International Journal of Cosmetic Science, 2019, 41, 311–319
doi: 10.1111/ics.12538
Striae reconstructed, a full thickness skin model that recapitulates
the pathology behind stretch marks
M. Perez-Aso
, A. Roca, J. Bosch and B. Martınez-Teipel
Provital, S.A., Gorgs Llado 200, 08210 Barbera del Valles, Barcelona, Spain
Received 27 March 2019, Accepted 3 May 2019
Keywords: cell culture, genetic analysis, skin physiology/structure, stretch marks, full thickness reconstructed skin model
Abstract
OBJECTIVE: Stretch marks are disfiguring skin lesions that often
cause problems of self-esteem, but little effort has been put to
studying this pathology. We therefore analysed cell cultures of dermal fibroblasts isolated from a striae albae, to thereafter reconstruct
a full thickness skin model.
METHODS: Human Dermal Fibroblasts (HDF) were isolated from
a striae distensae (SD) lesion and from the adjacent non-lesioned
skin. The dermis of two full thickness skin models was reconstructed with either striae- or normal-HDF, while the epidermis
was in both reconstructed with Normal Human Epidermal Keratinocytes.
RESULTS: Main observations and pertinent data: Gene
expression analysis of cell cultures revealed a generalized decomposition of the Extra Cellular Matrix (ECM), since collagens type I
and III, lysyl oxidase (LOX), biglycan, lumican and fibronectin
were downregulated, while MMP3 was increased together with a
decrease of its natural inhibitors (TIMP1, TIMP2 and PAI-1).
These findings were statistically corroborated for key ECM elements at the protein level (COL1, MMP1 and TGFB1). Interestingly, striae albae fibroblasts retained a pro-inflammatory
phenotype, as suggested by increased gene expression of CXCL8,
HAS1 and TNFA. We next reconstructed a full thickness skin
model (Striae Reconstructed) with dermal fibroblasts from striae
albae. Gene expression analysis showed that the Striae Reconstructed elicited not only ECM decomposition, but also skin ageing,
as indicated by the upregulation of P16, PTGS2 and SOD2. Discussion points: Although the epidermis was constructed with
normal human epidermal keratinocytes, the Striae Reconstructed
presented epidermal atrophy and a dramatic increase of b1-integrin at the epidermal-dermal junction providing, for the first time
to our knowledge, a rationale showing that the key cell player
behind stretch marks are dermal fibroblasts rather than epidermal
keratinocytes.
CONCLUSION: New knowledge: Taken together, our findings
shed new light into the aetiology of stretch marks and indicate that
the Striae Reconstructed, a new model for in vitro testing and drug
Correspondence: Miguel Perez-Aso, Provital, S.A. Pol. Ind. Can Salvatella - c. Gorgs Llad
o, 200, 08210 Barber
a del Valles – Barcelona,
Spain. Tel.: +34 937192350; fax: +34 937190294; e-mail:
m.aso@provitalgroup.com
Part of the present work was presented at the IFSCC 2018 Munich congress.
screening, may open new avenues for the treatment of stretch
marks.
sume
Re
OBJECTIFS: Les vergetures sont des lesions cutanees defigurantes
qui posent souvent des problemes d’estime de soi, mais peu d’efforts
ont ete consacres dans l’etude de cette pathologie. Nous avons donc
analyse des cultures cellulaires de fibroblastes dermiques isoles d’un
stria alba, afin de reconstruire ensuite un modele de peau avec une
pleine epaisseur.
METHODES: Des fibroblastes dermiques humains (FDH) ont ete isoles d’une lesion de Stria distensae (SD) et d’une peau adjacente sans
lesion. Le derme de deux modeles de peau de pleine epaisseur a ete
reconstruit avec du HDF striae- ou normal, tandis que l’epiderme
etait reconstruit avec des keratinocytes humains normaux.
RESULTATS: Principales observations et donnees pertinentes:
L’analyse de l’expression genique de cultures cellulaires a revele une
decomposition generalisee de la matrice extra-cellulaire (MEC) car
les collagenes de types I et III, la lysyl oxydase, le biglycane, le lumican et la fibronectine etaient regules negativement, tandis que la
MMP3 augmentait ses inhibiteurs naturels diminuaient (TIMP1,
TIMP2 et PAI-1). Ces resultats ont ete corrobores statistiquement
pour les elements cles de la MEC au niveau de la proteine (COL1,
MMP1 et TGFB1). Il est interessant de noter que les fibroblastes de
Striae albae ont conserve un phenotype proinflammatoire, comme
le suggere l’augmentation de l’expression des genes de CXCL8,
HAS1 et TNFA. Nous avons ensuite reconstruit un modele de peau
de pleine epaisseur (Stria Reconstructed) avec des fibroblastes dermiques de Striae albae. L’analyse de l’expression genique a montre
que la reconstruction de Striae induisait non seulement la decomposition de la MEC, mais egalement le vieillissement de la peau,
comme l’indique la regulation a la hausse de P16, PTGS2 et SOD2.
Points de discussion : Bien que l’epiderme ait ete construit avec des
keratinocytes humains normaux, les stries reconstruites presentaient une atrophie epidermique et une augmentation spectaculaire
du taux de b1-integrine au niveau de la jonction epidermo-dermique, fournissant pour la premiere fois une explication rationnelle
qui demontre que les cellules principales impliquees dans la pathologie de la Striae sont les fibroblastes et non les keratinocytes.
CONCLUSION: Nouvelles connaissances: Ensemble, nos resultats
donnent une nouvelle lumiere sur l’etiologie des vergetures et indiquent que le Striae Reconstructed, un nouveau modele de test in vitro et de depistage du medicament, pourrait ^etre une avancee pour
le traitement des vergetures.
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
311
Striae reconstructed, a model for stretch marks
M. Perez-Aso et al.
Introduction
elective surgery. The cells were isolated by centrifugal force following enzymatic collagenase digestion. Cells isolated with this procedure were purchased from Zenbio (Zenbio Inc., Research Triangle
Park, NC, USA) and were grown in high-glucose DMEM-GlutaMax
medium (Gibco, Carlsbad, CA, USA), supplemented with 10% foetal
bovine serum (FBS), 1% penicillin/streptomycin and maintained at
95% humidity in 5% CO2 environment at 37°C.
Striae Distensae (SD) are common lesions which can pose a significant
psychological burden for patients [1] and are a very challenging cosmetic problem for dermatologists to treat [2]. SD are characterized by
linear, smooth bands of atrophic-appearing skin that are reddish at
first and finally white [3], which are two clinically and histopathologically distinguishable forms of SD: striae rubrae and striae albae [1].
Pregnancy, sudden weight gain, rapid growth and Cushing’s disease,
endogenous or steroid-induced are the most frequent causes of this
disease, while genetic factors are also involved. However, the precise
aetiology of SD is not fully known [3]. In this line, a number of aetiological theories have been postulated, including inadequate development of the skin (especially elastic fibres and collagen [1,4]),
mechanical stretching of the skin and endocrine imbalance [1]. The
lesions generally follow cleavage lines transverse to the direction of
greatest tension, occurring most commonly on the abdomen, buttocks and thighs, as well as in the inguinal region. Histologically, SD
show variously a thin, flattened epidermis, fraying and separation of
collagen bundles with dilatation of blood vessels, and/or separation
or total absence of elastic fibres.
Paradoxically, SD are a common cause of consultation for dermatologists but have somehow rarely been the subject of research
and thus, their mechanism of development remains still disputed
[5]. Analysis of skin biopsies shows that expression of collagen,
elastin and fibronectin fibres in SD is significantly reduced compared to normal skin [3,6–8]. In agreement, studies with cultures
of fibroblasts from SD indicate that these cells express lower levels
of collagen, elastin and fibronectin, that are functionally dormant
[9] and that show altered contractile forces [5]. It was therefore
hypothesized that persistent mechanical forces may induce local
damage of the skin structure, but permanent lesions occur only in
patients whose dermal fibroblasts are incapable of quick repair of
these stretch-dependent injuries [9].
Largely driven by regulatory authorities and industry, there is a
focus in standardizing alternative skin models that produce results
that correlate with those of in vivo human studies [10]. Several surrogate skin models have been developed for the demonstration of
bioequivalence with in vivo human skin. In particular, culturebased reconstructed full thickness (FT) skin models, with layers of
human dermal fibroblasts (HDF) and keratinocytes, achieve a structure resembling the in vivo skin organization, which may be useful
for in vitro screening of compound candidates [11]. Although it has
been suggested that fibroblasts in the dermis may play a role in the
development of stretch marks [9], to our knowledge, there is no
previous description of a FT skin model constructed with dermal
fibroblasts from SD lesions. We therefore sought to develop a FT
skin model with SD-HDF, previously analysed ex vivo, and with keratinocytes from non-lesioned skin. We named this new skin model
Striae Reconstructed which, as far as we know, is the first successful
attempt to build a FT skin model with Striae Distensae Human Dermal Fibroblasts (SD-HDF) that recapitulates the pathology of stretch
marks.
Optimal cutting temperature compound frozen sections were
washed with MilliQ water (EMD Millipore, Billerica, MA, USA) and
fixed with paraformaldehyde 4% for 15 min. Then, sections were
impermeabilized with 0.5% Triton for 30 min and blocked in PBSBSA 6% for 45 min, incubated with the Anti-Integrin beta 1 antibody [12G10](ab30394; Abcam, Cambridge, UK, 1:25) at 4°C
overnight and repeatedly washed using PBS-BSA 6%. Incubation of
the secondary antibody (Ms-A488 A11017; Molecular Probes
Carlsbad, CA, USA, 1:200) was performed for 1 h at room temperature followed by repeated washes using PBS-BSA 6%. Then cells
were incubated with Hoechst (H3570, Invitrogen Carlsbad, CA,
USA, 1:400) and with Cell MaskTM (C10046, Molecular Probes
Carlsbad, CA, USA, 1:500) for 10 min in darkness at room temperature and washed again with PBS-BSA 6%. Slides were mounted
using Fluoprep (BioMerieux, Marcy l’Etoile, France). Confocal
images were obtained on a LEICA TCS SP5 laser scanning microscope (Leica Microsystems, Heidelberg, Germany) using either the
line 488 nm and emission 500–550 nm for Alexa 488, 405 nm
excitation and emission 420–480 nm for Hoechst or 633 nm excitation and emission 650–780 nm for Cell MaskTM. The confocal
pinhole was set to 1 Airy unit and z-stacks acquisition intervals
were selected to satisfy Nyquist sampling criteria.
Methods
Quantitative RT-PCR
Cell culture
Striae Distensae Human Dermal Fibroblasts (SD-HDF) were isolated
from an albae striae lesion, while normal-HDF were isolated from
the adjacent non-lesioned skin from the same donor undergoing
312
Full thickness reconstructed skin model
Human Full Thickness (FT) reconstructed skin was performed as
previously described [12] with the HDF from an albae striae lesion
or from the adjacent healthy skin described above. A dermal equivalent was reconstructed by mixing the HDF with a collagen mixture and placed in culture plates. The dermal equivalents were
allowed to contract to 0.7 cm during 4 days. Then, Normal
Human Epidermal Keratinocytes (NHEK) isolated from neonatal
skin by trypsin digestion were seeded on top of the dermal equivalent and the models were thereafter lifted onto filter paper to the
air-liquid interface (ALI). Ten days are necessary for complete differentiation of the epidermis. After 14 days, the equivalents were
used for histological analysis. In short, samples were fixed with formalin 10%, washed extensively with PBS and then immersed in
ethanol 70% for paraffin embedding, microtomy and standard H&E
staining, or samples were immersed in sucrose 30% for subsequent
shock freezing in optimal cutting temperature compound (OCT)
(4583, Tissue-Tek; Sakura Finetek, Torrance, CA, USA), cryotomy
and staining for fluorescent confocal microscopy analysis.
Confocal microscopy & immunocytochemistry
Cells and FT reconstituted skin models were grown as described
above and RNA was extracted with the TRIzolâ Plus RNA Purification Kit (Thermo Fisher Scientific, Boston, MA, USA) according to
manufacturer’s instructions, including a DNase I treatment step.
RNA quality and quantity were inspected by spectrophotometric
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
Striae reconstructed, a model for stretch marks
measurement using a BioDrop Cuvette and a spectrophotometer
(Spectramax M2, Molecular Devices, Sunnyvale, CA, USA).
Reverse transcription of RNA was performed using the iScript
cDNA Synthesis Kit (BioRad, Hercules, CA, USA) and relative quantification of gene expression was performed using the real-time RTPCR CFX Connect Thermal Cycler (BioRad, Hercules, CA, USA) and
SYBR Green (SsoAdvanced Universal SYBR Green, BioRad, Hercules, CA, USA), according to manufacturer’s protocol. Expression
data were normalized to the arithmetic mean of the housekeeping
genes ACTIN and GAPDH to control the variability in expression
levels and were analysed using the 2DDCT method described by
Livak and Schmittgen [13].
Primers were selected from the PrimerBank database [14], and
its specificity was double-checked with the online software MFEprimer2.0 [15]. The sequences for every primer are listed in Table I.
ELISA measurements
Cell cultures were starved for 24 h and levels of collagen type I,
MMP1 and TGF-b1 in the supernatants were measured with the
corresponding DuoSet ELISA kits purchased from R&D Systems
(Minneapolis, MN, USA) following manufacturer’s instructions.
Statistical analysis
Statistical differences were determined using Student’s t-test carried
out using GraphPad software (v 6.00, GraphPad Software, Inc.) on
a PC. The alpha nominal level was set at 0.05 in all cases. A P
value of <0.05 was considered significant.
Results
Gene expression analysis of HDF isolated from a SD lesion (SDHDF) revealed that most of the ECM components were downregulated when compared to normal-HDF (Fig. 1a). We found a 49%
and 52% decrease for Col1 and Col3, respectively, while biglycan
(BGN) and lumican (LUM), which are both needed for a proper
assembly of collagen fibrils [16,17], were reduced by 42% and 36%
respectively. Also, essential for the cross-linking of collagen and
elastin is Lysyl Oxidase (LOX) [18], which we found diminished in
SD-HDF by 41%. Different reports show that, together with Col1
and Col3, fibronectin-1 downregulation is a hallmark of SD lesions
[3,6], which is in agreement with our detection of a 37% decrease
of fibronectin (FN1) in SD-HDF. In the same line, and although we
found no marked differences on MMP1 expression, we found a
strong increase in MMP3 (286% of control), a secretory endopeptidase known to degrade extracellular matrices [19], which is coherent with a decreased expression of natural inhibitors of MMPs:
TIMP1 and TIMP2, and PAI-1 (26%, 38% and 35% respectively).
Similarly, VEGFA, which is known to stimulate collagen deposition
by HDF [20], was decreased in SD-HDF by 50%. On the other
hand, we found increased inflammatory mediators such as CXCL8
(190%), TNF-a (417%) and HAS1 (458%) on SD-HDF. This is not
surprising since, unlike HAS2 and HAS3, HAS1 is fundamentally
involved in the inflammatory processes [21]. As expected from previous reports comparing cell cultures of HDF from rubrae and albae
lesions [5], we detected a 42% decrease in a-SMA (ACTA2) expression in SD-HDF, which were isolated from a striae albae lesion. To
follow, we confirmed at the protein level that SD-HDF significantly
express lower levels of collagen (Fig. 1b) and that MMP1 shows no
significant differences between SD- and normal-HDF. In agreement,
M. Perez-Aso et al.
TGF-b1 secretion, a potent inducer of collagen synthesis by HDF
[22], was 83% lower in SD-HDF than in normal-HDF.
Human Dermal Fibroblasts have been suggested to be the cell
type responsible for the pathological features of stretch marks [9].
In this regard, previous reports with HDF, but not with keratinocytes, embedded in collagen lattices, indicate that SD fibroblast
elicit different mechanical properties [5]. In the same line, studies
with skin biopsies suggest that HDF from SD lesions have a limited
synthetic capacity leading to alterations of the connective tissue
[3,6,7]. However, to our knowledge, a direct analysis of the role of
keratinocytes and HDF in the SD pathology by co-culturing both in
a reconstructed skin model has not been conducted to date. Therefore, in order to directly test whether HDF play a prominent role in
the SD pathology, we reconstructed two different FT 3D skin models, the dermis of which was populated with either normal-HDF or
SD-HDF (normal and Striae Reconstructed respectively), while the
epidermis of both models was reconstructed from the same culture
of NHEK. As expected, the H&E histology shows that the structure
of the normal-reconstructed skin resembles that of the in vivo skin
(Fig. 2a). Interestingly, the epidermis in the Striae Reconstructed
was dramatically thinner. Confocal images (Fig. 2b) revealed that
the epidermis (above the dashed line) of the Striae Reconstructed
model is much less populated by keratinocytes than that of the
normal-HDF reconstructed skin model, as the Hoechst staining of
nuclei shows. Fig. 2b also reveals a marked increase of integrin-b1
at the epidermal-dermal junction.
When analysing the gene expression of the Striae Reconstructed
(Fig. 3), we found several genes to be similarly regulated to those
in 2D cell cultures, but interesting differences were also detected,
such as that only in the Striae Reconstructed MMP7 and MMP9
were increased and that not HAS1, but the inflammatory cytokine
IL6 was found increased in the Striae Reconstructed. Interestingly,
the Striae Reconstructed, when compared to the skin model reconstructed with normal-HDF, showed elevation of skin ageing markers such as p16 [23], PTGS2 [24] and SOD2 [25].
Discussion
Although SD are only harmful in extreme cases [26], they are disfiguring skin lesions which can cause serious psychological concerns [27] and even mild lesions can cause distress to the bearer
[26]. However, despite the considerable investigations into their
origins, the pathology of SD remains unknown and much research
is needed. Regarding available models of SD, only a few studies use
actual fibroblasts from SD lesions for in vitro cultures, the majority
of studies regarding SD are clinical studies with volunteers [1] and
there is no animal model that reliably recapitulates the SD condition [28]. To date, the most common in vitro models of SD are collagen lattices embedded with SD-HDF [5], simple but wellestablished connective models that mimic 3D properties of the ECM
[29]. Therefore, the aim of the present work was to develop a new
SD skin model that includes not only the dermis, but also the epidermis. With HDF isolated from an albae skin SD lesion and keratinocytes from healthy volunteers, we reconstructed a FT skin
model that closely recapitulates the SD lesion, thus opening new
avenues for the fundamental research on the pathology behind
stretch marks.
First, we analysed the differences on the ECM and inflammatory
mediators in cell cultures of SD-HDF and normal-HDF. As shown
in Figs 1a, 2d, cell cultures of SD-HDF show the main hallmarks of
the SD lesion: decreased expression of collagen (COL1 and COL3)
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
313
Striae reconstructed, a model for stretch marks
M. Perez-Aso et al.
Table I Primer sequences used for the gene expression assays.
Gene name
Description
Primer Sequences (50 -> 30 )
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
ACTB
actin beta
ACTA2
actin, alpha 2, smooth muscle
BGN
Biglycan
CDKN2A (P16)
cyclin dependent kinase inhibitor 2A
COL1
collagen type I alpha 2 chain
COL3
collagen type III alpha 1 chain
CXCL8
C-X-C motif chemokine ligand 8
DCN
decorin
DPT
dermatopontin
ELN
elastin
FAK
Focal Adhesion Kinase
FBLN4
fibulin 4
FBN1
fibrilin 1
FGF2
fibroblast growth factor 2
FN1
fibronectin 1
HAS1
hyaluronan synthase 1
HMOX1
heme oxygenase 1
HSPG2
heparan sulfate proteoglycan 2, Perlecan
IL10
interleukin 10
IL6
interleukin 6
ITGA4
integrin subunit alpha 4
LOX
lysyl oxidase
LUM
lumican
MMP1
matrix metallopeptidase 1
MMP12
matrix metallopeptidase 12
MMP2
matrix metallopeptidase 2
MMP3
matrix metallopeptidase 3
MMP7
matrix metallopeptidase 7
MMP9
matrix metallopeptidase 9
P4HA1
prolyl 4-hydroxylase subunit alpha 1
PAI-1
serpin family E member 1
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
314
GGAGCGAGATCCCTCCAAAAT
GGCTGTTGTCATACTTCTCATGG
CATGTACGTTGCTATCCAGGC
CTCCTTAATGTCACGCACGAT
AAAAGACAGCTACGTGGGTGA
GCCATGTTCTATCGGGTACTTC
GAGACCCTGAATGAACTCCACC
CTCCCGTTCTCGATCATCCTG
GGGTTTTCGTGGTTCACATCC
CTAGACGCTGGCTCCTCAGTA
GAGGGCCAAGACGAAGACATC
CAGATCACGTCATCGCACAAC
GGAGCTGGCTACTTCTCGC
GGGAACATCCTCCTTCAACAG
TTTTGCCAAGGAGTGCTAAAGA
AACCCTCTGCACCCAGTTTTC
ATGAAGGCCACTATCATCCTCC
GTCGCGGTCATCAGGAACTT
GGGGCCAGTATGGCGATTATG
CGGTTCAAATTCACCCACCC
GCAGGAGTTAAGCCCAAGG
TGTAGGGCAGTCCATAGCCA
GCTTACCTTGACCCCAACTTG
ACGTTCCATACCAGTACCCAG
AAGAGCCCGACAGCTACAC
AGGGATGGTCAGACACTCGTT
TTTAGCGTCCTACACGAGCC
CCATCCAGGGCAACAGTAAGC
AGAAGAGCGACCCTCACATCA
CGGTTAGCACACACTCCTTTG
CGGTGGCTGTCAGTCAAAG
AAACCTCGGCTTCCTCCATAA
GAGCCTCTTCGCGTACCTG
CCTCCTGGTAGGCGGAGAT
AAGACTGCGTTCCTGCTCAAC
AAAGCCCTACAGCAACTGTCG
CCAAATGCGCTGGACACATTC
CGGACACCTCTCGGAACTCT
GACTTTAAGGGTTACCTGGGTTG
TCACATGCGCCTTGATGTCTG
ACTCACCTCTTCAGAACGAATTG
CCATCTTTGGAAGGTTCAGGTTG
CACAACACGCTGTTCGGCTA
CGATCCTGCATCTGTAAATCGC
CGGCGGAGGAAAACTGTCT
TCGGCTGGGTAAGAAATCTGA
TAACTGCCCTGAAAGCTACCC
GGAGGCACCATTGGTACACTT
AAAATTACACGCCAGATTTGCC
GGTGTGACATTACTCCAGAGTTG
CATGAACCGTGAGGATGTTGA
GCATGGGCTAGGATTCCACC
TACAGGATCATTGGCTACACACC
GGTCACATCGCTCCAGACT
AGTCTTCCAATCCTACTGTTGCT
TCCCCGTCACCTCCAATCC
GAGTGAGCTACAGTGGGAACA
CTATGACGCGGGAGTTTAACAT
TGTACCGCTATGGTTACACTCG
GGCAGGGACAGTTGCTTCT
AGTACAGCGACAAAAGATCCAG
CTCCAACTCACTCCACTCAGTA
ACCGCAACGTGGTTTTCTCA
TTGAATCCCATAGCTGCTTGAAT
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
Striae reconstructed, a model for stretch marks
M. Perez-Aso et al.
Table 1 (continued)
Gene name
Description
Primer Sequences (50 -> 30 )
PDGFA
platelet derived growth factor subunit A
PTGS2
prostaglandin-endoperoxide synthase 2
PXN
paxillin
SOD2
superoxide dismutase 2
TIMP1
TIMP metallopeptidase inhibitor 1
TIMP2
TIMP metallopeptidase inhibitor 2
TNFA
tumor necrosis factor
VCAN
versican
VEGFA
vascular endothelial growth factor A
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
GCAAGACCAGGACGGTCATTT
GGCACTTGACACTGCTCGT
CTGGCGCTCAGCCATACAG
CGCACTTATACTGGTCAAATCCC
CTGCTGGAACTGAACGCTGTA
GGGGCTGTTAGTCTCTGGGA
GCTCCGGTTTTGGGGTATCTG
GCGTTGATGTGAGGTTCCAG
CTTCTGCAATTCCGACCTCGT
ACGCTGGTATAAGGTGGTCTG
AAGCGGTCAGTGAGAAGGAAG
GGGGCCGTGTAGATAAACTCTAT
CCTCTCTCTAATCAGCCCTCTG
GAGGACCTGGGAGTAGATGAG
GTAACCCATGCGCTACATAAAGT
GGCAAAGTAGGCATCGTTGAAA
AGGGCAGAATCATCACGAAGT
AGGGTCTCGATTGGATGGCA
(a)
(b)
Figure 1 Gene Expression Profile and protein secretion differences between Striae and normal-Dermal Fibroblasts. HDF were isolated from a striae albae skin
lesion (Striae-HDF) and from the adjacent non-lesioned skin (normal-HDF) and (a) Gene expression was analysed as described under the section ‘methods’. (b)
Collagen type I, MMP1 and TGF-b1 protein levels on the supernatants from normal-HDF and from Striae-HDF were quantified by ELISA. Data represent
means SEM. of three to six independent experiments. Statistical analysis was performed by the Student’s t-test where **P < 0.01 vs. normal-HDF.
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
315
Striae reconstructed, a model for stretch marks
M. Perez-Aso et al.
(a)
(b)
Figure 2 Full Thickness Skin model reconstructed with striae-HDF (Striae Reconstructed) elicits epidermal atrophy and increased integrin-b1 expression in the
epidermal-dermal junction. Full thickness skin models were reconstructed in parallel with either HDF isolated from a striae lesion (Striae Reconstructed) or with
HDF isolated from healthy skin adjacent to the same lesion (Normal Reconstructed). The same batch of NHEK was used to reconstruct the epidermis of both
models. (a) Regular H&E stain was performed on paraffin-embedded sections. Different magnifications are shown (59, 109, 209, 409). (b) Immunofluorescence was performed to visualize Integrin-b1 (red), nuclei with Hoechst stain (blue) and the cell membrane with Cell Mask (green). Scale bar = 10 µm.
and fibronectin (FN1). That collagen levels are significantly reduced
in the SD-HDF were corroborated at the protein level (Fig. 1b).
Moreover, and in agreement with decreased synthesis of major
ECM components, we detected a striking increase in MMP3 mRNA
levels, which has been specifically shown to degrade collagen,
316
fibronectin and elastin [30], together with a decrease in all three
MMPs inhibitors: TIMP1, TIMP2 and PAI-1. Conversely, we found
that MMP1 mRNA was slightly reduced and unaltered at the protein level, and that MMP2 mRNA was reduced. However, when
compared to the MMP3 increase, these changes were small. In this
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
Striae reconstructed, a model for stretch marks
M. Perez-Aso et al.
Figure 3 Gene Expression Profile differences between Striae Reconstructed and FT skin model reconstructed with normal-HDF. RNA from whole lysates from
both FT skin models was isolated and gene expression was analysed as described under the section ‘methods’.
regard, it has been previously discussed that the different MMPs
considerable overlap when cleaving ECM substrates [31], a biochemical redundancy to safeguard any losses of regulatory control
[32]. Our findings suggest, therefore, a compensation for the dramatic MMP3 increase, a mechanism which often confounds efforts
to fully understand MMPs functions [32]. Taken together, these
findings suggest that MMP3 plays a predominant role in regulating
ECM degradation in the striae.
Further evidence that SD-HDF produce a deteriorated ECM is
provided by findings on the enzymes needed for the maturation of
collagen fibrils. In this line, we detected that LOX, which is essential for the cross-linking of collagen and elastin [18] and for connective tissue formation [33], that biglycan (BGN), needed for a
proper assembly of collagen fibrils in the dermis [16] and that
lumican (LUM), which regulates fibril collagen assembly to increase
skin tensile strength [17], were all three found decreased in SDHDF. Moreover, as expected from the deterioration of the ECM, we
found significant lower protein TGF-b1 levels, a well-established
inducer of collagen deposition by fibroblasts [34]. Despite that more
studies on the role of VEGFA in SD are lacking it is known that,
while promoting angiogenesis, VEGFA also indirectly generates significant amounts of TGF-b1 and Connective Tissue Growth Factor
(CTGF) from HDF to stimulate collagen deposition [20]. Since SD
are also atrophic scars by their nature [35], our finding that
VEGFA is decreased in SD-HDF is in agreement with decreased
Col1, Col3, TGF-b1 and increased MMP3, providing further evidence that SD-HDF promote the formation of a deteriorated ECM.
Because seminal works on the SD pathology highlighted that the
hallmarks of the SD lesion are decreased Col1, Col3 and fibronectin
among others [3,6], our findings show a correlation with SD-HDF
cultures and the lesion in vivo.
Two phases for the development of SD are well-defined: an early
inflammatory lesion (striae rubrae) followed by an atrophic dermal
scar (striae albae). From a bio-mechanical perspective, ex vivo fibroblasts from patients with early striae rubrae exhibit high levels of
alpha-smooth muscle actin (a-SMA) and generate higher contractile forces in comparison with fibroblasts from later stage striae [5].
Collagen lattices embedded with SD-HDF also revealed that SD from
early lesions contract with stronger force, but late lesions, that is
albae, show similar contraction forces to normal-HDF [5]. In our
hands, SD-HDF from striae albae express less a-SMA contractile
actin (Fig. 1a; ACTA2) and they also secrete fewer amounts of
TGF-b1 (Fig. 1b), which is well known to induce fibroblasts not
only to secrete collagen, but also to contract the ECM following
expression of a-SMA [36,37]. Together, these findings support the
notion that our model closely recapitulates the striae albae skin
lesions. We also found that SD-HDF were not completely dormant,
since they also showed increased expression of inflammatory mediators such as CXCL8, TNFA and HAS1.
It is well known that 3D reconstructed dermal equivalents
recapitulate better than 2D cell cultures the normal physiology of
the skin [38]. Because the interaction of cells with the surrounding ECM is essential in many physiological and pathological processes [29], and because they also allow the study of the
signalling between epidermis and stromal cells, which is crucial
for growth and differentiation [39], we used the SD- and normalHDF cell cultures described above to reconstruct two different FT
3D dermal equivalents, the epidermis of which was formed by
NHEK in both the SD- and the normal-HDF reconstructed models.
Although, parallel expression patterns were found for some ECM
proteins and cytokines between the 2D and 3D models (Fig. 3),
striking differences were also detected, such as finding MMP7 and
MMP9 increased in the Striae Reconstructed, or that the main augmented inflammatory mediator was IL6 instead of HAS1. Probably, the major difference found in the gene expression analysis is
that in the 3D model, but not in 2D cultures, SD-HDF show clear
traits of skin ageing, such as increased expression of p16 [23],
PTGS2 [24] and SOD2 [25]. Therefore, these findings highlight
the importance that the presence of keratinocytes and a 3D environment has on the behaviour of SD-HDF. In fact, in agreement
with our findings, it has been recently found that co-cultures of
keratinocytes and fibroblasts from aged donors in collagen dermal
substrates are a very useful alternative to in vivo studies [40] and
that epithelial-dermal interactions play an important role in the
skin ageing process, so that a 3D model would be needed for its
proper study.
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
317
Striae reconstructed, a model for stretch marks
M. Perez-Aso et al.
Although for both models, normal- and Striae Reconstructed, the
epidermis was formed with NHEK, and in agreement with previous
reports showing that keratinocyte differentiation is affected by
fibroblasts [41], we found epidermal atrophy only in the Striae
Reconstructed (Fig. 2a), which is typical of SD lesions [2], as well as
a dramatic increase of basal membrane integrin-b1 (Fig. 2b). The
latter is likely because of the activation of a keratinocyte response
to maintain the epidermal-dermal junction by augmenting key
adhesion receptors, a response also found in situations of stress
where keratinocytes acquire stronger adhesion properties, as in
wound healing [42]. In agreement with our findings, recently
Pageon and colleagues developed a FT 3D skin model of ageing
[43] by inducing the formation of Advanced Glycation End products (AGEs) in the dermal compartment, a hallmark of skin ageing
which, in turn, caused a significant increase of integrin-b1 expression in the epidermis. Both observations, epidermal thinning and
increased integrin-b1 expression in the basal membrane, may be
closely related since integrins are not only the major receptors for
keratinocyte adhesion to the basement, but they also play a global
role in epidermal migration [42], which is in agreement with the
observation of a reduced number of cells in the topmost area of the
epidermis (Hoechst staining on Fig. 2b). Taken together, these findings suggest that SD-HDF induce a stronger adhesion of keratinocytes to the dermal-epidermal junction which, in turn,
prevents keratinocytes from migrating to upper layers of the epidermis. Moreover, integrins can regulate the paracrine cross-talk
between HDF in the dermis and keratinocytes in the epidermis and,
interestingly, two growth factors that we found diminished in the
Striae Reconstructed have been recently functionally linked to integrins in the epidermis: VEGF and TGF-b1 [42]. That a fundamental
aberration of fibroblast metabolism in SD exists has been previously
noted [3,8,9] but, by co-culturing both cell types in a 3D FT skin
model the present work provides, for the first time to our knowledge, a direct rationale showing that the key player in the pathogenesis of the striae are dermal fibroblasts rather than the
epidermal keratinocytes.
In summary, in the present work, we characterized the dermal
fibroblasts isolated from striae albae and found that, ex vivo, they
recapitulate the main features found in SD skin lesions: decreased
accumulation of collagen and fibronectin, among other extracellular matrix, growth factors and inflammatory components. Moreover, we developed a FT skin model reconstructed with normal
keratinocytes and fibroblasts from SD lesions (Striae Reconstructed)
providing, to our knowledge, the first direct rationale showing that
dermal fibroblasts, and not epidermal keratinocytes, are the key cell
type behind the pathology of stretch marks. Moreover, the Striae
Reconstructed, but not the cell cultures of SD fibroblasts, showed
skin ageing traits, indicating that the reconstructed skin model better recapitulates the in vivo condition. Because more studies are
needed to better understand the pathology of SD, our new in vitro
model opens new avenues for the fundamental research of stretch
marks, and serves as a new platform for drug efficacy tests.
Acknowledgements
For its help and participation in these studies, the authors thank
the Microscopy Core of the Univeristat Autonoma de Barcelona
(UAB), in particular to Monica Roldan, and the Histology laboratory of the Neurosciences Institute of the UAB, in particular to Mª
del Mar Castillo Ruiz.
Conflict of interests
All authors are full time employees of Provital S.A.
References
1. Al-Himdani, S., Ud-Din, S., Gilmore, S. and
Bayat, A. Striae distensae: a comprehensive
review and evidence-based evaluation of
prophylaxis and treatment. Br. J. Dermatol.
170, 527–547 (2014).
2. Keen, A. Striae distensae: What’s new at the
horizon? BJMP 9(3), a919 (2016).
3. Lee, K.S., Rho, Y.J., Jang, S.I., et al.
Decreased expression of collagen and fibronectin genes in striae distensae tissue. Clin.
Exp. Dermatol. 19, 285–288 (1994).
4. Tsuji, T. and Sawabe, M. Elastic fibers in
striae distensae. J. Cutan. Pathol. 15, 215–
222 (1988).
5. Viennet, C., Bride, J., Armbruster, V., et al.
Contractile forces generated by striae distensae fibroblasts embedded in collagen lattices.
Arch. Dermatol. Res. 297, 10–17 (2005).
6. Watson, R.E., Parry, E.J., Humphries, J.D.,
et al. Fibrillin microfibrils are reduced in
skin exhibiting striae distensae. Br. J. Dermatol. 138, 931–937 (1998).
7. Zheng, P., Lavker, R.M. and Kligman, A.M.
Anatomy of striae. Br. J. Dermatol. 112,
185–193 (1985).
318
8. Gilmore, S.J., Vaughan, B.L., Madzvamuse, A.,
et al. A mechanochemical model of striae distensae. Math. Biosci. 240, 141–147 (2012).
9. Mitts, T.F., Jimenez, F. and Hinek, A. Skin
biopsy analysis reveals predisposition to
stretch mark formation. Aesthet. Surg. J. 25,
593–600 (2005).
10. Abd, E., Yousef, S.A., Pastore, M.N., et al.
Skin models for the testing of transdermal
drugs. Clin. Pharmacol. 8, 163–176 (2016).
11. Monika, S.-K., Bock, U., Diembeck, W.,
et al. The use of reconstructed human epidermis for skin absorption testing: Results of
the validation study. Altern. Lab. Anim. 36,
161–187 (2008).
12. Gangatirkar, P., Sophie, P.-F., Li, A., et al.
Establishment of 3D organotypic cultures
using human neonatal epidermal cells. Nat.
Protoc. 2, 178–186 (2007).
13. Livak, K.J. and Schmittgen, T.D. Analysis of
relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C
(T)) Method. Methods 25, 402–8 (2001).
14. Wang, X., Spandidos, A., Wang, H., et al.
PrimerBank: a PCR primer database for
quantitative gene expression analysis, 2012
update. Nucleic Acids Res. 40, D1144–9
(2012).
15. Qu, W., Zhou, Y., Zhang, Y., et al. MFEprimer2.0: a fast thermodynamics-based program
for checking PCR primer specificity. Nucleic
Acids Res. 40(W1), W205–W208 (2012).
16. Corsi, A., Xu, T., Chen, X.D., et al. Phenotypic effects of biglycan deficiency are linked
to collagen fibril abnormalities, are synergized by decorin deficiency, and mimic
Ehlers-Danlos-like changes in bone and
other connective tissues. J. Bone Miner. Res.
17, 1180–1189 (2002).
17. Chakravarti, S., Magnuson, T., Lass, J.H.,
et al. Lumican regulates collagen fibril
assembly: skin fragility and corneal opacity
in the absence of lumican. J. Cell. Biol. 141,
1277–1286 (1998).
18. Siegel, R.C., Pinnell, S.R. and Martin, G.R.
Cross-linking of collagen and elastin. Properties of lysyl oxidase. Biochemistry 9,
4486–4492 (1970).
19. Eguchi, T., Kubota, S., Kawata, K., et al.
Novel transcription-factor-like function of
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
Striae reconstructed, a model for stretch marks
human matrix metalloproteinase 3 regulating the CTGF/CCN2 gene. Mol. Cell. Biol.
28, 2391–2413 (2008).
20. Wilgus, T.A., Ferreira, A.M., Oberyszyn,
T.M., et al. Regulation of scar formation by
vascular endothelial growth factor. Lab.
Invest. 88, 579–590 (2008).
21. Siiskonen, H., Oikari, S., Sanna, P.-S., et al.
Hyaluronan synthase 1: a mysterious
enzyme with unexpected functions. Front.
Immunol. 6, 43 (2015).
22. Ghosh, A.K., Bhattacharyya, S. and Varga,
J. The Tumor Suppressor p53 Abrogates
Smad-dependent Collagen Gene Induction in
Mesenchymal Cells. J. Biol. Chem. 279,
47455–47463 (2004).
23. Ressler, S., Bartkova, J., Niederegger, H.,
et al. p16INK4A is a robust in vivo biomarker of cellular aging in human skin. Aging
Cell 5, 379–389 (2006).
24. Surowiak, P., Gansukh, T., Donizy, P., et al.
Increase in cyclooxygenase-2 (COX-2)
expression in keratinocytes and dermal
fibroblasts in photoaged skin. J. Cosmet. Dermatol. 13, 195–201 (2014).
25. Leccia, M.T., Yaar, M., Allen, N., et al. Solar
simulated irradiation modulates gene
expression and activity of antioxidant
enzymes in cultured human dermal fibroblasts. Exp. Dermatol. 10, 272–279 (2001).
26. Dosal, J., Handler, M.Z., Ricotti, C.A., et al.
Ulceration of abdominal striae distensae
(Stretch Marks) in a cancer patient —quiz
case. Arch. Dermatol. 148, 385–390 (2012).
27. Korgavkar, K. and Wang, F. Stretch marks
during pregnancy: a review of topical prevention. Br. J. Dermatol. 172, 606–615 (2015).
M. Perez-Aso et al.
28. Bogdan, C., Iurian, S., Tomuta, I., et al.
Improvement of skin condition in striae distensae: development, characterization and
clinical efficacy of a cosmetic product containing Punica granatum seed oil and Croton lechleri resin extract. Drug Des. Devel.
Ther. 11, 521–531 (2017).
29. Daniela, K.-B., Thomas, K. and Beate, E.
Expression of pro-inflammatory markers by
human dermal fibroblasts in a three-dimensional culture model is mediated by an
autocrine interleukin-1 loop. Biochem. J.
379, 351–358 (2004).
30. Ye, S., Eriksson, P., Hamsten, A., et al. Progression of coronary atherosclerosis is associated with a common genetic variant of
the human stromelysin-1 promoter which
results in reduced gene expression. J. Biol.
Chem. 271, 13055–13060 (1996).
31. Parks, W.C., Wilson, C.L. and S L-BY.,
Matrix metalloproteinases as modulators of
inflammation and innate immunity. Nat.
Rev. Immunol. 4, 617–629 (2004).
32. Sternlicht, M.D. and Werb, Z. How matrix
metalloproteinases regulate cell behavior.
Annu. Rev. Cell. Dev. Biol. 17, 463–516
(2001).
33. Kothapalli, C.R. and Ramamurthi, A. Lysyl
oxidase enhances elastin synthesis and
matrix formation by vascular smooth muscle cells. J. Tissue Eng. Regen. Med. 3, 655–
661 (2009).
34. Tellios, N., Belrose, J.C., Tokarewicz, A.C.,
et al. TGF-b induces phosphorylation of
phosphatase and tensin homolog: implications for fibrosis of the trabecular meshwork
tissue in glaucoma. Sci. Rep. 7, 812 (2017).
© 2019 Society of Cosmetic Scientists and the Societe Francßaise de Cosmetologie
International Journal of Cosmetic Science, 41, 311–319
35. Safonov, I. and Safonov, I. Atrophic Scars
and Stretch Marks, pp. 1–95. Springer, Berlin
Heidelberg (2012).
36. Scharenberg, M.A., Pippenger, B.E., Sack,
R., et al. TGF-b-induced differentiation into
myofibroblasts involves specific regulation of
two MKL1 isoforms. J. Cell. Sci. 127, 1079–
1091 (2014).
37. Verrecchia, F. and Mauviel, A. Transforming growth factor-beta and fibrosis. World J.
Gastroenterol. 13, 3056–3062 (2007).
38. Li, L., Mizuho, F.-K. and Herlyn, M. The
Three-dimensional human skin reconstruct
model: a tool to study normal skin and melanoma progression. J. Vis. Exp. Jove 2937
(2011).
39. Schlotmann, K., Kaeten, M., Black, A.F.,
et al. Cosmetic efficacy claims in vitro using
a three-dimensional human skin model. Int.
J. Cosmet. Sci. 23, 309–318 (2001).
40. Diekmann, J., Alili, L., Scholz, O., et al. A
three-dimensional skin equivalent reflecting
some aspects of in vivo aged skin. Exp. Dermatol. 25, 56–61 (2016).
41. Schumacher, M., Schuster, C., Rogon, Z.M.,
et al. Efficient keratinocyte differentiation
strictly depends on JNK-induced soluble factors in fibroblasts. J. Invest. Dermatol. 134,
1332–1341 (2014).
42. Longmate, W.M. and DiPersio, C.M., Integrin
regulation of epidermal functions in wounds.
Adv. Wound Care 3, 229–246 (2014).
43. Pageon, H., Zucchi, H., Dai, Z., et al. Biological effects induced by specific advanced glycation end products in the reconstructed
skin model of aging. Biores. Open Access 4,
54–64 (2015).
319