BCH 315 Biochemical Genetics and Molecular Biology Nucleic Acids Polymers of Nucleotides Types of Nucleic Acids – RNA (ribonucleic acid) • single strand – DNA (deoxyribonucleic acid) • Double strand (double helix) DN A RN A NUCLEOTIDE ▪ 3 parts PO 4 nitrogen base (C-N ring) ◆ pentose sugar (5C) ◆ ▪ ribose in RNA ▪ deoxyribose in DNA ◆ AP Biology phosphate (PO4) group nucleotid e N base 5′ CH 2 4′ O 1′ ribose 3′ OH 2′ Types of nucleotides ▪ 2 types [have different N bases] 1. purines ▪ double ring N base ▪ adenine (A) ▪ guanine (G) 2. pyrimidines ▪ ▪ ▪ ▪ AP Biology single ring N base cytosine (C) thymine (T) uracil (U) ▪ DNA and RNA contain the two major purine bases, adenine (A) and guanine (G), ▪ AP Biology ▪ Each of them contains two pyrimidines. ▪ cytosine (C) is the major pyrimidine in both DNA and ▪ ▪ AP Biology RNA the second pyrimidine in DNA is thymine (T) while uracil (U) is the second pyrimidine in RNA. Only rarely does thymine occur in RNA or uracil in DNA. pentoses ▪ Nucleic acids have two kinds of pentoses ▪ deoxyribonucleotide units of DNA contain ▪ 2- deoxy-D-ribose, the ribonucleotide units of RNA contain Dribose. AP Biology FUNCTIONS OF RNA ▪ Ribosomal RNAs (rRNAs) are components of ribosomes, the complexes that carry out the synthesis of proteins. ▪ Messenger RNAs (mRNAs) are intermediaries, carrying genetic information from one or a few genes to a ribosome, where the corresponding proteins can be synthesized. ▪ Transfer RNAs (tRNAs) are adapter molecules that faithfully translate the information in mRNA into a specific sequence of amino acids and so on AP Biology Function of DNA ▪ The storage and transmission of biological ▪ information are the only known functions of DNA. The ability to store and transmit genetic information from one generation to the next is a fundamental condition for life. AP Biology ▪ The amino acid sequence of every protein in ▪ ▪ ▪ a cell the nucleotide sequence of every RNA, is specified by a nucleotide sequence in the cell’s DNA. A segment of a DNA molecule that contains the information required for the synthesis of a functional biological product, whether protein or RNA, is referred to as a gene. A cell typically has many thousands of genes, and DNA molecules AP Biology • Genetic material is located in nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA 8.1 Griffith finds a ‘transforming principle.’ • Griffith experimented with the bacteria that cause pneumonia. • He used two forms: Griffith injected mice with bacteria S form (deadly) and the R form (not deadly). • A transforming material passed from the dead S bacteria to live R bacteria, making R bacteria deadly. 8.2 Structure of DNA • Avery identified DNA as the transforming principle. • Avery isolated and purified Griffith’s transforming principle- combined R bacteria w/ an extract from S bacteria • Avery performed three tests on the transforming principle. – Qualitative tests showed DNA was present. – Chemical tests showed the chemical makeup matched that of DNA. – Enzyme tests showed only DNA-degrading enzymes stopped transformation. 8.2 Structure of DNA • The nitrogen containing bases are the only difference in the four nucleotides. 8.2 Structure of DNA Scientist🡪 Chargaff found: The amount of adenine in an organism approximately equals the amount of thymine The amount of cytosine roughly equals the amount of guanine. A=T C=G Chargaff’s rules 8.2 Structure of DNA • Nucleotides always pair in the same way. • The base-pairing rules show how nucleotides always pair up in DNA. – A pairs with T – C pairs with G • Because a pyrimidine (single ring) pairs with a purine (double ring), the helix has a uniform width. G C A T 8.2 Structure of DNA • • The backbone is connected by covalent bonds. The bases are connected by hydrogen bonds. hydrogen bond covalent bond • Genetic information is transferred from DNA and converted to protein • RNA molecules work as messengers • Proteins are the biological workers • Information of the DNA is copied to a RNA molecule in transcription • RNA directs the protein synthesis in a translation • Protein’s 3D structure determines it’s function • Information transfer only in one direction DNA chains • The phosphodiester bonds link successive nucleotides in DNA DNA Molecules • Two polynucleotide chains are joined • Double helix, twisted in right handed way • Full circle in every 10 bases • ”ladder-structure” –Bases = steps –Sugars and phosphates = supporting pilars • Two nucleotide chains run in opposite directions 🡪chemical direction (5´-3´) Complementary Pairing • Bases pair with other bases • Space between the chains is limited 🡪 Purines with two carbon rings pair only with single ring pyrimidines A+T G+C • Complementary pairing is vital for the use and storage of the genetic information! • Interaction is stabilized by hydrogen bonds The Genetic Code • Describes how nucleotide sequence is converted to protein sequence • Unit of three nucleotides = a codon • A codon codes for a specific amino acid (structural component of protein) • The four bases can form 64 different codons • 20 amino acids are found from the nature • Regulatory codons • Right reading frame is obligatory! atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc • Three different reading frames can be used, but only one is the right one • Translate tools are found from the internet Frame 1 The right one Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D IPLVQ Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T FPWSN Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H Genes • A gene: DNA sequence that is needed to encode amino acid sequence of a protein • Composed of exons, introns and different control elements • Exon – protein coding sequence • Intron – intervening sequence • Genes vary a lot in size: Humans: average 3000bp largest 2.4 million bp • Genes are separated by sequences with unknown function • Only one strand of the DNA carries biological information 🡪 template strand • Potential to store biological information is enormous The Human genome... The different types of sequences that make up the total DNA of a human cell • 3 billion base pairs • about 22 000 genes • Only 2 % of the DNA encode proteins • Genes include exons and introns • Beside coding areas also additional secuences are found • 50 % repeated sequences (”junk DNA”) Mutations • Alterations in DNA sequence • Some are part of normal DNA variation • Caused by chemical and physiological agents and errors in DNA replication • Cells can repair some mistakes • If not repaired changes in DNA sequence are made permanent by DNA replication Point mutations: Single base mutations: 1. Missense mutation: leads to an amino acid change 2. Silent mutation: does not change the amino acid 3. Nonsense mutation: causes premature stop-codon • Frameshift mutations: insertion/deletion dublication translocation 🡪 Altered reading frame 🡪 Severe impacts on protein structure Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA Phenotypes Genotype GCCAAGAATGGCTCCCACC T GGCTCTCAGACATTCCCCT GGTCCAACCCCCAGGCCAT CAAGATGTCTCAGAGAGGC GGCTAGACACCCAGAGACC TCAAGTGACCATGTGGGAA CGGGATGTTTCCAGTGACA GGCA Genotype ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTC C CACTTTCAAGCTCGGCCCCT T TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG Inherited diseases • DNA mutations are significant in development of diseases • Inherited diseases are caused by mutations passed from a parent to a offspring • Monogenic diseases: disease is caused by one mutation in one gene • Multifactiorial diseases: disease is caused by interaction of different mutations and environmental factors • Mendelian inheritance: Presence or absence of the phenotype depends on the genotype at a single locus • Dominant character: only one allele needed to cause the phenotype (heterozygous) • Recessive character: both allels needed to cause the phenotype (homozygous)