. Photosynth Res. 85, 15-32
Apt, K.E., Collier, J.L., & Grossman, A.R. (1995). Evolution of the phycobiliproteins. J. Mol. Biol. 248,
79 – 96.
Blot, N., Wu, X.J., Thomas, J.C., Zhang, J., Garczarek, L., Böhm, S., Tu, J.M., Zhou, M., Plöscher, M.,
Eichacker, L., Partensky, F., Scheer, H., & Zhao, K.H. (2009). Phycourobilin in trichromatic
phycocyanin from oceanic cyanobacteria is formed post-translationally by a phycoerythrobilin
lyase-isomerase. J. Biol. Chem. 284, 9290-9298
Böhm, S., Endres, S., Scheer, H., & Zhao, K.-H. (2007). Biliprotein chromophore attachment:
chaperone-like function of the PecE subunit of α-phycoerythrocyanin lyase. J. Biol. Chem. 282,
25357-25366
Bogorad, L. (1975). Phycobiliproteins and complementary chromatic adaption. Annu. Rev. Plant
Physiol. 26, 369-401.
Bolte, K., Kawach, O., Prechtl, J., Gruenheit, N., Nyalwidhe, J., & Maier, U.G. (2008).
Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a
nucleomorph-encoded open reading from the cryptophyte Guillardia theta. BMC Plant Biol. 8,
56
Bushmanova, E., Antipov, D., Lapidus, A., & Prjibelski, A.D. (2019). rnaSPAdes: a de
novo transcriptome assembler and its application to RNA-Seq data. GigaScience. 8. 9, 1-13
40
Chang, L, Liu, X., Li, Y., Liu, C.C., Yang, F., Zhao, J., & Sui, S.F. (2015). Structural organization of an
intact phycobilisome and its association with photosystem II. Cell Research. 25, 726-737
Chen, Y.R., Su, Y.S., & Tu, S.L. (2012). Distinct phytochrome actions in nonvascular plants revealed by
targeted inactivation of phytobilin biosynthesis. Proc. Natl. Acad. Sci. U.S.A. 109, 8310-8315
Cunningham, B.R., Greenwold, M.J., Lachenmyer, E.M., Heidenreich, K.M., Davis, A.C., Dudycha,
J.L., & Richardson, T.L. (2019). Light capture and pigment diversity in marine and freshwater
cryptophytes. J Phycol. 55, 552-64
Dammeyer, T., Bagby, S.C., Sullivan, M.B., Chisholm, S.W., & Frankenberg-Dinkel, N. (2008).
Efficient phage-mediated pigment biosynthesis in oceanic cyanobacteria. Curr. Biol. 18, 442-448
Dammeyer, T. & Frankenberg-Dinkel, N. (2006). Insights into phycoerythrobilin biosynthesis point
toward metabolic channeling. J. Biol. Chem. 281, 27081-27089
Douglas, S.E. (1992). Eukaryote-eukaryote endosymbiosis: insights from studies of a cryptomonad alga.
Biosystems. 28. 1-3, 57-68
Douglas, S.E., Zauner, S., Fraunholz, M., Beaton, M., Penny, S., Deng, L.T., Wu, X., Reith, M.,
Cavalier-Smith, T., & Maier, U.G. (2001). The highly reduced genome of an enslaved algal
nucleus. Nature. 410, 1091-1096
Ehrenberg, C. G. (1832). Über die Entwickelung und Lebensdauer der Infusionsthiere; nebst
ferneren Beiträgen zu einer Vergleichung ihrer organischen Systeme. Abhandlungen der
Ko¨niglichen Akademie der Wissenschaften Berlin, Physikalische Klasse, 1831, 1–154.
Fairchild, C.D. & Glazer, A.N. (1994). Oligomeric structure, enzyme kinetics, and substrate specificity
of the phycocyanins alpha subunit phycocyanobilin lyase. J Biol. Chem. 269, 8686-8694.
41
Fairchild, C.D., Zhao, J., Zhou, J., Colson, S.E., Bruant, D.A., & Glazer, A.N. (1992). Phycocyanin
alpha-subunit phycocyanobilin lyase. Proc Natl Acad Sco. USA 89, 7017-7021
Frankenberg, N., Mukougawa, K., Kohchi, T., & Lagarias, J.C. (2001). Functional genomic analysis of
the HY2 family of ferredoxin-dependent bilin reductases from oxygenic photosynthesis
organisms. Plant Cell 13, 965-978
Frankenberg-Dinkel, N. (2004). Bacterial heme oxygenases. Antioxid. Redox Signal. 6, 825-834
Gantt, E. & Conti, S.F. (1966). Phycobiliprotein localization in algae. Brookhaven Symp. Biol., 19, 393405
Gantt, E., Edwards, M.R., & Provasoli, L. (1971). Chloroplast structure of the Cryptophyceae: evidence
for phycobiliproteins within intrathylakoid spaces. J. Cell Biol. 48, 280-290
Gieskes, W.W.C. & Kraay, G.W. (1983). Dominance of Cryptophyceae during the phytoplankton spring
bloom in the central North Sea detected by HPLC analysis of pigments. Mar. Biol. 75, 179-85.
Glazer, A.N., & Wedemayer, G.J. (1995). Cryptomonad biliproteins – an evolutionary perspective.
Photosynthesis Research. 46, 93-105, 1995.
Gould, S.B., Fan, E., Hempel, F., Maier, U., & Klösgen, R.B. (2007). Translocation of a phycoerythrins
α subunit across five biological membranes. J. Biol. Chem. 282, 30,295 – 30,302.
Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L,
Raychowdhury R, Zeng Q, Chen Z, Mauceli E, Hacohen N, Gnirke A, Rhind N, di Palma F,
Birren BW, Nusbaum C, Lindblad-Toh K, Friedman N, Regev A. Full-length transcriptome
assembly from RNA-seq data without a reference genome. Nat Biotechnol. 2011 May
15;29(7):644-52. doi: 10.1038/nbt.1883. PubMed PMID: 21572440.
42
Gratani, L. (2014). Plant Phenotypic Plasticity in Response to Environmental Factors. Advances in
Botany. 2014, 1-17.
Greenwold, M.J., Cunningham, B.R., Lachenmyer, E.M., Pullman, J.M., Richardson, T.L., & Dudycha,
J.L. (2019). Diversification of light capture ability was accompanied by the evolution of
phycobiliproteins in cryptophyte algae. Proceedings. Biological sciences, 286(1902), 20190655.
Guillard, R. R. L. & Hargraves, P.E. (1993). Stichochrysis immobilis is a diatom, not a chrysophyte.
Phycologia. 32. 3, 234-236.
Hallegraeff, G.M., Anderson, D.M., & Cembella, A.D. (2003). Manual on Harmful Marine Microalgae.
Oceanographic Methodology. 2nd revised edition. 978-92-3-103871-6. UNESCO Publishing.
Harrop, S.J., Wilk, K.E., Dinshaw, R., Collini, E., Mirkovic, T., Teng, C.Y., Oblinsky, D.G., Green,
B.R., Hoef-Emden, K., Hiller, R.G., Scholes, G.D., & Curmi, P.M.G. (2014) Single-residue
insertion switches the quaternary structure and exciton states of cryptophyte light-harvesting
proteins. PNAS. 26, E2666-E2675.
Heidenreich, K.M., & Richardson, T.L. (2019). Photopigment, Absorption, and Growth Responses of
Marine Cryptophytes to Varying Spectral Irradiance. J. Phycol. 56, 507-520.
Hill, D.R.A. & Rowan, K.S. (1989). The biliproteins of the Crytophyceae. Phycologia 28, 455-63.
Hoef-Emden, K. (2008). Molecular phylogeny of phycocyanins-containing cryptophytes: evolution of
biliproteins and geographical distribution. J. Phycol. 44, 985-93.
Hoef-Emden, K., & Archibald, J.M. (2016). Cryptophyta (Cryptomonads). Handbook of Protists, DOI:
10.1007/978-3-319-32669-6_35-1.
43
Jeffrey, S.W. & Vesk, M. (1997). Introduction to marine phytoplankton and their pigment signatures. In
Jeffrey, S. W., Mantoura, R. F. C. & Write, S. W. [Eds.] Phytoplankton Pigments in
Oceanography: Guidelines to Modern Methods. UNESCO Publishing, Paris. Pp. 37-84.
Jenkins, J., Hiller, R.G., Speirs, J., & Godovac-Zimmermann, J. (1990). A genomic clone encoding a
cryptophyte α-subunit: evidence for three α-subunits and an N-terminal membrane transit
sequence. FEBS 273, 191-194.
Kahn, K., Mazel, D., Houmard, J., Tandeau, M.N.d., & Schaefer, M.R. (1997). A role for cpeYZ in
cyanobacterial phycoerythrins biosynthesis. J Bacteriol. 179, 998-1006
Kieselbach, T., Cheregi, O., Green, B.R., & Funk, C. (2018). Proteomic analysis of the phycobiliprotein
antenna of the cryptophyte alga Guillardia theta cultured under different light intensities.
Phytosynth. Res. 135, 149 – 163.
Kim, J.I., Moore, E.C., Archibald, J.M., Bhattacharya, D., Yi, G., Yoon, H.S., & Shin, W. (2017).
Evolutionary Dynamics of Cryptophyte Plastid Genomes. Genome Biol. Evol. 9. 7, 1859-1872.
Kim, J.I., Yoon, H.S., Yi, G., Kim, H.S., Yih, W., & Shin, W. (2015). The plastid genome of the
Cryptomonad Teleaulaz amphioxeia. PLoS One 10, e0129284.
Kronfel, C. M., Kuzin, A. P., Forouhar, F., Biswas, A., Su, M., Lew, S., Seetharaman, J., Xiao, R.,
Everett, J. K., Ma, L. C., Acton, T. B., Montelione, G. T., Hunt, J. F., Paul, C. E., Dragomani, T.
M., Boutaghou, M. N., Cole, R. B., Riml, C., Alvey, R. M., Bryant, D. A., & Schluchter, W. M.
(2013). Structural and biochemical characterization of the bilin lyase CpcS from
Thermosynechococcus elongatus. Biochemistry. 52. 48, 8663–8676.
44
Krzemińska, I., Pawlik-Skowrońska, B., Trzcińska, M., & Tys, J. (2014). Influence of photoperiods on
the growth rate and biomass productivity of green microalgae. Bioprocess Biosyst. Eng. 37. 4,
735-741
Kupka, M., Zhang, J., Fu, W.-L., Tu, J.-M., Böhm, S., Su, P., Chen, Y., Zhou, M., Scheer, H., & Zhao,
K.-H. (2009). Catalytic mechanism of S-type phycobiliprotein lyase chaperone-like action and
functional amino acid residues. J. Biol. Chem. 284, 36405-36414
Lane, C.E. & Archibald, J.M. (2008). New marine members of the genus Hemiselmis
(Cryptomonadales, Cryptophyceae). J. Phy-col. 44, 439-50.
Lin, X., Xu, Y., Jiang, J., Lavine, M., & Lavine, L. C. (2018). Host quality induces phenotypic plasticity
in a wing polyphenic insect. Proceedings of the National Academy of Sciences of the United
States of America, 115. 29, 7563–7568.
Ludwig, M., & Gibbs, S.P. (1989) Localization of phycoerythrin at the lumenal surface of the thylakoid
membrane in Rhodomonas lens. J. Cell Biol. 108, 875-884
MacColl, R. (1998). Cyanobacterial phycobilisomes. J. Struct. Biol. 124, 311-334.
Magalhães, K., Santos, A.L., Vaulot, D., & Oliveira, M.C. (2021). Hemiselmis aquamarina sp. nov.
(Cryptomonadales, Cryptophyceae), A Cryptophyte with A Novel Phycobiliprotein Type (Cr-PC
654). Protists. 172, 125832
McFadden, G.I. (2001). Primary and secondary endosymbiosis and the origin of plastids. Journal of
Phycology. 37. 6, 951-959
45
National Center for Biotechnology Information (NCBI)[Internet]. Bethesda (MD): National Library of
Medicine (US), National Center for Biotechnology Information; [1988] – [cited 2022 Oct 20].
Available from: https://www.ncbi.nlm.nih.gov/
Overkamp, K.E., Gasper, R., Kock, K., Herrmann, C., Hofmann, E., & Frankenberg-Dinkel, N. (2014).
Insights into the Biosynthesis and Assembly of Cryptophycean Phycobiliproteins. Journal of
Biological Chemistry. 289. 39, 26691-26707.
Price, T.D., Qvarnstrom, A., & Irwin, D.E. (2003). The role of phenotypic plasticity in driving genetic
evolution. Proceedings of the Royal Society B: Biological Sciences. 270, 1433-1440
Rathbone, H.W. (2021). Tracing the evolutionary history of the cryptophyte light harvesting antenna: a
structural perspective. PhD Thesis, School of Physics, UNSW, Sydney.
Rathbone, H.W., Michie, K.A., Landsberg, M.J., Green, B.R., & Curmi, P.M. (2021). Scaffolding
proteins guide the evolution of algal light harvesting antennas. Nature Communications. 12,
1890.
Richardson, T. (2022). The colorful world of cryptophyte phycobiliproteins. J. Plankton Res. (2022) 113
Roff, D.A. (1996). The evolution of threshold traits in animals. Quarterly Rev. Biol. 71, 3-35.
Saunée, N.A., Williams, S.R., Bruant, D.A., & Schluchter, W.M. (2008). Biogenesis of
phycobiliproteins: II. CpcS-I and CpcU comprise the heterodimeric bilin lyase that attaches
phycocyanobilin to CYS-82 of β-phycocyanin and CYS-81 of allophycocyanin subunits in
Synechococcus sp. PCC 7002. J Biol Chem. 283, 7513-7522
46
Scheer, H., & Zhao, K.H. (2008). Biliprotein maturation: the chromophore attachment. Mol. Microbiol.
68, 263-276
Schomaker, R. (2022). Cryptic cryptophytes: The plasticity in how cryptophytes response to changes in
resource availability. PhD Thesis, University of South Carolina.
Shen, G., Saunée, N.A., Williams, S.R., Gallo, E.F., Schluchter, W.M., & Bryant, D.A. (2006).
Identification and characterization of a new class of bilin lyase: the cpcT gene encodes a bilin
lyase responsible for attachment of phycocyanobilin in Cys-153 on the beta-subutnit of
phycocyanin in Synechococcus sp. PCC 7002. J Biol Chem. 281, 17768-17778
Shukla, A., Biswas, A., Blot, N., Partensky, F., Karty, J.A., Hammad, L.A., Garczarek, L., Gutu, A.,
Schluchter, W.M., & Kehoe, D.M. (2012). Phycoerythrin-specific bilin lyase-isomerase controls
blue-green chromatic acclimation in marine Synechococcus. Proc. Natl. Acad. Sci. U.S.A. 109,
20136-20141
Sidler, W.A. (1994). Phycobilisome and phycobiliprotein structures. In: Bryant DA, ed. The Molecular
Biology of Cyanobacteria. The Netherlands: Kluwer Academic Publishers. 1994, 139-216
Spangler, L.C., Mina, Y., Philip, J.D., & Scholes, G.D. (2022). Controllable Phycobilin Modification:
An Alternative Photoacclimation Response in Cryptophyte Algae. ACS Cent. Sci. 8, 340-350
Tomazic, N., Overkamp, K.E., Wegner, H., Gu, B., Mahler, G., Aras, M., Keller, S., Pierik, A.J.,
Hofmann, E., & Frankenberg-Dinkel, N. (2021). Exchange of a single amino acid residue in the
cryptophyte phycobiliprotein lyase GtCPES expands its substrate specificity. BBA –
Bioenergetics 1862. 148493
47
Vesk, M., Dwarte, D., Fowler, S. & Howler, R.G. (1992). Freeze-fracture immunocytochemistry of light
harvesting pigment complexes in a cryptophyte. Protoplasma. 170, 166-176
Wedemayer, G.J., Wemmer, D.E., & Glazer, A.N. (1991). Phycobilins of cryptophycean algae.
Structures of novel bilins with acryloyl substituents from phycoerythrin 566. J Biol Chem 266,
4731-4741
Wedemayer, G.J., Kidd, D.G., Wemmer, D.E., & Glazer, A.N. (1992). Phycobilins of cryptophycean
algae. Occurrence of dihydrobiliverdin and mesobiliverdin in cryptomonad biliproteins. J Biol
Chem 267, 7315-7331
Wemmer, D.E., Wedemayer, G.J., & Glazer, A.N. (1993). Phycobilins of cryptophycean algae. Novel
linkage of dihydrobiliverdin in a phycoerythrin 555 and a phycocyanin 645. J Biol Chem 268,
1658-1669
Whitman, D.W. & Agrawal, A.A. (2009). What is Phenotypic Plasticity and Why is it Important?
Phenotypic plasticity of insects: Mechanisms and consequences, 1-63.
Wiethaus, J., Busch, A.W., Kock, K., Leichert, L.I., Herrmann, C., & Frankenberg-Dinkel, N. (2010).
CpeS is a lyase specific for attachment of 3Z-PEB to Cys82 of beta-phycoerhthrin from
Prochlorococcus marinus MED4. J. Biol. Chem. 285. 48, 37561-37569
Wilks, A. (2002). Heme oxygenase: evolution, structure, and mechanism. Antioxid. Redox Signal. 4,
603-614
Windig, J.J., De Kovel, C.G.F., & De Jong, G. (2004). Genetics and mechanics of plasticity. Pp. 31-97
in T.J. DeWitt and S.M. Scheiner (eds). Phenotypic plasiticity: Functional and Conceptual
Approaches. Oxford University Press, Oxford.
48
Xue, B., & Leibler, S. (2018). Benefits of phenotypic plasticity for population growth in varying
environments. Proceedings of the National Academy of Sciences of the United States of
America, 115. 50, 12745–12750.
Zhao, K.H., Deng, M.G., Zheng, M., Zhou, M., Parbel, A., Storf, M., Meyer, M., Strohmann, B., &
Scheer, H. (2000). Novel activity of a phycobiliprotein lyase: both the attachment of
phycocyanobilin and the isomerization to phycoviolobilin are catalyzed by the proteins PecC and
PecF encoded by the phycoerythrocyanin operon. FEBS Lett. 469, 9-13
Zhao, K.H., Su, P., Li, J., Tu, J.M., Zhou, M., Bubenzer, C., & Scheer, H. (2006). Chromphore
attachment to phycobiliprotein β-subunits: phycocyanobilin: cysteine-beta84 phybiliprotein lyase
activity of CpeS-like protein from Anabaena Sp. PCC7120. J Biol Chem. 281, 8573-7522
Zhao, K.H., Su, P., Tu, J.M., Wang, X., Lui, H., Plöscher, M., Eichacker, L., Yang, B., Zhou, M., &
Scheer, H. (2007). Phycobilin: cysteine-84 biliprotein lyase, a near-universal lyase for cysteine84 – binding sites in cyanobacterial phycobiliproteins. Proc Natl Acad Sci US. 104, 14300-14305
Zhao, K.H., Zhang, J., Tu, J.M., Böhm, S., Plöscher, M., Eichacker, L., Bubenzer, C., Scheer, H., Wang,
X., & Zhou, M. 2(2007). Lyase activities of CpcS- and CpcT-like proteins from Nostoc
PCC7120 and sequential reconstitution of binding sites of phycoerythrocyanin and phycocyanins
beta-subunits. J Biol Chem. 282, 34093-34103
Zhou, W., Ding, W.L., Zeng, X.L., Dong, L.L., Zhao, B., Zhou, M., Scheer, H., Zhao, K.H., & Yang, X.
(2014). Structure and mechanism of the phycobiliprotein lyase CpcT. J Biol Chem. 289, 2667726689.
49