Biology for CAPE® Unit 1 Biology for CAPE® Richard Stuart Lorna Fosbery LaPlace McPherson Unit 1 3 Great Clarendon Oxford It University furthers and Oxford The © This in means, Press, must Data the the the part prior of have of the in and in by law, reproduction scholarship, registered trade mark of countries McPherson 2012 2015 2012 Press by any of rights the 2015 be or or by any University under terms organization. scope Oxford reproduced, form Oxford licence outside Department, in may in writing reprographics Rights Oxford. asserted publication in a of research, other Lorna Press in is certain transmitted, permission University Oxford been Ltd Kingdom excellence University this or United University permitted the and LaPlace Oxford appropriate to UK Thornes system, expressly sent address impose No of worldwide. authors by 6DP, department Stuart Nelson concerning be British by OX2 objective Oxford the retrieval as a in © published with should of reserved. a Enquiries You rights without or agreed Press Fosbery, published rights is publishing illustrations edition stored the by Richard moral First Press Oxford, University’s University Original All the education Text Street, of the above University Press, at above. not this circulate same Library this work condition Cataloguing on in in any any other form and you must acquirer Publication Data available 978-1-4085-1646-1 17 Printed in Great Britain by Ashford Colour Press Ltd, Gosport Acknowledgements Cover photograph: Illustrations: Page The make-up: authors Mark Wearset and Wearset the Lyndersay, Ltd, Boldon, Ltd, Boldon, publisher Lyndersay Tyne would & Tyne like Digital, Trinidad. www.lyndersaydigital.com Wear & to Wear thank the following for permission to reproduce material: Photos Module Luttick Biology 2.5.1 1: 1.8.3 ( James on DR Module DVD, 2: SCIENCE 2.2.1 2.7.2.i 4.4.1 5.6.1b David Module 1.3.4 3: Fig. PR. G 1.1.1m © 2.3.1 5.7.1 1.4.1 Cell Although we cases. the the this notied, earliest Links and If to for have made resource PHOTO J.C. REVY, for Michael the Inc. / effort publication PHOTO publisher will by B 5.5.2 1.3.2 1.5.2 DR PHOTO 1.4.1 trace this has rectify not any party materials websites only. contained are provided Oxford in any by disclaims for contact been third party Oxford REVY, Cell 2009; ISM/ COX/SCIENCE PR. G LIBRARY; 5.9.1 JOHN PHOTO GIMENEZ-MARTIN/ 3.1.1 5.6.1a Glowimages/ David author’s WHEELER/SCIENCE 2.1.2 students and all possible or in omissions in good faith responsibility website GENE Williams; Watson; errors any J.C. John Fox/Getty; own. PHOTO LIBRARY; BURBIDGE/SCIENCE PHOTO LIBRARY. Bruce and own; and Plant Springer-Verlag 2.8.3a 2.7.2.ii PHOTO opportunity. third 2.4.1 Claire KEITH author’s 2.3.1 LIBRARY. LIBRARY; Dr own; Wesson LIBRARY; Gunning, LIBRARY; ISM/SCIENCE Laurence PHOTO author’s PHOTO PHOTO Information Fig. to 2.8.1s ISM/SCIENCE Alamy; DVD, p150 1.10.1 Stubbleeld/istockphoto.com; Watson; on 2009; LIBRARY; teachers , LIBRARY; SYRED/SCIENCE every before information work. © Biology Springer-Verlag holders a CMEABG-LYON-1, Bruce AND Gunning, copyright 2.7.3 PHOTOTAKE POWER Plant 2.8.3b and PHOTO FAWCET T/SCIENCE Photography/istockphoto.com; society; 2.2.2 students DON GSCHMEISSNER/SCIENCE LIBRARY; Zmeel 2.2.1 GIMENEZ-MARTIN/SCIENCE Fox/Getty; IASPRR LIBRARY; p30 © for LIBRARY; STEVE PHOTO Getty; School); WHEELER/SCIENCE PHOTO LIBRARY; GSCHMEISSNER/SCIENCE Girls’ Information KEITH SCIENCE STEVE Allen’s referenced for in all at a resource for teachers, by B Contents Introduction v 3.4 Determining the initial rate of reaction Module 1 Cell and 3.5 molecular biology 2 Introduction to biochemistry 1.2 Water 1.3 Carbohydrates 1.4 Complex 1.5 Lipids 1.6 Proteins (1) 12 1.7 Proteins (2) 14 1.8 Proteins (3) 16 1.9 Qualitative 1. 10 Quantitative Factors hydrogen bonding sugars (1) 56 inuencing enzyme (2) 58 4 3.7 – enzyme 2 activity and inuencing activity 3.6 1. 1 Factors 54 Practice exam-style questions: 6 Enzymes carbohydrates 10 biochemical tests 1. 11 1. 12 18 biochemical tests Module natural 2 Genetics, variation and selection 62 1. 1 Nucleic acids 62 1.2 DNA 1.3 Protein synthesis (1) 66 1.4 Protein synthesis (2) 68 1.5 Protein synthesis (3) 70 1.6 Genes to 1.7 Practice replication 64 20 Biochemistry Practice summary 22 phenotypes 72 exam-style questions: Biochemistry exam-style questions: 24 Structure 2. 1 Introduction to cells 26 2.2 Cells – microscopy 28 2.3 Cells and organelles 2.4 Eukaryotes 2.5 Tissues 2.6 Cell 2.7 Movement 2.8 Investigating 2.9 Cell 2. 10 Practice Cell 60 8 electron and 30 prokaryotes and organs 34 membranes across 32 36 membranes water potential summary 38 40 structure and function 3. 1 Enzymes 3.2 Investigating enzyme 3.3 Quantitative results 46 48 activity 50 roles of nucleic acids 74 2. 1 Mitosis (1) 76 2.2 Mitosis (2) 78 2.3 Life 2.4 Meiosis 2.5 Segregation 2.6 Nuclear division 2.7 Practice cycles Mitosis 44 exam-style questions: and 80 82 and crossing over 84 summary 86 exam-style questions: and meiosis 3. 1 Introduction to 3.2 Terminology 3.3 Monohybrid 3.4 Codominance in 88 genetics genetics cross and 90 92 94 sex linkage 96 52 iii Contents 3.5 Dihybrid 3.6 Interactions and cross 98 between Module 3 Reproductive 1. 1 Asexual reproduction 1.2 Asexual reproduction 3.8 Patterns of in 104 owering plants 146 inheritance 1.3 summary Sexual reproduction in 108 owering plants 148 exam-style questions: Patterns of 4. 1 144 102 Chi-squared test Practice inheritance Principles of 1.4 Pollination 150 1.5 Pollination to 1.6 Plant 1.7 Practice 110 seed formation 152 genetic engineering 112 4.2 Gene therapy 114 4.3 Insulin 116 4.4 Genetically 4.5 Practice Plant production modied organisms reproduction summary 154 exam-style questions: reproduction 2. 1 Female reproductive 2.2 Male 2.3 Gametogenesis 2.4 Fertilisation 156 system 158 118 reproductive system 160 exam-style questions: Aspects of genetic engineering 162 122 5. 1 Variation (1) 124 5.2 Variation (2) 126 5.3 Mutation 5.4 Sickle 5.5 Darwin and early development 164 2.5 Internal development 166 2.6 Hormonal 128 cell anaemia control of 130 reproduction 168 132 2.7 5.6 144 alleles genes 3.7 3.9 biology Natural selection (1) The effect of maternal 134 behaviour on foetal 5.7 Natural selection 5.8 Species 5.9 Variation and (2) how they and natural 136 evolve selection summary 5. 10 Practice 140 2.8 Human 2.9 Practice Human reproduction 172 summary 174 exam-style questions: reproduction 176 exam-style questions: Variation iv 138 development and natural selection 142 Glossary 178 Index 185 Introduction This Study Guide has been developed exclusively with the Caribbean ® Examinations candidates, Council both in ) (CXC and out of to be used school, as an additional following the resource Caribbean by Advanced ® Prociency Examination It prepared ) (CAPE programme. ® has been teaching and by a team examination. with The expertise contents are in the CAPE designed to syllabus, support learning ® by providing the features and for guidance Inside this activities On of in to problem syllabus. is in an Do provide to the your electronic techniques: candidate answers could skill syllabus format! examination-style designed questions study to and concepts be level short answers and improved. and questions. specically inside refer key includes understanding, examination sections the examination example where examination are to that sample Biology CAPE examination with show your in master and CD good questions, activities to remember interactive build best you requirements examiner will your for developing type multiple-choice you easier course answering Y ourself refer This an achieve it activities essay activities condence the you from you make the Marks and feedback T est help Guide assist Y our These of on Study to answer to requirements full tools included and guide so to provide helpful that experience feedback you can will revise areas. unique combination examination practice of will focused provide syllabus you with content and invaluable interactive support to help you ® reach We your have the full included sections. that potential At includes lots the some in of end hints, of Biology. CAPE explanations many activities to of the help and chapters assist your suggestions is a in summary each of section learning. ® As you you work took during textbooks, internet. places are this Use we internet. through reliable. your guide the have T ry CAPE lessons. and nd Entries you relevant this up-to -date you nd accurate Wikipedia course, doing suggestions good, in Biology While information given to your to of should through should information add to your searches websites. read you you Those always be from notes. can that In make end double any notes read in the some on the .edu checked or .ac for accuracy. When each you nish section. denitions use the advice T ry you the to to are how nd This and Y ou many some ways topic, will the end is notes especially understand. can ways examples also in in of this to each of each questions these topic. chapter the you start This are by is to at the asking end of for prompt exam-style information can use important Y ou make which summary many you questions to with questions. summarising concise the that relevant answer of answer notice terms At to some exam. learn the glossary. on have topics. of a Y ou can charts you can write and for for topics yourself posters organise you have revision to you in have bullet help so weeks found points your information learnt the difcult about learning. and we that before give these There you book. v 1 Cell 1. 1 Introduction and molecular Just completion of this biochemistry Chemistry of Learning outcomes On to section, about be able dene of everywhere biochemistry in as molecules the study state and their made biological of elements: C, conversion is the the basis cell of state that walls on in the most colour plants. of Earth. within It light of common colour chlorophyll, is used energy Chlorophyll plant surrounding biological the in your main cells. those to to is inside Cellulose plant absorb cells. light chemical is and energy chloroplasts, the is the as such which compound Cellulose is and that are forms compound on most Earth. the following H, O, N, S and Biochemistry P many are is the These study of molecules biological are the molecules building and blocks their of life roles – in constantly biological polymers made assembled monomer and taken apart. Metabolism is the term given to all the by chemical joining the molecules being molecules life found organisms. look is pigment in common are It involved organelles organisms that you green. photosynthetic the is to: biological roles life you environment should biology reactions that occur in organisms and can be divided into: molecules together. anabolism from catabolism into All the with major chlorophyll is carry Y ou messages, information, The air and compounds know and of The you is of use life are in – are known we Biology – pure are very store as you It store on the itself and also by form biological that bres that provide and are energy, retrieve functions. dioxide, nitrogen, compounds. compounds. have molecules can out are forms carbon progress will with strong. other inorganic organic based molecules energy, many oxygen, are are bonds functions biological have biological reactions. carried cellulose molecules reactions large covalent those cannot terms down functions of biological organisms and of These so of that composed some element two and up larger anabolic catabolic bonds reactions, gases and your just as form range learn gases. carbon make can transducer also catalyse Here chemical energy will that up as break known covalent bonds. build known that are element These other chemistry chemistry. they transport around hydrogen This an that are reactions staggering is strong. they compounds double compounds very the ones; atoms. and reactions ones; carbon. other single the – smaller element the – smaller without learnt The complex Biochemistry knowing but which is some you must course: chemical substance consisting of one type of atom atom – smallest properties and protons, isotope – neutrons S tudy compound molecule – chemical and foc us at computer-generated biological molecules, and the same element by of having an atom the chemical consists of neutrons electrons element with different numbers of nucleus smallest physical made from particle of properties a of two or more substance the chemical that substance retains and is elements the composed of atoms ion – an or atom more or molecule electrons and or is chemical either group positively that or has lost negatively or gained charged DNA. 2 surrounded substance the more of an nucleus especially one proteins or a is of the models of the – element; and atoms in component the two Look of ionic bond – a chemical bond between two ions with opposite charges Module covalent bond electrons – a chemical between atoms bond in a involving the sharing of a pair 1 of are small molecules that these are assembled into are assembled into larger ones. In small much larger molecules. Glucose is asked The molecule small that is assembled molecules are in known different as ways monomers, to the polymers. The as polymers. Lipids biological summarised are Not made molecules in this all the from are a large small subdivided biological number into of molecules sub-unit groups, which Elements Sub-unit carbohydrates C, H, O (ratio lipids give groups of molecules, nucleic acids. students See page often 62 for larger structure and function of DNA RNA. are molecules. are C, molecules Examples glucose starch 1 : 2 : 1) Roles (amylose and C, H, O* H, O, glycerol, fatty N, acid phosphate S amino (20 acids C, H, O, N, energy storage glycogen cellulose support triglycerides energy thermal electrical membranes phospholipids (phospholipids) proteins in organisms amylopectin) P acids different types) nucleotides (ve different types) storage insulation insulation haemoglobin transport collagen support amylase catalysts pepsin insulin messengers antibodies protection DNA information storage RNA information retrieval production (mRNA, * the table. Macromolecules nucleic name larger and molecules to a the molecules. biology some forget relatively molecular Link biological cases and molecule. When There Cell tRNA, rRNA) of proteins Note Ratio of C : H = approx 1 : 2, but ratios and keep of C : O and H : O are high, e.g. 9 : 1 and 18 : 1 Summary questions Try the questions 1 Dene below the following organic macromolecule your answers in a folder alongside 4 terms: your Name notes. one biological molecule that carries out each of the following functions: compound monomer polymer. energy transduction energy information storage storage transport carrying of oxygen messages protection against disease-causing 2 List 3 Write the four main groups of biological molecules. organisms down the chemical formula for glucose and 5 show how to calculate its relative molecular Explain what makes carbon suitable as the ‘element mass. life’. 3 of 1.2 Water and Learning outcomes hydrogen The giver of W ater On completion of this section, forms be able describe approximately humans, and 70 per makes up cent of about the 90 bodies per cent of of animals, plants. the structure of a water molecule and all Earth by water organisms water are O) (H and many organisms dependent should be a on gas it. like At live the in it. Life evolved temperatures hydrogen sulphide we (H 2 describe hydrogen between list the water liquid. bonding not molecules properties of There water explain how hydrogen cells the bonding properties are in are water have S) on and not a 2 reason in it is the hydrogen oxygen atom not solar probably system bonds has a explains (as between greater far as water attraction why we life on Earth and know). molecules. for exists the These electrons exist in the because covalent is bond responsible for The elsewhere the All to: surrounded life you including should bonding with hydrogen. This makes the oxygen slightly electronegative and of the hydrogen slightly electropositive so that a water molecule is dipolar. water The list the roles of water in partial organisms explain as an the importance environment for of are indicated by the symbol δ (delta) with on δ the + oxygen charges living water organisms. and on δ slightly negative bond very is easily the charge weak broken. hydrogen. In and (about bodies the one of A hydrogen slightly tenth water , the bond positive strength hydrogen forms charge. of bonds a between Each covalent break and the hydrogen bond) reform and all the time. W ater molecules are ‘sticky ’ thanks to the hydrogen bonds between them. a This cohesion between water molecules gives water important properties that are summarised in the table opposite. S tudy foc us You hydrogen bond the may roles be of asked water to in discuss living how the organisms structure and also and as properties an of water environment. explain Remember that hydrogen bonding is key to these explanations. b Summary questions Figure 1.2.1 1 Dene 2 Explain 3 Find the terms why solvent; hydrogen solute; soluble; bonds form insoluble; between water dipolar; cohesion. molecules. a Two water molecules with a hydrogen bond between them. the names of seven different biological molecules that dissolve in b Each water molecule may have water and seven that do not. hydrogen bonds with up to four other water molecules. 4 Explain the medium importance and a of water as a component of cells, a transport as environment for coolant. Link 5 Hydrogen cellulose; bonds this are will important be dealt in 9. They are also with important (page proteins 4 63) (page and 15). in advantages and disadvantages of water an on Discuss why the presence of liquid water on Earth is so in we DNA the organisms. 6 page Discuss know it. stabilising 7 Find out what happened to water on the planet Venus. important for life as Module Property Explanation Roles of water 1 in Roles of organisms good solvent for substances that charged dissolve polar molecules (e.g. glucose) (e.g. Na solvent and in water; uncharged within also dissolve, and are ) are less readily weak solvent for nutrients (oxygen and and carbon transport charged attracted to dioxide) e.g. charges on blood the plasma; but an − , Cl media, substances cells gases in as environment ions solvent + readily water lymph; phloem carbon dioxide is much water and xylem saps more soluble than oxygen molecules high specic heat capacity 4.2 J are necessary increase 1 g of the water to specic temperature by 1 °C; of other energy of water is higher than that of substances limits the uctuations in the temperature of breaks organisms hydrogen capacity this this thermal heat common bonds and the environment of those that live in between water high latent heat of vaporisation water molecules much thermal needed change to to energy cause water is water loss to of (e.g. vapour water for in sweating) lot of high latent heat of fusion much thermal needed water; from reactive to much water water energy change splits is is ice stay transferred when it forms ice to form to in as a energy so are by of a is in habitats pools) too shallow (e.g. does aquatic ponds, not rock evaporate quickly water tends liquid, membranes raw as water evaporate cells damaged and efcient quantities water to is thermal needed small cooling transpiration to cell not ice crystals material for + hydrogen ions (H ) and photosynthesis − hydroxyl ions (OH ) provides and hydrogen ions electrons for photosynthesis and respiration used in hydrolysis reactions, density ice is less dense than water ice that forms breaks and at e.g. cell kills risk digestion in cells membranes cells; organisms of freezing ‘anti-freeze’ make provides aquatic not need lower freezing water cannot into smaller a be compressed volume as hydrostatic animals, turgidity which cohesion hydrogen bonds molecules hold together water on an water – insulation for cytoplasm in in organisms beneath in sea worms plant provides supports water skeleton e.g. anemones, high do point aquatic incompressible so developed skeleton acts of highly compounds ice oats that buoyancy for organisms cells, support columns xylem of gives some surface tension organisms surface of live – on water 5 1.3 Carbohydrates – sugars Carbohydrates Learning outcomes are organic compounds that have the following properties, they: On completion should be able of this section, you contain have elements C, H and O to: the general formula C (H O) x describe the structure of the form of include state and the β monosaccharides (e.g. y glucose), disaccharides (e.g. sucrose) glucose and 2 ring difference between polysaccharides (e.g. starch, glycogen and cellulose). a glucose Simple describe explain the structure of sugars sucrose Simple sugars are monosaccharides, which have the formula C (H x the relationship which the structure and function H 6 and of O 12 two foc us as they are donate aldehyde and four , ve, six or seven. Glucose with the in y formula is an example. Glucose molecules exist as straight chains and as 6 ring the reducing agents electrons from ketone often forms the –OH two sugars three, Most about Simple is sucrose. rings. S tudy x of C glucose O) 2 between below of is dependent carbon forms different glucose atom the ring glucose properties at in on and the ring β 1. (beta) The with polymerised roles (see form position position and are the to page as of shown the two the form –H and forms –OH here. There –OH are a above groups (alpha) the are with ring. macromolecules These with very 8). their groups. They 6 CH OH 6 2 CH OH 2 are known as reducing sugars. O C C 5 O 5 H OH H H H H C 4 C C C 4 OH H OH HO OH Link H OH H 2 C C C 3 2 3 H n solution, glucose is in the the straight ring form. n the chain form an giving as a the straight sugar. For its agent. group page group molecule reducing ketone see aldehyde and more is is ability a to act has a reducing information on this are component Glucose other is and Trioses at and RNA) in are six hexoses carbon are water in fructose soluble. the to and more these detail of in blood and It of is and so is an galactose. the form animals. It Glucose of is example is of a a hexose polar carbohydrate readily taken molecule that up sugar; by and is cells and polymerised used as a a source to raw and of form energy a in respiration polysaccharide material to make other for energy storage compounds, e.g. disaccharides common monosaccharides that you will come across are pentoses acids will on have ve carbon atoms and trioses that have three. be page 62. the organisms provide Complex sugars in Monosaccharides respiration atoms molecules nucleic important metabolism has transported that looked a and β glucose. The numbers refer to the carbon atoms therefore Other nucleotides (DNA glucose metabolised: Link of chain Fructose also glucose exposed 18. Pentoses OH and Figure 1.3.1 form H transition between OH are joined together to form complex sugars known as photosynthesis, for disaccharides. The diagram from glucose shows how this happens in plant cells that example. make sucrose water is glucose is removed molecule known reaction covalent 6 as a that and water and is and an C2 glycosidic because bond so of the bond is fructose. oxygen fructose and formed. therefore the The very In ‘bridge’ the reaction, forms molecule. type of The reaction glycosidic strong. a between bond molecule C1 bond is is a a of of the that forms condensation type of Module CH 1 OH 2 CH OH S tudy 2 foc us O O H H H H When H OH H HO CH OH Benedict’s 2 f H OH OH sucrose is boiled solution with is nothing hydrolysed by happens. reacting H with H hydrochloric acid or the enzyme O 2 CH sucrose HO HO OH sucrase then the glucose and OH 2 CH fructose OH released react with 2 O O H H Benedict’s H solution to give a colour H change. H OH H HO See page 18 for more details. HO O CH OH 2 glycosidic H OH OH bond H between C1 Figure 1.3.2 In fact, sucrose reaction is the of and glycosidic makes bond transport to is and a formed as as slower way its Sucrose is and polar the are a the but shown. not sugar less-reactive than that CH of is and available to formed in react. for glucose by but It transport in not lack 18). for as form of may in 1.3.2. involve plants groups This page Figure does soluble, ketone (see sugar shown formation water aldehyde non-reducing have in complex, Sucrose fructose sucrose advantage never more water phloem. glucose is much elimination in and C2 Formation of the disaccharide, sucrose The the transport reactive as the reactivity be plants an as the animals. OH 2 CH OH 2 O O H H H H H OH H HO HO O CH OH 2 H OH OH H H O 2 CH OH 2 CH OH 2 O O H H H H H OH H HO HO HO OH CH OH 2 H OH OH glucose Figure 1.3.3 H fructose When the glycosidic bond in sucrose is broken by the addition of water, two monosaccharides are formed The a type of reaction hydrolysis in which water is added to break a glycosidic bond is reaction . Summary questions 1 Dene the following monosaccharide; condensation; 2 Use a simple and β terms: hexose; 4 carbohydrate; disaccharide; glycosidic bond; Make simple breakage Make of a diagrams a to glycosidic show bond the formation between two and hexoses. hydrolysis reactions diagrams to show the difference 5 Make 6 Suggest a list of the features of carbohydrates. between why glucose is transported in animals, but glucose. sucrose 3 of table glucose to and compare the structure is transported in plants. and functions sucrose. 7 1.4 Complex carbohydrates Glucose and other monosaccharides are used as monomers to make Learning outcomes polymers and On completion of this section, for be able describe polysaccharides , for cell the structures monomers. Figure 1.4.1 shows of of an existing chain with the are used for Polysaccharides a glucose formation energy are storage made monomer added from to starch, of a glycosidic the bond. the O polysaccharides: O O glycogen O and which walls. to: end as cellulose you many should known making O OH cellulose H O 2 explain the the relationship structure between and function of the O O O O O O O OH polysaccharides. addition growing of glucose end of to a 1,4 amylose glycosidic between C1 bond and C4 Did you know? Figure 1.4.1 The formation of a glycosidic bond between the end of a polysaccharide and a glucose monomer Cellulose organic is the most compound common on Earth. The Glycosidic bacteria, fungi and termites and recycle it as important carbon role in dioxide the bonds that form between C1 at the end of the growing chain that play an C4 of glycosidic biosphere. the unbranched glucose bond From If chain monomer that the forms rst glycosidic energy glucose bonds. amylose amylopectin glycogen and amylopectin therefore to carbon make joining that glucose formed. A 6 is being these a branching are point growing another glucose added monomers branching on added amylopectin but has to the is points monomers known The is can in formed chain. chain are added a together . by type 1,6 form this as 1,4 way of There a glycosidic glycosidic with an adding more are bond. 1,4 three polysaccharides: Amylose is monomer monomer bonds storage all has many more more are 1,6 forms of starch. glycosidic branches. Glycogen bonds Glycogen than is is very similar amylopectin sometimes called to and ‘animal starch’. The three energy storage polysaccharides are made from a glucose monomers. Cellulose not Polysaccharide used Monomer Glycosidic a 1,4 is for bonds a long chain energy molecule storage, but for made from making Structure the β glucose cell monomers. walls of It is plants. Role starch amylose glucose unbranched chain amylopectin a glucose 1,4 and 1,6 a glucose 1,4 and 1,6 right-handed branched not glycogen – a 8 β glucose 1,4 storage in plants energy storage in animals, chain helix branched chain, branched than cellulose energy helix more amylopectin fungi and unbranched grouped straight plant chain some into cell bacteria bundles walls within Module 1 Cell and molecular biology polysaccharides S tudy To help you similarities the foc us understand and biological simple the differences polymers, diagrams of between make some amylose, amylose amylopectin CH OH 2 CH 2 OH annotate 2 O O their H H H H OH OH OH etc. and them structure glycogen with and points about and function. You can etc. O do O O the same for proteins and nucleic O acids. OH OH OH 1,4 glycosidic bond glycogen CH OH 2 O H H etc. H OH O 1,6 glycosidic bond O H CH OH CH 2 OH OH CH 2 CH 2 O H O H H O H H H H etc. H H H H OH OH OH OH O O H O OH H OH 2 O H etc. OH Summary questions O OH H O OH H OH 1 Figure 1.4.2 Explain why starch and glycogen Two polysaccharides: amylose and glycogen make suitable energy Structure and function molecules for storage suitable for and cell cellulose walls of is plant cells. The storage compact. polysaccharides Amylose and are insoluble amylopectin are in water , stored in unreactive plant cells and as starch 2 grains and glycogen is stored in animal cells as smaller granules. Draw a diagram formation amylopectin glucose can and be Alternate β are to glycogen added glucose or have branches removed molecules as are they required arranged have by at a many places a growing cellulose molecule. 180° This helix, with many projecting –OH groups on bond to point in make to each other as hydrogen gives a straight chain, bonds molecules with adjacent bonded cellulose together by both sides molecules. hydrogen Find of the chain that is very strong. Microbrils are in a criss-cross pattern to provide even a new branching glycogen. out bonds A bundle forms the arranged in more names of the i ii a a polymer of polysaccharide of of two or more monomers; a plant components of plant cell walls cell other walls the to iii microbril show glycosidic not made cellulose 1,6 they fructose; form a where following: a of cell. 3 added to As than cellulose; iv cell wall strength. components of bacteria and fungi. 4 Explain how glycogen and macrofibril cellulose are suited to their microfibril functions. CH OH H CH OH 2 H OH H OH OH H H O H etc. OH 2 H OH H H OH H H O H H H OH O H H CH OH 2 Figure 1.4.3 H O H OH H Close packing of cellulose etc. molecules in a microbril and the pattern CH OH of microbrils in a cell wall 2 9 1.5 Lipids Lipids are organic compounds composed of the same elements as Learning outcomes carbohydrates, In On completion of this section, addition be able describe a the molecular good of how a the of are energy molecular why of as higher same ratio structure of as hydrogen to oxygen. polysaccharides The two groups of lipids described with here, biological main phospholipids , also The groups glycerol of attached have have the These phosphate carboxylic to units. same acid form and group ester of units basic are structure fatty with acids. nitrogen-containing fatty acids reacts groups with the –OH bonds. Triglycerides phospholipids the and three attached. are Each suitable much structure phospholipid explain and Phospholipids triglycerides sources describe a the structure triglyceride explain have have to: glycerol of not monomers. triglycerides they do you repeated should but they component membranes. are triglyceride different 1.5.1, as molecule fatty they acids, have the full carbon chain. Saturated carbon atoms in Figure the carbon three As 1.5.1, with chain identical lipids polar have and are storage tissue) in rich oils. released as as They are are the and fatty have acids bond are of more oil in during mass in carbon of fat Seeds carbohydrate they or as are in have acids. are not (adipose especially storage more B along long-term tissue because much between atoms fatty Figure the such excellent energy molecules to There in triglycerides groups special A bonds different make respiration, of double –OH for attached Some plants. efcient reduced as between than stored acids. unsaturated, mixture rather fatty such any are hydrogens. a three acids , hydrogens T riglycerides highly same of not have water . oxidised, from fewer droplets oils they When than and do double groups in glycerol fatty others molecules. and acids therefore –CH of saturated Some one acids; many Fats carbohydrates fatty least and fatty animals hydrogens. at are complement chain. insoluble energy in the consists some than of all energy those is protein. H H H C C glycerol C H H H H O A H C C O three fatty H C acids C O B H C C H 3H O 2 H H C O O C O triglyceride H C O C O H C O C H Figure 1.5.1 Glycerol and three fatty acids combine to form a triglyceride O C ‘water-hating’ O tails: C phospholipid O C ‘water-liking’ head: Figure 1.5.2 P = phosphate = choline hydrophilic A phospholipid is composed of glycerol, two fatty acids and a phosphate- containing part 10 hydrophobic C Module 1 Cell and molecular biology Phospholipids Each phospholipid Attached often to to that phosphate not one a in on top with of T wo to layers of This is the biological Fat Fat need we need stored is food is no fat food and balance become experience over a 30 a food result per a good cent be tails a fatty a in that and This acids are region. either If in form hydrophilic a layer heads centre. with regions covered the the acids. group hydrophilic will with bilayer fatty choline. have in bilayer the ill from diet health. organs, for excess a central contact is the on page are two the also we a with water . structure of 36. would good than population there is being and can of good people in do of and is there There classify body a variety people mass index as 20% recommended mass fat are of ways obese or (BM) including: more mass for to above height; greater than the body 30. when negative their diet. as fat not food obesity obese so at energy enough epidemic as into in as these when are excess in Did you know? we soluble energy protein than classied fat periods are that known decient obtain the more are people Many an be acids are provider scarce have D, Humans store obese. they during they balance they countries is and fatty vitamin energy food even fact as carbohydrate energy or in else insulation. when energy overweight of is providing more many such otherwise Fat periods positive There anything thermal convert use thing. vitamins, shortages; in will as (‘water-hating’) spheres form two phosphate two molecule hydrophilic which the a phospholipids phospholipid Some in and have of and is such whereas the tiny will make and can who group, hydrophobic two is During People As fat suffer scarce. may diet cannot have glycerol glycerol and obesity acids. energy eat. the protecting or storing we and for little and and of human to form the of of hydrophobic layer phospholipids fatty vitamins a will and region basis which essential and membranes, the makes single or in the diet in consists groups soluble, This a water water hydrophobic –OH water region water the attracted is water . (‘water-liking’) contact the nitrogen-containing ‘head’ soluble molecule of or to with very obese. Summary questions 1 Dene the following terms: fatty acid; glycerol; ester bond; saturated fatty acid; unsaturated fatty acid; hydrophilic; hydrophobic; monolayer; bilayer ; obesity 2 Make a table to phospholipids. as 3 the differences Explain term compare why the (Remember between triglycerides structure to include and functions what they of have triglycerides in common as and well them.) are efcient sources of energy and good for long- storage. 4 Explain 5 Find: i the the importance names of of the phospholipids two in essential fatty organisms. acids in the BMI human diet; ii Category the below fat 6 soluble The body vitamins; mass iii index the risks (BM) is to health calculated body of using mass 20 underweight obesity. in the following formula: 20–35 acceptable 25–30 overweight over 30 obese over 40 very kg _________________ BM = 2 (height a Calculate A the 1.65 m, b Use c What the BM for 45 kg; table advice to B the following 1.63 m, identify would you in people: 64 kg; C the give metres) 1.65 m, appropriate these four 75 kg; D 1.45 m, categories for each 75 kg. person. obese people? 11 1.6 Proteins Learning outcomes (1) Amino Proteins On completion of this section, acids are polypeptide should be able describe the structure state of that consists of an made from unbranched one or chain of more polypeptides. amino acids. A There are 20 to: different macromolecules you generalised amino there they all types share of amino the same acid that cells molecular use to structure make as proteins. shown in However , Figure 1.6.1. acids are 20 different H amino acids used to H make group O proteins explain how amino acids differ H OH R from one another residual describe the formation Figure 1.6.1 breakage of a peptide group and A generalised amino acid molecule bond. All amino carboxylic and a acids acid group hydrogen the group the generalised a group. that atom is have is carbon Attached specic then the then –CH central to amino the to the atom, the central type acid amino an is of atom amino glycine, acid is amine is acid. which alanine group a a hydrogen If it is (see and is the atom another smallest. Figure 1.6.2). If In 3 Amino acid amino acid this Three-letter group R is known as group R for residual. Comments abbreviation glycine gly –H smallest amino many found collagen close methionine met –CH –CH 2 –S–CH 2 rst to allow for packing amino acid primary sequence when polypeptide –CH a is produced on ribosome (see page ala of 2 every alanine acid; in a 71) non-polar R non-polar R which a group 3 glycine H CH 3 H O H N O phenylalanine phe N H OH H CH OH H 2 has structure formed hydrolysis condensation H atoms alanine O 2 2 cysteine dipeptide cys –CH –SH sulphur-containing 2 H O H CH 3 H R group; forms O covalent disulphide N H OH peptide H The formation and breakage of a peptide bond bonds between parts H bond 12 of H carbon Figure 1.6.2 group, ring of a polypeptide or between polypeptides Module When the two amino acids C of the carboxylic group of the other forms a (see tripeptide. A are joined group of Figure together one 1.6.2). polypeptide a amino The peptide acid addition consists of bond with ten of or the forms N of another more linking the Cell hormone molecular biology Did you know? The acid acids. articial 200 times dipeptide antidiuretic and amine amino amino 1 Phe Gln Asn Cys Pro NH Ile Gln Asn Cys Pro NH sweetener sweeter of two aspartame than amino sugar. t is is a acids. 2 oxytocin 2 Figure 1.6.3 Two nonapeptides (with nine amino acids) that are biologically active. represents the N terminal of the peptide; the opposite end is the C terminal.) (–NH 2 R groups The R properties groups that of polypeptides project from and the proteins central are chain dependent of: on Link the –C–N–C–C–N–C–C–N–. Proteins As you can see from the table some amino acids have polar groups that membranes attract water molecules, but others are non-polar and do not. This polypeptides can have a sequence of amino acids with groups part of Some R These The form groups attract groups form rm link a hydrophobic phospholipid position –SH to a to of each to react in negatively to form to to link polypeptides or ionic polypeptides together attachments different form other cysteine can that can pass through the position of page page and 66. of If amino maybe Some amino the acids molecule. the substrates signalling receptor is is form is a different positively charged t in a important disulphide parts of a as two bond. polypeptide act Link to together or is not random. ‘pockets’ will molecules the molecules, not areas, t into as genes the are these in as you structure function which ‘pockets’ such by then or will like will will discover be function ‘pockets’ antigens Any the change charge proteins more enzymes are information active in to page on them 49. on different differently. the ‘pockets’: enzymes hormones, t into binding sites S tudy in foc us molecules t to into the binding amino distribution. substrates, in The You 36. adjacent These The polypeptide determined special into this groups. together . changed polypeptide have Other acids sequence proteins on bonds. refer sequence hydrophobic information central sites, for The more bilayer . ionise to region through a non-polar see R have means region, for that pass so messenger will be sites acids This in in antibody these means molecules ‘pockets’ that and the are not required to remember molecules. changes molecules, antigens will not the such t and shape and as the different but if you can properties the in the types of next it of amino acids, helps to explain the proteins as highlighted section. non-functional. Summary questions 1 Dene 3 the following: amino peptide dipeptide tripeptide polypeptide. Make from acid a a diagram dipeptide Give in 5 a three an cysteine. annotated Explain drawing the of the importance amino protein Find of this the acid amino an how a amino tripeptide is formed acid. the is the sequence of amino acids important. names ii why of: i some production of the two amino proteins amino acids and acids that give are that form not used in their functions. acid 6 in and reasons aspartame; Make show bond 4 2 to Write short proles of the nonapeptides antidiuretic proteins. hormone and oxytocin. 13 1.7 Proteins Learning outcomes (2) Levels of organisation A On completion of this section, polypeptide Each should be able describe the four levels straight has a by joining denite ten or number more of amino amino acids acids. together . They describe the proteins in in a chains which spontaneously form into specic are formed shapes. of The organisation formed polypeptide to: as is you table summarises the levels of organisation. protein bonds that hold Level of Description Comments shape. organisation primary sequence of amino acids determined structure that position of disulphide position bonds a-helix β-pleated sheet tertiary further folding structure to of complex polypeptide 3D will form both two more structure associate polypeptides together to form the a right back a at have and sheets polypeptides identical and sheet polypeptides a-helices β-pleated quaternary a helix to form some shape in determines polypeptide folds forth gene protein cysteines these handed or the the polypeptide forms structure give of sequence where secondary by codes for or can be different protein Primary amino structure acids disulphide are ribbon Did you know? folding Some but proteins no have beta-pleated example is alpha helices, haemoglobin, are on page composed beta-pleated broin silk that spun by is 16. which Some is almost sheets a give a – -helix (the arrows latter in proteins) – further complex -helices sheets, as and well as distinct structure of example, component silkworms of of proteins entirely – for major of without secondary covered wide with -pleated regions sheet structure to structure sheets. An as models Tertiary sequence structure -pleated drawn – position bonds Secondary and and and of spiders. Figure 1.7.1 The three levels of organisation of a polypeptide 14 Module Bonds that There are four hydrogen and stabilise bonds bonds that form 1 Cell and molecular biology proteins stabilise between polypeptides: polar groups, such as the dipolar –NH –CO ionic bonds hydrophobic disulphide hydrogen form between interactions bonds bond ionised between between between amine polar the R and non-polar S-containing carboxylic side R acid groups chains groups of cysteines. groups OH central CH bonds of CH 2 ionic carbon atom O O an amino acid 2 between ionised R groups CH C CH 2 2 2 hydrophobic O NH CH 3 interactions between non-polar R groups CH Link 3 CH CH For more information about 2 hydrogen bonds, see page 4. CH 3 disulphide bond (covalent) CH CH 2 Figure 1.7.2 After 2 The bonds that stabilise polypeptides proteins are produced inside cells by the assembly of amino acids, Summary questions they are might further processed. There are a variety of ways in which this happen: 1 The addition composed group of of of a prosthetic amino acids; haemoglobin group for and that example, is part haem of a that protein is the not Find a ribbon protein prosthetic show the regions Polypeptides haemoglobin haem are assembled and catalase to give both a have protein four its quaternary polypeptides structure; each with has a group. Chains of sugar of the of it to secondary catalase. structure diagram lysozyme. Annotate molecules may be added to the polypeptide to form and tertiary explain structure quaternary structure. function of lysozyme. Find how why but it not State the a 2 out many polypeptides glycoprotein. there Polypeptides may be cut into two or more pieces and joined are happens in the formation of a surface are proteins forming hydrophobic insoluble in are soluble hydrogen R groups in bonds that amylase; insulin; insulin. glucagon; Globular the following together , proteins: as in water with hydrophilic with water molecules. exclude water . Fibrous R groups on Internally proteins catalase; anhydrase; the the functions there carbonic myoglobin. of each State of these proteins. are water . 3 Explain the and the difference primary its structure secondary between of a protein structure. 15 1.8 Proteins Learning outcomes (3) Globular Globular On completion should be able explain section, difference and brous describe of this the are soluble in water and folded into complex 3-D you to between proteins molecular haemoglobin structure proteins proteins shapes. Fibrous such a proteins are insoluble in water and have simple shapes, to: the globular of and fibrous its and cells; and helix. collagen material structure relate as Haemoglobin is a between bone. Both brous cells are in is a protein globular that structures formed from is a such more protein major as found component tendons, than one inside red of blood the ligaments, muscles polypeptide. its transport Haemoglobin functions Each describe the molecular a of collagen and relate molecule globins to are A haem with groups four carry four one red show the composed the centre of of molecules second oxygen it look not of made ferrous of amino temporary this of acids; that The ) (Fe bond means oxygen. iron at chemically its centre. with an each haemoglobin the shape molecule. of addition haemoglobin oxygen of the This makes it making easier this makes cell. t blood is molecule lls estimated cell it easier to accept the fourth. contains changes form shape exposing opening the out haem from groups a to is it Each – two a haem is of molecule. rst million to it very the As molecule molecule easier accept This ‘tense’ accept there can to of the accept third the and is because in the haemoglobin form to a more oxygen. a that polypeptide about not polypeptides polypeptide as 280 four each molecule makes haemoglobin red is In haemoglobin circle. This blood each a groups changes ‘relaxed’ if is atom forms haem molecule a group an oxygen turn within globins. foc us of sometimes β 2+ haem Diagrams haemoglobin two its function. different S tudy and this group. structure of structure polypeptide molecules, one! each polypeptide helices, but no has alpha beta-pleated sheets Did you know? Haem group is – an a example part of a of a polypeptide prosthetic protein molecule 2 Fe that is not Proteins that are made like not this, of amino acids. containing made of amino parts acids, Figure 1.8.1 are called conjugated haem polypeptide Haemoglobin has quaternary structure proteins. Collagen Collagen is cartilage, an tendons, organisation A molecule form triple acids S tudy R foc us Remember more than that one quaternary any protein polypeptide structure. that has has helix. with of be them. wound The to form a it as is made network is triple of the third not take together helix The of not bres. bres as joined of in each of has of bone, levels of the helices do a helices between structure covalent weakness form amino smallest the bonds tertiary by that to 1000 means hydrogen triple lines other about This the skin, several polypeptides together the no has to haemoglobin. Glycine space. many again are of around acid. much ends there identical form are those consisting amino up toughness Collagen as wound long, folded The so three and helices provides same are are that muscles. the These every does tightly within and quite polypeptides triple haemoglobin. not helices. glycine so protein ligaments are collagen The (–H) coincide 16 that left-handed group can extracellular of bonds not where Module the bres may structures pulling break. such as This tendons arrangement that have makes high collagen tensile suitable strength and 1 Cell for biology Link Cellulose collagen similar b molecular resist forces. a and is is a a polysaccharide protein, but and both structural features have and covalent functions. Try comparing their bond structure and function Summary question 8 by completing below. glycine 300 Figure 1.8.2 nm a The triple helix of collagen; b triple helices are joined together to form collagen bres Figure 1.8.3 Collagen bres from human skin. Notice the characteristic banding pattern that is visible at this magnication in an electron microscope (the bres are 300 nm wide). Summary questions 1 Explain why following: protein haemoglobin globular with is protein; quaternary an example conjugated of 5 the protein; Explain its how the structure of collagen is related to its structure of haemoglobin is related to Draw a table to and functions compare of the structure, haemoglobin and distribution collagen. transport functions. Explain why collagen is an example of a brous Collagen and broin proteins. State how (see their page 14) are structures both brous differ. Find some computer-generated haemoglobin protein. 4 the structural functions. 7 3 how structure. 6 2 Explain 8 show their Draw a of collagen and of annotate them to structure. table function and models to compare cellulose and the structure, location and collagen. 17 1.9 Qualitative Learning outcomes biochemical Test for The On completion should be able describe starch; of this section, tests starch reagent for the starch test is the iodine in potassium iodide solution you (known simply as 1 The substance 2 If iodine solution). to: the biochemical reducing sugars; to be tested may be a solid or a liquid. tests for non- solid, place a sample of the substance on a white tile or in a Petri dish. reducing state sugars; the positive results for Colour proteins; these change and lipids tests. with 3 If 4 Use liquid place into a test-tube. negative iodine a dropping pipette Result Explanation positive iodine starch starch-iodine to add iodine solution. solution yellow-orange or no to blue-black blue change; remains iodine solution yellow-orange present negative no no starch The foc us to call the reagent for test ‘iodine solution’ the centre complex iodine to of the which bind helix has a of amylose blue-black to form colour to for the solution sugars reducing of copper sugar test is Benedict’s solution – an sulphate. the 1 starch starch for reducing reagent alkaline Remember to present Test for S tudy binds If the substance to be tested of the is solid, make a solution with water . not 3 2 Put about 1 cm test solution into a test-tube and add an equal ‘iodine’. volume 3 Boil 4 W atch (The with change on Benedict’s boiling a Benedict’s water bath carefully test-tube placing Colour in of into a for may water be solution. (do not colour put bath heat directly with a Bunsen burner). changes. into with a water boiling Result Explanation positive sugar bath at about 80 °C rather than water .) solution 2+ blue to green/yellow/ reduces copper(II) ions ) (Cu in Benedict’s solution + orange/red with to a reducing sugars change; solution Benedict’s remains necessarily (Cu ) to form a precipitate of copper(I) glucose) negative no reducing sugars present to react with copper(II) ions blue Test for If a test may is 18 ions oxide (not no copper(I) present precipitate non-reducing substance contain sucrose 1 Divide 2 T est A gives a sugars negative non-reducing (see the page test with sugars. result The with only the reducing common Benedict’s into two solution equal as parts, above. A test non-reducing 7). solution sugar and B. it sugar Module 3 Add a few drops of dilute hydrochloric acid to B and boil for a 1 Cell and molecular biology few minutes. 4 Cool the sodium 5 When A B A B – – – add dilute test to sodium (beware, with the Benedict’s boiling will solution as solution or solid zz). above. Result Explanation negative for green/yellow/ sugar, reducing no negative for change change and reducing positive for orange/red no hydroxide latter solution change blue Test for The change on Benedict’s no – and carbonate neutralised, Colour with test-tube hydrogen hydrochloric non- sucrose sugar reducing both reducing non-reducing no sugars acid acts to fructose for reducing sugars hydrochloric present acid to the catalyst protein test is biuret solution (a solution of If the substance Place 3 Add 1 cm of to the same should be tested is solid, make a solution with record water . may test solution in a test-tube. in carry the and be side Colour to volume of biuret solution and mix by shaking the these all on t Make tests for is the them easy sure you details in as you the to forget tube procedures. side. change with Result Explanation S tudy biuret out lab. learn tested practical from sugars foc us examination. the using non-reducing copper 3 2 both hydroxide). yourself 1 hydrolyse are after any S tudy sodium to that even hydrolyse You and a glucose sugars proteins reagent sulphate as and foc us solution What if samples contain both reducing blue to violet/purple/ positive a coloured complex forms where and non-reducing sugars? What lilac there are peptide bonds would be the results for samples A and B? Attempt Summary question 4 and no change to the blue negative no peptide bonds present see if you are right. colour Summary questions Test for lipids 1 Lipids as are insoluble ethanol. This in test water , makes but use they of are this soluble in organic solvents Make a summary these biochemical 2 Crush any solid some ethanol. If test the material to be tested in a pestle and mortar and add test is a liquid just show tests. Use add some ethanol and shake headings: (starch, method; negative to column biochemical reagent; substance to fact. the following 1 table such etc.); positive result; result. dissolve. 2 3 Pour off the test-tube of ethanol, water which (do not may have dissolved some lipids, into a Make to mix). a ow test a sample tissue for reducing Change when adding Result You have Explain cloudiness – positive the ethanol dissolves the lipid; emulsion addition to water the lipid throughout the water sugars. a tiny particles – an Some solution no lipid present to glucose that is a why the and fructose. be used Benedict’s to conrm test this. plant material glucose and contains sucrose. Explain emulsion how negative of as both change storage non- is 4 dispersed no plant and how on cannot an of reducing show water mixture white to Explanation 3 ethanol to chart be dispersed test you to can use conrm the Benedict’s this. 19 1. 10 Quantitative The Learning outcomes biochemical tests in biochemical On completion should be able of this section, here you Section is attempt 1.9 present to make explain how to carry test for out a qualitative. not how results much They is tell you present. quantitative to that The varying the tests described degrees. The reducing nal reducing how quantitative to carry test for out Benedict’s test semi- sugars describe all to: quantitative but the Semi-quantitative are tests is green is much colour sugar then change is the with present in Benedict’s a test concentration test sample. of the gives For an idea example, reducing sugar if is of how the very much nal low; colour if red it a higher . One way to improve this estimate is to make up a series starch. of colour standards using a glucose solution and Benedict’s solution. 3 1 T ake 20 cm of a stock glucose solution of known concentration, –3 e.g. 2 100 g dm Make a series of dilutions from this stock solution, e.g. 50.0, 20.0, –3 10.0, 5.0, 3 Place equal 4 Carry and 5 out 1.0, the the Y ou now have of the Benedict’s or boiling test-tubes permanent S tudy 0.1 g dm volumes heating Cool 0.5, test all and dilutions as the in into Section test-tubes keep labelled them 1.9 for (maybe test-tubes. (using the same take equal volumes length of photographs time). for a record). a set of colour standards. foc us –3 Concentration of t is important to glucose/g dm Result on testing with Benedict’s carry out the solution procedure when in exactly the making the that you colour know the same way as standards so results are valid. you do them differently you be sure about the estimates of the 50.0 dark red 20.0 red 10.0 orange f cannot accuracy of your concentrations. 5.0 yellow 1.0 6 green 0.5 light 0. 1 blue Carry out exactly 7 Cool the the the the Benedict’s same test procedure test-tube concentration and of on as place a solution when next reducing green to sugar; of making the the the the colour test substance colour standards answer may be using standards. to a determine range, –3 e.g. A S tudy test between like this, 1.0 and which 5.0 g dm can give you an estimate of the concentration, is foc us semi-quantitative. Summary question 1 you some some fruit gives juices results from testing for sugar. Answer reducing question 20 before the continuing. This test weighing against in can it the be on a improved balance. concentration any test substance graph. Y ou can try can this by The of be for removing masses glucose. the The determined yourself in precipitate, recorded can be drying plotted concentration by taking Question 4 an on of it on a 25. on then graph reducing intercept page and sugar the Module Quantitative test for T o make can the make a iodine series test of 1 Cell and molecular biology starch for starch dilutions of quantitative a starch we solution. 3 1 T ake 20 cm of a stock starch solution of –3 known 2 Make concentration, a series solution, e.g. of e.g. 100 g dm dilutions 50.0, 10.0, from 5.0, this 1.0, stock 0.5, 0.1, 0.05 –3 and 3 0.01 g dm Place equal labelled 4 Add the each heat 5 same these Place as each a with optical are percentage Plot the of dilutions iodine (remember it is Benedict’s test-tube the (results of volume test-tube detects 6 volumes into test-tubes. into a as to necessary to solution). colorimeter , density recorded solution not of the Figure 1.10.1 which Testing a solution of starch with a colorimeter solutions absorbance or Link transmission). graph of the colorimeter readings against the concentration of You can read more about using a starch. colorimeter 7 Follow 8 The exactly the same procedure with any test to an intercept on of the starch in the test sample the sample. concentration concentration determine can be found by taking on page of starch in a solution 52. graph. Summary questions 1 A student following Fruit juice juices Colour after orange-red Q green R blue the table reducing method Explain Make a with Benedict’s on sugars the opposite boiling page to with solution Benedict’s estimate in the three fruit juices. of nding out the concentration why the fruit 3 some fruit P Use 2 tested with the results: the actual Benedict’s test cannot Explain show solution the concentration the limitations in any whether test or of of this substance. not fructose is in juices. table to show how to make the following dilutions from a –3 100 g dm starch solution: –3 50.0, 4 Explain the reducing 5 Draw the 10.0, difference 5.0, 1.0, between 0.5, 0. 1, 0.05 qualitative and and 0.01 g dm quantitative . tests for sugars. a ow chart decrease in to show the concentration procedure of starch in that you bananas would as use they to determine ripen. 21 1. 11 Biochemistry Y our Learning outcomes summary Unit questions On completion of this section, be able recognise questions and those the multiple-choice that test that understanding list the short and this section with different answer knowledge based on to There also knowledge are ways in questions which are to requires levels of do the to of is the organisation have the you what chapter . these knowledge on the In and CD the three next types section of questions understanding that relate to there of this are are more chapter . each chapter . will test section are to your of labelled show recall the subject with you K where knowledge areas you (knowledge) they apply. and have your ability and covered. U They of will K to The apply MCQs in (understanding NOT be labelled of like in the examination. answer In the examination you put your answer on a sheet. Haemoglobin is an example of a protein with: A primary structure B primary and C primary, secondary D primary, secondary, to is (polypeptides) of only secondary structure only and tertiary structure only of work tertiary and quaternary structure (K) question. A haemoglobin levels right your questions understanding made Which so organisation it of the following shows the correct bond associated with each of of the globins all four test this know 2 four show in longer you not anything from molecule will foc us proteins. You out short-answer answers. of MCQs your 1 the questions, questions. S tudy about longer The special 1 requiring (MCQs) this Question multiple-choice Multiple-choice questions this answers answer we topics questions knowledge) plan questions of test written consists to: like test you In should 1 biological molecules shown? has and D Disaccharide Polysaccharide Protein Triglyceride ester glycosidic covalent peptide peptide ester glycosidic covalent glycosidic glycosidic peptide ester glycosidic peptide ester glycosidic answer. A B C D (K) Question 2 that the hold turn. then 3 S tudy at Section answer. This is these in 1.4 an multiple-choice negative to check example question statement. the exam, Look as your of a with a most often they Starch on to and you the match together . think next. glycogen is are It the The up is the a right right macromolecules good idea answer answer polysaccharides. is to for read the and each rst the bonds column column in and C Which one of the following feature of starch but not of is glycogen? A Starch is B Starch has C Starch contains 1,6 glycosidic bonds D Starch contains 1,4 glycosidic bonds made an from a glucose unbranched component (U are each case, you have to work out whether the statement applies difcult. to 22 move sub-units what to out for In the Circle you foc us a Look requires glycogen or not. The only statement that does not apply is B of K) Module Short answer questions 1 Cell and questions variety of in Paper different 2 are answered in a different way and involve completing Question responses: 5 matching completing writing pairs (see Question sentences one word 1 on (Question answers page 24) terms When 4) table (Question For writing sentences 5b) (Question 6a and giving labels describing on a diagram or pattern or trend interpreting 4 Copy information in you from a table or in write and collagen the form of text, table, graph using the or diagram. the each of the following spaces is essential for life. It passage by most is the main makes component substances of dissolve up most of the cytoplasm in … bonds that form that the … between the a tops those of boundary over 5 to a wide State Collagen very body in fluids, water between molecules between range what and tall is of trees. water so water which They and such as making it molecules explains meant by the are are air . temperatures haemoglobin blood. make has State TWO types of an haemoglobin bonds, have in … State three are responsible THREE structure ways of in T riglycerides a Explain suitable b Explain for cell and how for polypeptide triple helix, but polypeptides. questions ask between why water two responsible W ater remains it a as term also has primary high in … three n both points as a and there marks is for able the the … available. Describe and Refer then to the link it to the glossary for to … technical terms. at state . structure of a S tudy protein. foc us proteins. other than peptide bonds, that 7 is not an essay question, collagen you will need to structure your common. which the structure of collagen differs carefully, deciding on a from to answer the question. You haemoglobin. phospholipids the structure energy how three has four least structure might 6 both for strategy the make about . answer c the storage structure of are in triglycerides than of found animal makes carbohydrates, phospholipids and plant them such makes cells. glycogen. them a table compare more as or want suitable always you give the one or good answer rst, once membranes. a if to question more idea you have numbered to can asks items. plan cross written points you t to is your it your out answer in full. Longer Paper total 7 2 of answer question also 15 has some longer answer questions and each of these has a marks. Carbohydrates a Describe b Explain Proteins and the why proteins structure glucose perform many is are of biological glucose soluble roles and in inside molecules. sucrose. water , cells; but starch starch is an is not. energy storage molecule. c i Explain of ii how the structure of a protein differs from the structure starch. Explain why performs a Many excellent but and a relationship at Question b about proteins. give something these appropriate travel think two you and function. function. the the b cells the The part provided. are different of syllabus. suitable b and the haemoglobin, haemoglobin structure W ater is graph about word(s) it denitions drawing Notice complete in difference chains forming and why the b) e.g. a given comparing collagen you learn answering each sure shows to tables the foc us a important biology (SAQs) S tudy The molecular proteins perform multiple roles, but starch only one. 23 1. 12 Practice exam-style questions: Biochemistry Try the following questions 1 Figure 1. 12. 1 shows eight as examination biological practice. B A CH C OH CH 2 molecules. Study them OH S tudy 2 carefully O H OH H H H and then answer the questions that H N COOH C Before 2 OH OH H OH OH follow. you H answering each question, biological choose molecules and one of OH carefully write down D CH CH OH E OH it relates to. You molecular and H each molecule for more and there may be more at all. letters that you do not them. Circle amino acid that is a of OH N OH OH signicant G CH H N C collagen that identify Put question 3 OH CH CH you them. CH 3 H parts H H help major any COOH C 2 use 2 constituent CH 2 O an H O F a identify HO H H one H or to 2 OH question try CH than OH one the structures O may H choose at 2 O letter look OH H the 2 the start H OH H H In foc us O N C H C H C N CH H C H CH marks by the side of 3 those 3 you don’t 2 O b disaccharide found in the know. Try O H that is polymerised C C molecule with a peptide molecule that form fatty f molecule an amino hydrolysed C C O O H O O C O H C O C O C O O to acids with hydrophobic g is H C H bond C e C cellulose O d O H H H H form H to hydrophilic and regions acid that forms Figure 1.12.1 disulphide 2 A student The bonds tested results Tissues of in some the proteins plant and biochemical Results of animal tests are tissues shown to find in the out which biological molecules Benedict’s Iodine S tudy solution solution Biuret Ethanol reagent water and Look red B precipitate contained. yellow-brown lilac white blue blue-black blue no emulsion C green blue-black lilac no emulsion D yellow yellow-brown lilac white emulsion E blue yellow-brown blue white emulsion foc us carefully down write A they table. biochemical tests the across columns some notes of to the the help rows Use the i contain ii did iii contain b State c What not the biochemicals from in the table to state which tissues: starch contain lipids which your any and tissues conclusions Explain 24 information sugars proteins. are can answer. reducing likely be to made be plant about in the origin and relative explain and you results. a and table emulsion identify precipitate your concentrations answer. of reducing read questions rst. H molecule to O the phloem c P not sugars in the five tissues? the Module 3 The table in as Copy each You below living an includes statements roles of and molecular biology water: complete the living table organisms. by indicating with a tick ( ) which one of the properties of water is responsible for role. should Roles of put only one tick water in each heat transport blood medium plasma surface for walk row. Properties of High to the Cell organisms environment for and about 1 and small water specific Strong capacity cohesive forces between water High molecules heat of Solvent for vaporisation molecules polar and ions in phloem insects on major component sweat used movement in of of heat loss water in xylem prevents body 4 A wide variations student carried Benedict’s the in temperature out a quantitative solution. After precipitate. The filter the test, paper Concentration of test for the with Initial reducing reaction the sugars mixtures precipitate was by testing were filtered, dried mass of filter and known concentrations using filter then paper weighed. The Mass of filter paper and of of glucose known results are mass, in Difference the in with to remove table. mass/g –3 glucose/g dm paper/g precipitate 0 0.84 1. 16 0.32 20 0.83 1. 17 0.34 40 0.81 1. 17 0.36 60 0.82 1.27 0.45 80 0.84 1.24 0.40 100 0.83 1.27 0.44 a State which b Describe result the is an anomaly. precautions that the student should S tudy take are c to make sure that valid and reliable to find how the Approach the student’s reducing sugar method can be concentration foc us results collected. Suggest after drying/g used of question a fruit six questions has six logically, for marks allocated example you if should part b write of at this least precautions. juice. d Explain state using 5 why the the student glucose this would not concentration of be able to the fruit juices method. a Describe THREE ways in b Explain why the energy c Explain why cellulose is which polysaccharides available in suitable for glycogen making differ from can cell be made walls of polypeptides. available very quickly. plants. 25 1 Cell 2. 1 Introduction and molecular Learning outcomes Using We On completion of this section, be able use see dene the light microscope microscopes are so small. in biology There are because two many types of of the things microscope that that we you want need to to: know a cells you to should to biology terms resolution about: and light electron microscopes magnification describe how to use a microscope list the The differences animal and plant principles electrons are electrons pass a light cells as the two by types lenses of microscope on an object are to similar . be viewed. Light The or light through or are absorbed or diffracted by the object. or Further seen focus the light or beam of electrons so that an image of the object microscope. can a be eyepiece viewed. condenser lenses give In a lens, the light microscope objective lenses microscope the such and an ability to as that in eyepiece magnify Figure lens. the 2.1.1, The object there is objective by ×4, ×10 objective or lens lens ×40. The image formed by these lenses is magnified by the eyepiece (4) lens, which power), is usually ×100 ×10. (medium The power) overall and magnifications ×400 (high are ×40 (low power). objective objective lens of focused between lenses with microscopes. light 10) (40) No matter how impossible to microscope stage to clips see is detail. much see an very limited The object fine by is detail. the resolution magnified This is wavelength of your eye in the because of is light. light the microscope, resolution Resolution about 0.2 mm is (200 of the it is the ability µm), which coarse means focus that any objects closer together than this are seen as one object stage not two. Y ou cannot see any object smaller than 200 µm. The resolution condenser slide fine of your eye is a function of the density of light receptor cells in your lens focus retina. light The resolving light and light has about Figure 2.1.1 how a half power the of wavelength the a light size microscope is is interrupted between interrupt dependent by 400 nm the light objects and rays on in the the 700 nm. and can wavelength specimen. Objects be seen in of Visible which the are light A typical school or college microscope. Anything that is smaller than 200 nm cannot be seen. The light microscope (the condenser lens is light microscope has a resolution of 200 nm (0.0002 mm), which means beneath the stage) that two points Anything S tudy the foc us in –6 1 nm = 1 × 10 3 mm; there are 10 nm light size and in separated smaller , such microscope are resolved as are and photographs by this cell distance membranes, magnified we taken can can then see through seen cannot small them the be be objects directly as separate seen. larger through If images than the objects. in 200 nm eyepiece eyepiece. 3 in a µm; there are 10 µm in a mm. Magnification size of rules S tudy an for is image, the ratio such calculating as a between drawing magnifications the or actual a and size of photograph. actual an size of image ____________ = actual When calculating actual sizes magnications always size actual drawings/diagrams never 26 centimetres. photographs in millimetres, of image _____________ take measurements from size and or size = magnification and Remember sizes: foc us magnification object the these Module Drawing Y ou can 1 Cell and molecular biology cells make temporary microscope cell preparations Remove as a leaf Elodea. stain plant from Place with coverslip of on a on iodine top and a animal water slide solution. and dry plant, in the such water Put middle and surfaces of the top slide. and Place cytoplasm of each nucleus cytoplasm slide in turn microscope on the and stage focus of with nucleolus the the low You power objective lens (e.g. ×4). When change to the medium can look at animal cells in by focus, lamella a strand bottom wall cells. power placing tissue on some a crushed slide, liver staining with cytoplasm lens and then the high power lens. methylene with Figure two 2.1.2 types shows of cell drawings made of under a blue cover and covering slip. these high nucleus power . Figure 2.1.2 When you make make the a high drawing power fill at drawing least half of cells, the space Drawings of a leaf cell of Elodea and a liver cell (magnification = × 1000) follow these provided; simple leave rules: space Link: for Look labels and annotations at page drawings, use a sharp pencil (e.g. HB) and never use a use clear , internal make show know cell The sure that e.g. to show the of should have the be proportions the same contents present; are do of the outline same of as width : length cells not use – draw any the cells and any drawings the cells you on asked plan to of and high make cells from power the same slide. are ratio what shading you or see not colouring what for you the 2.1.2 are and differences summarised in between this the plant and animal cells in S tudy Plant Animal cell cell membranes Plant Animal resolved cell cell They chloroplast large Feature in are visible as shape vacuole a the cytoplasm approximate 40 – the label you too small put what they ‘cell you be of by are labels on not membrane’ are boundary to microscope. indicated although if outer are light often drawings wall foc us table. Cell xed advice be contents. Feature cell may drawings microscope the you details similarities Figure lines details drawing, continuous you pen plan 35 for (notes) labelling the is cell. 20 size/µm nucleus Summary questions S tudy 1 Describe how to make a temporary slide of plant tissue and focus it with In the high power of a Summary Find out why 3 Explain question microscopists use phase contrast and uorescence microscopy. and width millimetres and magnication. the difference between the terms magnification and Calculate answers the to actual the sizes nearest of the cells micrometre. shown in Figure of the measure divide cells the by in the Remember to resolution. multiply 4 4, microscope. length 2 foc us 2. 1.2. Give your by 1000 micrometres to the and nearest to give round whole a up result or in down number. 27 2.2 Cells – electron Learning outcomes Cells The On completion of this section, be able light more detail microscope microscope state the electron explain an differences and the electron light between 400 microscopes advantages of microscope in using times range that of resolution and identify far not greater show the details resolution. A of cells. beam of For this electrons we has need a organelles from of 1.0 nm taken and than in therefore that of a structures the electron a light and resolving power microscope. even large of This 0.5 nm allows molecules in which us to see microscope. 2.2.1 Figure shows animal 2.2.2 a an electron drawing micrograph made from the of a human white blood cell micrograph. and electron micrographs of the plant and animal cells were made with plant transmission electron microscope . The electron beam passes through cells the list the animal differences and electron plant between cells as seen specimen can in be to replaced operator can hit photographic with view a the paper fluorescent image and to screen search make or for the digial image. camera suitable The so features paper that the to photograph. micrographs. nuclear envelope nucleolus nuclear pore cytosol cell membrane nucleus Golgi body mitochondrion rough endoplasmic reticulum Figure 2.2.1 Electron micrograph of a Figure 2.2.2 Made using Figure 2.2.1 showing the organelles in a white blood cell white blood cell (× 6700) (× 6700) The electron beam is focused by magnetic lenses in a column that Link: contains column An electron micrograph of a is on page the so that the the Pumps electron specimen 30. fluorescent 28 specimen. are beam used is not to remove deflected the on air its from the pathway plant through cell a photographs electron a is terms The micrographs of better magnication and a sub-cellular are Figure of with to: wavelength does you a should in microscopy screen. to the photographic paper , digital camera or Module The following table lists the differences between light microscopy 1 Cell and foc us microscopy. Use Feature Light microscope Electron the internet wavelength/nm 400–700 learn 1.0 resolution/nm 200 0.5 highest ×1000 ×250 000 without study loss are of advantages (at of best: using 1500) both (or light and electron electron on cells. Use these to recognise the organelles page 31. more) microscopes to cells. Light such microscopes as division The can movement movement detail of how to listed magnication to nd microscope micrographs There biology and S tudy electron molecular of of vacuum of be used cells, and which in in and means see living nuclear movement observed fixation to phagocytosis, chromosomes cells specimens processes of of that all and living division processes, digestion, (mitosis and meiosis), cytoplasm. electron staining cells intracellular microscopes kills water them; must are they be are dead as the observed removed as part in of a the preparation. V arious cells in techniques, light required Some of in artefacts Light The electron the combine Images of the and All in when the in Light the are are be not used very the thin to the in produce thick buy living stains to metals that cause specimens. It is so the easy to miss thin. either the iodine, natural methylene colours blue slides). are in black colour-enhanced to heavy specimens, (e.g. prepared view and beams. structures colour , stains to cells. quite thick microscope cheaper cell this used fixatives are (100–500 nm). are for be the electron living see sections of can of microscopy distort to colours use deflect penetrate stains are to in used electron microscopes may microscope the contrast, the electron and cut specialised images in cutting or phase without cannot be light specimen many can beam must computers that microscopes electron structures as microscopy used proteins objects specimens stains with – such microscopes than and white; images. electron microscopes, S tudy which also need Eukaryotic resolution trained ribosomes of light technicians are only to operate 25–30 nm and across, so maintain they are below the Make sure you Electron cells, microscopes such as include a column for microscopes. the features foc us them. allow ribosomes, viewing that are of not very small visible in structures the light within question you choose in Summary 4. microscope. Summary questions 1 Calculate Figure the actual length of the cell shown 4 in 2.2. 1. Make a animal section 2 Explain the microscope and 3 List of: advantages to palisade the i (see the view white page cells, mesophyll organelles the using such the as cell; in ii the palisade and white blood 5 cells Suggest an show on the cells page differences shown in between the gures in the this 30. investigation microscope the to plant electron cells. visible blood 30 for of table and electron palisade mesophyll is best; ii the in which: light i the electron microscope is best. micrographs mesophyll cell cell). 29 2.3 Cells and Cells Learning outcomes On completion should be able dene the of this organelles section, have obtain gain produce list the energy of and functions convert it to carry into out: usable form raw materials from their surroundings to: term biological molecules, such as carbohydrates, lipids, proteins organelle organelles animal variety you and a in plant nucleic acids and package excrete store materials so they can be exported from the cell cells outline the functions of waste materials the and retrieve genetic information. organelles. Y ou can cells in S tudy foc us the the of a eukaryotic cell as generated, materials in information gained, exported, which energy stored, products substances the moved It reproduce is also raw made and blood would destroy bacteria and a factory animal that table your cells occur that with opposite diagrams. to through rest of plant the are cell the are organelles. compartments different. previous For The because example, section structures the the that labelled functions of conditions lysosomes in a contain the the in enzymes a that digest whole white membrane-bound all the biological cell. blood Lysosomes cell takes structure molecules. are up otherwise required into to break they down the vacuoles. and the the organelles that you need to know about. = clearly visible in school/college light microscope. that S stands structures spun in a for and membranes protein unit which macromolecules. It is used refers to to measure how they small sediment centrifuge. structures Svedberg – are made examples are of mitochondria and chloroplasts and as the annotate adding cells all fibres – examples are centrioles. organelles cells. Use Keep about the of label information animal these require kept shows Sub-cellular all these the into in sub-cellular can foc us in be that table Note diagrams in The waste when large cell must cellular Make processes micrographs and about itself. S tudy and localised These * removed. cell electron compartments. is The components are the into a white complex factory from divided plant cell that Think see are The hair-like flagella surface (singular: structures flagellum) are known also as made cilia of (singular: protein cilium) and fibres. more you work book. Figure 2.3.1 Electron micrograph of a palisade mesophyll cell from a leaf. You can see five chloroplasts, a nucleus and a large central vacuole. Between the chloroplasts are two mitochondria that are smaller and paler. (× 3500) 30 Module Organelle Features rough at endoplasmic reticulum (RER) sacs smooth endoplasmic reticulum Golgi like (SER) body Function(s) of membrane enclosing uid lled ribosomes space RER outer surface RER but is covered with no in pile of at sacs with the mitochondria formed (singular: lled matrix mitochondrion) inner ribosomes on outer makes triglycerides membrane vesicles forming around modies edge surface of single two membranes area for protein and secretory attached lysosomes to and is surrounding highly folded enzymes for RER or free RNA in (30 nm membrane to give site of synthesis; to Golgi (fats), *chloroplasts many (plant area for body phospholipids, – diameter; membranes other proteins; makes lysosomes respiration made of assemble giving large pigments amino acids to make proteins 80S) surrounds uid lled chlorophyll, and large with contain out internal packages vesicles aerobic enzymes for parts particles only) protein respiration cytoplasm in a uid enzymes cells out proteins cholesterol apparatus) ribosomes carry transports ribosomes surface (or Golgi 1 surface site and of of cells and all the destroying and for worn digesting food bacteria reactions of photosynthesis enzymes cell membrane surface (or cell bilayer membrane) (see of page phospholipid with proteins cell 36 for features) boundary; controls retains exchange of cell contents; substances with surroundings nuclear envelope structure outer pass *nucleus like that surface; between clearly visible of pores ER to with allow cytoplasm in LM and and EM ribosomes on substances separates to allows darkly centrioles (animal made cells only) the staining of base area in when stained contains nucleus protein bres, of a cytoplasm; between the two nucleus DNA *nucleolus nucleus from movement structure in store produces is similar to assemble cilium/agellum of genetic information as chromosomes ribosomes the spindle chromosomes when to move nuclei divide Summary questions 1 Make a poster organelles, You may large you 2 wish work your the synthesis energy of to table. You Name ii that includes their functions make can way export that of by poster white the are iii blood of each within in to of the the form this the 3 cell. of a poster involved the i as in; i the cell; and digestion the following other mitochondria body; 4 how each iii nuclear the intake Describe from course. proteins from transformations; materials roles information through organelles and the add drawings and Make a Name in and smooth pairs structure chloroplasts; and rough of organelles differ and function: ER; ii iv nucleus cell and Golgi membrane and envelope. list the functions of the functions organelles that you that have that are occur involved in in cells. each of the listed. cells. 31 2.4 Eukaryotes and The Learning outcomes cells because On completion should be able of this section, the to: of identify eukaryotic cell cell cells in they into the electron microscopes describe the light a the nucleus, cells have organelles. This much state the pages which is complex Organisms 2.4.1 has all structure of shows these a are the eukaryotic meaning membrane such simpler diagram or features as cell of cells. the structure do is is term systems bacteria This that not called subdivide have this sort prokaryotic. – of for the features example, seen plenty of in prokaryotes. bacteria do No one have flagella. cell cell differences not a loop previous and capsules prokaryotic in and cell have These structure. Figure prokaryotic described eukaryote. you prokaryotes of wall DNA between capsule prokaryotic outline the and eukaryotic cytoplasm cells endosymbiotic development of eukaryotic cells. storage cell granule membrane Link ribosome Look at the diagram and the table to flagellum see how prokaryotic the functions Section pages 2.3, 30 to you cells carry identied Summary out Figure 2.4.1 in question 4, The features of prokaryotic cells on 31. Structure Features capsule thick, Functions compact, slimy layer outside cell wall provides protection for bacteria, reduces cell wall made from murein, polysaccharide cell (surface) phospholipid not cross bilayer cellulose; linked with into murein mesh proteins; by no is a cholesterol ribosome contains ribosomes, contains bacterial smaller (note storage granules partially than of granules, enzymes; have glycogen, 20 nm no lipids diameter; 70 S (singular made of one bre and protein phosphate store enclosed by membrane agellum) genetic material of smaller chromosome DNA (prokaryotes 32 base loops; have is both no to when in potential allow entry and protein synthesis, other reactions synthesis energy loop are of in nuclear DNA; the plasmids cytoplasm envelope) are stores copy and to give bacterium of of haploid lipids for synthesis rotates moves bacterial bursting water ER) and not dehydrating permeable membrane agella higher parasitic phagocytes substances chemical in of respiration, chromosome eukaryotic: prokaryotes stores storage of of cells from solutions exit against chances prevents peptides membrane cytoplasm e.g. genetic each (see corkscrew through information; gene, page so 80) motion; liquids one prokaryotes are Module The differences between prokaryotic and eukaryotic cells are listed in 1 Cell and molecular biology this table. Feature Prokaryotic cell Eukaryotic Plant typical size/µm 0.5–3.0 capsule found cell wall membrane-bound in some (murein, not cellulose) ribosomes smaller: nucleus DNA bacterial loop of 20 nm/70 S chromosome DNA in is a cells Animal 40–60 20 organelles cells (made of cellulose) 30 nm/80 S 30 nm/80 S chromosomes cytoplasm cells nuclear made of linear DNA found within envelope Endosymbiosis Endosymbiosis is the idea that organelles have evolved from prokaryotes. S tudy Mitochondria They both and chloroplasts share many features with have: Symbiosis a loop foc us prokaryotes. of DNA although some mitochondria small transfer 70 S which genes are in is similar that to control the bacterial features chromosomes in the in interact chromosome, chloroplasts gain and means with benet from endosymbiosis, nucleus cells ribosomes that each in a the cells mutual molecules that only function within the organelles coded for by genes in the mitochondrial and chloroplast similarities bacteria as suggest shown in that Figure these organelles have been live inside In other to led, so prokaryotes it is evolving DNA. into The both association. and thought, are species and benecial arrangement. This RNA two other derived mitochondria and chloroplasts. from 2.4.2. loop of DNA Summary questions nucleus anaerobic prokaryotic ancestral cell cell of 1 photosynthetic eukaryotes – the terms eukaryote and prokaryote. algae aerobic 2 and Dene List the structures found in: plants prokaryote i both prokaryotic eukaryotic aerobic cells; prokaryotic photosynthetic ii cells; cells only iii and in only in prokaryotes prokaryotes eukaryotic cells. Dene term ‘invade’ ‘invade’ anaerobic cell 3 cell and ancestral aerobic prokaryotes cell into supports eukaryotes that the idea. – protists, fungi Find out about Lyn Margulis, and of the early champions of animals the Figure 2.4.2 endosymbiosis evidence non-photosynthetic one mitochondria the of 4 develop the outline idea that organelles, such as Endosymbiosis mitochondria evolved by and chloroplasts, endosymbiosis. 33 2.5 Tissues and organs Some Learning outcomes eukaryotic There On completion should be able of this section, you dene the terms tissue and list the differences tissues, organs between and the with they are different body a are unicellular species processes nucleus. described of of Many as a these consisting and protist eukaryotes multicellular . they occur are single cells. classified within have Cells of bodies specialise one as mass divided in of into different organ functions many All cytoplasm to: cells, are protists. organisms cells, organ Groups and of examples are similar of organised cells epithelial are cells together known that as to give sheets tissues. forms The sheets of or masses table of cells. includes some cells. systems list the and major organs in plants animals make a section plan of a drawing plant of a Type of Single or Surface Example of epithelial Shape multi- features location cell layered squamous single none alveoli cross organ. in the lungs multi- S tudy none epidermis layered The outer layer of the skin is Epithelia line the the single microvilli of organs, such as thin the oviduct and kidney tubules the extensions intestine, lining – inner short, surfaces skin an cuboidal epithelium. in foc us of the cell membrane trachea. to increase surface columnar single area microvilli lining small intestine single cilia lining and lining Tissues are groups Organs are structures several The major table of similar composed functions shows you cells for the examples that of carry different out the tissues same that oviduct function. carry out one or body. of plant and animal tissues and organs. Plant tissues Plant organs Animal tissues Animal organs epidermis leaf epithelium brain, chlorenchyma stem muscle tongue, sclerenchyma root blood spinal eye individual parenchyma trachea bronchus, cord, and ear muscles, bone e.g. xylem cartilage phloem adipose biceps individual bones, e.g. femur liver, pancreas, stomach, large intestine, ovary, 34 small testes, and kidney, uterus Module In animals, organ systems comprise of several organs that work 1 Cell and bring about sensory, one major muscular , function reproductive, of the body. digestive and The excretory, endocrine of organ systems in systems are the will have to distribution through from the the make of root plan tissues. of making plan drawings of mammals. images Y ou foc us nervous, Practise examples biology together S tudy to molecular drawings Figure R anunculus . of sections 2.5.1 shows Figure 2.5.2 a through organs transverse shows a to show section plan stems of cross and sections leaves that of you roots, can download. drawing made section. b air space xylem a epidermis cortex (parenchyma tissue) endodermis phloem Figure 2.5.2 A plan drawing made from the section of the root of Ranunculus Figure 2.5.1 a Transverse section of a root of Ranunculus with b an enlarged view of the transport tissue (xylem and phloem) Follow this make guidance the around drawing the use a use thin, when fill drawing sharp pencil making at for (e.g. least half labels HB) plan and and drawings: the space provided; leave space Link annotations never use a pen TS the single, boundaries continuous of the lines to show the outline of the organ and is make same do the as not proportions in the abbreviation for (also called a transverse cross section) tissues and the section of the tissues in the plan drawing exactly the LS is the longitudinal abbreviation for section. section include drawings of cells and do not shade or use any colours. Summary questions 1 Dene 2 List 3 the organs that terms: tissue, comprise reproductive system, female Find list out blood, 4 the following Find leaf, and and skeletal, out and stem, organ and the following reproductive the functions organ system organ systems system, in digestive of the following animal of the following plant humans: and tissues: male nervous. muscle, epithelial. list root, the functions xylem, phloem, parenchyma, organs and chlorenchyma, tissues: sclerenchyma epidermis. 5 State 6 Suggest the purpose some of making advantages of plan drawings being of sections multicellular rather of organs. than unicellular. 35 2.6 Cell membranes Eukaryotic Learning outcomes the On completion should list be able the of this section, contents inside you cells the of cell components of cell main The arrangement proteins the arrangement components explain state why in a cell floating external the surroundings. organelles that They described provide also on a form page barrier between compartments 31. of in of membranes these a sea interior and molecules of lipid. are is phospholipids known as Phospholipids hydrophilic surfaces a and fluid form facing a proteins. mosaic bilayer the with with cytoplasm a the inside surroundings. Some protein molecules are associated and with or outside of the membrane, but transmembrane proteins pass are the membrane forming pores and channels. mosaic describe 2.6.1 gives the false impression that the components of a the functions membrane of membranes membrane membranes as uid and its the components the Figure and are of of through known cell that The hydrophobic describe a composed to: membranes are components of are fixed in position and do not move about. In fact, the cell phospholipids are in constant motion moving about within each membranes. monolayer , which phospholipid generally two S tudy 2.6. 1 may you shows can have why remain is the membrane ‘flip’ from within different one their in is described monolayer monolayer order to face to and the as fluid. the the Some other , but composition different of the environments. foc us a simple diagram rarely to copy draw and it in move able surface. that they monolayers Proteins Figure is molecules to For about move within over example, the the lipid. whole carrier The surface proteins for proteins of the glucose of cell, and epithelial but cells remain sodium on are one are learn. You Paper restricted to the intestine. They microvilli on the surface of epithelia of the in the small 2. are not found on the side epithelial cells that faces capillaries. Link Follow the advice about nding animations of membranes given other cell on page diagrams v and surface the Component of on internet. cell membrane Function phospholipids proteins glycoproteins chains of – proteins sugars with attached on short form uid, permeable impermeable transmembrane receptors for exterior side cells a bilayer that so proteins and to as ions hormones, nerve barrier between exterior of cells and cytoplasm about molecules and proteins sites for a move non-polar to between recognition acts can large are polar molecules channels and carriers neurotransmitters cells other and similar muscle cells at synapses between nerve cells when forming tissues during development glycolipids sugars – lipids attached cholesterol with on one exterior chain of recognition stabilises sites for the non-polar and lymphocytes phospholipid bilayer by binding to polar ‘heads’ and ‘tails’ controls uidity temperatures 36 antibodies side by and preventing becoming phospholipids too uid at high solidifying at low temperatures Module 1 Cell and Figure 2.6.1 carrier channel molecular biology A diagram showing the fluid protein protein glycolipid glycoprotein mosaic structure of a cell surface membrane cholesterol phospholipid 7–10 nm bilayer Functions of At cell membranes surfaces: S tudy Function Comments barrier many water-soluble across; cell, permeability large such partially some permeable and proteins; through cell many movement by bulk substances or ow extended area for that the larger cell through in the small as phospholipid cannot into pass diagram intestine. surface. you would Use preceding to of an epithelial one 2.5 transmembrane pass proteins See required leave a columnar Draw Draw expect help LS through cell from in microvilli the on organelles to nd Sections a the in 2.2, this 2.3 cell. and you. through microvilli to absorption through membrane vacuoles. are Make pass and transmembrane cannot transmembrane from pass through bilayer cannot semi-permeable) substances surface phospholipid that cannot ( not can others membranes increase membrane molecules proteins, substances bilayer absorption as substances foc us in through are the carried small endocytosis proteins vesicles and bilayer to or or exocytosis Summary questions on page 39 1 recognition receptors have binding sites for Dene the following terms: cell cell-signalling surface membrane; fluid mosaic; molecules, such as hormones and growth factors phospholipid bilayer; cholesterol; glycoprotein; glycolipid; Within cells: transmembrane protein Function Comments form 2 Describe the membranes compartments isolation of hydrolytic enzymes in lysosomes do not harm the in a of eukaryotic cell. so 3 they distribution State the width of a cell cell membrane. concentration their substances, e.g. enzymes and substrates provision of of of 4 areas chloroplast with and different mitochondria pH, e.g. have interiors visible rest of Suggest in large surface chloroplasts in the why and mitochondria have visible electron not microscope. membranes are as two parallel micrographs of lines cells membranes magnied chloroplasts molecules, have such membranes for as by 100 000. many pigment 6 Find vacuoles surface body and vesicles membrane and Golgi summarise the uid cell and the evidence chlorophyll for transport light are for forming ATP area intracellular membranes cytoplasm often provide why different 5 pH from Explain move into the body to cell substances from cell, from surface mosaic structure of membranes. cell RER to Golgi membrane 7 Explain have why plant cells do not microvilli. 37 2.7 Movement across Cell Learning outcomes to On completion should be able of this section, you – membranes move they may to: in are be list the move ways across in which dene and Some membranes describe active exocytosis, dene the out of raw and outside barriers cells. to Substances materials. cell the movement, W aste products leave but enter they because substances to be also used allow cells move need out elsewhere substances them because or they because they cell. substances too big and are small must be enough enclosed to pass within a through the membrane membrane, in vacuoles some or vesicles. simple diffusion, facilitated osmosis, are substances are and their toxic function membranes diffusion, Movement is either passive or active. by diffusion transport, Passive endocytosis term water potential. movement Molecules The cell energy cross does comes Metabolic example, blood from on a to the may use its kinetic be of energy used to oxygen gradient own of create from the the the maintained down energy air by their to concentration move the gradient. molecules. The molecules. gradient in in alveoli breathing the in and first the the place lungs flow – into of for the blood heart. diffusion. soluble Molecules substances Oxygen from energy Simple are need movement relies the membranes not and small carbon and Facilitated such as pass through ethanol dioxide are pass small the phospholipid readily enough through to pass bilayer . the Fat bilayer . through as both uncharged. diffusion. Polar molecules cannot pass through the Did you know? phospholipid open Aquaporins are special all the with a polar lining to to diffuse in or to there allow are channel movement proteins down a for them. gradient. These are Carrier out of also allow movement, but these open when molecules bind allow to water time so channel proteins proteins bilayer them, they are not open all the time. W ater molecules are polar and cells. they cannot Osmosis. of water higher easily This is through water pass a a special type partially potential high through to a the of bilayer diffusion permeable place with (see that page involves membrane a lower 36). from water the a movement place with a potential. concentrations low concentration carrier S tudy carrier foc us protein protein This diagram shows concentrations either side of of the the different substances on membrane. channel protein simple diffusion Figure 2.7.1 Water facilitated diffusion active transport This diagram shows the different ways in which molecules cross membranes potential Link W ater Osmosis and water potential potential another focused page upon in more detail is the tendency of water to move from one are and is determined by: on the quantity of water the concentration present 40. 38 of solutes, such as ions and sugars place to Module the pressure exerted by the cell wall (in plant cells and 1 Cell and in animal Solutions with molecules. of solute high water Solutions with potentials have low potentials water low concentrations have high of Channel solute concentrations molecules. moves and from proteins a solution with a high water potential to a a low water potential. Cells contain cytoplasm and carrier transmembrane are proteins are proteins. Channel used carrier in facilitated proteins in solution facilitated with foc us cells). diffusion; W ater biology prokaryotes, S tudy not molecular plant cells diffusion and active also transport. contain such as cell potential always into cell travel water forth of than the water sea and sea out. tap of water . is cell no a into net are cell movement in movement is about solutes, lower water molecules cells the movement contents many much W ater When net the contain have move The water , there potential cells membranes. move same: or molecules into These thus water across water placed about The vacuoles. ions, distilled more gradient potential Active and large and with When usually molecules. back cell. their sugars water , potential the is inside compared distilled water into sap proteins, placed down of water and of S tudy foc us the out is of Vesicles the term or vacuoles? Vesicle used to describe is a small vacuoles. water the same as the water . movement Active transport. present in cells diffusion. by very Some substances Cells have these they to other , then soil in against proteins them. to They their accept the to will out! in not T o that root on from cells one so into these gradients. to one that glucose are move gain respiration molecules absorb cells concentration by molecules happens kidneys inside move released move This the tend energy to required outside. will moved shape and they own Carrier release water be their change are concentrations Instead must use substances. membrane, from low substances move side side of to absorb it is the the ions not lost in urine. Bulk transport. endocytosis. Cells For take example, in particles from phagocytic their while surroundings blood cells take by in bacteria. Summary questions These or are much through the membrane. too bilayer This Lymphocytes large so pass are reduces produce to through enclosed the in quantity antibodies that the a of transmembrane vacuole made membrane are large at of the molecules. proteins cell cell surface 1 surface. These Dene the following diffusion, terms: simple diffusion, are facilitated diffusion, vesicle, enclosed within vesicles made by the Golgi body and move to the cell vacuole, active transport, surface membrane. They fuse with the membrane so that their exocytosis, endocytosis, secretion. contents are membrane vesicles expelled becomes and to the part vacuoles of outside the requires cell by exocytosis. surface energy from The membrane. the vesicle Movement 2 of cell. 3 Exocytosis Explain why in Explain there why to cell of vesicle and out are cross of cells. special Endocytosis channel contents substances membranes food released to surroundings particles cell surface proteins (aquaporins) for ‘stick’ water. membrane vesicle fuses 4 with cell the differences between surface the following membrane to vesicle Explain cell surface pairs: i channel infolds surround protein particles and carrier protein; ii moves simple towards and facilitated diffusion; cell vacuole moves iii surface through passive and active transport cytoplasm membrane and may fuse with across a membranes; iv secretion lysosome and protein molecules packaged are excretion; v exocytosis and endocytosis. into Golgi body modifies and packages proteins lysosome releases vesicle for export from the cell by exocytosis or enzymes for digesting particles taken in by into vacuole 5 Find to digest food of endocytosis particles and Figure 2.7.2 examples endocytosis exocytosis and list them. Bulk transport across membranes – exocytosis and endocytosis 39 2.8 Investigating Learning outcomes water Salty solutions During On completion should be able dene the of this section, potential your course you should develop your skills of experimental you design, data presentation section deals and data analysis and interpretation. This to: terms water potential immersing with these tissues in skills in solutions the of context different of investigating water the effect of potential. gradient, plasmolysis, turgid, Read through the four investigations described in this section and answer flaccid the explain that type diffusion osmosis is a questions describe and explain the immersing plant and in solutions of more questions on this topic in 1 animal the fruit of an egg plant, Solanum melongena , into equal-sized different sections. water are effects Cut tissues There 2.10. Investigation of follow. special Section of that Place the sections into five different concentrations of salt potential. (sodium chloride). Concentration of The results sodium are summarised here: Observations on the egg plant tissue –3 chloride/mol dm compared 0.00 rmer (distilled water) 0.25 very 0.50 slightly 0.75 softer 1.00 very with freshly cut tissue similar softer –3 Figure 2.8.1 than in 0.50 mol dm soft Sections cut from egg plants make good material to investigate osmosis and plant cells. The changes happen very quickly. Investigation Add one observe S tudy foc us sample red The are results in Investigations descriptive or 1 and drop the and blood of 2 fresh place on a of to the different contents microscope slide concentrations of the and of test-tubes. observe the salt. Stir Remove and a appearance of the cells. 2 qualitative. Try Concentration of Summary blood appearance question 2 on page 43 sodium Observations of the blood –3 chloride/mol dm using your plant and knowledge animal S tudy Do not refer solutions. actual given It in a and 0.00 (distilled water) to is a present, cells red present, solution few 0. 15 cells ‘weak’ best to low or or and 0.25 shrunken cells present, no red solution 0.50 shrunken cells present, no red solution present, no red red solution solution refer if to ‘strong’ to they say their are that a high of the 3 solute This is tissue. 40 cells 0.06 Investigation concentration concerned. no foc us question has osmosis cells. concentrations solution of an investigation to obtain some quantitative results using plant Module Choose a suitable plant tissue such as the storage tissue from tubers 1 Cell and or yam, potato, Solanum Dioscorea alata . tuberosum ; The part of sweet these potato, plants Ipomoea that you eat biology of: S tudy European molecular foc us babatas ; is storage These are the variables in this tissue. investigation: Use a cork cylinders borer or or a chip machine to cut the storage tissue into independent sucrose T rim same the – concentration of ‘chips’. ends so they are squared off and make the pieces all solution the dependent derived – change in mass length. Weigh the pieces and record their individual – percentage change in masses. mass Place the pieces into separate test-tubes each containing solutions of sucrose as shown in the results table control – type immersion, After 12 hours reweigh the pieces and record the this mass investigation because percentage the it is initial change in necessary masses mass is of the to calculate the tissue, length potato derived the percentage pieces variable. It temperature, of volume results. of In of below. are is change different. calculated in Can The solution. you think of variables? There as control variables any is more more on control about page 59. follows: change in mass ______________ percentage change × = original Concentration of sucrose 100 mass Initial Final Change in Percentage change Mean solution/mol dm mass/g mass/g mass/g 0.0 1.26 1.49 0.23 18.3 1.23 1.51 0.28 22.8 1.22 1.43 0.21 1.22 1.31 0.09 1.28 1.32 0.04 3. 1 1.25 1.31 0.06 4.8 1.43 1.29 –0. 14 –9.8 1.32 1.26 –0.06 –4.5 1.34 1.25 –0.09 –6.7 1.32 1. 10 –0.22 –16.7 1.26 1.07 –0. 19 –15. 1 1.22 1.05 –0. 17 –13.9 1.28 0.98 –0.30 –23.4 1.25 1.01 –0.24 –19.2 1.23 0.97 –0.26 –21. 1 1.3 0.95 –0.35 –26.9 1.27 1.01 –0.26 –20.5 1.23 0.96 –0.27 –22.0 percentage in change –3 0.2 0.4 0.6 0.8 1.0 mass in mass 19.4 17 .2 7 .4 5. 1 –7 .0 –15.2 –21.3 –23. 1 41 Module 1 Cell and molecular biology Three there pieces is in were the concentration pieces of rather than These results used results. then potato all you cannot in the are for If each there can be say little that labelled same plotted concentration is the so to variation results they are see in are put how the much results reliable. into for The separate variation each three test-tubes container . on the following graph. 20 15 10 ssam 5 ni egnahc 0 egatnecrep 5 10 15 20 25 0.0 0.2 0.4 0.6 0.8 1.0 3 concentration Figure 2.8.2 of sucrose /mol dm Graph to show the effect of immersion of potato storage tissue in different solutions of sucrose The Link curve there Use the data conversion on page graph so 45 you to plot a can nd the is drawn no we can we could on change use this the in graph mass. intercept predict that it passes This on the would did through not graph to happen. zero happen find Use the the per in cent any of at the which results, concentration intercept at zero at but which per cent –3 water potential storage in kPa of the potato to find the concentration, which is 0.28 mol dm tissue. The changes in water between solutions texture, the length tissues and and the mass are sucrose the result of movement of solution. –3 In osmosis more out decrease in of concentrated the cells into than the 0.28 mol solution so dm the water pieces of moves by tissue size. –3 In solutions osmosis S tudy of is there water, no net it from concentrated the surrounding than 0.28 mol solution into water dm the cells so moves the by pieces of foc us tissue When less is is no overall movement best to state that diffusion of water In increase the solution movement there move by in of and membranes osmosis. solution in in which water . out do like size. of not this. In there this the cells there no change through suddenly So is solution, is become no net water the in mass there molecules cell surface impermeable diffusion of are is no still overall able membranes. when water put by in to The a osmosis. Plasmolysis Investigations see the was in onion 42 1 changes the and that blood scale 3 cells leaves to were occur in see carried to the out Investigation the with individual changes, 2. W e such plant cells can as tissue in the use those and it is difficult to storage tissue as epidermal tissue from in Investigation 4. it Module Investigation 1 Cell and off the epidermis enough to fit sucrose or salt microscope under the below and slide a of an cover leave in the microscope onion slip. them Put for solution and scale look the 10 in leaf pieces cells Put they like cut into into minutes. which for and different each were those pieces solutions piece on immersed. in the Figure increase surface this the of turgor volume potential. cells with by of water the as it high the has Cells moves vacuole, against pressure solutions the distilled membrane pressure In 2.8.3 a, cell an filled which wall. equal with Most of water the each of cell pushes The and concentrations osmosis. into the of When Observe and like this sucrose force are or comes cell wall salt, and cell withstands known organisms terms osmosis water potential. isotonic always It and between is not the cells refer best hypotonic, since behaviour solutions, as happens water the about of to to use hypertonic or to turgid from in water photographs. osmosis writing movement a cytoplasm cellulose opposite water by foc us small the In biology 4 S tudy Peel molecular moves vacuole of they cells they to describe in do the different not explain what them. out that a decreases the cell in size, wall. membrane have In lost space with and their distilled solution The fills plasmolysis pulling water all this and the the the external in turgidity increases cytoplasm between the cells the cell cells are of and the cell from surface condition plasmolysed. away is known Cells like as this (soft). turgid. percentage membrane This are flaccid cell wall solution. condition are and As the concentration plasmolysed cells of increases the salt until at –3 0.5 mol all dm concentration pushing to the In the against pressure water into the cell 3, the over time not wall the the Figure therefore potential cell storage was (see plasmolysed, and water of solutions plasmolysed are The potential the However , are cells potential. Investigation put cells contents tissue very pieces of the this in cell cell wall salt was This placed the cut means two of At is not and from that the a b certain contents solution (cytoplasm that firm. but 2.8.3 b). are not exerting is any equivalent vacuole). the the potato cells solutions and are turgid. gained mass Figure 2.8.3 a The cells are fully turgid as –3 as water The diffused cells were into able the to cells absorb (see 0.0 some and water 0.2 to mol in dm become more Figure turgid. 2.8.2). they are immersed in distilled water; b the cells are plasmolysed as they are This immersed in a solution with a high means that the cells from the freshly cut tissue were not fully turgid as concentration of salt they have diffuse If you and The to in or take then mass absorbed as put water absorb and storage the negative out it water . potential water is of we to has water fully The have reach will and cells is water seen were been it turgid these zero. as that into are pieces tissues tissue back cells figure the The left in water not 0 kPa for show there the enough equilibrium is of tissue in 12 any no the for means freshly for absorbs weigh to more their tissue Summary questions it increase any that cut water solutions. hours, further space which potential that long 1 in be plants are adapted to live in dry soils and in from soils; they Explain, using soils by with a osmosis. very T o low water maintain a potential. water W ater potential is must have water potentials lower than those of the writing about osmosis and the movement of the water investigations between Y ou may text books in cells find the and different hypotonic and their terms on environment, hypotonic, websites. solutions; solution is they one These do in not always hypertonic terms cells and describe explain which refer what to between water isotonic the in is one in which they decrease in volume used to in of them. volume; and an Explain a one in which they do not increase or decrease in volume, concentrated or lack gradient. of them, If cells can gain be explained water by in terms osmosis the of The the water ii burst when distilled A external Plants, the in solution external into or out gradient volume is higher solution. of and the the that Y ou cells. is water than that In why can an the potential of say that isotonic cells of the the cell there is solution remain the cells or a is higher water there same is If a water volume. salt in solution; placed into water. such as sea lavender mangrove, which has live a in very very low salty water Explain how you would of the water potential of the cell than potential no do water potential tissue. i when changes root decreases cells: solution nd the on older cells potential. potential animal plasmolysis a soil, in 2 hypertonic isotonic volume. why show and is and cells, 4 solution 1 40. potential. behaviour happens increase water obtained soils. not or term results root 3 When the absorbed gradient page tissues the absorb in passively osmosis; water water . salty potential, water terms flaccid; plasmolysis. a 2 Some the pressure; pressure potential; ability will Dene potential gradient; turgid, turgor water . that tissue of these plants. of gradient potential 43 2.9 Cell summary Cells can be a rewarding topic to revise as it links to so many other Learning outcomes topics. T o begin with here are some ideas for activities to assist revising ‘cells’. On completion should be able organise of this section, you to: information about cells show how the different parts cell. al anim of a cell help it diagra large a and cell to to function or A3 e som use efciently use a graphic information link the organiser about structure to cells of display and to organelles tions func to their functions tures str uc ou Y use data graphs provided to nd potentials and of sodium to the plot graphic of organiser For make a example spider together it your you all diagram the have is chapter . See facts covered below you started. ‘cells’ in paper and aspects the you W rite middle then of the down Then so for the of think topic a one good make of the you have sheet of and links spend to covered between these for links answering with the questions of exam doing we this have you, but also with given others. try if of more the terms you using a friend technical are write the terms. family out the terms, definitions. or Some in glossary own with Y ou and can this chapter starting longer test then member they can terms time learning how to give to on and page entries. yourself matching read read are out very out the by in 178, Also printing them the together . definitions terms similar . precise and Make definitions Thin k out some electron all identify of cells so organelles you from learn real as well as from diagrams you sure for that them. from prot should micrographs. for images of Search of organelles different types of specialised that one eins simple mem bran es e bran of and diffu sion, osm osis topic. onlin mem for es as static . anim ation s show the acro ss activ e mov of the phos pholi pids diffu sion, and not that also subs tance s by prepare questions cell str uc tures , mov emen t one made Searc h cell the drawings of dyna mic different than terms the your other on Y ou will in separately or cell. deal with type practise of write and you n. draw so of online topics; common different with paper . idea the definitions ask call the electron make is to and large very question, central links finish of sentences can you cells, topics This word piece and around you terms. and to topics a could glossary Many micrographs word. of in Print them pairs to you get a out provide this own 1. terms and concepts have you Or collect we of out could see differentiate sucrose write sort. to chloride. but some you the ing draw ou Y cell. summary will water solutions Chapter a a the you line Make Make asked between with have de inclu also can of questions ent differ you that tic ar yo prok a the of some to the tate anno and ms diagra In able d r-size poste l Labe this. for r pape an of m be may ou Y and emen facili tated trans port, bulk flow. mitochondria graphic for . r organise examples concept of maps, ry T mind g searchin maps, diagram spider s organelles eukaryotic and flow charts, and also find cells ions instruct them. Use graphic a about variety organise revision . how of to nucleus make different cells rs to help your prokatyotic red blood cells specialised cells sperm 44 t mem bran es cells cells Module Make a poster incorporating of all cell the structure diagram s specialis ed or cells photogr aphs information. Y ou can their structur e and is identify related to it to help your revision. function . Here examples are need the that you concentrations to nd the potato Investigation the with table red pancrea tic pollen human human palisade blood that converts the to water water potential could of graph some research : a biology how potentials make molecular their sucrose use and of You important Cell Link Find most 1 storage 3 on tissue from page 40. cell exocrine cell grain sper m cell g followin ovum s: heading Name cell; of Organ system; ; features to make format. your the table e structur its Plot guard white blood cell – phagocy te white blood cell – lympho cell probably e landscap tion informa explain each cyte have cell how is in the related to . function conversion chloride sodium that the to of al Structur in table Use cell Organ; n. Functio will you this do o T Tissue; 1 and graphs sucrose chloride MPa = when 1000 Concentration of so that you solutions. can Y ou answering find will the need Questions water the 8 potential conversion and 9 on page of sodium graph 47. for Note kPa sodium Water potential/ Concentration of –3 chloride/mol dm 0 Water potential/ –3 MPa 0 sucrose/mol dm 0 MPa 0 0. 1 −0.440 0. 10 −0.260 0.2 −0.850 0.20 −0.540 0.3 −1.260 0.30 −0.860 0.4 −1.680 0.40 −1. 120 0.5 −2. 120 0.50 −1.450 0.6 −2.570 0.60 −1.800 0.7 −2.970 0.70 −2. 180 0.8 −3.420 0.80 −2.580 0.9 −3.860 0.90 −3.000 1.0 −4.320 1.00 −3.500 45 2. 10 Practice Cell On page 22 questions another we introduced which type of have one exam-style structure you to correct multiple-choice and function multiple-choice answer. question But that 2 there you questions: Four is plant following cells from water the two, on your CAPE three which or Biology even four combination is Paper answers correct. 1. This and Here you are type have some has to The following are found 1 microvilli 2 cilia 3 receptor 4 cellulose 5 glycoproteins on the surfaces surfaces 3 4 decide water potential/MPa −0.76 −1.34 −0.65 −1.01 of cells are all in contact 1 B 3 C 1 as shown in and Figure 2. 10. 1. cells. cell 1 4 proteins cell 2 wall the following of the 2 cell of have 1 cell A root examples. cell Which a one, The 1 of can cell expect cortex potentials. animal are NOT found on 3 the cells? 2 Figure 2.10.1 and 5 In and which direction between D Read 4 only. the list area; proteins and membrane found cells the cilia to of D is bring interact the surrounding so surface – the two are with the cell structures to increase movement. part there be movement of water cells? of the cell cell surface walls A 3 B 2 C 1 D 4 to 4 and 2 that to 1 and 3 4 and 2 the to Receptor molecules from cell. Cellulose right are microvilli about glycoproteins and environment the (K) carefully. The rst protrude from surface will 3 the are membrane to 2 and 1 (U of K) surface outside only of To answer plant as you this add potential question more you solute need to a to know solution three the things: water decreases answer. water moves region of down higher water potential water potentials −0.65 is the a water water are highest potential potential given to a negative water gradient from region of numbers, potential and a lower so −1.34 is the lowest. Water can each are in given and the lower water B and also one the of question work out between between as is the question. Cell potential −0.76 MPa, you potential Water move other, the water than Check 46 only touching of the Try these are all SAQs. has high be the will nd water is which cannot should 3 going to Cell answering anotate answer. Here that two the you 2, you potential cells right are answer. against the happen. but this that type diagram could are choices water neighbouring must moves from Cell the cells with gradient, options. When you 1 the so C the case to draw is not of help you arrows cells. questions for yourself as exam practice. These Module 3 This is a list functions of (1 organelles to 8). Match (A to the H) and a list organelles of with cell 8 their of functions. A cell The into surface 1 storage membrane of genetic information table red shows blood the cells different 1 Cell results after a and of molecular counting sample of biology the blood is number placed solutions. Concentration of Percentage of sodium cells destroyed chloride red blood by –3 B Golgi C rough body endoplasmic 2 endocytosis 3 formation reticulum secretory haemolysis 0.00 100 0.02 100 0.04 100 0.06 80 0.08 45 0. 10 28 0. 12 12 0. 14 0 0. 16 0 0. 18 0 0.20 0 0.22 0 0.24 0 of vesicles D nucleus 4 formation of proteins E lysosome 5 formation of lipids F smooth 6 respiration endoplasmic solution/mol dm reticulum G nucleolus 7 production of ribosomes H mitochondrion 8 storage of hydrolytic enzymes 4 State THREE that 5 a are Draw least b a in diagram 50 mm Assume is structural features not found the in of eukaryotic of a prokaryotic cells cells. mitochondrion that is at a Plot a b State graph of these results. length. actual length 3.5 µm. Calculate the of the the water potential at which 50% of the mitochondrion magnication of cells are destroyed (Use the graph page 45 to nd by haemolysis. your you drew from the table on drawing. c Explain some cells have large numbers Explain 9 The fertilised eggs without cut do not into why mitochondria are thought to a Draw a 50 mm b Show diagram prokaryotic of some onion placed in scale solutions of sodium a Golgi immersed for ten chloride. The minutes and then have microscope slides in the bathing solutions. cells. The 6 and concentrations of placed on developed from peeled off pieces survive. pieces were Explain results. any functional different mitochondria the epidermis was leaves, d potential.) of mitochondria ii water why: c i the body that is at least at number of random was plasmolysed cells counted. The in 100 results are cells chosen shown below. across. on your diagram how a Golgi Concentration of body forms sodium Percentage of –3 chloride secretory vesicles. c Describe what containing happens substances to are plasmolysed 0.00 secretory vesicles that solution/mol dm exported from cells 0 0. 10 7 cells. d State one function production 7 a Make cell b a c State d Use the the the Golgi body other 0.20 43 0.30 67 0.40 87 0.50 100 than secretory vesicles. simple surface Label of of drawing to show the structure of a membrane. components width of the of the membrane. membrane. a Plot b State a cells your diagram to explain how polar across the are of these water results. potential plasmolysed. at (Use which the 50% graph of you the drew molecules from pass graph the the table on page 45 to nd the water membrane. potential.) c Explain how plant cells become plasmolysed. 47 1 Cell 3. 1 Enzymes and molecular Learning outcomes Enzymes Catalysts On completion of this section, be able dene the terms: catalyst; site; activation energy explain that proteins to enzymes that are catalyse globular broken that enzymes are specic other study are detailed catabolic are those and the page → surface closely Substrates Enzymes complex are glucose maltose → and by the in study anabolic are those shown check also glycosidic In n−1 about the fatty → fructose acids by of by acids substances to is reactions making a you (amino molecules bonds → between starch + acids, a for number. Think peptide how out many of nine 3.1.1 the water are How The shape into it. → into the the to the of breakage Now site to molecule ts because shape 48 write as bond glycosidic bonds of peptide bonds glycerol by breakage of ester bonds by breakage of phosphodiester bonds by forming bonds, such as: glucose monomers in starch: amino acids in a polypeptide: polypeptide + (water) how t. enzymes There active the idea site the the site of are is the such lock enzyme substrate so catalyse two that and is in the a by which As may can substrate changes better providing this substrate key . molecule there reactions ways t shape t a place happen. very closely molecules slightly between the to t mould This mode of action is known as an induced fit. two Only with For the appropriate example, shape amylase of will active accept site will starch, accept but not a a specic protein. is specic to the breakdown of starch and catalyses the of every specificity which of must other an be glycosidic enzyme is bond to form determined complementary to the by maltose the shape shape of the (a of disaccharide). its active substrate. This foc us complementary not glycosidic you means substrate a question. site, active of the The A are are: specic to the is around hydrolysis S tudy Examples molecules in reactions? answer changed n–1 shows active Amylase have are This substrate. condensation be peptide many eliminated ones. to substrates n–1 substrate enzymes of are which of reaction synthetase molecules. bonds form? the (water) between acids) Enzymes itself amino made will photosynthesis. large make that in simpler breakage and nucleotides build bonds Peptide reactions. foc us n are substrates synthetase peptide Figure S tudy so or on your anabolic of substrate doing n Other the reactions molecules n to and catalyse breakage amino → acids (glucose) of which of 2 on Nucleases Link page without that of decomposition as a together occur . triglycerides Starch to reaction catalysts reactions understanding a Lipase on 54. Refer of Proteases Enzymes peroxide t from → nucleic hydrogen to provide reaction. polypeptide reactions respiration can down starch will rate biological Amylase reactions. you the are Sucrase Link 2. The increase Enzymes metabolic page the sucrose particular Catabolic that themselves. They likely during explain substances up reaction more reactions used protein. the enzyme; substrate; product ; active are catalysts to: of are you being should biology has shape. that the it it active has into an a only Remember the site. There same of that are to have different one reactions cut they peptide degrees reaction. of the bonds. shapes of Others same that specicity are type. match less For or t and specic example, together . some and the enzymes will table are catalyse shows a specic number enzymes that Module Enzyme Specicity pepsin next – breaks peptide 1 bonds products substrate to phenylalanine, glutamic acid and leucine trypsin next to arginine or lysine chymotrypsin next to phenylalanine, tyrosine and tryptophan enzyme exopeptidases at the C and subtilisin between N terminals of enzyme–substrate complex peptides Figure 3.1.1 Active any pair of amino acids The mode of action of an enzyme sites Did you know? An active site is a ‘pocket’ in an enzyme molecule. This is lined by There R-groups of some amino acids that are close to each other after are thousand enzyme molecule is folded into its tertiary shape. Some of the thought different making sequence, it determines inside or the some the form. site not. which active The substrate active are are The substrate site the adjacent shape can molecule combination of to made t. is other in the the R-groups When the substrate put enzyme each by under and strain substrate so is is an over a in human some cells. primary important molecule that be enzymes amino specialised acids to the bonds as ts break enzyme- Summary questions complex 1 Dene the following terms: catalyst; enzyme; substrate; Activation energy product. The reactions catalysed by the enzymes described above are not 2 favourable. They require the formation and breakage of covalent Explain why necessary Covalent bonds are stable bonds, which require energy to form and 3 activation a in each why are there are Write a word energy the equation synthesis of energy start to a necessary triglyceride from fatty to so cell. energy – show the and break. many energy enzymes bonds. the acids reaction in and glycerol. substrate b State the name that forms acids energy 4 in the the bond between fatty glycerol. specicity of enzymes. products reaction Figure 3.1.2 Explain and of time 5 Activation energy Describe an the enzyme mode using of the action of induced t mechanism. Activation energy is the energy that must be overcome before a reaction 6 can proceed. Much energy is needed to make or break the covalent a Write out sequence in the reactions involving biological molecules. Enzymes provide where activation occur so substrate energy slowly is that molecules overcome. life would are positioned Without not exist in enzymes as we such the know a way that reactions of primary a polypeptide active with sites the bonds 20 different amino acids the that would includes adjacent it. lysine and b pairs and of amino leucine, acids: arginine phenylalanine. Show on your sequence be the following broken given in the by the primary bonds the table that will enzymes above. 49 3.2 Investigating The Learning outcomes enzyme activity reaction On completion should be able of this section, you now describe how progress of to follow they and ready the to is When collide form enzyme to product determined form nding molecules are leave the the to at which sites. complex. a substrate complexes. active enzyme-substrate rate added enzyme-substrate molecules another by A The reaction enzyme Over time is the the number an enzymes proceeds. molecules occurs to: of activity of substrate molecules decreases and the chance of a substrate enzyme-catalysed molecule entering an active site decreases. This means that the number reaction of describe how to use product to follow of explain as how 1/t for to can it follow takes the to course reach an of an end enzyme-catalysed point. For example a reaction by solution of seeing milk how protein starch is decreases. the long disappearance formed iodine Y ou solution molecules calculate rates cloudy. as Add a protease and the cloudiness disappears. This can be done follows: enzyme-catalysed 3 1 Add 10 cm of a solution of milk powder to test-tube 1. reactions 3 create from tables to practical record 2 Add 3 Put 4 After both of a protease test-tubes in solution a water to bath test-tube at 30 °C 2. for ve minutes. investigations. 5 S tudy 1 cm results ve minutes, return the W atch carefully pour test-tube 1 and to the the time contents water how of bath long it test-tube and takes start for 2 a the into test-tube 1, timer . cloudiness to foc us disappear . Keeping the substrate they are enzyme solution both at solution separately the The and until desired time is short time taken temperature for the reaction is taken there a to fast for rate and reach the of you an reaction reaction can end to then calculate point in occur the the is not reaction rate as: the rate will 1/ t in be of reaction. completed which t = the If in a time seconds. called equilibration –1 The In unit many for rate cases disappearance amylase it is is better solution. them this is is to not to follow do this the added T o with it of in this iodine case is possible cloudiness starch, the you to as there take see of change milk be a record from the as such protein slight starch samples and a the may hydrolysis solution –1 (written seconds by the s ). as is that change testing in the Figure If cloudiness with reaction colour . for hydrolysed. mixture 3.2.1 and shows test how done. 03:00 samples of taken 15 at reaction second mixture intervals sample of reaction in mixture pipette A B water S tudy foc us at testing 30 °C reaction Taking a sample as soon as is added to the mixture: amylase iodine substrate starch D is suspension spotting 1 2 3 called taking a reading at ‘time zero’. Figure 3.2.1 50 with solution the and enzyme C Following the hydrolysis of starch but iodine tile Module Y ou should continue taking samples until two results give a yellow 1 Cell and recorded that in a all the starch has been hydrolysed. These results table: not Time/seconds Colour of iodine solution Starch the results know all the starch Therefore blue-black 15 blue 30 red-brown 60 yellow 90 yellow 0 the ‘between making make the draw it draw the write columns a table table right table brief a at to record reasonable the top of outlines but a with size follow and not this too (see page 41 for small; remember not the rst column is 30 and headings physical rows) for in left might of what the each quantities independent contain data write short should arrange (i.e. put a independent you words, to the down in the and be the body the of or – variable; the so that letter for the phrases, organised of have appropriate numbers only the second the solidus in or Write variable(s); in the example, table patterns independent to should numbers, rst word how equations have to into the the body column slash include 3 per dm be ticks can identify or be variable brief, e.g. – of the table do note as g/dm that g dm it 2 a take etc. best is and in the which are starch, triglyceride. meant Suggest single is ascending What to 3 order a why result Explain why hydrolysis not have units (units by it is at time the of time zero? important rate for milk to zero. the protein is (/) . . It meaning ‘per ’ concentrations should seconds not should not be used in units. Calculate in a table you should not always be written out in full write using the rate of reaction If the results in the table. g ‘per ’ or , 5 Students often suggest that –3 The solidus it using minutes. negative is used exponent, to separate cm , what means is ‘per ’ measured from iodine solution to starch-amylase the is examination measured. papers use Y ou may brackets notice around that the many units text in should be added reaction the mixture unit protein, headings) –3 better , a the test-tubes crosses, seen in to 3 as to the following sometimes column from you seconds’. and 4 is table) written appear 60 answer SI calculated hydrolysed. precise Summary questions column should dependent number variable descriptive values be examples) the columns want do took pencil sucrose, you to most hydrolysed: subsequent we it to show table long guidance: 1 units the how page (columns informative headed results in exactly present for foc us are From When biology colour S tudy indicating molecular at time zero so that the books colour tables. change without why 6 this Describe is biuret 7 is should precautions take when investigation valid at hydrolysed disappearance iodine would rate which using a the test. List four an Suggest done. you the be followed samples. not how determine protein can taking to follow of solution you carrying starch so that out the using you obtain results. 51 3.3 Quantitative In results the investigation outlined in Section 3.2 the results are qualitative. W e Learning outcomes do not know how much starch has been hydrolysed. If –3 concentration On completion of this section, be able the solution is we know the 3 then 10 g dm 10 cm contains 1/100 of the you mass should of of starch = 0.1 g. So in 60 seconds 0.1 g of starch is hydrolysed and –1 can explain the difference calculate and the rate as 0.1/60 = –1 (grams 0.002 g s per second) or 2 mg s between The qualitative we to: rates calculated from the results in Section 3.2 are the overall rate quantitative for the complete hydrolysis of the substrate. As the substrate results concentration describe how to results it reaches the hydrolysis of draw graphs to show practical the rate the end point when the reaction must stops. If slow we down can readings at intervals we can see if this take happens. concentration of starch can be determined using a colorimeter to results from measure a reaction starch The the when quantitative following during obtain until quantitative decreases the optical density of the starch–iodine complex. investigation –3 explain how to use a Make a solution 10 g dm of starch and use it to make up these calibration solutions: graph. –3 0.75, For a description complex see Add equal volume Link of page the Place of each 0.50, volumes iodine of 0.25, each solution test-tube in a 0.10, 0.07, solution to each to 0.05, 0.01 g dm test-tubes and the same test-tube. colorimeter to measure the optical density. starch–iodine Optical 18. density may be measured using absorbance or percentage transmission. This table gives some colorimeter readings for known concentrations of starch. –3 Concentration of S tudy are Using milligrams 1000 less a avoids of micrograms smaller in milligrams than concentrations see Colorimeter 0 0.00 1000 0.30 2000 0.52 3000 0.70 4000 0.85 5000 0.96 6000 1.06 reading: foc us There numbers starch/mg dm in a writing 1.0 for very starch. You (µg) gram. used for quantities. There are low may even 1000 µg mg. 7000 8000 1.24 9000 1.28 10 000 These 52 1. 15 results 1.30 are plotted on a graph, see Figure 3.3.1. absorbance Module 1 Cell 1.4 and molecular biology Link For 1.2 advice best t’ on on how graphs to draw refer to ‘lines page of 55. 1.0 ecnabrosba 0.8 0.6 0.4 S tudy foc us 0.2 Notice that the disappearance rate of of starch is not the 0.0 same 0 2000 4000 6000 8000 throughout the time period. 10 000 When is it at its highest? 3 concentration Figure 3.3.1 of starch/mg dm This calibration graph allows you to convert colorimeter readings to concentrations of starch When drawing S tudy graphs you should follow this guidance: Use make do use not draw the of the graph each axis in makes each it 1, easy axis too for should you use at least half the grid provided, should 5 be marked or you be 10 to be plotted with for an each plot labelled plotted and on the the units as information you answer on page 50 Summary 1e. extract with x-axis and the y-axis appropriate 20 mm clearly on scale, square data; the on never e.g. the use quantity using grid. This multiples and SI of unit(s) 3 or –3 derived the help question small should be 2, so to pencil variable variable of paper graph should multiples graph the independent dependent the make foc us appropriate, e.g. time/s, –1 , concentration/g dm rate/g s –1 or rate/s plotted lines; points use should must dots not be in be clearly circles used; if ( ) you marked or need saltire to and easy crosses plot three to (×); lines see on dots on the on a grid their graph, Here are some vertical Time/min crosses (+) can also be results: own Colorimeter used. reading: absorbance Summary questions 1 a Copy the b Use the table of results concentration the each sampling c Draw d Describe e Explain a of calibration graph the why in the margin and add a third column to show trend the to the shown rate 1.32 2 0.60 4 0.30 6 0. 10 8 0.09 10 0.08 12 0.06 14 0.04 16 0.01 starch. graph determine the concentration of starch at time. to 0 show of starch in concentration your reaction against time. graph. is not constant throughout the time period. 2 Explain of 3 the advantage hydrolysis Suggest follow the the of of using the colorimeter when investigating the rate starch. precautions you disappearance of should take when using the colorimeter to starch. –3 4 Describe how to make the dilutions of starch from the 10 g dm solution. 53 3.4 Determining If Learning outcomes you take On completion should be able explain the of this section, the follow initial the samples course of rate an of reaction enzyme-catalysed reaction you can either to: you follow the disappearance follow the appearance of substrate to: term of product. initial rate of From the graph drawn on the disappearance of starch in Summary reaction question describe how to determine 1c rate of an and 53 you can observe that the rate is fastest decreases with time as the concentration of at the starch reduces. enzymeEventually catalysed page the beginning initial on there is no substrate left so the reaction stops. The collisions reaction. between enzyme beginning T o follow which is of the in Catalase the molecules reaction appearance yeast and catalyses is the and as of the a product common O 2 is possible common celery, to which liquidised catalase. may to use be in an also a The set use a solution extract contains blender diagram up. Y ou in and of the of 2H added can use O + how use The the a enzyme and at the plant catalase, tissues. peroxide. 2 but as The it is such plant ltrate is apparatus gas highest substrate. O material, enzyme. were the the hydrogen catalase, plant to animal 2 ltered. also we 2 from shows could → molecules is many decomposition 2H It substrate enzyme syringe potato, material the for to expensive as is extract the is cut and following collect it more lettuce the or up, contains reaction oxygen produced. 00:30 volume of oxygen determined 10 every seconds oxygen collected downward of water at reaction bath hydrogen constant and temperature Figure 3.4.1 mixture by displacement water – peroxide catalase This shows how to follow the reaction in which hydrogen peroxide is decomposed to oxygen and water S tudy You may shown may carry here also foc us be this is collected temperature 54 out oxygen is a investigation collected in control a gas by with different downward syringe. The variable. apparatus. displacement important point of to In the method water; note is oxygen that Module The table shows the results obtained which are then plotted on a 1 Cell and molecular biology graph. Time/s volume of oxygen 3 7 collected/cm mc/detcelloc 3 0 6 0.0 10 2.6 20 3.9 30 4.8 40 5.4 50 5.7 60 5.8 70 5.9 80 6.0 90 6.2 100 6.2 5 4 negyxo 3 fo emulov 2 1 0 0 20 40 60 80 100 time/s Figure 3.4.2 Graph to show the volumes of oxygen produced when an extract of catalase is added to hydrogen peroxide The initial rate calculating taking a is determined the rate tangent from to the by the either: rst curve sample, drawn on or the graph. 3 Using the second Lines of After you a line on of the use best what the rate in this example is −1 0.3 cm s . best t plotting would method, you to t points show which are on the a graph trend. includes you In all have most or to cases most of decide you the what should points, sort look but of to this line draw depends investigating. Summary questions Y ou can follow these points for guidance: 1 look at could they if be points of carefully straight be points place side a could the to the do your the on line a that curve not line fall so – in do you can which neatly you they have on use case a the fall on a line ruler you line a can to number best put use (straight same of a or of t? on the exible curved), points why graph determine or reactions ruler then on Explain it is try 2 either Describe the the in enzyme how initial initial to rate if you with cannot straight see a lines pattern which to the shows results, then uncertainty you about can the join the points the as is the one maximum catalase, four such as of the fastest-acting number converts to polypeptide, lysozyme, comparisons active site Enzyme active all of of enzymes. molecules molecules between enzyme and collisions With are the of of and enzymes, is depends ability that which smaller and between enzymes collisions each are efciency site determine of reaction of of hydrogen Use the graph you drew for variables. of The substrate product turnover that per unit an of number enzyme, time. is to such a active have only the the the site high an active have one turnover measure on of has of ease of enzyme and the a active number very T o an make fair per and reaction. a the 1c on initial page rate 53 of reaction. Predict the effect Not reaction. proportion of such the substrate of increasing the initial concentration rate and explanation for enzyme. substrate in determine enzymes, calculated of the result high site. is between catalyse substrate efciency Other efciency t to site. question Catalase 4 has studies. peroxide. Summary Catalase to of relationship 3 between rate line decomposition important This 5 Predict the the effect temperature rate of reaction explanation for suggest your of on on an answer. increasing the and your initial suggest an answer. successful. 55 3.5 Factors influencing V arious Learning outcomes of On completion should able this effect substrate of to activity explain the substrate enzyme investigate of effect the concentration an of substrate temperature. of Substrate increasing on difference competitive inhibitors substrate active molecules. activity. site molecules where Here we Think the colliding reaction consider about two our with occurs and model enzyme then the factors: concentration concentration procedure depicted on concentration. concentration the of enzyme page 54 is used to investigate the effect of enzyme-catalysed reaction state terms the of (1) the substrate rate activity enzyme concentration an product the in entering The rate of affect activity molecules, you release how the section, to: describe on be of factors enzyme and and as The procedure is repeated for each substrate follows: between decide a range decide on prepare of hydrogen peroxide concentrations to be used non-competitive explain the intermediate concentrations to be used their the different concentrations by diluting the 20 volume effects 3 hydrogen describe how to investigate peroxide of temperature of an on explain the effect temperature means that when of 1 cm peroxide is decomposed, 20 cm the of oxygen are produced. −3 20 volume solution is ). 1.67 mol dm enzyme The volume 3 A activity (20 the hydrogen effect solution on of the table shows the results. increasing rate of an 3 Concentration of enzyme-catalysed Volume of oxygen/cm reaction. –3 H O 2 /mol dm time/s 2 3 mc/detcelloc negyxo 10 20 30 60 90 100 0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.2 0.0 0.7 1.4 1.9 3.2 4.4 4.6 0.4 0.0 1.3 2. 1 2.8 4.0 5.2 5.5 0.6 0.0 1.8 2.6 3.2 4.6 5.7 6.0 0.8 0.0 2. 1 3.2 3.9 5.2 5.9 6.0 1.0 0.0 2.0 4.0 4.8 5.8 6.0 6.0 6 5 4 3 1 fo emulov 0 7 0.8 2 0.6 0.4 1 0.2 0 0 0 20 40 60 80 100 time/s Figure 3.5.1 This graph shows the progress of the reaction with different concentrations of hydrogen peroxide These results are plotted on a graph (see Figure 3.5.1). 0.3 1– s 3 T angents mc/noitcaer rates. to the These curves are then in Figure plotted 3.5.1 on are another used to determine the initial graph. 0.2 Y ou can see from Figure 3.5.2 that as the substrate concentration fo −3 increases, the rate of reaction increases. etar 3 0. 1 remains laitini At a the 0 0 0.2 0.4 0.6 0.8 constant at concentration origin. The 0.20 cm of rate zero After the 0.8 mol dm rate −1 s there increases was as no more reaction, substrate so the line molecules must are start at available 1 and there are more successful collisions with the active sites of enzymes. 3 concentration of H O 2 /mol dm 2 −3 Figure 3.5.2 Up until the concentration the concentration the rate of 0.8 mol dm enzyme activity is limited by This graph shows how of substrate because if the concentration is increased increasing the concentration of substrate −3 increases. At concentrations greater than 0.8 mol dm the rate is influences the initial rate of the decomposition of hydrogen peroxide by catalase 56 not limited by concentration the has substrate concentration no The effect. rate must because be increasing limited by the something else. Module Some substances interact with enzymes and reduce their activity. 1 Cell and known site as without inhibitors. being Some changed in inhibitors a reaction. t temporarily These are inside the because they compete with the foc us active competitive Even inhibitors biology These S tudy are molecular substrate for entry to the if you did not have the result active −3 for site. If the concentration of the substrate is increased then the effect 0 mol dm inhibitor can be reduced as shown in Figure not inhibitors than the compete enzyme longer with the form molecule inhibitors so the cannot These active to the enzyme be are site, changes complementary cannot temporarily site. reduced bind overall substrate. is of the to another shape and enzyme The increasing effect the site the on of the active as they do enzyme. site is no complexes non-competitive substrate concentration. of without any with enzymes at different temperatures may be investigated the at competitive inhibitor non-competitive inhibitor concentration reaction mixtures in water baths at a range of of substrate by Figure 3.5.3 placing no starts inhibitor with etar activity line fo Temperature The the molecule inhibitors Enzyme-substrate inhibited. by parts non-competitive but its with so 0,0. desylatac-emy zne The combine active produced origin, noitcaer other be 3.5.3. the Other would of oxygen the there temperatures. This graph shows the effect The of a competitive inhibitor and a non- substrate and enzyme solutions are equilibrated at the temperatures used, competitive inhibitor at increasing then mixed together and kept at each of those temperatures over the range substrate concentrations chosen (0 °C to 70 °C in this example). The results of such an investigation 6 protease hydrolysis of milk protein are shown in the table below . 1 on s/0001 −1 Temperature/°C Time for cloudiness Rate of reaction × 1000/s 5 4 × noitcaer to disappear/s no 0.0 1400 etar 10 reaction 2 fo 0 3 0.7 1 0 15 960 0 1.0 10 20 30 40 50 60 70 80 temperature/°C 20 650 1.5 25 480 2. 1 30 360 2.8 35 240 4.2 40 185 5.4 Figure 3.5.4 This graph shows the effect of increasing temperature on the rate of an enzyme-catalysed reaction Summary questions 1 Explain of 50 440 2.3 55 850 1.2 a State for no reaction 0.0 70 no reaction 0.0 is meant by terms: each range, intermediate values 2 60 what the following the the limiting factor reaction substrate when the concentration –3 was 0.4 mol dm evidence for b These results are plotted on a graph (see Figure State the . Give your the answer. limiting factor when 3.5.4). the substrate concentration −1 The rate of reaction increases up to a maximum rate of 5.4 × 1000 s at was the optimum the rate temperature of 40 °C. At temperatures above the at its maximum in the optimum investigation. decreases steeply and there is no activity at 60 °C. 3 The rate increase increases in frequently as kinetic with increased energy enzymes. and temperature molecules However , as of the means that substrate there collide temperature is an and molecules vibrate and bonds stabilising the tertiary to break. At the optimum temperature the number of of is at enzyme its maximum, molecules but become beyond that temperature non-functional as they what will 60 °C all the enzymes are happen to the reaction more i mixtures 0 °C to if 30 °C; and 70 °C to 30 °C. In each case denature. explain At the successful ii more at 35 °C structure transferred from: collisions reaction 65 °C. Predict following begin rate temperatures: the 4 enzyme the following more increases Predict your answer. denatured. 57 3.6 Factors influencing Learning outcomes On completion should be able of this Enzyme section, describe enzyme describe pH on explain the on and the effect concentration enzyme of of activity explain enzyme concentration From your effect of understanding increasing the the effect number investigated rates of reactions. increased of collision theory you can probably predict the of Figure by concentration of there can shows are more successful making reaction 3.6.1 If of enzyme the collisions dilutions be enzyme on the rate of determined the as molecules of per unit catalase on page there enzyme- time. extract This and will can the be an be initial 54. results. activity. As the concentration increases. This The assumes limiting fo etar desylatac -emyzne noitcaer concentration rate that is is at in of enzyme directly each excess increases concentration so so proportional that the to of substrate rate the of reaction enzyme enzyme the concentration. substrate concentration is not a factor . pH Reaction mixtures constant pH. possible to enzymes Figure 3.6.1 (2) to: and increasing activity you catalysed enzyme may These make were be prepared solutions buffer are solutions investigated at using known over special as buffer various different solutions ranges solutions ranges of to of pH. maintain and it a is Three pH: This graph shows the effect pepsin catalase alkaline of increasing enzyme concentration on the rate of an enzyme-catalysed reaction The rates phosphatase. of reaction were determined and are shown in Figure 3.6.2. alkaline pepsin catalase phosphatase 100 etar sa 60 40 etar fo fo noitcaer mumixam egatnecrep desylatac-emyzne 80 20 0 1 2 3 4 5 6 7 8 9 10 pH Figure 3.6.2 Look 58 carefully each as a This graph shows the activity of three enzymes at different values of pH at enzyme pH Figure is increases maximum 3.6.2 active the and over a activity follow range of of each these descriptions: pH enzyme increases until it reaches Module maximum at over activity occurs at the optimum pH for each 1 Cell and a of pH certain above range the of optimum pH there is pH no the activity is pH the the measurement enzyme shape. The amino acids some of longer The At is in the is and bone site. an values are pH of in tissue; if as As an activity. pH at enzyme is enzyme blood, it the and not lose is not the the R-groups concentration their simple one pH linear unit scale. A (e.g. pH 7 .0 optimum to correct become a of of the changes pH 8.0) represents concentration of a change hydrogen in ions of ×10. less shape, are no pH. to is the pH between of where 1.0 with with a a pH it and cytoplasm body places very of pH the has sites close pH the of enters ion values usually site At between active enzymes parts is active hydrogen the where in the these enzyme active this the the the pH concentration. interactions of stomach is as and denatured the by ion break intracellular such active determined phosphatase optimum, most active certain active Alkaline is its hydrogen interactions optimum Catalase as in active Pepsin at shape these effective. is of foc us decreases change pH biology enzyme S tudy values molecular is high about pH lower works. 2.0. 7.0. such than its active. Control variables Buffer etc. solutions As and it other we is have therefore factors, pH you are constant factors constant about as Y ou in that are that to is each are do to this and that keep inuences by you a during for an If be a pH, long when pH as are to the other any 7.0, of the will enzyme keep the lasts. which three valid 8.5, S tudy foc us enzyme reaction but pH enzymes investigating and investigating the draw for that investigation you pH activity concentration solution as e.g. the suitable then able of constant buffer activity, not pH nding variables . will are the mixture enzyme values inuences substrate using changed control you certain factor reaction not called factor give a temperature, can otherwise the pH investigating constant V ariables used important such concentration. that are seen are one of must kept the be kept conclusions You could be asked enzymes with you also may enzymes Do not about the covered be which panic in questions which – asked you the do of about are familiar; about not other recognise. question principles this you will be enzymes chapter. investigating. Summary questions 1 Predict shown what on becomes 2 Use the will Figure a happen 3.6. 1 if at the higher enzyme substrate concentrations concentration is not than in those excess and limiting factor. information in Figure Enzyme 3.6.2 to Range of which complete pH this table. range over enzyme is Optimum pH active pepsin catalase alkaline phosphatase 3 Explain 4 Suggest how mixture even 5 State why the a buffer you might though control temperature solution on a is check buffer variables for enzyme used that when the solution an investigating pH does not has been added. investigation into enzyme change the in effect a activity. reaction of activity. 59 3.7 Practice exam-style questions: Enzymes These two complex multiple-choice type that information very some notes to we questions introduced carefully. help you It is a analyse on are of page good these the 46. idea to types more Read This question the write of hydrolyses (Remember questions. is a form of that does 1 A metabolic pathway consists of several which the product of the first about the glycogen of the second and reaction is of a metabolic be so forth. This is not X What of be the 1 enzyme effect enzyme 2 reducing specific for → of adding 1 enzyme 2 substance Y would increase 3 substance would no 4 enzyme 5 substance Z and and Z sugar would be would at the is not B 1 4; B 2 5; C end is the 2 because starch correct a competitive down the rate inhibitor at which a competitive 3 A longer P concentration reaction Y to Z. This be student 2, 3 and questions Q investigated protease – from a – from – from The produced enzyme so 4 1, inhibitors occupy destroying is not 2 page increase B 2 is the A them, 3 the so is slowed 57), as it then is correct student not not are 1 denatured. This enzyme (see and added, enzyme will 2 at a 5; D 5 slower only. then sites the of incorrect down (K 2 by the at the some 5. prokaryote a the which effect that prokaryote lives that of in lives a mammal results of the that lives in investigation If the the of Y rate test-tubes 1 starch in glucose 3 glycogen the 4 starch 5 sucrose in this table. enzymes/ maximum Q rate R 0 5 0 35 10 10 0 60 25 enzyme activity 20 8 100 35 30 15 70 48 40 30 35 95 50 45 18 35 60 65 0 0 70 100 0 0 90 40 0 0 of inhibitor would by enzyme 2. with solutions amylase and that the Make amylase plot See multiple and at scale used the do not axis for increase temperature page lines 53 for on a guidance about this and how graph. foc us amylase 40 °C for 30 minutes. examiners sugar be detected do not want to give the units in a In question reducing you sucrase When kept temperatures sure sucrase and and foc us S tudy (possibly because they involve too much after description) they will call them arbitrary units. You may minutes? abbreviate A 1, 3 and 4 and 5; B 1, 2 and 3; C 1, 4 and 5; D them 4 to ‘au’ in 1, gures from 60 tropics. given 20 correctly. would on the Arctic 0 S tudy and 2 tubes try springs 0 evenly. 30 can of Notice which you temperature hot are Activity of P without competitive usual Contents were is enzymes: slows activity because and Test-tube test-tubes amylase and U) as follows: The and rate answer. prepared is the enzymes concentration used this catalyses affect leaves the glucose incorrect. Competitive active is enzyme be formed inhibited is an answer. percentage of If has (glucose), there Z denatured in structured Temperature/°C A glycogen. amylopectin which substrate specific for sucrose. some yourself. R 1 are for three be in 2 2? would also pathway: → Y would inhibitor similar to break down the enzymes. Amylase and an Here enzyme is very starch the not example in starch.) Although test-tube present. Sucrase substrate specificity of bonds reactions will in is glycosidic (K and U) your graph. your answers when quoting to Module a Draw a graph of the results of the c student’s Explain b Describe the effect of temperature on and in pH Cell and this and molecular temperature are biology kept investigation. enzymes, 5 P, Q why constant investigation. 1 Enzyme inhibitors may be competitive or R. non-competitive. c Explain the d Suggest effect of temperature on enzyme R. Make how function 4 Succinate at enzymes, such high It as P, are able diagrams to show how: to i competitive inhibitors, ii non-competitive and temperatures. dehydrogenase mitochondria. such is catalyses a an enzyme found reaction that inside occurs inhibitors interact with enzyme molecules. in 6 Acetylcholine is a chemical transmitter substance respiration: released succinate nerve cells at synapses. → cells breaks foc us in Names of You may to succinate a down synapse contraction biochemicals see conduct impulses written as succinic acid as fumaric acid. At the pH of the cell ionise to form anions ions with (negatively inhibit a –COO names group) with the not as sufx acids –ate with to which a substance that structure very has similar to that of a a series of to small volume of succinate. A malonate succinate solution was each test-tube. These tubes were 25 °C with test-tubes of solution. The and the student enzyme initial rate of at procedure are does not paralysis or and remain muscle death. organo-phosphates enzyme at synapses are in insecticides insects have a and structure very how organo-phosphates carbamates with its the and do not. enzyme organo-phosphates acetylcholinesterase to activity. Suggest why these insecticides are health hazards environmental hazards if not used carefully. added equilibrated The enzyme sucrase catalyses the hydrolysis of the at glycosidic bond in sucrose. A investigated succinate dehydrogenase solution was results to it impulses pH added to each tube reaction determined. The repeated the malonate. The a that student 6 to lead acetylcholine; inhibit and 6.5. A can animals. Carbamates Explain molecular concentrations of so continuous this. b prepared and this interact is to that –COOH. They show a Malonate cells enzyme charged similar given muscle the these other are and is and that biochemicals acetylcholine causing Carbamates fumarate stimulates fumarate contract. Acetylcholinesterase S tudy It dehydrogenase nerve succinate by but without shown using student concentration sucrase at Rate of units effect on the of increasing rate of the activity of 40 °C. 3 test-tubes different succinate/arbitrary the sucrose in the table. Ten Concentration of of were set up concentrations each of a containing sucrose 5 cm of solution. The reaction/arbitrary test-tubes ten were placed minutes. A flask in a water containing a bath at sucrase 40 °C for solution units was With also put into the water bath. Without 3 malonate malonate After ten added 0 0 5 11 at 1 cm the added the sucrase reaction solution mixtures was were a further water to each was ten minutes. After boiled. Benedict’s test-tube. The time ten solution taken for a 18 colour 15 16 21 20 20 22 rates a change of was enzyme State the recorded 22 23 b Explain i 30 23 23 35 23 23 was independent, why kept and used to calculate activity. control variables 25 of test-tube. The 40 °C for minutes, 12 was 10 each 0 kept 5 minutes, to the at in dependent, this temperature 40 °C; ii derived and investigation. why it of the was water raised to bath: boiling point. a Plot b Use the results your graph malonate on on to the a c graph. explain reaction the Sketch a results and graph substrate effect catalysed enzyme, of by to show explain the the student’s effect concentration on of the predicted increasing activity of the sucrase. succinate dehydrogenase. 61 2 Genetics, variation 1. 1 Nucleic of this section, page 3, be state able that polymers list the nucleic of acids nucleotides components a acids you need were to listed know as one about. of the There four are groups two of nucleic biological acids: deoxyribonucleic ribonucleic simple of diagram acid (DNA) are of acid These polymers which are stable draw that to: nucleotides nucleic you molecules should selection Polynucleotides On completion natural acids Learning outcomes On and are shown molecule (RNA). built in up from simplified that is a monomers form long-term in known Figure store of 1.1.1. genetic as nucleotides DNA is a large, information. There a are three types of RNA that are used for retrieving information from nucleotide DNA recognise the and using it to synthesise polypeptides. The three forms of RNA structural formulae are: of ribose, deoxyribose, pyrimidines describe and and the RNA structure and signicance discuss of purines, messenger ribosomal transfer the of the RNA nucleotide and bonds. and not (rRNA) (tRNA). is composed of a pentose (5-carbon) one to Each the of make five bond pentose nitrogen-containing polynucleotides forms sugar of by between the phosphate the the bases. Nucleotides formation phosphate of are the structure of group of one DNA 5’ structure of 5’ O HOCH OH 2 proteins. The OH 2 4’ 4’ 1’ 1’ pentose H monomers of DNA are H H H the monomers of H nucleotides; proteins are 3’ amino H H sugars H 2’ OH 3’ OH 2’ OH H acids. ribose deoxyribose O P HO phosphate O O phosphate H H O base N H C C N C N N N C C purine C C H C C N N H H H C N N bases N 2 H H deoxyribose sugar adenine Figure 1.1.1 (A) guanine (G) A simple diagram of a nucleotide. Different shapes are used to O O O show the five different bases. H H H CH C C C N C C 3 C C N C CH HN C C N O S tudy H O H O pyrimidine CH N foc us H N H H bases In RNA ‘U cytosine replaces T’. Remember this as you work next few thymine, 62 pages. RNA has DNA uracil. thymine (T) uracil (U) through Figure 1.1.2 the (C) has joined phosphodiester foc us confuse the a next. HOCH with sugar , them. together Do RNA differences group S tudy (mRNA) DNA Each between RNA nucleotides The structural formulae of the components of nucleic acids nucleotide Module The composition Ribose is the of DNA pentose and RNA sugar in is 2 Genetics, different. RNA – at variation carbon 2 there is an hydroxyl is double stranded Deoxyribose is the pentose sugar in DNA – at carbon 2 a replaces the hydroxyl group of in some viruses DNA has RNA has the the bases bases adenine, guanine, adenine, that have DNA. Once inside ribose. a everywhere hydrogen single-stranded selection (–OH). except natural Did you know? DNA group and cytosine guanine, and cytosine and thymine host cell replicated this viral to form DNA is double usually stranded DNA. uracil DNA carbon atom 3 C A molecule that are of DNA bonded phosphates projecting opposite is a double together make up inwards the and by helix hydrogen ‘backbone’ forming consisting bonds. of each hydrogen of The two polynucleotides deoxyribose polynucleotide bonds with the sugars with bases the of ribose and phosphate bases A the polynucleotide. G guanine The only nitrogenous pairs that bases fit are complementary between the in size sugar–phosphate and shape ‘backbones’ so that are the A–T and U C–G. The ‘backbones’ are arranged so that the orientation is in opposite carbon directions – sugars arranged are upwards to 5' the on the direction to the are with other on polynucleotide angles strands one so carbon that side assumes antiparallel . and a 3 the a pointing Figure 5' to 3' are direction shape as 1.1.3 downwards polynucleotides helical sugar–phosphate In the on base you on can one arranged the are side in other . pairs see a at Figure 1.1.4 Simplified diagram of a small section of RNA right ‘backbone’. S tudy 5′ carbon atom and atom 5 3′ foc us are pronounced ‘5 prime’ 3 and carbon 5 uracil and 3' Each not atom the ‘3 prime’ and are used to C G identify deoxyribose phosphate and T the RNA. polynucleotides Note polynucleotide A that in in DNA one DNA is 5′ to 3′ and cytosine the C opposite is 3′ to 5′ G guanine T A carbon atom 3 carbon atom 5 adenine Figure 1.1.3 Structure of a small region of DNA Summary questions 1 Suggest and why state the DNA and RNA are called structural features that nucleic they acids have 5 in Name simple 3 State and would the ve monomers labelled the following DNA diagrams structural pairs: purine; DNA show differences ribose DNA of to and and and RNA their make 6 structure. between deoxyribose; RNA; and each of the 7 is an organism in the to nd? ratio necessarily in full DNA; b constant for was found percentages expect why not Explain 1 : 1 and you Explain but pyrimidine polynucleotide of thymine. What common. 2 The why: the each a of Explain of A : G the the ratio the and same ratio of A species contain your three 24% bases answers. of C : T in is 1 : 1 in DNA, RNA. of A + T : C but to other + G : C + G varies in + T is DNA between always is species. polypeptide. 8 4 Suggest why DNA is far more stable than RNA. Make of a DNA for table and to compare RNA. Do the structure not forget to and functions include a column the features. 63 1.2 DNA replication Learning outcomes Templates DNA On completion of this section, is be able store of base genetic pairing information and is passed on to new cells in you growth should a and and to new generations of organisms in asexual and sexual to: reproduction. explain the signicance of base The pairing in double polynucleotide polynucleotide state the signicance of in describe the process conservative means of within semi- replication of already DNA. DNA cytosine we always form pulled 2 m. out it in it your all the would Multiply cells that cell that DNA from extend for by body would template a copy the and extend it to number is a about of estimated the sun the are hydrogen pairs is bonds, which enough to be that with is for ideal for making made by a replication new matching in of with always bases. by the two collectively one. because The nucleotide when a pairs sequence with with polynucleotide As this happens, phosphodiester template each term bases strand are are these to against the held double-stranded bases are a newly and assembled the This but bases means together together DNA, and and bases give bonds held of thymine polynucleotide. polynucleotides stabilise has Nucleotides existing polynucleotide the broken guanine. together each and polynucleotide adenine an sequence bonds bonds Each along joined nucleotides covalent one. together nucleotides Did you know? you a know complementary human that existing assembled If as DNA an acts hydrogen template bonding structure DNA that by by hydrogen are weak needed. and CH back 70 times! H 3 O N N H N N N H N N O thymine adenine H H O N N N N H N N O N Link N H H Look back to information page on 4 for more hydrogen bonds. Figure 1.2.1 There are two hydrogen bonds between adenine (A) and thymine (T) and three between cytosine (C) and guanine (G) in DNA Before S tudy replication happens known Why DNA semi-conservative? molecule polynucleotide template and consists that one conserved molecule of as DNA acted ‘old’ half – Each of newly polynucleotide. The been can occur , nucleotides need to be synthesised. This foc us one as ‘old’ the strand hence as the cytoplasm and deoxynucleoside uses energy to form activated nucleotides triphosphates. new synthesised the in new has Replication same, page ensures although 128). (1929–) the sequence of occasionally that mistakes occur Research in 1958 conservative replication or Matthew that dispersive involved synthesised by showed strands; as Meselsohn replication was producing dispersive base new DNA give always rise (1930–) was proposed pairs to at and remains the time. involved of Frank Stahl not Conservative two newly making DNA semi-conservative. composed 64 of new sections alternating from one strand the mutations semi-conservative, composed replication to to the other . (see Module Step The 1. DNA enzyme helicase Step 2. separates Each assemble Step 3. DNA and a travels two acts both the new, and along the between the DNA polynucleotide as a template. catalyses the elongating bond carbon bonds unwinds base and strands of Free pairs the Genetics, variation and natural selection break. enzyme DNA. nucleotides strands. polymerase to covalent nucleotide hydrogen the strand against nucleotide off unwinds; topoisomerase 2 is formed 3 of template phosphate strand is assembled in a 5' groups strand is assembled in one the between existing strands to 3' attachment strand. Two in a the 3' to piece, but the a 5' break phosphate strand. direction. This of phosphates DNA of direction. The means other is the polymerase that new one assembled in sections. base Step 4. base pairs DNA polymerase are cut out checks the and sequence; any pairs incorrect replaced. sugar– phosphate backbone Step 5. Hydrogen strands; molecules Figure 1.2.2 bonds form topoisomerase into two between catalyses the double the polynucleotide winding up of new DNA helices. thymine adenine guanine cytosine Figure 1.2.3 Semi-conservative replication of DNA A small part of DNA to show its double helix structure Link Research animations replication’ done that online, try and Question of ‘DNA once Summary 2 on page you have question 6 74. Summary questions 1 Make 2 Use a ow chart diagrams to to show explain the what stages is in meant replication. by the term template in DNA replication. 3 Explain 4 State 5 In why what their replication is paper structure of required of pairing 6 Find in out explain in necessary. a cell before 1953, James Watson DNA mechanism for is that the they genetic it and described material’. can replicate. Francis Crick ‘suggests Explain a the wrote possible that the copying importance of base replication. about how the their work of results semi-conservative rather Matthew showed than Meselsohn that the and method conservative or Frank of Stahl replication and is dispersive. 65 1.3 Protein synthesis Learning outcomes Overview of Ribosomes On completion of this section, be able assemble state that DNA code for explain bases triplets how in bases amino the DNA of in cells acids amino sequence codes for structure of of amino acids rate. the All large produce decreases; of messenger produce pancreas the primary synthesis in acids the into polypeptides. correct sequence The come in instructions the form for of to: molecules protein you assembling should (1) some the insulin of which of in amino the acids are single when lymphocytes ribosomes sequence RNA quantities the for in For concentration produce cell produced proteins. antibody require insulin nucleus. of blood molecules mRNA or the example, in the glucose at molecules antibody. Some cells a very that Protein fast specify synthesis a involves the following: polypeptide use the genetic sequences of sequences in sequences of code bases RNA to in DNA and amino convert transcription activation in of molecules; polypeptides. of DNA to produce mRNA, which occurs in the nucleus into into acids translation ribosomes amino this of acids, occurs in mRNA either free to in which the form the involves attaching them to tRNA cytoplasm polypeptides, cytosol or which attached to occurs on endoplasmic reticulum S tudy foc us post-translational the Protein shapes molecules that are have very dependent Golgi of sequence changes, have a amino different acids. the shape If properly, if at DNA can does not The which occurs in code is a store sequence for an of of genetic bases amino information in acid. a length There of are for the DNA four is synthesis a bases code. in of polypeptides. Each DNA triplet (A, T , C of and bases G) so all. it is possible DNA is copies S tudy proteins, the codes function some the protein and of specic on Genetic sequence modification body. a of to make template the base 64 for different making sequence triplets. messenger from the RNA nucleus which to conveys ribosomes in short-lived the foc us cytoplasm. Why 64 triplets? You can count the The number in the table or calculate it as diagram shows polynucleotides how relate to the sequences the sequence of in the bases mRNA. in The the two polynucleotide 3 4 (4 × 4 × 4). along which template the coding bases S tudy base are four code bases does not in DNA. A work as it is not 4 strand. which is the of RNA transcription; As you same can as nucleotides assembled complementary the coding see that is the of the strand mRNA is the polynucleotide has produced a sequence except is of that U T . two only coding A T G T A C G G C T T A C G T T A G T A C A T G C C G A A T G C A A T C A U G U A C G G C U U A C G U U A G strand 2 codes for sequence for foc us replaces There the strand = enough, 16 amino whereas acids a four which base template code would code for too many strand 4 (4 = 256). mRNA amino acid met ser gly leu arg stop reading frame Figure 1.3.1 Follow the sequence of bases in the two polynucleotide strands of DNA and in the single mRNA polynucleotide for the beginning and end of a polypeptide 66 Module 2nd A 2 Genetics, variation base 2nd G T C U and natural selection base C A G AAA Phe AGA Ser ATA Tyr ACA Cys UUU Phe UCU Ser UAU Tyr UGU Cys AAG Phe AGG Ser ATG Ser ACG Cys UUC Phe UCC Ser UAC Ser UGC Cys AAT Leu AGT Ser ATT Stop ACT Stop UUA Leu UCA Ser UAA Stop UGA Stop AAC Leu AGC Ser ATC Stop ACC Trp UUG Leu UCG Ser UAG Stop UGG Trp GAA Leu GGA Pro GTA His GCA Arg CUU Leu CCU Pro CAU His CGU Arg GAG Leu GGG Pro GTG His GCG Arg CUC Leu CCC Pro CAC His CGC Arg GAT Leu GGT Pro GTT Gln GCT Arg CUA Leu CCA Pro CAA Gln CGA Arg GAC Leu GGC Pro GTC Gln GCC Arg CUG Leu CCG Pro CAG Gln CGG Arg TAA Ile TGA Thr TTA Asn TCA Ser AUU Ile ACU Thr AAU Asn AGU Ser TAG Ile TGG Thr TTG Asn TCG Ser AUC Ile ACC Thr AAC Asn AGC Ser TAT Ile TGT Thr TTT Lys TCT Arg AUA Ile ACA Thr AAA Lys AGA Arg TAC met TGC Thr TTC Lys TCC Arg AUG Met ACG Thr AAG Lys AGG Arg CAA Val CGA Ala CTA Asp CCA Gly GUU Val GCU Ala GAU Asp GGU Gly CAG Val CGG Ala CTG Asp CCG Gly GUC Val GCC Ala GAC Asp GGC Gly CAT Val CGT Ala CTT Glu CCT Gly GUA Val GCA Ala GAA Glu GGA Gly CAC Val CGC Ala CTC Glu CCC Gly GUG Val GCG Ala GAG Glu GGG Gly A U G C esab esab ts1 ts1 T A C G Figure 1.3.2 These tables show the genetic dictionaries for DNA triplets and RNA codons. Amino acids are commonly known by their three-letter abbreviations. The groups of three bases in RNA are known as codons. The tables above S tudy show the strand genetic and RNA dictionary codons. in The the form DNA of DNA triplets and triplets RNA on the codons form the You genetic code that specifies each of the amino acids during foc us template do not need to learn these protein triplets and codons, but expect to synthesis. use T o read second, acid the DNA e.g. C, cysteine. genetic genetic and then Now dictionary. find The dictionary, the the third, find e.g. the G. complementary base sequence is first This base UGC base, triplet e.g. sequence and A, codes this is then for in the the the the a genetic triplets to dictionary codons to and amino convert acids. amino mRNA codon S tudy for foc us cysteine. Take In reading the message for a polypeptide a cell needs a ‘start’ triplet care ‘triplets’ well. The triplet code for methionine (met) on the template strand and its codon is AUG. This is the start codon. Methionine removed from the beginning of the polypeptide after it and bases use of the terms ‘codons’. The in DNA are groups of called is triplets; usually your is three T AC over as groups of three bases in is mRNA are known as codons. produced. Features of the – it genetic universal it codes for the is 20 found it codes for the sequence code in all amino organisms acids of found amino (with in acids a few minor variations) Summary questions proteins that form the primary 1 structure of Explain must a sequence why of three nucleotide bases codes for an amino there are three ‘stop’ there are between be three two or four one and six codes for each amino acid (met has Make there are more a table to codes codes than needed so the genetic code is called a genetic dictionary the stop gives the codes for the 20 amino acids plus the amino acids: and serine, glycine, methionine. the of (expect bases U in the replaces coding strand of DNA is the same as Write out the RNA sequence of complementary bases to in that code for ADH sequences (see page and oxytocin 13). T) the in that the 4 DNA codons codes sequence mRNA the RNA code 3 three and the following valine, show a phenylalanine, degenerate one six) for not bases. one template has code and codes 2 arg genetic bases acid or and the polypeptides template strand of DNA Biologists talk about ‘one gene is one polypeptide’. you understand Suggest what mRNA. by this phrase. 67 1.4 Protein synthesis Learning outcomes Transcription DNA On completion should be dene able the describe as of this section, is located amino acids free in the (see page to term how transcription DNA is transcribed Transcription factors bind to cytosol 31). of the promoter for a produce large through the on this see Transcription factors genes during as a cell the cells. are Ribosomes situated in the that assemble cytoplasm, nuclear of has It endoplasmic two may version of pores many to the and copies be of that the transcripts are of each only The of in The one either all cell on each is may the form RER genes cannot to the form those DNA information produced to gene, one polypeptide. polypeptide. provide reticulum able need loop to out ribosomes of mRNA by transcription. occurs in the nucleus of eukaryotic cells. The region of gene to be transcribed is activated by transcription factors that identify sequence, for page ‘switch area of DNA to open up. Only small regions of DNA on a 123. chromosome are the bonds activated at any one time. T o access the template strand, on’ hydrogen between the strands must break and the double helix differentiation, for information on this as in replication. see The page only quantities result process uncoils more of the the the information cell functioning code DNA as Each attached to T ranscription in front or chromosome. the known nucleus polypeptides homologous and DNA the make to: Link of in you mRNA. region (2) enzyme RNA polymerase is responsible for assembling the RNA 76. nucleotides. 3′–5′ direction. bonds. S tudy foc us known Termination factors termination signal bind region Transcription factors factors are specic proteins regions of to and that The The as The RNA the enzyme moves nucleotides polymerase termination template assembled when which it by forming reaches follows a strand a of the specicity of phosphodiester to be Hydrogen bases are in of bases triplet. unwinds about to the sequence stop chains examples in in corresponding termination DNA. They the DNA DNA. bind are stops signal, the of along specific to areas gene transcribed. bonds the the two break in between the polynucleotide the area of DNA protein corresponding to the gene to be molecules. transcribed. This is catalysed by helicase. One polynucleotide template for mRNA. the Free nucleus exposed S tudy RNA bases nucleotides are here. Each ribose nucleotide sugar has of two of the in and energy replication phosphates bond to form between the a growing chain template are joined phosphodiester to form the loss the provide a (which which does is polynucleotide catalysed RNA than DNA less proof reading polymerase). and leaves the nucleus becomes nuclear mRNA. Figure 1.4.1 Transcription pore a by polymerase transcript phosphodiester nucleotide enzyme through 68 by mRNA. This mRNA the the in the three RNA the on with a – phosphates. As a of nucleotides up nucleotides bonds base, as not together shown RNA pair acts synthesis polynucleotide. foc us The The free the nuclear pore Module The end process of transcription is an mRNA transcript. Since there 2 Genetics, variation ribosomes, times. These the mRNA mRNA polymerase transcripts travel will from transcribe the the nucleus, gene and into the through on one from is strand one DNA. in are many Along polynucleotide, chromosome molecules a while transcribed respects to replication chromosome, other from genes the some elsewhere opposite but genes on only are occurs They transcribed the ribosomes cluster molecules polynucleotide. enzymes should know the similarities and differences between these that are summarised in Features topoisomerase unwinds helicase hydrogen breaks within the strands of DNA Replication Transcription 2 1 act as broken life down span determined mRNA by of the as their – how long it takes their to decrease by a half. base refers nucleotides foc us templates The free to form DNA polynucleotide that by time. table. S tudy number used same (polysomes). the concentration bonds be the two half-life processes are and is at together polyribosomes molecules Y ou can cytoplasm. similar of foc us nuclear many T ranscription selection many mRNA pores natural are S tudy many and align against to pairing that in transcription between the template strand in DNA and the newly formed DNA mRNA. bases of the free nucleotides adenine, guanine, cytosine, base pairing name type of of A–T enzyme involved guanine, cytosine, and C–G DNA polynucleotide adenine, thymine A–U polymerase RNA DNA uracil and C–G polymerase S tudy mRNA foc us produced rRNA quantity a of DNA involved in all nucleus the DNA in the only nucleus the genes active DNA that at of the is are the also some tRNA time and tRNA produced (see by permanent (see page page 62) are transcription. There 70) base and pairing in in rRNA. Summary questions 1 State what 2 Draw a ow 3 Suggest 4 Explain a short of 5 the of per 1.4. 1 transcribed not to before show polymerase time, cell to it the transcription RNA once Figure needs chart why why cell period DNA Use a while can carry stages of a gene travels DNA of out transcription. transcription. does along a not stop region polymerase only of at a stop DNA travels triplet. many along a times in region cycle. explain why only one polynucleotide of a gene is both. 69 1.5 Protein synthesis T ranscription Learning outcomes template. On completion should be able of this section, the to: dene the terms first and describe into a how to mRNA is translated polypeptide explain is a the roles pool about of which mRNA Once a in mRNA is the a or copy is produced of the cytoplasm polypeptide. ‘identified’ acid ribosomes of in mRNA, of of ten not For ‘labelled’ this using it to the from DNA can code be DNA for translated happen, same a amino three base into acids molecules do not have bases, they are attached codes. to RNA amino of have the the that do. acids twenty ability of This all amino to process 20 types acids make is in have them amino the to from acid activation . cytoplasm. be present anything In in else. There humans, the diet Our as cells we are tRNA able and be of acids. in translation do molecule sequence amino molecules process amino acid Since activation the amino primary have is Each assembling you (3) to synthesise the other ten amino acids. Lysine is an example of an protein amino acid we cannot make and which must be in the diet. synthesis. Amino acid activation Did you know? Enzymes Amino acids cannot such make, are as lysine, known as which we essential acids specific the amino acids in and the tRNA in tRNA of protein important as RNA molecule attachment stage cytoplasm transfer an for molecules this have it a active each amino synthesis after have molecules is type acid in to which of its that The amino tRNA the identified shape sites (tRNA). its resembling acid. of tRNA a specific the amino recognise Energy molecule. identity by accept enzymes is This amino the required is the acid for only is molecule. clover leaf with the following regions: Link a site where amino acids are attached – always with the base sequence –CCA This is back the a to good page structure point 12 to of an at which remind amino to look yourself acid. two a ‘loops’ of nucleotides formed by some base pairing of ‘loop’ with an anticodon – the three bases that identify the amino acid. Figure 3' 1.5.1 shows a tRNA molecule with the methionine anticodon UAC. glycine A amino acid C attachment C site 5' C A G C C C A C U hydrogen bonds ATP ATP AMP AMP ATP AMP glycine U C C G A C C A C U C A anticodon Figure 1.5.1 A tRNA molecule anticodon Figure 1.5.2 synthetase 70 anticodon anticodon Amino acid activation by a type of enzyme known as an aminoacyl tRNA Module The enzymes constantly activate amino acids so that there is a 2 Genetics, variation to take part in A and acyl that there units of is can a large begin. ribosomes ribosome has two accepts supply mRNA and fits sites an of into A activated combines a site ‘groove’ and a amino with P the acids, large between the the and process small two. site the tRNA-amino acid sites. A P for them P As site you Figure holds read the the lengthening account below A site. the process The first a the tRNA-methionine codon molecule therefore not with occupy complex remain ribosome the enters in (AUG) so the is the anticodon site. the place. moves not translation stages enzyme peptidyl an transferase enzyme made of is If, A site When that by complex start codon then the the UAC chance, it tRNA enters and bond forms the whole will pair only another does not enters complex with it a pair the A and site, does carrying C C codes A site. for G the the G are into A C fits empty the G These complex an and G AGC. UCG C is is C it codon G with tRNA-serine exposing U pairs a site G so second P U that and the the ly the A example, occupy g t-RNA-amino A anticodon to ser and A our moves Now ribosome that both sites are full the enzyme peptidyl transferase ribosome catalyses the formation of a peptide bond between the moves C -terminal the two of methionine amino acids and the N-terminal of serine to join along the ribosome molecule dipeptide leaves (met-ser) anticodon peptide moves the CCC bond to the ribosome occupies occupies forms third and the the between P now the the codon. The second one site. A empty tRNA A dipeptide site and first with and the the another glycine. This U on the C are C that C factors C elongation G requires A process gly ser tRNA carrying A elongation mRNA together . met Now ribosome. for a stop this, G reaches anticodon G ribosome an G the with G until tRNA C no U is G continues There A process codon. U This so ribosome translation stops and termination factors remove the mRNA ribosome molecule. moves along m e se r tripeptide g ly Dene 2 Make 3 Explain the functions mRNA, tRNA the following a table to terms: compare and of amino acid activation tRNA and translation mRNA. the following peptidyl and in translation: ribosome, transferase. U A actively if carrying there out were protein no lysine in a human synthesis. translation that a cell provide. mRNA b G requirements for G the G of C list G must a U Make U a G A 5 C was happen C that would C cell what C Suggest G A 4 mRNA t Summary questions 1 Explain the role of each item in a rRNA protein. C In serine – in U methionine site. to sites. complex met acid P 1.5.3. start tRNA and amino- is ne Did you know? Each peptide T o as A It site: polypeptide. follow stands for peptidyl. of ribozyme foc us sub- The A P and know translation selection translation. Translation Now natural ready S tudy supply and your ribosome list. Figure 1.5.3 Translation 71 1.6 Genes to Learning outcomes phenotypes Chromatin Eukaryotic On completion of this section, cells microscope should be able describe the between relationships DNA, chromatin explain the nuclei known used homologous in which chromosome discuss the and links is you not and Where as the between phenotype of can can see often clearly see with that the the light appearance that is is active The less the stain associated tightly and areas coiled This it is is with takes stain DNA staining being darkly histone up inactive densely DNA more areas than of others. proteins more that are is of to form deeply not and being euchromatin transcribed. chromosomes an Chromosomes This double precise, become structures tightly the visible happens two to after as consisting make sister separate they two have of two sister chromatids structures replicated, molecules chromatids . are so of nuclear chromosomes DNA As genetically during the that are replication is very identical. foc us The chromosomes metaphase can nd protocols for by searching of are mitosis clearly (see visible page 81). as If separate they are structures during photographed at the this stage extracting the the image can be sorted to match the chromosomes into homologous term pairs. ‘learn DNA this some heterochromatin . more packaged online you Y ou DNA, are DNA since transcription. is division. You that stain. karyotype organism. S tudy a even Homologous proteins nuclei use contain chromatin. is terms nuclei The and chromosomes if to: the have you The arrangement of chromosomes into pairs is a karyotype. The genetics’. chromosomes the centromere The Y in sex each is pair always chromosomes, chromosome chromosomes is are in X the the and are known as same Y , homologous same are with size, place not the they and like X have they this as the have only chromosome. same the a same small The shape, genes. part of the non-sex autosomes centromere The human and two two sex genome sex has about chromosomes. chromosomes. 20 000 The Males genes and chromosomes have 22 pairs of 22 are pairs of autosomes numbered autosomes 1 and to an 22 X and and a X Y Figure 1.6.1 chromosome. Genes a protein to control polypeptide cell it will through Red blood b cells The of does 16. of about the haemoglobin molecular refer to genes the not sickle shows a form cell of are two or a oxygen anaemia some if autosomes is as to be to involve structure happens stem cells by a and two in protein. X then Golgi added to bone it may the If it will body marrow. with Large the it is a other involve and in pass where production synthesis translation, used make combining with protein the or After structures. exported molecules also formed in tertiary reticulum sugar may acids and it quaternary from faulty, occur transport having rearranged the is on polypeptides then faulty is page on different proper of being of cut insulin. numbers assemble and Diseases the if they are of is of of into that they faulty. If one haemoglobin produced and haemoglobin thalassaemias. polypeptides phenotype chromosomes. production haemoglobin affected. 130) the are the molecule genes, the either severely (see human consequences 72 of molecules. for genes amino endoplasmic polypeptides haemoglobin cytosol; by form polypeptides and the of secondary Modification to and a details to into rough polypeptides page pairs phenotype sequence possibly glycoprotein. Link the folds pass the modified, structure 22 chromosomes. DNA to more have Homologous pair of chromosomes: the human X chromosomes For Females The code for the are table and the Module Conditions the at in the Himalayan warm phenotype that are the colour the of direct an Siamese rabbit and of the and is gene between expression in melanin organism result interaction of inuence of temperatures The and body breed Siamese is all only its action genes and genes. features, For example, tyrosinase produced (for the of cats, in both example, the is environment Genetics, variation and natural selection in inactivated extremities. internal sickle 2 and cell (for external anaemia) example, the cats). Link Gene Chromosome Polypeptide Consequences of location affected faulty gene Two genes enzymes a globin 16 a-globin given that tyrosine globin 11 b-globin 11 enzyme: table code for in and the amino acids, phenylalanine, as b-thalassaemia shown TYR the involved a-thalassaemia metabolising b in are tyrosinase in the diagram. albinism (transmembrane no protein melanin in the skin in or hair melanocytes) PAH 12 enzyme: phenylketonuria phenylalanine (PKU) hydroxylase AR X testosterone no receptor protein receptor complete testosterone insensitivity INSR 19 insulin receptor no receptor (Donohue syndrome protein Summary questions 1 Dene the terms chromosome syndrome) relationship protein in diet 2 Draw a digestion in a ow named use 3 that phenylalanine between chart gene to may the and the two. show how inuence Find out ability hydroxylase (You information from sections about inuence when explain phenotype. previous occur chromatin the gut human reactions and to in the need this this to and the chapter.) genes that the following features: see colour; production tyrosinase of factor VIII for (PAH) phenylalanine testosterone blood clotting; receptor. What do DOPA accummulates these tyrosinase phenylpyruvic 4 acid to what protein in may common? happen molecules after Explain why insulin receptor developing proteins ner vous have translation. 5 damage Outline to dopaquinone causes genes enter the Golgi body system after translation, polypeptides of but the a and haemoglobin b do melanin mutations in genes tyrosinase cause for PAH blocks in and not. metabolism, 6 so reactions do not Explain of Figure 1.6.2 the effects of mutations occur the genes: i TYR; ii PAH; iii AR; The TYR and PAH genes code for enzymes that are involved in metabolising iv INSR on the phenotype. the amino acids phenylalanine and tyrosine 73 1.7 Practice exam-style Structure All the questions questions. You that in this can find accompanies this section more are short practice and roles answer MCQs on questions: of a Make a simple the book. of labelled diagram of a normal Explain why in and DNA there are four different all the containing cycle of DNA a medium containing only nitrogen. After one isolated from these both isotopes of cycle bacteria DNA. After replication in the medium a containing nucleotides light isotope, half of the DNA was similar to that not five. produced c isotope of nucleotide. the DNA light replication further b acids bacteria were transferred to the CD had 1 nucleic State THREE ways in which mRNA in the first cycle of replication and the rest differs from had only the light isotope. DNA. a Which part of a nucleotide contains the element nitrogen? 2 In 1958, the American Meselsohn their and a heavy In the The many 1950s, results, Watson replication nitrogen contained this and Francis Crick Organism a bacteria. They in all the Explain table grew c containing Predict would DNA the below, i relative provided how replication isotope. Some of the determined the b results of medium so that Erwin Chargaff in in in heavy summarised Matthew published the generations isotope of molecules 3 Frank Stahl experiments on bacteria for researchers quantities of evidence for the these is results have the that obtained conservative; the four results support the idea ii bases structure if Meselsohn and Stahl replication was: dispersive. in of DNA DNA in different proposed organisms. by James 1953. Percentage of Percentage of Percentage of Percentage of adenine thymine guanine cytosine 24.7 23.6 26.0 25.7 31.3 32.9 18.7 17 . 1 wheat 27 .3 27 . 1 22.7 22.8 octopus 33.2 31.6 17 .6 17 .6 sea 32.8 32. 1 17 .7 17 .3 chicken 28.0 28.4 22.0 21.6 human 29.3 30.0 20.7 20.0 Escherichia coli that semi-conservative. (bacterium) a a yeast urchin Explain the The how the structure next table of data in the shows Chargaff ’s Organism Percentage of a 24.0 virus b State how c Suggest d In the would e 74 the why DNA you Explain table data for the the data for expect the to the arrangement of nucleotide bases in Watson and Crick’s model of the virus of A a virus. Percentage of thymine Percentage of 31.2 23.3 nucleotide a fish, contain ratio data for adenine extracted from why confirms DNA. is bases + T the virus different from 28% cytosine? + G : C in of the the data for Explain your differs from all contain the the to data for other the cytosine species. organisms in the first table. organisms. adenine. What answer. species Percentage of 21.5 differ from nucleotides guanine percentage of the nucleotides Module 4 Lysozyme is secretions is an to composed folded The into table enzyme found break of a down one the in polypeptide specific tears cell tertiary and walls of of 130 other b bacteria. amino 2 Genetics, Outline It DNA acids how leads receptor structure. c shows: a to variation sequence the of why surface, but the the natural selection nucleotides production glycoprotein for Suggest and of the in membrane insulin. receptor for receptor for insulin is on testosterone the is cell in the nucleus. the sequence lysozyme of three amino acids in the human polypeptide S tudy one possible mRNA that sequence codes for of nucleotide these amino bases for acids. Question give arg foc us the cys all 6b the asks for details it says that glycoprotein. You CGU an outline, so transcription you and do not have to translation. Also glu notice mRNA of UGC the membrane should refer to receptor the Golgi is a body in your GAA answer. template … DNA … … In Question steroid a Copy and DNA complete triplets on the the diagram template to show Explain why the human is fat a different gene for sequence of need to know that testosterone is a soluble. strand. lysozyme The diagram triplets from shows the part of the process of protein may synthesis have you the 7 b and 6c that occurs in the cytoplasm of eukaryotic the cells. answer you Lysozyme have has given a very in a specific tertiary structure. cys amino c Explain how the DNA in the gene for acid lysozyme gly determines the specific tertiary structure of cys arg glu lysozyme. 5 a State THREE from The table that ways in which transcription differs replication. shows inhibit the modes replication and of action protein of several A drugs synthesis. C C C Drug Mode of C action E U G A aphidicolin inhibits DNA A A C direction C C G U polymerase B C ciprooxacin inhibits which R rifampicin the enzyme unwinds inhibits RNA D topoisomerase DNA a Name b State the the types terms of RNA used labelled A, to describe of B the ribosome and C. groups of polymerase nucleotide bases at D and E. (rifampin) c T tetracycline prevents to the A the site attachment of of Explain t-RNA ribosomes correct the protein. to b Explain on the effects replication; ii that: drugs R i drugs A and T and C have on have d protein how the help you amino acids sequence (You with in may your refer that are arranged primary to the into structure diagram of above answer.) Describe THREE features molecule become the of a not found polypeptide in a DNA molecule. synthesis. c Drugs these R and T drugs only do not affect bacteria. Suggest affect eukaryotic why S tudy Question 6 A length of DNA with a specific nucleotide the code for the formation of the is of a a the hormone glycoprotein found cells in State the the codes for liver, name the insulin. The in the muscles given to receptor cell the receptor surface and fat asks the you right to explain sequence, how so the this amino answer acids are needs of of translation. protein membrane storage length in receptor details protein for 7c sequence arranged carries foc us cells. tissue. DNA that protein. 75 2 Genetics, variation 2. 1 Mitosis of this section, started life be able distinguish cell between nuclear and division state that cell embryo many mitosis nuclear division genetic stability is the that type of maintains division is cytoplasm the the position mitosis and in the cell discuss the role of mitosis also known divides as into a zygote. two cells. Almost This asexual that repair This in a size cell give that produced hollow as the divides two new occurs are maintains development, When a surface cell ball zygote its cells identical of cells but nucleus cells, as genetic the reaches membrane carbon and each is now with each formed. growth a in first and nucleus. number other This composed divides increase to is and to of then the Mitosis like the this. is The parent stability cells a in the certain embryo size it is gain nutrients unable to and support grow itself as in the dioxide is fast not large enough. enough This is to absorb because as enough cells oxygen become or larger surface area does not increase enough to support the increase in the cloning. volume the of protoplasm surface cells divide unicellular yeast. 1 to division are same time a reproduction, the replacement, the Each until in lose growth, cell, zygote cycle cell a cell size. division egg of Later replication, fertilised fertilisation divides nuclear nucleus. describe a continues about cells. nuclei after to: by as you immediately should selection Cell division Y ou completion natural (1) Learning outcomes On and area to into two volume after eukaryotic Their (cytoplasm nuclei ratio plus becomes growing organisms, divide by nucleus). for a such mitosis smaller . while as and As and This you Amoeba, then cells the increase is one can reason see this Paramecium cell divides in size why in and by binary nuclear division fission Figure 2 cycle. this or by 2.1.2 This budding. shows shows These the are events that after a forms that cell of occur is asexual in a formed, reproduction. stem the cell during following one events cell occur in sequence: growth DNA of cytoplasm replication mitosis cytokinesis (cytoplasmic 3 division). growth DNA of cytoplasm replication occurs in the ‘S’ phase of interphase. ‘S’ stands for 4 synthesis. The molecules are molecules G ‘G ’ phases made such to as are growth synthesise nucleoside phases new during membranes triphosphates are which and biological new made in organelles. In preparation 1 cytokinesis for replication attached to and tRNA transcription. molecules Amino ready for acids are synthesised and translation. 5 Replication almost information parent Figure 2.1.1 cell. always inherited If by replication gives the is rise two not to identical daughter like this DNA cells then is the so the identical cells may genetic to that of the differ This Amoeba is dividing into genetically and not function together in a tissue. The immune system two by binary fission. The nucleus divides detects before the cell divides into two. cells expressing Occasionally reading Link Use the to nd lm of and stem rate of for further page 144. during polymerase. cells, can that lose Some have the lost ability and eliminates replication of these the to in spite inuence power respond to of the proof mitosis. divide, to them. can signals start that to divide control their division. asexually by information budding refer multicellular organisms, mitosis is involved in: and growth repair replacement asexual of cells and tissues to other 76 cells occur proteins dividing. Yeast In reproduces mistakes DNA Differentiated internet Paramecium by different following damage wounding or 144–7). reproduction (see pages Module In multicellular to form out specific continue and skin functions. there white divide time. cells If These dividing example, red organisms tissues. cells. damaged cover the animals, to cells the produced differentiate mitosis replace is In stem blood to skin that by are cells cells Stem cells by wound a the in the cut division and the base the same replace for of that the the are For cells damaged off are classied in all divide of the the to form cells they cells can stem plants, are areas and the Cell The meristematic where these cambium cells cells that are are gives the equivalent found: rise to examples xylem and of stem are root phloem changes cells) cells. that occur mitotic to a cell cell between cycle . During one the division cell to form two daughter nuclei followed, in the (such cytoplasm to give two daughter cells each tips, and the cases, with cells shoot nuclear division is not followed by in fungi that have hyphae (long thin types; of of stem adult marrow one or two the next nucleus by the its own foc us are not call interphase cytoplasmic threads) that a ‘resting divides cell is far from being ‘at rest’ division interphase: DNA is replicated, nucleus. division are are synthesised, as membranes happens cell bone cell tips macromolecules Sometimes range Embryonic all as the stem types. during of produce of tissues. cycle most to can form. produce stage’. A first according S tudy the types Meristems Do as selection tissues. cycle known natural different cells tissue In and Did you know? There to epidermis variation carry replacement rubbed stem the cells. the Genetics, together to ability more marrow remain specialised retain more surface then then cell become cells bone cells at and stem produce in by to 2 and organelles are not made. subdivided into cells. cytokinesis p h a s na pa ah es m e t a p h a s e o esa hpo let mitosis Link Prokaryotes e cell since G G do not divide by mitosis differentiates they linear phase do not have chromosomes. nuclei See and page 144 1 phase 2 for stem S phase replication cell a description binary ssion in of replication and bacteria. continues of to divide DNA Figure 2.1.2 The mitotic cell cycle. Mitosis takes about 5–10 per cent of the cycle. Summary questions The rate of cell division is controlled by proto - oncogenes that stimulate 1 cell division and tumour suppressor genes that slow cell Explain the nuclear A mutated proto - oncogene, uncontrollably. If a tumour called an oncogene, suppressor gene stimulates mutates it cells becomes to the rate of cell division to increase. Cells that start to and divide Suggest are often removed by the immune system; if not they into tumours, such as benign and malignant to a explain cell what that does would not may receive grow and divide happen uncontrollably between cell division inactive, 2 allowing difference division. a nucleus during cell cancers. division. Mitosis ensures that each new cell has exactly the same genetic 3 information as its parent cell. All the cells in the body (with the Explain why important of gametes) have identical genetic information so that they can all a two the result of replacement. Explain in number other genetic nuclei of and are produced chromosomes the stability is same as in the maintained the in the daughter cells as daughter parent because in the a nuclei are the same the genetic is no genetic a asexual reproduction differs from unicellular organism, as such as eukaryotic Amoeba or Paramecium nucleus parent in information is the Outline the events that occur cell during there how prokaryote that 5 same is repair mitosis: daughter each stability growth, efficiently. 4 As during work and together genetic exception the mitotic cell cycle. variation. 77 2.2 Mitosis (2) DNA Learning outcomes Y ou On completion should be able of this section, you can garlic. to: name the four describe stages of processes The a that make stages the of cells growing meristem. tip cell Score the garlic of to show 2 After mitosis from of the yourself root shoots this tip and of roots Here is a procedure underside of a clove to if a is followed you make plant, where follow such a mitosis. temporary as mitosis with by onion is or localised cloves of is garlic. of garlic with a sharp knife and suspend 3 Cut a over day water remove so the some base just intact touches the water surface. off 10–20 mm on a watch of the glass root (or Heat Put in (The of acid shallow a small dish) for volume 10 of ethanoic minutes. –3 10–25 cm bath. 1 mol dm hydrolyses hydrochloric the DNA acid forming to 60 °C in deoxyribose a water aldehydes foc us which carefully at Figure 2.2. 1 and identify the react holds plant W ash the with cells the stain, and hydrolyses the middle lamella that together .) and 5 2.2.2 tips. other 3 S tudy roots. the four 4 Figure for and mitosis. acid Look cycle mitosis diagrams stages the of the occur the during see during mitosis 1 the replicated preparation called is root tips in cold water for 4–5 minutes and dry the hot on filter stages paper . of mitosis in the photomicrograph. 6 Then try Summary question Use a mounted needle to transfer the root tips to 3. hydrochloric 7 W ash filter 8 Use the root the Use a Add a blue Break 12 Place of leave again for in 5 cold minutes. water for 4–5 minutes and dry on a remove the of to remove slip for 2 with over gently slip all keep but the two root tips onto a clean 2 mm gently the growing root tip. (acetic- orcein) stain or toluidine minutes. a the to from tips. ethano - orcein leave tissue press cover but drop and cover and the to rest, small up needle slide. the stain 11 slip tips mounted scalpel Discard 10 and paper . microscope 9 acid mounted root spread with needle. tips. the the Place cells. blunt filter paper over Alternatively, end of a the tap mounted the cover surface needle or pencil. 13 Use the those low in power Figure Y ou of may prepared slides. be the show what plant to search form also that way – a the the the during cells they furrow drawings above diagrams happens and the make described from Plant spindle not Figure 2.2.1 cell. to way that made chromosomes the microscope asked in Note drawings to the slide for cells like 2.2.1. to the not have across have cell the chromosomes an cell are so the during in have not diagrams centrioles animal drawn are are cell, centrioles walls you prepared 2.2.2 They nucleus, in slides from Figure microscope. mitosis do in from or for and not a organising membrane cytokinesis. a does Note diagrammatic Photomicrograph of plant cells dividing by they do not look like this in real cells as you can tell mitosis by In plant cellulose of the with 78 cells of cell an a cell and plate animal looking plate other to cell. forms cell divide carefully wall the at the across the materials. cell into photograph. middle of the Membrane two. There is cell. forms no This on furrow is made either as side there is Module 2 Prophase centriole DNA is wound chromatin chromatids Centrioles envelope the up so it condenses. attached move to breaks is packaged Each to each opposite up into into other poles small at of pieces S tudy chromosomes. The chromosome a has Microtubules centromere. the cell. The that foc us two sister protein nuclear disperse through cytoplasm. make of hollow the and are made molecules globular together tubes. They form cytoskeleton can of joined quickly be (cell to part skeleton) assembled and Metaphase broken Chromosomes cell, which is metaphase by to called pole, others so across the organise that attach to the DNA forming the the middle equatorial microtubules. Some chromosomes. The replicated themselves plate. Centrioles assembling pole arrange sometimes the spindle centromeres chromatids in mitosis. the of apparatus extend from the centromeres can as plate or microtubules the of down separate in is the next stage. S tudy foc us Anaphase Spindle microtubules are anchored at the centrioles so when Look they are broken down they shorten pulling the at videos chromatids opposite apart. The poles chromatids with have chromosomes, sister the separated each chromatids centromere they composed are of pulled leading. Once become one animations and time lapse sister of mitosis online. to the sister single-stranded molecule of DNA. Telophase Chromosomes arrive reappears. The nuclear endoplasmic at the poles envelope and uncoil. Chromatin reforms from pieces of rough reticulum. S tudy foc us Cytokinesis During cells a which The or after ring of telophase the cytoplasm microtubules forms contracts to draw membrane fuses so in the below divides. the membrane separating the In cell to form two new animal membrane a furrow. You must stages them. of be to identify and Remember the sequence interphase and cells. cytokinesis Figure 2.2.2 able mitosis are not stages of mitosis. The stages of mitosis in an animal cell. Summary questions 1 Explain plant why the cells in the diagrams on this page are animal cells and not cells. 2 Explain 3 Identify how the mitosis stage of maintains the genetic mitotic cell stability. cycle shown by each cell in Figure 2.2. 1. 4 Make walls 5 a drawing as Arrange cycle. two your (You of lines one with drawings may need cell from a gap so to they cut each between up show your stage. (Remember to show the cell them.) the stages drawings as they occur in and stick them into the cell your S tudy notebook in the correct When 6 List what happens to a chromosome during a complete mitotic cell Describe what happens to nuclei, nuclear envelopes, centrioles and answering Summary question cycle. 6, 7 foc us sequence.) the do not forget the three stages of cell interphase. membrane to make during sure you one complete describe what cell cycle. You happens to could each tabulate structure in your each answer of the stages. 79 2.3 Life cycles Learning outcomes Meiosis The On completion of this section, other type chromosomes should be able state that nuclear meiosis division is the that type halves of nuclear a division nucleus is is meiosis, halved. This is in which essential the in number of organisms every number time two so that gametes the fuse number of chromosomes does not that double together . human life cycle starts at conception when a sperm fertilises an ovum and (egg variation, sexually the The chromosome promotes in to: reproduce of you not cell). The fertilised egg or zygote has two sets of chromosomes – a genetic paternal set inherited from the father and a maternal set inherited from the stability mother . describe the human life produced cycle retain explain the owering plant This cell from the is this ability diploid diploid to as it cell divide. has by They two sets mitosis of are differentiate chromosomes. also to diploid. become But All the not cells all specialised and life often lose the ability to divide. Some cells remain undifferentiated during cycle development describe the role of meiosis in and enter the developing sex organs as the gamete-forming life tissue. These cells are the germ line cells. Cells like this in the ovary cycles. divide Did you know? by just before two start are around specialised cells 200 in different the human and is a plants by In very few, producing but biological a they greater are will see have the of one, role sets that two, of refers of cells to is involved organisms three, four is to or number. Mitosis ploidy number, whatever to of can do not The cells gametes). process in the that making until month form Sperm after to cells They of stop puberty form that ova sperm at when a time one or (female divide production millions production these generates have two Each chromosome. 22 plus an or a correspond abbreviations cells of have gametes one set of variation in the by starts every meiosis at to puberty day. to halve the number chromosomes. nuclei X Y set of of chromosomes; chromosomes Humans have chromosome chromosome. with n sets that the and size 2n are of 23 and the used contains are They of are produced. males numbers organism to signify of as nuclei one chromosomes human The haploid Species the maintains in have example a set having one of with 22 each plus an in you the haploid can and see in set females chromosomes a X set table. diploid. Haploid number the Diploid (n) number that Drosophila melanogaster 4 8 23 46 12 24 10 20 20 40 28 56 39 78 be. human, Homo sapiens Pride Barbados, Field of mustard Caesalpinia pulcherrima (‘fast elephant, Loxodonta africana dog, mouse, Brassica rapa house in common multiple with sets Mus musculus Canis familiaris adder’s tongue fern, * plant’) European domestic 80 line each meiosis. chromosomes nuclei fruit y, happens germ (male state by more; halve ploidy so Meiosis chromosome the chromosomes. You and meiosis testis, cells chromosomes. type having number this approximately continuous Sets of foc us –ploid in divide of of sufx remain to capable variety Diploid The start comparison molecules. S tudy then body. haploid. of and the chromosomes have and divide sperm Meiosis Flowering birth to gametes). produce There mitosis of Ophioglossum reticulatum many ferns, this chromosomes, species not just is likely two sets. 630 to be polyploid, 1260* so there are (2n) Module The process The fact that it gains of that is not. one type. the Meiosis At egg set nucleus nucleus. maternal The is pollen rise within Pollen to the set of and the apart, fusion and plant life since cells the is the divide and, is random tell ensures since it came maternal males the X cell that from in the of came and and natural selection Did you know? Not chromosome chromosomes it process. variation implies daughter of Genetics, XX each all the is animals same male have way as and XY sex determined humans; in birds is female, for example. from the paternal chromosome is origin. of are a type origin different meiosis spore gamete In in millions Flowers by female female quite 1600 ancestor . not. a each nuclei since to not that two in paternal paternal is are possible often is cycle it that grain; Y is is is chromosomes each gamete there of so with maternal set it most the of that is set controlled chromosomes other but and number complete carefully restored common contain the gives a is one Occasionally surprising shared They chromosome chromosomes origin owering hardly we in is of chromosomes the gains fertilisation, number One sperm cell complete represented. diploid halving each 2 to that years made to for form of (1.6 sexual spores. multinucleate unlike the humans. billion pollen This years) is since reproduction. The male structure grain, is spore that retained ower . grains are transferred from ower to ower or , sometimes within Link the a same tube ower . towards If the pollen transfer female spore. is successful Inside the then pollen a pollen tube is a grain grows nucleus that This divides female other by mitosis gamete nuclei nucleus to then temporary to to form give a divides store form of a two diploid triploid by male in zygote and endosper m mitosis energy gamete a to give a nuclei. the One other nucleus. triploid fuses fuses This tissue with with triploid that acts is an outline of the owering the plant life cycle, more detail which is described in two on pages 148 to 153. (3 n) as a seed. Summary questions adult flowering plant 1 Dene and 2 the terms haploid, diploid triploid State the number of flower chromosomes mitosis, growth in the endosperm and tissue development of Pride of Barbados, Caesalpinia pulcherrima stamens carpels 3 Name ten specialised cells in humans. pollen sacs ovules 4 Explain in life why meiosis is necessary cycles. meiosis seedling 5 Make cycle pollen grains embryo a meiosis seed and the life where and gamete Some organisms cycles with as fertilisation embryo zygote mitosis occur on diagram. germination 6 female show Indicate dispersal your gamete to humans. sac mitosis male diagram of have life short diploid meiosis occurs soon stages after in fertilisation. These organisms embryo are seed haploid for mitosis, growth cycle. such organism is Plasmodium inside fruit that Figure 2.3.1 life and One development most of their causes malaria. Find a life The owering plant life cycle cycle diagram for this organism and suggest the advantages disadvantages of most of the life being and haploid for cycle. 81 2.4 Meiosis Meiosis Learning outcomes two. On completion should be state able that divisions, of this section, The divisions you name the meiosis meiosis consists I and of during obvious with difference mitosis is that so the it is easy nucleus to goes confuse through the two meiosis: meiosis I meiosis stages of meiosis I the processes that – meiosis II homologous chromosomes separate – chromatids separate. II main ways in which meiosis differs from mitosis are as follows: and describe most in similarities two II many to: The has meiosis has meiosis II two divisions of the nucleus known as meiosis I and occur mitosis has meiosis only one division meiosis. I involves the pairing and separation of homologous chromosomes S tudy Take care mitosis. and lose is homologous chromosomes there are four there are two the chromosome number is the chromosome number remains daughter nuclei are daughter nuclei produced daughter do not nuclei at associate the end with of each meiosis other in mitosis II foc us over It writing easy marks to as a meiosis misspell daughter nuclei at the end of mitosis and halved in meiosis I them the same in mitosis result. number as the haploid parent in in meiosis mitosis have the same chromosome nucleus Link daughter parent If you are unsure about in mitosis and what it over pages daughter you what once nuclei and II. look produced the parent through the thing This halves does The in from each other and from the in mitosis are genetically identical to each nucleus in The not egg 162 in this the but egg of It because an not 2.4.2 from do the in two starts of egg, daughter meiosis again and II Figure that cells the The in meiosis haploid animals in 2.4.2, if chromosome mitosis. halve show the I think divides number divide in chromatids an that the meiosis of each number II. animal daughter spore follow cell chromosome meiosis in a cells. cell. In this Details production in case of plants are respectively. takes for might the in in four differentiate cells meiosis half when they does 148 state the as of Y ou have again production and beginning formation nuclei Figure cells arrested above, I. humans potential until in diagrams happen separate produced haploid process in in pages the chromatids. happen meiosis are meiosis the daughter diagrams sperm to will chromosome before each over the into 40 years divides to birth, menstrual division cytoplasm sperm months of cells but is cycle. before the (see produce arrested Some they nucleus unequally to page mature eggs is the may large whole Meiosis meiosis remain meiosis. same one The sperm. during complete give 162). as I in In the shown cell (the Stages of meiosis during formation of pollen grains in a owering 82 to happens and same plant different 76–79. As Figure 2.4.1 genetically meiosis is for, other look are in what happens nuclei nucleus secondary a nucleus. oocyte) and three tiny cells that each consist of little more than Module Meiosis early prophase Genetics, variation and natural selection I Prophase I 2 I centriole chromosomes in the light homologous chiasmata prophase I details); at the join, metaphase I end of move to I move the paternal anaphase all facing microtubules Telophase the of hold parts after thicker; they (or the together; crossing spindle in over over breaks endoplasmic other diagram chromosomes in are visible is maternal unshaded (see non-sister page 85 for more complete up into small reticulum; sacs of centrioles replicate microtubules metaphase) (in this are crossing chromosomes bivalents in chromosomes envelope the and form equatorial same to nuclear part poles other attach of plate each words bivalent the position paternal themselves chromosomes are pole) to the centromere chromosomes microtubules poles of each chromosome if this was (each towards anaphase with the of two poles; chromatids) chromatids are pulled would be by the pulled to mitosis I chromosomes the of the nuclear number I and I opposite telophase the I maternal double-stranded shortening I shorter bivalents; paternal exchange become to and independently become to form the become visible opposite bivalents Anaphase they pair and and prophase Metaphase that chiasma) form break which not shaded chiasmata membrane, and are (singular chromatids late so chromosomes chromosomes condense microscope of reach the envelope opposite reforms chromosomes cytokinesis occurs cytoplasmic – the bridges of to the cell poles make surface between two parent the daughter cell – these nuclei nuclei membrane forms that are have half the haploid a furrow leaving small cells Interphase An interphase may occ ur between the divisions of meiosis I and II in which case the chromosomes uncoil. Cytokinesis may also occur at this stage, but not in all organisms . prophase Meiosis II II Prophase II centrioles meiosis nuclear replicate and move to the poles that are at right angles to those in I envelope Metaphase breaks up as in prophase I II Summary questions metaphase II individual double-stranded chromosomes align on the 1 equator with their Explain that randomly why the microtubules attach to i the halves ii does during not meiosis Anaphase important number: meiosis halve I; during II. II II sister the chromatids centromere break and apart move at 2 Describe what opposite poles by shortening anaphase as meiosis nuclear envelopes haploid genetically Make reform nuclei that different to to what give are a table and from cytokinesis all the happens compare what meiosis with I to in meiosis include II. similarities one parent may follow, but well as differences.) cell; not in 4 Identify the stage of meiosis organisms shown Figure 2.4.2 to during (Remember as another I II. II II four a in happens to meiosis I 3 Telophase during of and microtubules happens to chromosome telophase is chromosome arranged centromeres anaphase it chromatids The stages of meiosis in an animal cell to produce sperm cells in describe the Figure what is 2.4. 1 and taking place to chromosomes. 83 2.5 Segregation Learning outcomes completion of this section, individual be able one state give that rise processes to describe explain over in heritable the segregation meiosis chromosomes organisms another . With produced by the exception sexual the same of reproduction identical twins are we different are genetically to: unique. over you from should crossing Segregation of All On and process of meiosis variation of random chromosomes in types All of genes between known alleles members determine individuals as are of alleles are that expressed the environment. the environment the in features caused we have the Genes species by the of each provide the the (see same species. different inherited phenotype have depends Genetic versions page 72). on inheritable genes of genes, way these interaction variation. the differences the The the since The with effect of I the process during of prophase on the expression of those genes is not inheritable. crossing I During of meiosis information meiosis. these is first of The chromosomes daughter each I; Cell changes that changes nucleus or is are to from the one Pairing of segregation, A chromosomes one halving arranged receives chromosome. separation, occur passed of into set generation of the homologous to pairs occurs in the the genetic next. The number . so with that one chromosomes chromosomes Cell rearrange cells chromosome chromosomes homologous of to of each example occurs in anaphase of prophase I. B diploid (2n first cell 4) meiotic division second meiotic division haploid Figure 2.5.1 haploid cells cells Random segregation of homologous chromosomes in meiosis I. Maternal chromosomes are shaded darker; paternal chromosomes are lightly shaded. The S tudy arrangement is entirely random. homologous Make sure you know the Check and the the terms gene glossary for always paternal try to use pairs In of Figure and maternal 2.5.1 you chromosomes. can chromosomes They see can this at metaphase happening either line up as with I two shown in difference cell between of foc us and the A or as in cell B. There is a 50% chance chance they will that they will be in allele. alignment A and This rise a 50% be in alignment B. meanings them correctly. gives different to inherited mixtures of variation maternal and because paternal each nucleus contains chromosomes. Link Y ou II Random segregation in can see Figure the results of this in the haploid nuclei at the end of meiosis 2.5.1. of 23 chromosomes results of the is responsible for dihybrid cross as the shown Random segregation combinations of during maternal meiosis and in humans paternal can generate chromosomes 2 different (8 388 608). At 23 on pages 84 98–99. fertilisation the in zygote. a human number of possible combinations is therefore 2 23 × 2 Module 2 Genetics, variation and natural selection Crossing over When wind homologous around chromatids between possible to touch see I is over This Crossing over chromatids. nucleotide this is were to nucleotides are many Genes in the are a of close crossing over and crossing over does over the that to so and of prophase point sections has at occurred where are chromosomes part that has to I exchanged it is the The that they two separate as chiasmata. would or , on so maternal alleles are occur if breakage occurs may be in gained that the not early in at lost to be by Did you know? a gene. of there and split is average the just than Loss as on The for gene harmful not part single all. switched tend ‘clusters’. or a resulting as are and genes. within protein just chromosome together origin occurs no genes in different not it and likely, how of precise point more genes a of genes be crossover divide over one as human of chiasmata of Nos small 21 and chiasmata chromosomes two. There chromatids such number large is rarely between more the chromosomes, 22. off. up by Occasionally them. A A pair each chromatids are control inherited occur another that between together are the combinations protein DNA At breaks as non-sister mutation regions beginning over at inactive the exchange one precisely added happen sections that very crossing or an to different fact, produce DNA and between at together . Later chromosomes occurs pair stay the crossing gives lost other attached gives In they breakage DNA called paternal. so chromatids. where of Crossing would each remain exchange prophase If chromosomes other non-sister chromatids and each B A B B of A b a B a b A b a B a b homologous chromosomes a b Summary questions chiasma 1 Figure 2.5.2 Explain what is meant by the Crossing over between chromatids of a homologous pair and the effect on term heritable variation. the alleles of two genes, A/a and B/b Crossing over segregation that or no ever adds of two will even more chromosomes. humans, have the with same variation As the a to that generated result of all this exception of identical by variation twins, 2 random it is have ever Dene is thought of had the used to term a State when effects that of an generation. random segregation individual We have has seen and inherited four ways crossing before in which over are passing to ‘shufe’ them meiosis on to generates the the b random is the alleles of random and If a so daughter nuclei contain one of mixture is receive show of random paternal cross and over chromosomes segregation maternal during that so a cells a I halves of a State chiasmata of are I so mixture of chromatids of maternal is also and random paternal – often DNA b describe paternal crossing Make one the the chromosome to In order restore gamete the the and body for the are end number , meiosis replication diploid not are by not to I, why the If a next each occur number . identical. inherited that of is there a need Also chromosome these chromatids crossing chromosome generation genetically identical has for over with there and will occurs two will will two the other be not that occurs, on the some effect the process of over. diagrams of crossing alleles B/b; of to show over three genes: C/c. Explain the in cycle. a life advantages of meiosis to the groups work over a chromatids two crossing chromatids sister have so I. and that while prophase when between chromosomes prophase are a c sister mixture At chromatids in during A/a; division? separate in why formed not. chromatids. sister Explain daughter 6 second process segregation. a segments segregation meiosis segregate chromosomes nuclei maternal is gene 5 contain chromatid one one chromosomes homologous the the and variation alleles daughter of homologous nuclei chromosomes meiosis, inheritable: pair of during describe next 4 that it promotes variation occurs genes as behaviour chromosomes. segregation The the genotype. 3 Meiosis segregation describe is 7 Explain the why same identical twins have genotype. of together . 85 2.6 Nuclear division This summary chapter concerns two forms of nuclear division, mitosis and Learning outcomes meiosis. On completion should use be able and mitosis of make and identify this section, you It to: the is a good mitosis tables to each events stage make show models what mitosis of to the and in about explain nuclear and differences process DNA Mitosis Meiosis the condenses each feature at the start 1 2 division of divisions of the nucleus in importance this of table The each of chromosome the daughter number same nuclei as the parent (meiosis I and meiosis II) half number the parent of nucleus the nucleus in meiosis in both in meiosis I in meiosis II only in meiosis II only (promoted division. homologous pair to form crossing chromosomes bivalents over occurs chromosomes at the are metaphase random chromatids opposite genetic arranged move of variation daughter occurs divide poles to the among nuclei (maybe errors in a little if replication) crossing of and 1 the meiosis Make II. a Y ou (see divisions cell table above with the table you drew to by over, random Compare I plate segregation centromeres 86 between during meiosis. foc us the similarities envelope number Think the table. ‘disappears’ of S tudy a occur chromosomes happens and in meiosis nuclear summarise Feature that of to meiosis compare meiosis during during idea and segregation chromosomes) compare meiosis I II. new table should Question be 3 that able on compares to page think 83). of mitosis other with meiosis features to add I and to meiosis the table Module The table that occur 2 below Match and one each letters once, is during list event to more a of meiosis with identify than stages (1 to a or meiosis (A to H) and a list of Genetics, variation natural selection events or events not at stages and all. of meiosis. stages; Some you events Use may the use occur in numbers each more letter than stage. S tudy Event during pairing and 10). stage the once of 2 of meiosis chromosomes Number Stage of meiosis 1 prophase 2 metaphase 3 anaphase 4 telophase 5 prophase 6 metaphase 7 anaphase 8 telophase Devise A I for condensing nuclear of chromosomes envelope bivalents crossing align on reforms equator of cell over centromeres separation of divide homologous foc us Letter your own matching question mitosis. B I C I D I E II F II G II chromosomes separation of sister chromosomes align equator cell four 3 of the nuclei The on the 10 content shows the H II 9 are formed DNA graph chromatids of cells changes changes that throughout the cell cycle. This occur . 5 fo yrartibra /AND stinu 7 6 4 ssam 3 2 1 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 time/hours Figure 2.6.1 Explain Changes in DNA content in a cell during a mitotic cell cycle what changes in happens the at quantity each of stage DNA of the shown in cell cycle Figure to bring S tudy about Print 4 Make models of chromosomes using pipe cleaners or other out such as knitting wool, string or modelling clay. Use them of the different stages of mitosis and that the advantages chromosomes during of making nuclear models division. to What of the notes occur in each on stage the of meiosis. mitosis Explain photos mitosis. Write to events model separate suitable stages material foc us 2.6.1. show are the the behaviour limitations of of these revise on separate match the cards. When photos with you the notes. models? 87 2.7 Practice Mitosis This section can find 1 The contains SAQs MCQs on diagram the CD shows a on at and mitosis the back mitotic cell exam-style and of meiosis meiosis. You this questions: The book. next photograph lymphocyte in is another an electron stage of micrograph of a mitosis. cycle. cytokinesis mitosis G 1 (first growth phase) G 2 (second growth phase) S (synthesis phase) b a Outline the processes that must happen Describe during interphase before a cell divides by what is happening in the lymphocyte during the stage shown in the electron mitosis. micrograph. b Name the stage of mitosis in which each of the c following Explain the advantages occurs: of using a light S tudy i chromosomes chromosomes move to c the v at centromeres; condense; opposite reforms; of split poles; iii iv chromosomes sister ii microscope chromatids nuclear the envelope assemble at the equator than role of mitosis in the growth the Look rather lm electron at of some time mitosis lapse before answering Question 2c. of 3 and A student made a series of sections through the plants. root d of microscope. the animals behaviour foc us study chromosomes cell. Explain to State THREE other roles of mitosis in animals tip meristem of an onion. The student counted and the number of cells in each stage of the cell cycle plants. and e Suggest what might happen to the daughter presented the end of one mitotic cell The two photographs show in a that stages of the it cell takes 13 hours Number Percentage Length of of of time of cycle anaphase telophase BETWEEN the photographs. 88 two to stages the of to cell metaphase happens 25 °C Stage of prophase what at mitosis. interphase Describe student cycle. cells cells each a table. The cycle. complete 2 results cells discovered at the in stage stage/min 254 45 16 7 23 chromosomes mitosis shown in the total 345 100 each 780 Module a Copy the of and the total length b c complete number of Suggest of the about stage in and the in number time make the Describe cells of table each counted; each what ii calculating as a 6 percentage calculating The the length student of time the diagram organisms of could of Genetics, shows reinhardtii, a different that relative cell i stage. conclusions the by: stage 2 this variation the life single-celled divide to form mating species strains: is cycle natural of gametes and selection Chlamydomonas organism. The + that –. The adult are of haploid number 17 . each diploid zygote cycle. happens immediately and after to a root tip cell during fertilisation telophase. + adult gamete cell 4 a At the end of interphase of the mitotic cell cycle, division human cells have 6 picograms of DNA in each – nucleus. The diploid number for humans is a Copy and complete the table to show how and human how nuclei many at chromosomes different stages of there Copy are the mitosis b and meiosis. c Mass of nuclear per division pg DNA State diagram mitosis number the Explain and indicate where occur. of chromosomes in the zygote gametes. all the gametes organism why are genetically d nucleus Describe how organism prophase cycle produced from identical to one each other. chromosomes per and the in adult Number of nucleus/ life in and Stage of adult much meiosis DNA gamete 46. the life cycle differs from that of of this single-celled humans. of 7 The human diploid number is 46. Human mitosis chromosome end of Y telophase of a mitosis No. chromosome, Make a anaphase I I is No. diagram segregation prophase 1 of of the 22 to largest is the show and, the smallest. how chromosomes meiosis apart from leads random No. 1 and No. 22 at to variation. of b i Make a diagram to show crossing over meiosis between prophase II chromosome of ii meiosis c end non-sister Explain Describe how what No. chromatids of 1. crossing happens over to increases variation. chromosomes No. 1 of and telophase No. 22 during anaphase I and anaphase II of of II meiosis. meiosis 8 b Explain during c how the Explain growth how variation mitosis of meiosis within a maintains an genetic a stability give rise to b a Explain what is meant by the animals. terms Use your term c 5 diagram metaphase and fertilisation of a chromosomes animal. population Make haploid i I of ONE as in they how of homologous appear at meiosis. diagram homologous State pair would the to explain when what is applied to chromosomes meant by the chromosomes. you have drawn and behave differently Explain why during mitosis; diploid ii The Indian muntjac deer, Muntiacus muntjak, has meiosis lowest diploid muntjac b deer Draw number have diagrams chromosomes arrangement a to in at of any diploid mammal. number compare the metaphase anaphase I of of of the behaviour of chromosomes the is different to that in mitosis. Female six. arrangement mitosis meiosis with in of the this species. c Describe THREE ways chromosomes during chromosomes in in which meiosis the behaviour differs from of that of mitosis. 89 in 2 Genetics, variation 3. 1 Introduction Learning outcomes completion should be dene able the genetics, of this section, all that to terms inheritance, features our ‘skip Inheritance we inherit children. features People from our sometimes parents say that and pass certain on such human a is generation’ the from passing grandparents of features from human features that to one their grandchildren. generation to another . genotype, is a list of some are inherited to a greater or allele the relationship genotype and extent. between the know features lesser explain inheritance you Here selection to: phenotype, gene and natural genetics Human We On to and phenotype hair colour , length and style brachydactyly (short ngers and of toes) an skin free and eye colour organism. S tudy or attached intelligence blood groups, ear e.g. polydactyly freckles (six hitchhiker ’s ability ngers ABO, on the thumb MN Rhesus to taste phenylthiocarbamide out features and how the listed phenotypic here are controlled the the features only are These was in his choice and features because plants he had tend to to is alleles the of observed that cross-pollinated he chose by are hand mid-19th sativum At time the and inherited it are gene human features of an with and organism other biochemistry, than its genes. physiology, anatomy. of an will Mendel organism; see in the (1822–84) it usually following carried refers to pages. of the inheritance of different features in out the a garden pea, no - one understood involved some sort how of features blending were from inherited both and parents. many Mendel the rst to state that features are controlled by discrete entities that passed on from inheritance parent a to repeat chromosome experiments to offspring. using that specially complete can vary We He now deduced for the to give dene a the production different gene particulate of a as a length nature polypeptide. forms of the of DNA The published 35 days. The harvested and seeds it then is have 1866 not in a are known polypeptide scientic appreciated as journal until his alleles. without paper a was the beginning of the 20th century. In 1905, William and coined study of the term variation. genetics T oday the to mean term the covers all study the of aspects germinated possible than one at (1861–1926) to genes, their effects, methods of control, inheritance and DNA get technology, much faster in was forms can of so results work different life inheritance immediately his His These bred their Bateson that genes. codes differently. readership. rediscovered within that sequence function Mendel Mendel’s wide plants’ involving foc us possible relying generation such as genetic engineering and gene therapy. on per Mendel were had no discovered conrmed 90 one many Some genotype; environment. you Gregor by our a that year. as controlled (polygenic); give the in nucleotide plants genes to (either/or) fashion. S tudy results two phenotype. can on cycle or do human inherited pea but of ‘fast features constitution century, study Pisum are discrete one our appearance) genetic are genes and to the have was was features the of we Some many genes all part that effect. by anything the assumed be span of study. This self-pollinate to are Genotype systematic plant both (outward the lucky no morphology In Mendel refers are genes some by features above the has and inuenced Phenotype Did you know? listed by environment (monogenic) is hand inherited. controlled It (PTC) height All be toes) face foc us and Find and lobes as idea in the about the the 1870s material of mechanism and it was of not inheritance. inheritance. until 1952 Chromosomes that DNA was Module Animal and Barbadian blackbelly in the they 17th chose features The and the at but crossed are Jamaica to and Hope to is on to the cattle a breeds, European hardiness Farmers produce adapted breed descended offspring conditions European the Hope suitable Farm not are centuries. Jamaica T wo with resistance of Hope conditions. milk most Genetics, variation to of heat grow disease breed give have Barbadian natural selection 80% brought sheep continue began in the that to to to breed breed and Barbados from animals 15% and with The of genotype and the 5% 20th tropical high Zebu features Zebu of to give African the conditions. years adapted Holstein, introduce Jersey , early was conditions. to sheep island. Jersey tropical about to breed tropical breeds from selected yields cattle of were disease of the current Holstein. Figure 3.1.1 Features and breeding sheep 18th adapted breeding century plant 2 blackbelly Barbadian blackbelly sheep sheep: tolerant coarse heat good instead parasite throughout lean and more Features hair and of of wool the year (unlike mild-avoured stamina Jamaica (so avoid overheating in the tropics) resistant and Hope are other meat more breeds even agile on of poor than sheep) food most breeds of sheep. cattle: tolerant resistance to ticks (insect external parasites) and tick-borne diseases high survive Many of carcass and milk yield on the are presence so or important interested to in plant bananas, to degradation farming the of breeders to these arid of such wipe that We the in a improve, and cattle, few are This makes milk by features, controlled generations. as yield many and genes improvement Qualitative are breeds. such controlled by These Commercial such single features farmers as genes are are and more more features. as crop we to has can wheat out diseases; land to involved. named conditions practices. understanding are only of try features environment. horns take diseases, tolerate breeders factors quantitative threaten resistance by absence may that quantitative many improvement and are inuenced as pasture. features weight, difcult Some poor also cope of need secure our and with happened only genetics rust plants. black We crops as a grow change result future livestock crops that climate the Sigatoka need of of in food and attacks have saline and soils the irrigation our animals that that and poor supply crop by plants. Summary questions 1 Explain what phenotype, 2 Explain how adapted 3 Explain: apply to to i is meant genotype, by Barbadian tropical the terms genetics; ii the following gene and terms: inheritance, genetics, allele. blackbelly sheep and Jamaica Hope cattle are conditions. qualitative features why it is difcult to and quantitative features breed cattle to improve as they their milk yield. 91 3.2 Terminology Learning outcomes Genes In On completion of this in section, a and be able differentiated state that a DNA that codes for production state that gene of a the is a length of polypeptide is of a gene on make the are cell each DNA the lengths of chromosome molecule. Genes is single-stranded are the sections of and so this there but of code are control DNA, binds. a to variety uses. lengths of promoter genes Some of between is that are may areas be do turned sequences there it In DNA transcription as between of polypeptides. other when known In for DNA not on to of these code and for off. which There RNA non-coding DNA redundant. a diagrams crosses have cells genes polymerase It genetic results by polypeptides, chromosome one used str uctural the locus are that position of to: that chromosomes you composed should genetics to and explain is possible position shows make of the to a pinpoint gene loci of on a the position chromosome some of the genes of is on each its a gene locus on a chromosome. (plural human X loci). Figure The 3.2.1 chromosome. predictions. a glycoprotein mitochondrial protein needed for muscle contraction Humans protein which have 46 includes chromosomes ribosomal factor VIII blood clotting factor protein During meiosis homologous pigment absorbing chromosomes separate, so that each nucleus gene. See information on receives page one 84 for pigment absorbing allele more cells in the Figure 3.2.1 retina were is hybrid is varieties different used for crosses and for the the crosses in a gene allele between of a All their same between for tall the patterns drawing Each the of band are you stained an X can to banding see in this a region containing purple the plants of many page 99 – of as light the retina be of in gene were in the of has gene. In the this next ratio allelic one his I + of tall – Each results the the retain pea you and gametes law he page at the with owers; When all will purple called of 84). discovered plants of of separation looked white Mendel there dwarf. the (see genes as dwarf that Alleles the consisted dwarf another . assortment law owers. which plants and ‘blending’ he with purple and these meiosis when plants hybrid these produce rst two generation (tall give no pea stating tall the self- plants dwarf. to when plants with by – result of of as 9 : 3 : 3 : 1, pairs from independent way dwarf for is the example, plants the is inheritance For to meiosis anaphase same alleles There called tall results allele of When of showed plants produce tall. order always pea varieties to were two during with tall the independently law the dwarf consisted segregation only. were and formation. the crossed it that As different Mendel’s over during self-pollinated that this Mendel investigated one and separate This behaved tall explain for plants generation generation gamete alleles . pea generation. crossed e.g. dominant alleles of after He height chromosome means the We alleles phenotypes segregated law 92 in lines this next 3 : 1. generation were possible the in generation. owers next two gene inheritance chromosome. represents chromosome genes. green cells bred features, during Mendel each of The hybrid When characteristic that cone inbred. plants must identity the that be controls has homologous Did you know? the that inheritance. of can ratio segregation show are known genetics pure alternative individual species. Chromosomes and non-sex protein for generation self-pollinated plants Did you know? laws of they offspring. species chromosomes clotting 44 A human X chromosome showing some of the gene loci established showing different in characteristic pollinate of male). The this. same offspring = of Mendel term in sex female autosomes protein for Mendel’s The blood protein red light two = each cone haploid IX (XX protein XY Link chromosomes, the all of these four see + this on white) his second Module 2 Genetics, variation Genetic diagrams Genetic diagrams are S tudy used to show how the genes for different inherited. These should be set out clearly so that teachers The rules can for follow your making reasoning; genetic you diagrams should are not explained take any short 1: Each not Describe gene given height, Step 2: There the controls in the of Identify will tell description a or these on be at diagrams Make sure investigated stem and that you genes ower state that this control 3: Choose least two alleles allele genetic symbols if it a capital recessive letter allele. codominance superscripts Step The 4: Give Use or for for the is for each dominant gene. or it The will this consisting them to has start do individual two this. two two T est a study guide and in obvious from letter , (see not then each 96 alleles, of even may homozygous a if lower different capital and the denitions genotype on of page phenotype the gene they recessive letter letters. letter for If for there the the the is studying gene and one in control or a narrow 90. Here sense two features and the gene to they that or refer we genes to are that them. parents. concerned. are The the individuals, involve case used 102). of the a chromosome. homozygous crosses and two use genotype alleles of allele pages and the at alleles. alleles, copies of with with same of this Link information be Look dominant alleles consists and by the in examination. colour . cross. the phenotype diploid diagrams the multiple the genotype for when genetic is are Use using plant and Step carefully features. which the the steps questions concerned. feature. Mendel allelic you of genes certain owers the always will gene question. position provided the foc us cuts. below. your Step selection and answering examiners natural features Follow are and same. but crossing a Each genotype do cell Some not is reects genetic expect all of heterozygous individual. Link Step 5: State Gametes number . are two all the Step from in 6: Use fusion a genotype, Step 7: not the gametes. meiosis be one to of one down square at of will down gametes each the genotypes W rite write Punnett of the there circle. just of because write crosses each same genotype haploid Always monohybrid be the the letter , show in different genotype all fertilisation. actual halving gametes in the This numbers of a the If chromosome inside circles. dihybrid types of crosses there gamete. If you that In will they are then out the different writing sex include a the X chromosomes genetic linkage in as diagram on page 97 and Y the genotypes. circle. possible square genotypes gives the that result probability of S tudy foc us offspring. Do W rite are shows genotypes and give the phenotype of not use criss-cross lines to show each the possible genotypes as it is easy one. to Step 8: answer W rite as a out the probability of each phenotype and express make mistakes the ratio. Link Sometimes you numbers for numbers by will be different the given the categories, smallest numbers so number to called nd of offspring. categoric the overall Note data. that Always phenotypic these are divide You will see on pages 104 to 107 that ratio. a statistical categoric test is applied to data. Summary questions 1 Dene the following terms: 2 Explain what breeding 3 Explain and the is meant by autosome, sex chromosome, the following: inbreeding, haploid and interbreeding, diploid. cross hybridisation. terms gene and locus. 93 3.3 Monohybrid Learning outcomes cross Confirming The On completion of this section, fruit be able state that involves a the monohybrid inheritance cross of the Morgan terms as to located dominant, are and peas. on many in New theories segregation ies dene century Mendel’s one gene Hunt melanogaster , (1866–1945) was for the animal studying chosen genetics by early in the to: 20th Drosophila ratios you Thomas should y, Mendel’s Y ork. about Morgan inheritance, independent He also to by but assortment provided chromosomes advantages originally in fact out he applied evidence investigating using set for Drosophila, as one that that (see big the much theory linkage but disprove found just the sex to to laws genes page of fruit are 97). There disadvantage – it recessive, homozygous and ies! In spite of this they are still bred for use in schools and colleges and heterozygous are make genetic interpret diagrams monohybrid used in research In a population In Pure-bred the and development. fruit of ies these fruit When do ies male some not with and emerge survive, small female from but in wings ies pupae and from with captivity long these very they small do. wings were pure-bred lines were foc us crossed stages of wild lines established. The genetics to crosses. wings. S tudy into in the life cycle of a fruit the together offspring three all quarters had of long them wings. had When long these wings and fruit a ies quarter were had bred short wings. y are adult. the to egg, (maggot), Metamorphosis pupal an larva stage as the pupa occurs larva and during changes adult. This feature protein the gene, The genetic Take care foc us over represent There choosing genes. You letters should are controlled inuences long inheritance S tudy is that and short, diagram of two one alleles: (w). V estigial parental phenotypes – a with known shows the long gene development are below gene vestigial by the gene wing means a (also very feature too letter unless similar your of to the the the this capital coding The two for a forms of alleles. wing cross length known as in wild involving D. the melanogaster . type) ( W) and small. male female × letter wing (wild type) vestigial genotypes parental gametes the case WW wing ww looks letter might parental + W in w cause choose genotype Ww 1 phenotype F another DNA choose case which is of wings. to F If the dominant lower handwriting, confusion. length monohybrid for long the rst as a of all long wing (wild type) 1 letter. F phenotypes long wing × long wing 1 genotypes F Ww Ww 1 Link gametes F w W 1 Look back genetic to the diagrams advice on on page w W , + , making male 93. W gametes w W WW Ww w Ww ww female gametes F genotypes and phenotypes WW 2Ww ww 2 long phenotypic F 2 94 ratio 3 long wing wing : 1 long wing vestigial wing vestigial wing Module The checkerboard or Punnett square is the best way to show the 2 Genetics, variation the that next the generation Punnett – even square when shows the there are possible few genotypes outcomes – involved. the represent genotypes During actual and organisms. phenotypes meiosis in the in the ies, F It shows next the the probabilities of separation gives rise gametes is to segregation variation with genotype W (WW), homozygous or ies that of since w to a F alleles pair ies are and F 1 lial and only be stand for rst 2 second lial. They should generation. separate separate of gametes give which recessive terms different because they are used during alleles . with with the the meiosis Notice allele also W ( Ww) and the parental are homozygous. This that can homozygous heterozygous I. when on individuals chromosomes foc us do 1 homologous selection Note genotypes The not natural genotypes S tudy of and fertilisation fuse with dominant ies S tudy which foc us are ( ww). F is not used here because we do 1 not If the cross is carried out by using females with long wings and know the ies. Only with short shows the wings that the (the gene chromosomes reciprocal for that wing cross) length determine Monohybrid test is the same not results linked with are the obtained. use with we the know which recessive inheritance of of an are This is recessive, characteristic individual involves are we know homozygous that all an individual with or the dominant heterozygous. crossing that recessive. However , characteristic could male fruit y homozygous genotype of with is long recessive. the the of to the be foc us the test cross We can nd out by the individual with the doing unknown homozygous wings The is also be done a showing the dominant test and males which are genotype recessive. The results recessive. crossed genetic could be would A of individuals homozygous with one both homozygous. sex. phenotype cross. of if cross allele dominant F 2 known with females homozygous and 1 parents This genotype F This S tudy Once genotype males with diagram a female shows how that to be the same. is work out the male. Summary questions phenotypes male female × long wing genotypes (wild type) vestigial – W wing 1 Explain ww allele, gametes + – W the following monohybrid cross, terms: dominant recessive allele, w , homozygous, heterozygous and test cross. male gametes 2 Plants rapa but female w gametes Ww – offspring offspring genotypes = Ww phenotypes w if ww 50% long 50% short – = Ww wing : all some Brassica a a long rosette stem, habit stem all. When does pure not in bred grow long- W stemmed plants are pure rosette crossed with Ww long (wild grow have the bred plants, all the wing offspring wing species w at – the normally which if of – W have long stems. When type) these plants are interbred three explanation quarters If all the offspring have long wings, then the gametes that have of the – as must have the dominant allele, some must of have the offspring the recessive have short-wings, allele, then the gametes given as them fact, if any short winged were symbols A for passed on recessive quarter long stem the and w ies emerge we know that the male rosette, alleles and he must be draw a genetic must diagram have one rosette. Using – a for In and W of If were been long-stemmed given offspring to explain these results. heterozygous. 3 Use how a genetic you genotype plant of diagram would nd of the a to out explain the long-stemmed species B. rapa. 95 3.4 Codominance Learning outcomes completion of this section, be able linkage four o’clock plant (Marvel of Peru), Mirabilis jalapa , has three you different should sex Codominance The On and ower colours. If pure bred red-owered plants are crossed with to: pure bred white-owered plants then the plants F have pink owers. 1 dene and use the terms codominance They sex linkage genetic problems like diagrams involving to on solve codominance and sex different ‘blending peas. next as are either inheritance’ However , generation the from if genotypic that these gives all ratio in of the two Mendel parental disproved pink-owered three the colours plants in a monohybrid are 1 : 2 : 1 cross phenotypes. with his interbred ratio. on page This looks experiments This then is the the same 94. linkage. The reason contribute as for to the the codominant intermediate phenotype alleles. The of colour the alleles (pink) is that heterozygous are written both plants. as alleles They are known follows: R = C red W The letter C represents the R either the The nor genetic o’clock parental white gene; the . This alleles indicates are represented that the alleles by are C with neither recessive. diagram plant = W or superscript dominant C shows through two the inheritance of ower colour in the four generations. phenotypes red-owered white-owered × plant R parental genotypes parental gametes answer W C W C R Link Now plant R C C W C Summary question 2 to C + R F genotype C W C 1 see the results of a test cross F phenotype all pink 1 involving codominant alleles. F phenotypes pink × pink 1 R genotypes F C W R C C W C 1 F Summary questions gametes R W C 1 R + C 1 Explain term what is meant by W C , C , male the gametes codominance. R W C 2 A pink-owered four plant was crossed C o’clock with a R R white- C C R R C C W C female owered plant. Use a genetic gametes R W diagram of this to test show the outcomes R One of the blood group the MN genotypes system. The M GYPA codominant. diagram parents group with to N and Draw show who MN W C and phenotypes C R R C 2C both may different GYPA a blood W C phenotypic ratio 1 red : 2 pink pink :1 white white 2 the This are two have have W C are genetic how W C two F alleles, W C 2 systems red is W C cross. F 3 C C blood children groups. shows three was that ower dominant Flower colour if alleles colours to the allele depends Enzymes catalyse pigment. The are not the on codominant two, for the as more would be variation the case if appears the allele as there for red white. production conversion of a of pigments colourless in the substance petals. into the red R State the probability that a child enzymes coded for by two C alleles are an inactive required to produce W could inherit each of the blood the red pigment. The allele C codes for enzyme. Where there R groups. is one cells 96 C to allele make there some is of only the enough red enzyme pigment which molecules gives the produced petals a in pink the colour . Module Sex 2 Genetics, variation and natural linkage Males Among the ies in Morgan’s collection were some that had rather than investigated the the usual wild inheritance of type eye red eyes. colour When the Females white genotype eyes selection phenotype genotype results did red X not R X match the prediction that there would be a 3 : 1 phenotype Morgan ratio in the R Y eyes R X red eyes red eyes as F 2 with the inheritance of wing length. r X When pure-bred white-eyed female fruit ies were crossed R white Y eyes X r X with r X pure-bred red-eyed red-eyed as red-eyed and and no When might all male have the white-eyed this fruit been males the next predicted. were females. generation F ies, Instead white-eyed. The were generation expression crossed the all the There of eye next were females were no colour white eyes were red-eyed had generation r X not swapped had Note males sexes. all the following features of sex linkage: the recessive phenotype is 1 combinations of sex and eye colour in approximately equal more numbers. in The inheritance of this gene was similar to the inheritance of the The gene for eye colour is on the X chromosome. equivalent gene on the Y chromosome. This means that There copies of this gene in the same way as with genes that females have males cannot autosomes. their Males T o only show have one inheritance copy of a as they only sex-linked have gene it one is parent, females can the X and Y chromosomes and put the symbols for but their females be can heterozygous X usual therefore the carriers of the to condition, include the from loci and chromosome. inherit condition have on than is male two males females recessive no in X chromosome. common alleles males can never be as carriers superscripts. The table shows all the different genotypes for the inheritance of eye colour in males inherit chromosome Males are hemizygous. chromosome. These They alleles chromosome homologous heterozygous are as in this have are to described allele always their as one X of each expressed as chromosome. carriers when the of the there genes is the and X that no Females mutant on which allele is phenotypes parental genotypes this red-eyed male × white-eyed X found R X the father the loci X foc us female a question says that males and r of a certain species were r + Y on have X females gametes not their chromosome. are If r Y X does are S tudy R parental Y from recessive example. parental their Drosophila X crossed, that does not necessarily , mean female that the gene involved is gametes sex-linked. You clues. r See need Summary to look for question other 6 X below R R X X male and Question 7 on page 109. R X Summary questions gametes r X Y r F genotype(s) X Y R Y X 4 Explain the 5 Explain how term sex linkage. r X sex is determined in 1 F phenotype(s) white-eyed male red-eyed fruit ies female and in humans. 1 r genotypes F X R Y × X r X 6 1 F gametes r X 1 R + Y , Suggest why sex linkage is seen r X in fruit ies X but not in plants, , such female as the four o’clock plant, gametes Mirabilis jalapa. R 7 r X a Find out about inheritance R r X male X r X r X R genotypes and phenotypes X and Y X r X Y haemophilia in colour humans. r Y R X of red-green blindness R F r X gametes Y the X X r X Y r X b Show, using how man a a genetic diagram, cannot inherit r X haemophilia from his father, 2 red-eyed white-eyed red-eyed white-eyed male male female female but can pass it to his grandson. 97 3.5 Dihybrid cross So Learning outcomes far we have Humans On completion should be able of this section, about you ies state that dihybrid the at have about and the at the 20 000 the genes number inheritance four inheritance different of in that B. two of code rapa genes. chromosomes, one is for gene proteins, 43 000. Y ou that with Let’s might there two fruit start predict are alleles. ies that about have with since 4000 fruit genes on inheritance each involves have 14 000 looking to: looked inheritance of and that the inheritance pattern will not be simple. two genes Dihybrid use genetic inheritance controlled explain diagrams of by how to show two features separate to use a genes test cross in Wild type have short crossed context of a dihybrid identify phenotypic ies wings and all have and the long black wings bodies. offspring had and Pure the grey bodies. bred wild ies type of There both are some types phenotype. that were were crossed all combinations of features appeared When in the these F offspring, cross in fruit 1 ies the cross the the following numbers: ratios. wild type (long wings long wings short wings and grey short wings and black and black and grey body, body), 650 198 Did you know? One of the chromosomes Drosophila is so small in that the genes are found chromosomes on three not four. the approximates ratio When the you foc us see smallest number like this, into the long to have segregated The results of body black different S tudy 225 body, 68. most This of body, to a wings body is ratio to also of 9 : 3 : 3 : 1. short wings about independently 3 : 1. of is But This one if about you 3 : 1 suggests another and look and that are give should that the be you phenotypic close to will nd one in ratio. of this the can ratio the two therefore see of that grey genes on chromosomes. genetic diagram involves the parental phenotypes shows inheritance of what two happens in this dihybrid cross which genes. divide wild type male × female with short wings others and to you the black body It parental genotypes parental gametes WWGG wwgg ratios wg WG chapter. + F genotype(s) WwGg 1 phenotype(s) F all long wings and black body 1 genotypes F WwGg × WwGg 1 gametes F Wg WG 1 , wG WG , wg wG , This is combined square shows produced effects meiosis that with four by 98 wG wg the WG WWGG WWGg WwGG WwGg Wg WWGg WWgg WwGg Wwgg wG WwGG WwGg wwGG wwGg wg WwGg Wwgg wwGg wwgg of: produces different fertilisation combine gametes how gametes male wg foc us Punnett variation , , female S tudy Wg , when gametes genotypes these randomly. gametes Module F genotypes 2 Genetics, variation and natural selection and 2 genotypes phenotypes WWGG long WWGg grey proportions S tudy foc us phenotypes 1 __ wing, 16 Working 2 __ out the genotypes in the F 2 body 16 9 __ should show you why using a 16 2 __ WwGG 16 Punnett square is so useful. Do not 4 __ WwGg use 16 criss-cross lines for this. 1 __ long WWgg wing, black Wwgg 16 3 __ 2 __ 16 body 16 1 __ short wwGG grey wwGg wing, 16 3 __ 2 __ 16 body 16 short wwgg black F phenotypic ratio 9 long wing, grey 1 __ 1 __ 16 16 wing, body body : 3 long wing, black 2 body : 3 black The Punnett square shows that short wing, grey body : 1 short wing, body there S tudy are nine different genotypes, but Figure because of dominance there are only four different phenotypes in 9 : 3 : 3 : 1, which approximates to the numbers given 3.5. 1 shows called this independent assortment , which of two means that the segregate in meiosis independently of one another . This is are on different chromosomes. Y ou can see this in Figure 3.5.1 some pairs you can use chromosome models to model this (see page the metaphase the maternal chromosomes on align I. and will align as the as left on and the in others right. There they is a B 50% chance maternal a that paternal chromosomes and will align in b each B metaphase a B A b of these ways. I b a on during and will A homologous 87). shown A of aligning plate cells paternal also a because In they as two equatorial genes happens opposite. chromosomes Mendel what the result ratio foc us Summary questions a A B B 1 Explain the meaning of the a B B anaphase a terms I and b A b dihybrid inheritance independent assortment. b b a A 2 B B B Brassica rapa green A a A plants a The leaves or allele for yellow green dominant. Use anaphase have either B leaves. leaves genetic is diagrams II to show the outcomes in the F 1 a a A A and F if a pure bred plant with 2 long b stems crossed telophase a a 3 A B b green leaves is with a rosette plant with II yellow A and b b The leaves. Punnett square shows B that there genotypes are in nine the different F of the 2 dihybrid Figure 3.5.1 cross. Suggest how it Independent assortment of the alleles of two genes, A/a and B/b would a be possible dihybrid those cross so genotypes to carry that had a out each of different phenotype. 99 Module 2 Genetics, variation and natural selection The y next that genetic is parental diagram heterozygous shows for both phenotypes what gene wild happens in a test cross on a fruit loci. type male female with short × wings parental genotypes parental gametes and WwG Wg WG Link you nd wG , difcult independent concept to assortment understand, body wwgg , , female If black gametes a use wg the chromosome recommended attach alleles sticky of referring the to models on page labels two 87 and show genes Figure S tudy to WG WwGg Wg Wwgg wG wwGg wg wwgg the while 3.5. 1. male gametes foc us Remember that there probability that two is a offspring 50% and pairs genotypes genotypes phenotypes WwGg long proportions phenotypes 1 of wing, grey body 4 homologous chromosomes will align 1 long Wwgg themselves with the on the metaphase dominant alleles of wing, black body plate the 4 1 two short wwGg wing, grey body 4 genes together. 1 short wwgg wing, black body 4 offspring S tudy foc us The You must state a phenotypic ratio null ratio 1 : 1 : 1 : 1 to you analyse use the your long 1 short the wing, grey body : 1 wing, grey cross ratio test body, for a long 1 wing, short black wing, dihybrid body : black cross body with hypothesis dominance before is 1 chi-squared at each gene locus. test If data. you good cannot to try dihybrid There data any crosses are for do some free you. monohybrid Monohybrid practical computer to generate simulations dihybrid cross. F some with data available Alternatively, and genetics simulations you can or of on use living model your the organisms it is and own. internet this then monohybrid simple that way will to generate simulate crosses. T ake 200 beads, 100 of one colour and 100 of a 1 different colour . These represent the alleles from 50 F individuals that 1 are heterozygous. (Anything suitable will do in place of beads. But they Summary questions must all touch.) 4 Describe why the dihybrid F be the Decide same size which and colour shape is so you dominant cannot and tell predict them the apart result by that you ratio 2 will expect in the ’. ‘F Devise a table to record the results. Place all the 2 is 9 : 3 : 3 : 1 whereas the test cross beads ratio is in colours 5 The results never as ratios. a bag and shake them up. Remove two beads and record the 1 : 1 : 1 : 1. of these exactly Suggest crosses predicted why this is are by the the case. of genotype another a the and pair you Each phenotype. of transparent When beads. beads. pair of Replace Y ou must beads the pick represents beads the in the beads at a genotype. bag, shake random, so Record and do the pick not use bag! have 50 offspring’, ‘F total the numbers of each genotype and 2 6 Make on a table page 73 similar to show to the the phenotype. Record 104) if genes can nd in carry out a chi-squared test (see page one on the maps internet. of to see your Dihybrid colours bag 100 and the difference predicted result is between the signicant observed or results (phenotypes) not. D. melanogaster. You chromosome Drosophila totals effects and of the cross. with (gene 1) Repeat 100 and the beads put of the same each other procedure colour . two Put colours but two in use of four the another different colours bag into (gene one 2). Module T o make the genotype of each offspring pick two beads from each 2 bag. S tudy Record the respective genotype bags and and pick phenotype again. Y ou and then could return make this the beads more to interesting by Read having codominance at one of the gene this table back this to guide the and should given in a relevant In each case make pages from sure you ratios understand Y ou carefully. loci. go Genetic foc us their be able to question. identify This genetic table Ratio Description of the 3 : 1 F from a ratios should help from the results that you this are the descriptions Page cross in you. cross monohybrid given table. with dominance; the parental generation was homozygous number 94 2 1 : 2 : 1 F from a monohybrid cross with codominance; the parental generation was 96 2 homozygous 1 : 1 offspring from 9 : 3 : 3 : 1 F from a a monohybrid dihybrid cross with test cross with dominance at ‘unknown’ both loci; being the heterozygous parental 95 generation was 99 2 homozygous for 1 : 1 : 1 : 1 offspring from dominance 1 : 1 : 1 : 1 F from a a at both dihybrid both cross gene loci test cross with ‘unknown’ being heterozygous at both loci; 100 loci involving sex linkage where the females of the parental generation were 97 2 homozygous recessive and the males were hemizygous dominant S tudy Summary questions 7 Usually, purple ‘cut’ The four tomato pigment leaves, table is but Parental have missing some shows separate plants the purple and have of stem so-called numbers crosses the stems, and tomato is although green. ’potato’ in Most cut plants have of Remember to offspring, resulting from write out the diagrams for Questions full, following Number and stem, page the 2 genetic and 7 instructions in on 93. phenotypes of offspring cut purple leaves stem, tomato the plants. phenotypes purple varieties leaves. phenotypes purple 1 some foc us leaves potato stem, leaves green stem, leaves cut green stem, potato 354 0 367 0 693 241 0 0 60 71 56 67 leaves × green 2 stem, purple potato stem, cut leaves leaves × green 3 stem, purple cut stem, leaves potato leaves × green 4 stem, purple cut stem, leaves cut leaves 323 101 308 109 × green stem, a Calculate b Identify alleles c Use the the of cut genetic genes each genetic leaves ratio for involved and gene. Choose diagrams to each of these explain suitable explain the the crosses. relationship symbols for results of the each between the alleles. of the crosses. 101 3.6 Interactions Learning outcomes Multiple So On completion of this between section, far we be able state that than two explain of some genes alleles the genes state have (multiple inheritance with that multiple more alleles) patterns alleles more group The are looked at dominant than locus. gene genes at different interact to control phenotypic feature two The genes and with two recessive the antigens experimental alleles. gene controls called or alleles. have The been pairs of of locus is on they antibodies. if red are If are three of antigens cells from detected red alleles chromosome production because animal There blood as 9 on one of are the the the solve problems and human blood are sometimes why blood involving The gene another they must be stimulate typed the before a same blood response, but transfusion is not always. carried is locus is known as I and it has three alleles, I B , O I and I A . I codominant and both are dominant to I . There are six and genotypes four phenotypes individual two can copies of as shown only have in the two chromosome of 9 table on these in each the alleles left. as humans are diploid cell. Phenotype The genetic diagram shows how a man who has blood group A and a A I A blood group A woman who parental O has blood group B can have phenotypes children with blood blood group AB blood group parental genotypes parental gametes A blood group O B I I I A O I B I B + I B O I O I I , , B male B groups. female group A B I B four × blood A all male I I This out. epistasis. Genotype I human O are with I an the multiple Any A They into (epistasis) and I cells. injected into blood genome. stimulate injected B and genes ABO a I alleles have Many human red person ‘foreign’ cells at A alleles codominant. loci then may alleles have been production genes to: have and you either should alleles gametes O I I A O I I , O I O I blood group O B A I female I O probability having blood a baby groups regardless children O I A O I I B O O I O I foc us A The B I gametes I S tudy B I of of with is any 1 blood they parents one always the that these in of genotypes I offspring phenotypes O I blood 4 of already. The give phenotypic the there of is ratio probability a these 0.25 blood is of (25% A I group groups have the offspring a or 1 : 1 : 1 : 1. child 1 in In I blood A group human inheriting 4) B I probability blood that a I blood AB group genetics these O I it is child blood B group more groups. will O I In usual this have any O to family one groups. Did you know? Epistasis Blood get typing given during a is essential blood of the transfusion. so people same In group Some features blood group. there is shortage of with AB blood these can or of any other genes more gene groups; type O can be given safely blood that although group must there systems be tested are (e.g. as will gene as is controlled the by case more with the than one ABO interact with each other . Epistasis is the gene. interaction loci in the control of a phenotypic feature. The of genes show In independent such cases, assortment however , the if they are phenotypic on different ratios expected with independent assortment (see page are different 99). other Rhesus) well. those Flower as the colour in pigment reactions 102 one are to to everyone, by that blood chromosomes. of only features receive involved blood are blood, two people controlled emergencies, Often when are There blue-eyed which catalysed by Mary, gives the Collinsia petals enzymes. their parviora , colour is is a good produced example, by Module In C. on parviora the there are two such reactions that occur in series as 2 Genetics, variation and shown natural white selection precursor Enzyme 1 is coded by the gene A/a and enzyme 2 is coded by the gene B/b. pigment Y If the substance right. genotype owers matter are of blue. whether produced and the In In converted to not 9 : 3 : 3 : 1 a plants and phenotype that the has that 2 owers produced. give plants enzyme the Z plant is are allele will in blue-owered genotypes or If A not as allele but have the alleles homozygous white. plant as are present have ratio dominant of is magenta present plant bb, on × then Y not not will will cross (magenta) the does will Y This page then it Y then owers. cross aa, substance recessive, dihybrid genes recessive, the A both be be pigment not be does Figure 3.6.1 Z (blue) These two enzymes catalyse reactions to produce a ower pigment 99. blue-owered AaBb plant AaBb + gametes Ab AB aB , ab , AB Ab , aB , female ab , , gametes , male offspring AB A ABB A ABb AaBB AaBb Ab A ABb A Abb AaBb Aabb aB AaBB AaBb aaBB aaBb ab AaBb Aabb aaBb aabb gametes genotypes and phenotypes genotypes phenotypes A ABB blue proportions 1 __ 16 2 __ Summary questions A ABb 16 9 __ 2 __ 16 AaBB 16 1 Dene the terms multiple alleles, 4 __ AaBb epistasis, 16 1 __ recessive epistasis and dominant epistasis. magenta A Abb 16 3 __ 2 __ 16 2 Aabb A couple are blood group B 16 and 1 __ blood group A. Use genetic white aaBB 16 diagrams 2 __ 4 __ 16 16 to predict the blood aaBb groups of their children. 1 __ aabb 16 3 Suggest surface offspring phenotypic blue : 4 white : 3 A and B are needed to produce blue, but in A-bb magenta as no are functioning enzyme 2 is made. But when no there are alleles blood expressed in cells that ( aa), neither B (to give blue) nor b (to give nuclei. Draw a genetic diagram to only predict recessive cell red is 4 produced on magenta have Both genes for ratio cells 9 how antigens magenta) the results of crossing is a magenta-owered plant expressed. of In this example the gene A/a is epistatic over gene B/b since if C. parviora is aa (homozygous recessive) gene B/b cannot be An B/b is said epistatic perhaps enzyme. by where type since each be is there gene the may inhibiting This variation, to gene hypostatic also its act locus. one controls a as or by dominant less This inhibiting transcription known is by is recessive action coding for epistasis . phenotype different the feature you an gene, inhibitor with saw recessive for both on loci. epistasis . another Epistasis compared as of plant expressed. gene Gene a the homozygous genotype with of an reduces the situation page 5 What effects epistasis have on Explain and do dominant recessive phenotypic your epistasis variation? answer. 99. 103 3.7 Chi-squared If Learning outcomes test you carry out inheritance, On completion should be able of this section, have you the Analyse the results of a developed the null results this that matter? chi-squared differences test run a computer exactly In as between a 1900, t any Karl ‘goodness observed of the Pearson of and simulation t’ ratios we (1857– test expected on to check results using categoric data. completing a chi-squared leaves have shaped indented like leaves, those of known potatoes. as Pure ‘cut’. bred Some tomato tomato plants plants with test cut a plants hypothesis have in the of gain Does or by: stating not far . experiments genetic T omato will so signicance when cross you obtained 1936) to: breeding leaves and purple stems were crossed with pure bred plants with table potato leaves and purple stems. green stems. All the generation F had cut leaves and 1 using a probability table to These plants F were test crossed against tomato plants 1 assess the signicance of the showing test results. the cross four recessive offspring phenotype showed the – potato following leaves and numbers of green stems. plants in The each of phenotypes: purple, cut purple, potato green, cut green, potato Link 70 The type studies is is of because you individuals such as data called in collected categoric count the different green, cut and in genetic data. This number of more about this on of such different phenotypes as this is to form expected 1 : 1 : 1 : 1 chromosomes I the 86 and in the assuming test that independent gametes of the 77 cross the offspring two assortment genes has of are a dihybrid on happened during plants. F 1 potato. The Read ratio cross meiosis categories, purple The 91 page null hypothesis is the hypothesis that states there is no signicant 124. difference between the observed and expected results. 2 The chi-squared signicantly test (χ different ) is from used the to nd out expected if these results are results. 2 The formula for calculating is: χ 2 (O–E) ______ 2 χ = O E = = = The S tudy You the can nd you may squared set out be test the to test for you to observed expected gures value value are put Categories programs asked E of…. into this table. 2 foc us chi-squared sum do should calculation carry you, a this purple cut purple potato E O−E 2 (O−E) (O−E) 70 81 −11 121 1.49 91 81 10 100 1.23 86 81 5 25 0.31 77 81 −4 16 324 324 /E as chi- learn in out but O how to green cut green potato table. 0.20 2 totals χ = 3.23 2 The is statistic, signicant shows 104 how χ or to , has not, do the we this. value need of to 3.23 look in at a this example. table of T o nd probabilities. out if This this table Module 2 2 Degrees of Distribution of S tudy χ foc us freedom ← increasing values of p decreasing values of p → In the the probability, exam top half you of would this only table as be given the p bottom half tells you how to 2 0.99 0.90 0.50 0. 10 0.05 0.02 0.01 0.001 1 0.00016 0.016 0.46 2.71 3.84 5.41 6.64 10.83 2 0.02 0.21 1.39 4.61 5.99 9.21 13.82 3 0. 12 0.58 2.37 6.25 7 .82 interpret the S tudy 7 .82 The 9.84 11.35 table in similar 0.30 1.06 3.36 7 .78 9.49 11.67 13.28 0.90 result p is ‘dodgy’ T o > use are. = too page = greater the In 126). freedom 5% of The p not 3.23, expected outcome outcome we is = was less need has to or cut in is different hypothesis. arbitrar y, but is as . the ever y this p < will be the one on page be on this calculate one from the the and page. To 107 , the df number use not by of the subtracting categories in 0.001 highly very signicant signicant degrees using leaves This a of tally there freedom chart are represents table at 20 times 7.82 critical from df highly table critical value remember at to nd the p = 0.05 (df) there (see three the we value, the other degrees is will out the which to you we car r y expected accepted until that which decision the 3 probability at The now many plants potato the intersect than 0.01 you will of 3. across This once and is how the scored case read row less know score be < probabilities examination than. to you 0.05. and null = this signi cantly the < could in is is expected it time result p different from plant step for the accept 5% a column result, is If 0.05 signicantly example, that not < different from than; which next column is p signicantly table this categories The 0.05 result good! Note: > the to one table, > foc us 18.47 the p χ 16.27 given 4 of values for the means value a the result value . that and the Our result we can of 0.05 probability in to this investigation. critical outcome use come get or biological investigations. It is more than and 0.5. 50% random precise The to say that probability which means fertilisation. of value getting that The the the of this result difference is greater result is is p due not is to than therefore chance statistically 0.1 and less between effects such significant 10% Link as and so Autosomal means that the gene 2 the null critical is a hypothesis value significant prediction to then see if Curled is wings bristles are and any between or of If the the value results observed the for is and is χ less greater than expected. experimental 0.05 If so, procedure is than and the there locus sex is on an autosome chromosome (see and page not on 92). the reviewed errors. spineless crossed bristles. accepted. rened Pure-breeding were spineless be probability difference rejected, there Drosophila. can the with The bristles wild autosomal ies pure-breeding all F are type had with ies straight recessive straight with wings curled and features wings and wings normal in normal and bristles. 1 Female ies from the were F test-crossed with males homozygous for 1 both gene loci. The results were as follows overleaf. 105 a Module 2 Genetics, variation and natural S tudy selection straight bristles Draw a table like that on page 104 to curled of how to derive the value for = normal bristles = 186; straight wings, spineless 18; wings, normal bristles = 16; curled wings, spineless bristles = 180. 2 show wings, foc us χ 275.76. The ratio The null observed of phenotypes hypothesis and is expected that expected in there is a cross no such as signicant this is 1 : 1 : 1 : 1. difference between the results. 2 The It value is for obvious observed is χ that calculated the numbers as 275.76. chi-squared are so value different is from going the to be expected large because numbers. the Putting 2 the χ value of these is much can less reject assort of than the 1 you are is is it the 3 W rite a number the Link Try doing own chi-squared data from pages 5 the tests on simulation do a df and are on = by is conclude be the on 3, we chance such a same see that from low that the the probability expected probability these different chi-squared two that genes chromosomes. chromosome, is of Complete what hypothesis. This always in ratio we do not The likely fact table six, of among the type that has are of the steps inheritance you follow. pattern there etc. not starts been ‘there done is no for you. signicant …’ always as but data. the row table shown the For is on page number a offspring phenotypes (One these sex-linked, if four table. see ratio classes with to dihybrid, test, expected between phenotypes your to chi-squared columns cross they at This cannot information null difference Draw and monohybrid, Determine 4 table (0.1%). hypothesis that 2 a the signicantly 3. asked Analyse is: 0.001 null chromosome into departing independently explanation If 275.76 results 104. rows monohybrid you among needed of for need the the The number depends cross three offspring headings with rows; you of on two for a need the of the dihybrid ve rows in columns.) by: a calculating the expected b calculating the difference c squaring d dividing results using the predicted ratio your between observed and expected results on 100–101. each the the class difference square (this of takes (to the into remove signs) difference by the consideration expected the size of numbers the for sample) 2 e adding f deciding g nding up the on the the identifying i checking of degrees 0.05 appropriate h results the of nal column freedom probability ( p) in to give (number the table of of the statistic, classes − χ 1) probabilities for the df the critical value 2 to see if the χ value is greater or less than the critical value. If it is less expected If is it and greater expected expected less probability 106 then and of there results then no there results than is and and once getting is a the in the signicant the null difference hypothesis signicant null 20. by between your chance, is between rejected. conclusions e.g. the predicted accepted. difference hypothesis Express result is p <0.1 the The in but predicted result terms >0.05. can of the be Module 2 Genetics, variation and natural selection Summary questions 2 1 The results of certain types of experiments can 5 What does 6 What is 7 What does 8 What do the χ value mean? 2 be analysed with experiments the have in χ test – what do these the importance of the 5% level (or 0.05)? common? p stand for? 2 2 What 3 Given type of data can be analysed using the χ test? you conclude if the value for p is greater if the value of p is less if the value of p is greater the formula: than 2 (>) 0.05 (5%)? (O–E) ______ 2 χ = what are the row and E column 9 headings in the What (<) table do 0.05 you conclude than (5%)? 2 for calculating χ ? 10 4 In How do questions you 11 calculate to 13 you degrees should What of freedom? use this table than of probabilities for the do (>) you 0.9 conclude (90%)? chi-squared test. 2 Degrees distribution of χ of probability, freedom 1 p 0.90 0.50 0. 10 0.05 0.02 0.01 0.02 0.46 2.71 3.84 5.41 6.64 0.001 10.83 S tudy 2 0.21 1.39 4.61 5.99 7 .82 9.21 foc us 13.82 Make sure you follow instructions 3 0.58 2.37 6.25 7 .82 9.84 11.35 11 1.06 A student type (long 3.36 investigated 7 .78 inheritance winged) fruit ies. All 9.49 11.67 in fruit ies. The the F fruit ies 13.28 student were long F you 18.47 crossed some winged. The F 1 the this section when 16.27 using 4 in the vestigial ies the have table. The the more better! winged fruit ies were practice interbreed with with these some wild results in 1 generation: 2 long a winged State 164 the vestigial phenotypic expect for the F ratio that the winged student 36 c should Use results. the to nd chi-squared if the results test of and this the cross table differ of probabilities signicantly or 2 b Give the null hypothesis for this not from investigation. d 12 Plants of Marvel Pink-owered red-owered pink-owered Use your the Show 13 Another plants The F of results red, amongst white or this can you make from your answer to c? pink owers. themselves to give the following results: 80 of genetics to give a b null investigation; test to analyse carried State these results. c What to out length a with supports working. wing conclusion results. 193 chi-squared student inheritance either bred expected 69 knowledge your have were plants hypothesis for use Peru plants white-owered a of plants What the breeding experiment to a the reason null conclusion whether hypothesis can you or not you your analysis made. make from your answer b? investigate the Link in fruit ies. In were: answering Question 12, look at 2 Section long winged What 65 conclusions Explain your vestigial could answer you make winged concerning 3.4 21 these results? in full. 107 3.8 Patterns of Learning outcomes inheritance Pedigree diagrams Questions On completion of this section, be able on genetics or family make predictions outcomes analyse of about genetic pedigrees genotypes and to the Nancy crosses describe patterns of Many predictions sometimes Geneticists set use in the these context when of a pedigree investigating explain them of it often (1945–) of Mary information discovered disease, these gives a serious Soto who descendants the about a position neurological died live in from inheritance the gene disorder , the shing of the disease villages by in pattern. responsible studying the around early Lake all for the 1800s. Maracaibo V enezuela. inheritance The and Wexler descendants determine make as Huntington’s in tree. to: characteristic are you diagram should summary using best way to be sure that you have learnt the genetics in this chapter is genetic to interpret of the some data and make genetic diagrams. In the pedigree diagrams diagrams. genetic circle = shaded conditions female; circle condition; S tudy sure diagram or page you set out in full. Use 93 the following symbols are used: male = person circle or with square symptoms = person of a who genetic does not show any foc us your the Individuals genetic of are the condition. identied to help by generation and number , e.g. I–1 and III–5. information The ABO on follow = square unshaded symptoms Make that square blood groups you. 1 Study all 1 Figure the 3.8.1 people in carefully the and pedigree work out diagram. the Y ou genotypes can start of this by 2 identifying those who are AB and O. Their genotypes must female I A be O 3 2 O and I O I . Now look at the parents of people who are B 4 5 6 O I I 1 B I I male A and you know that they must have the recessive allele, O 7 I , and this be heterozygous information you if they should are be blood able to group work A out or B. With the II O A A 1 2 AB O 3 4 O genotypes B 2 Draw of all genetic children that the people diagrams III–3 and to in the show III–4 pedigree. the might blood have groups and of any predict the III probabilities O Figure 3.8.1 A B of each. A The inheritance of ABO blood groups in a Albinism family This two pedigree This suggests carefully the male male with normal pigmentation female with normal pigmentation 3 albino female you that Work A as that is the to most the see from it out the different and can condition suggests albino is phenotypes both is the of not all because show recessive do autosomal for above do males who genotypes symbol one condition that parents an the people and not the and show the there are just condition. if females recessive you look have inherited condition. This condition. people dominant the allele in the and a pedigree, as the using symbol I for the recessive allele. Y ou may not know whether some of 2 the people dominant II the allele who or do not show heterozygous. you do not albinism If know this (see is the are the test homozygous case use cross on the dash page for 95). 5 4 Known in III the which 8 allele. 1 Figure 3.8.2 108 3 The inheritance of albinism we carriers centres people A in tell those genetic the the number cannot Identify of of of pedigree people from who conditions unshaded the may for may or indicated squares. albinism carry pedigree be are circles the alone carriers. carry the recessive who by they dots Explain recessive allele are. but Module 2 Genetics, variation and natural selection Huntington’s disorder This that condition both from a parent disorder inherited and who does dominant allele is males not had skip condition; and h is the in females it. a In a very in the the family generation. the allele normal different pedigree for used This way have for to albinism. inherited this suggests Huntington’s, pedigree that H, it is is the Notice the condition analysis an the autosomal Did you know? dominant allele. Nancy Wexler’s One complication with a pedigree analysis of Huntington’s is that analysis develops late in life as a degenerative disease. Often people pass on before they know they have it and some people inherit located from a parent who died young without having developed on pedigree gene Huntington’s disorder on the chromosome disorder the the for condition work it 4. Search for ‘Wexler the Huntington’s’ to learn more. condition. 5 Work out unsure question 6 State the genotypes possibly marks the for all they unknown probability Huntington’s of because that the are people too in the young, pedigree. indicate If this you by are using alleles. III–1 and III–5 have the dominant allele for disorder . f m unaffected Huntington’s disorder S tudy foc us I 2 The genotype HH is never found. All II people with Huntington’s are 7 heterozygous. III 9 Figure 3.8.3 The inheritance of Huntington’s disorder Haemophilia Haemophilia clot is males This 7 very and is none suggests Draw a an long. it inherited All of is genetic those them a diagram Use haemophilia. Draw III–3 have H will have from the for a to the in how normal genetic another the recessive show the which disorder inherited sex-linked haemophilia. and disorder with the time the pedigree disorder taken from for blood diagram their to are fathers. condition. person allele diagram child in to with III–6 and show h inherited for the the allele probability haemophilia. What is for that III–4 S tudy Remember evidence pedigree diagram that haemophilia is a foc us the to include the X and Y recessive chromosomes in your answers to condition? Question 8 What are the probabilities that a man will transmit haemophilia 7; use superscripts for the to alleles. i his son; ii his daughter; iii his grandson? male haemophiliac male unaffected female unaffected I Did you know? II Geneticists research contribute projects, such to many as the III Barbados National Cancer investigating family links Study, in the 1 incidence Figure 3.8.4 of breast cancer. The inheritance of haemophilia 109 3.9 Practice exam-style Patterns Most of these inheritance information an answer. symbols and do questions patterns in In to order the give you to invent the draw have genetic alleles your information prose. You examination, use for not in you so of to inheritance about interpret diagrams will make be to given sure questions: you 3 the height provide a Define the them over own. terms the and that for A test genes and height, t. The T, are cross that the is on of r. The made R, gene total the fruit. The over red fruit, different was determine colour dominant allele for yellow fruit, two features gene have plants tall dwarfness, a 1 plants of allele for the use Tomato that for is dominant loci for these chromosomes. between two tomato allele plants. b i When pure bred tomato plants with cut i leaves are crossed with pure bred The possible plant plants with potato leaves, all the cut leaves. Using D for the allele for and d for the allele for potato and a genetic plants F have diagram cut to the rt. State of male the gametes parent were of the RT, Rt, explain the genotype of this plant. State the genotype of the plant chosen as the leaves, female draw as cut ii leaves chosen offspring rT have genotypes tomato why all parent. Explain your answer. the iii leaves. State the phenotypes that you would expect 1 among ii Use a genetic diagram to predict ratio in the if F F 2 amongst A tomato breeder has a plants are you not sure b A cross plant with cut leaves, was used it whether is it is by would ratio expect. homozygous made as the between male the parent in same the plant test that cross dominant with the genotype rrTt. Draw a and genetic or to show the genotypes and phenotypes heterozygous. of Show, the but diagram whether offspring. Give bred another is cross 1 themselves. was c test the that phenotypic the using genetic diagrams, how you the offspring and the expected phenotypic could ratio. determine the genotype of a plant with cut leaves. 4 In cats, The 2 In mice there is a gene that controls fur short gene for hair, hair H, is dominant length over is not is sex-linked, long hair, sex-linked. An h. allele, colour. There y B are four alleles of this , of another gene that produces gene: b yellow coat colour. The allele B produces black ch C = full brown colour (wild type); c = chinchilla; y coat colour. The heterozygous condition B b B is d c = extreme dilution; c = albino (white). tortoiseshell. The gene is not sex-linked. The alleles show the a following relationships to each Use genetic following C is dominant to the other three ch dominant to c and c, but is recessive If a to C dominant c to c, but is recessive to c and C is recessive to the other three the black male cat mated with a Draw a genetic diagram to show what would be expected in the and F cat homozygous for when a pure bred wild with a pure bred chinchilla type If the offspring freely, 2 mouse a genetic diagram to show short expect if you crossed a produced in hair, the what were are the allowed chances to of interbreed obtaining yellow a male? mouse. what i Use the inheritance of these two genes in you cats would be is b Draw will generation? long-haired, crossed kittens F 1 generations of types ii mice kinds alleles. next b to ch is what of answers questions. long-haired, yellow female d a your d is c in alleles i c diagrams other: wild type mouse dilution with a to explain the terms sex linkage and codominance heterozygous for extreme chinchilla heterozygous for ii mouse Explain why it tortoiseshell c Is it possible for a pair of mice to have show all four phenotypes: not wild male possible to have a cat. offspring 5 that is albinism. In shorthorn cattle there is a gene that controls coat type, R colour. The chinchilla, extreme dilution and albino? diagrams to illustrate your With reference to your answers to parts a to 110 the term multiple alleles a red colour, the allele C white. Cattle have a coat that that is are heterozygous for described as roan – this a light c, red explain W gives answer. gene d C Draw gives genetic allele colour. Cattle with horns are homozygous for Module the allele¸ hornless. two a gene i A p. Cattle Neither loci are white that a hornless to the these on cow has with of different with red coat what loci and is is allele, P, are 7 sex-linked. The mated with a a would genetic expect the student carried out a and genetic natural selection investigation Drosophila melanogaster. Two characteristics were The observed, dominant features wings. The fruit ies F variation with fruit ies, normal the diagram in A Genetics, shape. The bull homozygous for Draw you is chromosomes. horns condition. predict dominant gene 2 that results student were were body were carried colour grey out heterozygous for and body a test both wing and cross gene on loci. as follows: 1 generation. grey ii Cattle in the F generation were black 1 among body themselves. Draw a genetic predict what you would normal wing, 83 body expect and normal wing, 88 diagram grey to and mated in the body and bent wing, 78 F black 2 body and bent wing, 74 generation. The b Explain, using this example of shorthorn student concluded independent the effect of dominance and that the results showed that cattle, codominance assortment had taken place. on a Carry out a chi-squared test on the experimental phenotypic variation. data 6 Like cassava, means leaves that and known as cell plants release when is substrate up are the and the cyanide from damaged. A down the b of slowly enzyme gene loci, at G/g in Use gene as a chromosomes. The allele, use and the enzyme glucosyltransferase that linamarin from a A student the an inactive production of precursor enzyme. The linamarase; e allele during and N of the substrates relationship G, and products is E gene G/g gene G and as and n for investigated ‘cut’ wings ‘Cut’ shown g for the student the in alleles for inheritance the fruit y, wing is carried wing body shape. of the feature Drosophila controlled by a single out two crosses, A and B, inactive Cross B enzymes, below: parents females normal E/e males glucosyltransferase linamarase wings ↓ ↓ F linamarin the alleles for below. ↓ → body g ↓ precursor the alleles for codes for an genes, summarised behaviour explains codes substance; codes for between 107). shape. Cross A enzyme. The the meiosis assortment wing how page catalyses the as codes for diagrams, on are gene. The production of of probabilities symbols melanogaster. for the of conclusion result E/e, which known found on different by colour are formed and table student’s chromosomes colour linamarase reaction. enzyme gene the independent 8 of two test the Show, chemical releasing happens very but (use cyanogenic. This hydrogen broken temperatures, speeds are they cyanide. This walls The they roots linamarin hydrogen normal clover to → all with wings with normal x ‘cut’ males with wings x females with wings all ‘cut’ males normal wings with ‘cut’ 1 hydrogen wings substance cyanide all females A pure breeding cyanogenic clover plant was normal with a pure breeding non-cyanogenic with crossed plant. All the wings F 1 offspring were cyanogenic. When an F generation F 2 was produced, three cyanogenic very phenotypes females in a wings 356 normal males 391 normal 376 ‘cut’ wings ‘cut’ wings 342 wings normal wings 2 cyanogenic wings 333 ‘cut’ wings non-cyanogenic the ratio Draw the of a of 9 : 3 : 4. genetic parents, the F Explain the to show genotypes generations of the and this genotypes a b genetic cross normal phenotypes cross. Draw of of Use A. Use wings your diagram the and answer to symbol n for to a the to explain N for the the allele for explain how results allele for ‘cut’ wings. these results 2 why dihybrid a diagram and and F 1 b normal 339 F slightly 789 2 were found: this ratio F cross of does not show a show typical ii 9 : 3 : 3 : 1. is that the sex-linked allele for rather ‘cut’ than wing being is: i recessive; carried on an 2 c As yet been non-cyanogenic produced by cassava selective plants have autosome. not breeding. Suggest c Give the genotypes of the parents, the F and the 1 why this is so. F in cross B. 2 111 2 Genetics, variation 4. 1 Principles of genetic Moving Learning outcomes Genetic On completion of this section, be able not dene the terms the genetic engineering the gene or removing (recombinant DNA technology), But restriction enzyme it a can removal gene also transferring vector explain how restriction ligases the process traditional of genetic breeding modication and articial by means selection. that It it are used in of into from to gene or genes, a and gene obtained At one one organism extreme transferring from individuals is from organism. species taking other a gene, one involve into a another of in an the to of of species. several a placing involves another individual same one it and this species. species The DNA different ways. and The enzymes DNA and is using genes corresponding engineering to: engineering and selection genes possible involves natural you are should and is then inserted into a vector, such as a virus, plasmid or liposome, genetic which transfers the gene into host cells. engineering DNA state the roles of vectors is universal different genetic so it is possible to make transfers between widely in species – for example from a human into a bacterium, a jellysh engineering. into a bacterium genetic in any code so or the a bacterium protein that into a plant. All is encoded by for wanting to cells the can gene ‘read’ can be the produced cell. Did you know? These DNA can also be ‘shot’ directly cells rather than using a are some bacteria food I 5’ 3’ 3’ 5’ recognition the reasons do this: and eukaryotic cells make special chemicals that are only vector. produced Hpa of into in quantities by other methods, e.g. enzymes for the industry making improving using to small crop plants nutritional animals obtain resistant by to qualities make other to diseases, of human crop pests and herbicides plants proteins for medicines that are difcult methods site 5’ making bacteria absorb and metabolise toxic pollutants. 3’ blunt Restriction enzymes are used to cut genes from lengths of DNA. They ends 3’ 5’ cut Hind across both sites as they Each restriction of DNA restricted to at cut specic only at sites these known as restriction sites. III 5’ 3’ palindromic 3’ 5’ recognition strands are site as it has reads direction. Restriction they rst a specic the same enzymes nucleotide in are the 5' named to sequence 3' after which direction the as bacteria is in the from 3' to 5' which site 5’ were isolated. 3’ ‘sticky’ end Some ‘sticky’ restriction enzymes, such as EcoR1, cut DNA to give it free, end unpaired 3’ ‘ends’. These ends are known as ‘sticky ends’ because they will 5’ form Figure 4.1.1 base pairs with complementary sequences of bases. This is how a The restriction sites in DNA gene cut viral DNA. by a restriction enzyme can be inserted into a plasmid or into for two restriction enzymes give blunt Others, such as HPaI and HaeIII, cut straight across DNA to ends. Did you know? Large These enzymes restriction they cut (endo used – by attack are known endonucleases within means DNA as viruses. a as because molecules within). They bacteria by also are defence against and using gene into the a bacterium. as the length gene of HaeIII, of 112 quantities the of bacteria vector , The so DNA to such the gene have are a viral with by DNA DNA a by a added Some the is gene done which have enzyme cut plasmid. This virus, must nucleotides the inserting gene. or restriction bases. of the plasmid same length mixed a or complementary can produced replicate as plasmid that are the can by then same cut it restriction to give it plasmids into bacteria inserting takes it the into restriction to give a enzyme, sticky will short such ends. take the site up as Copies the Module length of DNA cut by restriction 2 Link enzyme cut with Look cut back to the diagram of DNA on cut restriction pages 63 and 64 to see the hydrogen enzyme A bonds A the A plasmid – position bonds circular double-stranded between in of each the the base pairs and phosphodiester polynucleotide. DNA A bacterium plasmids taken up by bacteria bacteria replicate the plasmids S tudy Figure 4.1.2 gene by reform complementary without taking base up pairing the gene. of sticky ends; Hydrogen other bonding plasmids between the Plasmids are stranded DNA found attaches the phosphodiester Once the (rDNA) gene is two; bonds has the of enzyme the become produced. ligase added sugar–phosphate inserted rDNA is is into DNA the formed to form backbone plasmid by of the in some recombinant combining DNA DNA eukaryotes. from Did you know? two libraries bacteria are treated with calcium ions, then cooled and given can be made shock to increase the chances of plasmids passing through the membrane. contain The foreign bacteria are now described as transformed genes by within bacteria. a provides many copies of each cell gene for they double- sources. host surface of prokaryotes DNA. This heat in ‘sticky cloning foreign The rings covalent Gene different small will and ends’ foc us Plasmids are used as vectors to insert genes into bacteria research purposes. as DNA. Summary questions Some take plasmids up do plasmids. not take There up are a the foreign variety of gene ways and to some identify bacteria the do not transformed 1 bacteria from those that do not have the recombinant Dene the terms engineering, plasmids inserted contain into antibiotic these resistance resistance genes so genes; foreign making genetic plasmids: genes are transformed ligase, restriction enzyme, vector, transformation and bacteria transgenic organism. sensitive to antibiotics 2 plasmids contain uorescence genes (from jellysh); under UV Explain phrase the transformed bacteria will polymerase in bacteria copies the plasmids; the bacteria then binary ssion so that each meant universal’. Describe daughter cell has several copies of in the form how a gene The bacteria transcribe and may translate the foreign gene. are described Bacteriophages to deliver inject are foreign their DNA as into as the that infect they host attach bacteria. to the They cell are wall of used a as vectors bacterium 4 specic not proteins, always translation by adding animal such possible as processes sugars. cells as As the bacteria as a do cells grown for not eukaryotic result host are enzymes bacteria of a be eukaryotic cell inserted into a bacterium. Identify genetic and the advantages of engineering. cell. 5 Genetically-engineered bullet transgenic viruses genes of may The and bacteria the the removed from plasmid. by divide points by is is uoresce. 3 DNA what ‘DNA light in large food carry cells genetic for the to out cut, engineers production of quantities industry. the fold use complex and to is post- modify yeasts, this plant of 67 genetic to bases or at 10 either a will with end. amino dictionaries write that decapeptide proteins cells the page make However , Use (A on sequence code for a restriction sites decapeptide has acids.) proteins. 113 4.2 Gene therapy Gene Learning outcomes therapy involves On completion should be able explain describe be the used of section, you a term gene therapy gene therapy treatment for may genetic the genetic into to: how in this is an transfer disorder . cells application of a of normal There are a the principle functioning variety of of genetic gene methods into of a engineering. person delivery of who the It has genes using: viruses that liposomes plasmids are that that taken are can up by small be specic cells phospholipid injected directly bound into vesicles cells. disorders discuss the hazards of possible gene benets and SCID therapy. Gene therapy combined this condition. function. faulty were Purines are component nucleic acids, refer remind yourself to molecules page about 62 of to them. into the than The are by the but form of cell was similar syndrome enzyme children The to white of the was rst using white modied blood a signalling cell are is cells. for with enzyme successfully cells in as 1990 from the T and bone for the of condition cells. then of not breakdown with and forms does recessive the known severe two deaminase Children cells this stem with are homozygous involved blood is X-linked membrane molecules. the children There These returned has been marrow rather cells. condition for and allele treat adenosine blood white done to (SCID). who enzyme dominant the codes system’s very successfully the in gene. This since, chromosome rst toxic differentiated other used removal given blood. repeated the this which were rst happens of treated cells In This allele purines, Link was immunodeciency The dominant SCID. receptor gene allele A for therapy was gene one for inserted on of this into the the X immune form stem of SCID cells. Cystic brosis Cystic Did you know? (CFTR) the CF is the genetic most Northern about 1 common disorder in in serious people European 2000 brosis origin live born of affecting infants. that move to an inhaler . stimulate it are children no are some is of are cells very dominant allele into had and mixed some in thick has has the gene the and used the success clinical sticky cells as a carrier recessive viruses trials for respiratory homozygous years benets treatment longer of the and and the tract for does and not respiratory had tend to be in the liposomes vectors have protein as tract to stopped. associated so that with gene children no therapy longer for need SCID: to live in a life boys genome lead a with the to be treated with injections of adenosine normal life and, as far as anyone can predict, have span. problems X-linked because controlling need antibodies numerous happened 114 produce for out who in hazards and can normal There ions people mutation environment children a a a many This distinct deaminase the and provides sterile they inammation Benets There In Research deliver from chloride canal. mucus easily. vectors using the results pumps alimentary disorder (CF) gene cell there SCID is inserts; division with no in gene have developed control this case therapies: over the leukaemia; where allele in the inserted this patient’s into a gene Module it is difcult if an only to get the allele delivered to all the cells in a 2 Genetics, variation to is taken recessive switch off cells for in CF the by a conditions, a Huntington’s up dominant cell it such allele may as not CF , such can as be treated; one that it is is not the possible cause to is highly offer tract be are taken short-lived and therefore the therapy as heart the genes and the vectors prompt immune responses, which make use of the therapy very one a person taking response to part the in a virus trial used many children history of recessive the it members with cystic disease in as 1999 the has who skipped died brosis although it several young died and others have fallen genes, gene are born may be into that CF was families being and of gene in family the described them to could into a line gene Y ou the be zygote may problem of overcome so it is above delivering by placing passed to is genes the every somatic gene therapy . be to gene cell line in in all the cells concerned the body. that to discuss the Practical rst and sight such as where They a the it is also simpler include practical, precautions solutions. simplistic risks think Some ethical leading it is to very cheaper in taken people solution involved going, and Ethical issues research and approved benets by Moral that into This and other during believe involves inserting a is an egg right we to are an of concern trials. ethics in and such to the Before committee the human extend concern interfere have a with moral genetics the life a few genes is therapy is not a gene being are risks generation to passed the on next. or called moral ger m foc us issues as trialling, that gene many gene health expensive solutions, clinical involved issues in a good. country. There screening without problems deects genetic therapy as research is at many issues, knowing such genetic biological complex medical research who will tests involves leukaemia. of these: from Tay-Sachs nd out genetic carrying and the the wider genes apply people carriers more of tests for search for about and are thalassaemia, sickle about screening in cell the anaemia benets reducing to of the screening. staff can involved begin consider it with must the risks the of cases of these very serious disorders. be and research. imperative of to nd disorders. There information exactly efforts DNA S tudy even any gene in one number injecting therapy. issues problems thus, require out or any Genetic gene and, do S tudy asked by variations The therapy surrounding of Did you know? from solution effects 1930s. legal therapy disease. caused no solutions type are such pressure, autosomal affected identied with to involved The blood ill Germ Other most vector generations before high they therapy the humans, and Alzheimer’s because unlikely in gene to difcult single as disorders combined many that solutions the the continued is unlikely disease, diabetes frequently This foc us any common respiratory have It will of disorder would selection expressed be the natural tissue S tudy allele and to any with society . that apply People we the have life that inherited; knowledge successful these argue to have others that techniques threatening we we reply have improve genetic foc us no that about and Search for read more ‘learn about genetics’ the online ethics of to gene therapy. disorders. Summary questions 1 Dene 2 Find the out Present about 3 Explain 4 Research a gene therapy the current your ndings campaign in term to the different by think a research into suitable form, gene such therapy for as a leaet cystic brosis. or e-mail awareness. benets the future group, raise in and hazards genetic gene about gene disorders therapy. the of main therapy. to nd Imagine points you you out how have will to many present may be treated your ndings to highlight. 115 4.3 Insulin production The Learning outcomes concentration hormones. On completion should be able of this section, decrease you other to: describe is used how to genetic produce these, the insulin your blood insulin is concentration hormones make Of in of that and as cause a the of it result sugar is only hormone glucose to controlled in increase. develop the that blood. Some diabetes by a of stimulates There people type variety lose are the a several ability to 1. engineering insulin Diabetes outline the advantages disadvantages from of genetically explain why demand for using and insulin engineered there is insulin a Diabetes cells or the mellitus inability of is a cells disorder to caused respond to by an inability insulin. There to are produce two insulin types: increasing diabetes type 1 – insulin-dependent diabetes type 2 – non worldwide. insulin-dependent. T ype 1 diabetes secrete b insulin cells in the pancreas, pancreatic is caused possibly islets which of by by an the inability Langerhans secrete this to destruction in of the hormone. It is cell likely that body ’s starts length of DNA is own cells are immune when destroyed system. someone is by This quite the usually young. the T ype gene for the 2 diabetes is an inability of cells to insulin respond to insulin and may be because there transcription are few receptors on the cell surface membranes mRNA of target of diabetes cells (see pages 36 and 73). This form reverse transcriptase mRNA plasmid DNA – double-stranded often associated with obesity , a DNA high DNA is sugar diet, the inheritance of the alleles of polymerase certain cut by restriction ethnic addition and groups, ethnicity . particularly People people from of some Caribbean of and ‘sticky genes enzyme South Asian origin, are at high risk of type ends’ 2 diabetes. related plasmids annealing with cut DNA to by enzymes be cloned to The high global levels increase of in obesity diabetes is associated with mixed a change from traditional diets, diminishing between levels ‘sticky of physical activity , population ageing and ends’ ligase forms sugar–phosphate ‘backbone’ increasing people plasmids treated taken with up by calcium 2 diabetes. ve also replicated with diabetes in Ninety-ve the per Caribbean cent have of type bacteria ions adult plasmids urbanisation. in It is estimated population for people has over increasing in it, 40 that with in the children one levels in of 10 Americas. as levels of of one It the in is obesity bacterium increase. There bacterium is no is treated diabetes contains human gene for insulin later for diabetes. insulin by extracted injections controlled stages. treated bacteria by is although bacteria cure T ype 1 diabetes divides For insulin. diet injections many regular from of by may years injections animals, and T ype be required diabetes of such 2 exercise, was insulin as pigs and make cattle, which were slaughtered for the meat insulin Insulin trade. This although insulin Figure 4.4.1 most that is of insulin diabetics prepared modied bacteria or is now from This shows the steps involved in producing GM bacteria cells that produce insulin on a commercial scale 116 form yeasts. still available receive human genetically at Module The cut outline from insulin that of genetic DNA. In production make reverse insulin. replicated that was However , proteins was DNA RNA. was in has the insulin, as yeast Timeline for used the as mRNA that This has inserted a states the mRNA the as and a in base molecule. a for to the Event 1921 insulin 1955 Fred 1969 Dorothy US by two right along cells genetically Sanger vector way and to chains form other animal a is and the then and are in b cells a (cDNA) is into the cells bacteria cancer is cells, to do insulin produced rather in than produce not molecule. eukaryotic in bacteria. by researchers determined Hodgkin amino used X-ray structure of in Toronto acid in a bacterium, sequence crystallography of to insulin determine the insulin synthesised rst Escherichia coli (licensed to Link recombinant the drugs rm Reverse pharmaceutical rm Advantages of main sequence called for Eli Lilly starts selling recombinant insulin as be taking insulin. using GM of this changed analogues immediately 8 and 24 Many from viruses their RNA not form to alter that after hours to diabetics shown into either a insulin the both is that properties act meal) give take of the faster or more of than the same amino insulin. animal slowly background at the the produce over blood time. These insulin is and any less animal still advantage pure, insulin available than have in the UK, insulin is a period of the reliable leading of using them animal and insulins. withdrawn for increasing supplies through the health that meat are it example. worldwide. problems not on However , of main reported so it dependent they are State why The from companies many The of In the is on factors that such as they hypoglycaemic increasing the do attack of not GM when likelihood human Describe in diabetes of of the a blood diabetic is that warning there glucose of points the people a concentration cells to insulin. are availability some signs bullet modifying is 3 Discuss the falls have 4 advantages disadvantages produce insulin any require insulin. although insulin experience of people Caribbean, important people injections that countries, number some more and using GM disadvantage that on 68. Summary questions genetically The page copy more studies trade. Disadvantages of See of concentration produce one DNA. are process requiring enzyme to (useful 2 it an use acid regular expensive, is they insulin 1 have that transcription advantage can insulin between transcriptase Lilly) Humulin The selection double bacteria functioning proteins, biotechnology rm Genentech insulin 1983 natural enzyme make molecule It engineering polypeptide with discovered crystalline Eli and sequence single-stranded into genes used pancreatic substrate template that gene variation insulin Date 1978 isolating uses 112–113 difcult double-stranded made insulin why such of a that initially This cells, by pages very Genetics, insulin. modify is of on be mRNA which that give molecule produce Insulin it. The to to can found molecule complementary stranded that was transcriptase , single-stranded then engineering fact 2 of modied using cells to insulin. Explain the reverse transcriptase use of the enzyme in genetic engineering. coma. 117 4.4 Genetically modified Genetically modied organisms organisms (GMOs) are transgenic organisms. They Learning outcomes have of On completion of this section, one DNA or more are foreign inserted genes alongside which the are gene expressed. so that it is Promoter expressed sequences in the host you organism. should be able dene the to: term genetically modified organism state at GMOs least in two GMOs (GMO) examples medicine and Humans of GM in for describe GMOs the into hazards the in environment precautions that explain the hazards are in or in the are crop rst discuss the social, and transfer that production of have are individual been crop using articial genes released selection. between into the unrelated environment plants. plants crop by plants to be incorporating developed pest and had genes herbicide to improve resistance. losses to insect pests such as the cotton boll Pest weevil; resistance herbicide taken moral implications the GMOs by the allows farmers to spray herbicides to kill weeds without killing and the ethical for GM resistance all plants using laboratory that allows crop taken reduces precautions improved and cultivation GMOs always Almost testing The have releasing GM the agriculture technology species. agriculture in crop. of GMOs. Most recently, crops have been engineered to improve human health. An TM S tudy Weeds our are money plants herbicides soil. spent to that space, the are is that act will a GM as a rice known vaccine for as Golden hepatitis . Another rice is a GM banana B. foc us crops for ions from example compete light, Huge every control water and amounts year Feature Example of crop Feature that disease papaya resistance cotton toxin has been added with resistance to ring spot virus of pest on resistance coded for by a gene from Bacillus thuringiensis weeds. such herbicide resistance soya corn gene (maize) resistance corn (maize) sugar improved so cane of resistance herbicide weed spraying during genes control to pests weevil gives allowing kill to glyphosate control growth water by of crop vapour loss rice nutritional boll that effects cotton drought as to several qualities genes precursors of to produce vitamin A in endosperm Irish potato increased starch content Did you know? Transgenic confer virus, crop papayas resistance which in the to carry genes that Papaya ring spot devastated Jamaica’s mid-1990s. Most on leading crops in are crop rms, although 1998. 118 GM GMOs eld grown plants is Monsanto. trials on in USA, carried Few GM genetically Brazil out in crops and Argentina. Puerto are modied Rico grown in papayas by Much one the of research the Caribbean, began in Jamaica in Module GM The 2 Genetics, variation and natural selection livestock rst animals recently, milk, GM may animals eggs bodies animals enter for or were the have blood. been No production developed food market improve the transformed animals and to and have Feature to been consumption by their human produce given growth food specic approval humans (as rate; chain. of Example of these More substances by in regulatory 2011). Feature that has been added animal increase in growth rate salmon gene from ability decrease in pollution through pigs (‘enviropigs’) to enzyme the sh grow phytase phosphorus reduction prevent in dietary of human of disease proteins in chickens catch dairy genes for cattle milk GM species year to ocean pout that gives salmon round digest supplements phytins and so decreasing reducing need for phosphate pollution supplements transmission production all but human do not human transmit bird lysozyme ’u and other proteins found in milk microorganisms Microorganisms there are now conditions in were many the rst organisms producing laboratories or a wide factories, Feature to range not be of in genetically chemicals the wider engineered often in and controlled environment. Example of Feature that has been added microorganism production of animal protein bacteria chymosin (rennin) for somatotrophin for cheese injecting making into cattle to improve milk production wine production yeast improving to avoid the the taste and production colour of stability undesirable of wine as well as compounds (histamines) production medical dietary of human proteins for yeast insulin, supplements bacteria tryptophan Genetically-modied organisms GMOs other are used ways. medical human growth hormone, vaccines use to This produce is a list medicines of some of that the in are many (an amino acid) medicine difcult products to produce for in treatment and research: insulin production human growth thyroid stimulating factor vaccines, many VIII – a e.g. (see page 116) hormone blood for chemicals hormone clotting protein inuenza for research including monoclonal antibodies 119 Module 2 Genetics, variation and natural selection ® Did you know? human antithrombin transgenic In a year each GM goat much antithrombin as collected from human 90 000 alpha-antitrypsin transgenic (See Question 4 advantage and Did you know? Antithrombin enzyme inhibits that of using cheaper of in the (A TT) these prices of precautions factories transgenic thrombin, promotes clotting. Antitrypsin them blood inhibits the in milk by to treat emphysema produced in milk organisms the is substances the large production and concerned. to trypsin, phagocytes in which the is lungs on are used inherited to to doors, they are do not requires these microorganisms into the compete engineered this produce GM release to well produce energy in laboratories environment that in the are: natural substances that not available is readily give in substances facilities, prevent such escape of as lters on air conditioning and air locks organisms during lethal genes are added to the microorganisms so that they die if recombinant removed drugs as advantage; ‘wild’ contain their microorganisms containment released infections. These no to prevent the protease have produced sheep. environment by loss 122.) Some an blood on therefore page treat blood The donations. to can by be ) goats produces as (A T ryn treat people deciencies of from the conditions of the culture. who TM these Golden Rice anti-enzymes. The The S tudy Many their 250 ve worldwide enough diet. It million is of have gives you of Vitamin required that some more information about the genetic rice. A to age A failure of in is in the diet for result in: the health of epithelia and the retina eye. Vitamin in 140 the the low deciency of rod light may cells in the intensity retina (night to make the pigment necessary to see blindness) deciency. half severe in not that under vitamin A such do vitamin estimated estimate children this children suffer from Experts following modication foc us children receive problem: Vitamin A deficiency a dry, ulcerated poor cornea that becomes cloudy, leading to blindness million repair of epithelia leading to increased risk of infection, especially deciency measles that they have become blind. In the Caribbean, children in Haiti are at highest risk of vitamin A deciency. Solutions provide vitamin providing measles these has encourage been add vitamin these are S tudy reach foc us children Read more online, but websites side and of about GM take you the GM treat their accordingly. note should technology that if check debate they evidence you read which advocate and opinions as rice We grain that of exist able that to is a of very and many and as poor diet meat the eat. although transcribed every four to vaccinations provide breast cooking as six for months; polio and them with vitamin A milk oil, our , world. enough poorest and aid milk and sugar; and who is at supplementary effective regular often live mainly of a if intervals. beyond Many staple of the these food, such vegetables. yellow Plants have This organisations. consisting pigment, including the UNICEF , the early the or other and of A voluntary from and of such parts reach plants, people giving foods. vitamin not little b-carotene not such many metabolise in feed content organisations, do example as successful foods, in for time breast fortied doses on most grains are to services, maize make the to foods health b-carotene they 120 receive or are A and fortied of very same increase programmes children Many to called Governments feeding supplements, the mothers supplements A at have rice, genes substances. genes that translated. b-carotene, but not that for into the code White code in for rice these is vitamin part the the are in of the A. rice enzymes endosperm the cells, Module Substances the in Enzyme Genes pathway into inserted Source of 2 Genetics, variation S tudy genes and foc us A. tumefaciens plants to 1 psy B the system to C crt1 bacterium not Erwinia is a engineers get the as a delivery plasmid researchers into used plant rice because infect adult the bacterium cereal plants, does such as rice. uredovora ← 2 D enzyme 3 naturally ← ↓ infect which 2 embryos ↓ plasmid gall disease. Genetic bacterium cells. The ← its crown maize use ↓ and cause cancerous ← selection endosperm precursor ↓ natural is expressed in the 3 endosperm b-carotene The solution genes taken to this from problem maize and was a to genetically bacterium. modify Researchers rice in plants the using Golden TM project Rice the embryos used of the rice bacterium, plants. This Agrobacterium bacterium has a tumefaciens , tumour to inducing infect ) (T i plasmid that moves from the bacterium to the host cells and becomes TM Figure 4.4.1 incorporated into the rice chromosomes. Genes coding for the Some Golden Rice in front enzymes of some DNA profiles. b-carotene is a to make grew b-carotenes into plants inherited varieties by of future rice were which by inserted were generations. cross into these self-pollinated They can plasmids. so be the new The embryos genes incorporated yellow pigment, hence the name ‘Golden were into Rice’. different breeding. S tudy Field trials have been carried out in the USA and the Philippines. It foc us is TM possible that Golden will Rice become available to farmers in the next You few years. At the time of writing (2011) it is not. The project has should read technology with much resistance; opponents maintain that it is better to widen of those at risk of vitamin A deciency, for example by of leafy raised by with and ethical release of many GM Antibiotic be the example and objections organisms. resistance transferred to discussions your own will and opinions help of this issues of GMOs technology are this vegetables. you form There about GM discuss your friends, family teachers. The Moral then increasing others intake and the issues diet more met that people Some genes of these used pathogenic make to to the development, use and support and provide evidence to them. are: identify organisms GMOs making could some ‘escape’ and Summary questions antibiotics redundant. 1 Herbicide resistance genes could be transferred in pollen to Find GM species and lead to the development of ‘superweeds’ that out about: i are soya of and GM maize; ii GM Present your herbicides. ndings uses resistant microorganisms. to the weed Foreign genes could be transferred to wild relatives of our crop as a poster or a group plants presentation. so changing prove their useful genomes; sources of this genes for may ‘pollute’ crop those improvement species in the that may 2 future. Read objections modied food. Foreign genes certication can that ‘pollute’ they non- GM provide and ‘GM-free’ organic crops, which GMO crops outlining food. require more herbicide applications and just as the in farmers or Farmers crops and do not as non- GM reduction cannot not keep ‘breed many crops in there chemicals seed true’; farmers so in for this is no used sowing in for favours developing advantage in terms of cost following large-scale 3 crop poster benets of agriculture the and use the as commercial to their use. to agriculture. the a much objections pesticide genetically require of GMOs to Make GM farmers Explain GMOs the in advantages the of production using of medicines. countries. 121 4.5 Practice exam-style Aspects Find below genetic from a selection of short engineering. Some earlier of answer questions genetic questions require on questions: engineering 3 information The first genetic chapters. human a 1 a Explain how the following enzymes are used engineering: restriction enzymes, insulin Name the and Explain what is meant explain how genetic modification by the term vector the different vectors roles of which a a by gene for plasmid. would DNA and ii insert be the used to DNA for i cut human into the cut plasmid. of are used in of 20 in 51 amino amino acids acids that in insulin, are made coded for up by of 16 of DNA. the b bacteria. bacteria are and What of Outline DNA insulin reverse the c the human inserting ligase. There b into produce involved enzyme plasmid insulin transcriptase to in the genetic technique engineering is the tRNA minimum molecules number of different necessary for the types synthesis of genetic insulin? Explain your answer. engineering. c 2 The DNA target restriction sites enzymes (restriction are shown sites) for Explain why is to likely indicate where the number be fewer you than the have given actual in b number of below. The vertical different lines the three enzymes cut types of tRNA required. DNA. d A triplet insulin Hindlll in mutation 4 The the is TAG. diagram in template Explain the first shows strand the of likely base from T how the the gene for effects of a to A. gene for human EcoRI antithrombin cells from Haelll a i Describe the features of the restriction was introduced into extracted goats. nuclei goat fetus from removed goat sites human gene for enucleated shown in the diagram. cells With reference diagram, to explain restriction the the enzymes information advantages in genetic in of added the identical separately DNA has lengths with each of of the following DNA the were of cells using removed from treated restriction sequence to nucleus cells each added enucleated base AGT TGAAAGGCC T T CA T CGCACCC T T AA T T CGTGGCCAAGC T T T CAAC T T T CCGGAAGT AGCGTGGGAA T T AAGCACCGGT T CGAA b i State how divide many fragments after treatment of with DNA EACH will of by embryos 5’ be implanted ii Explain further mothers enzymes. why some treatment of the fragments before they can need be inserted kids into into the surrogate restriction mitosis 3’ embryos present cell pairs. to form 3’ to enzymes. The cells 5’ nuclei) engineering. nuclei Three (cells antithrombin without ii oocytes grow into goats plasmid vectors. that Retroviruses have RNA as their genetic secrete human antithrombin material. in their milk c RNA of can be incorporated retroviruses for eukaryotic used to cells. insert transformed Explain genes cells. into insertion how into the into the genome bacteria this or technique genome of is these a Explain b Complex cannot what produce Explain by proteins produced by why complex antithrombin. 122 meant human be bacteria. is a transgenic such as antithrombin genetically bacteria human are proteins animal. modified unable such to as Module Animal make growth c cells in human i culture have also proteins, such as modified and to 6 Several human to hormone. Discuss advantages modifying animals, cells, as Chinese such Outline human the such to as goats, and ovary animal cells, in human using a State b Explain, what is meant by the term soya, are Explain these genetic proteins. b variation have all the a natural selection genetically toxic engineered compound Bacillus thuringiensis (Bt). GM in rape, cotton, countries maize such as and the United Brazil. advantages of growing Bt varieties of plants. how are on seed grown and crop Outline oil and been based bacterium, of above, 5 plants poisons States, China to a hazards the tobacco proteins. produce crop varieties genetically hamster potential engineering of Genetics, express from the produce ii been insulin 2 crop plants, genetically such as modified those to listed improve gene therapy productivity. in outline, how gene therapy is carried c Outline the potential risks of growing GM crop out. varieties c Outline the advantages and hazards of and suggest steps that can be taken to gene minimise them. therapy. d 7 What Mexico of that maize; the banned samples DNA are the maize is the limits of cultivation grown only found sequence Cuzco valley in gene Peru in therapy? of GM remote in GM in mountain maize. The originates from and maize In regions researchers a virus 30-year-old 1998. that maize an investigation of Oaxaca tested for infects cobs from in a carried southern promoter cauliflowers. They museum in 2000 Mexico for sequence also collections out in tested a researchers specific that Mexico. The sequence genetic blue of engineers maize from table tested shows the use in remote their results. Sample of maize Presence () or absence () of local variety of maize 1 (1–3% of grains sampled) local variety of maize 2 (1–3% of grains sampled) maize from USA (100% of grains sampled) (100% of grains sampled) GM Bt GM herbicide blue resistant maize from maize from maize from USA promoter sequence in maize genome Peru 30-year-old museum collection a Explain why the researchers used i blue maize and 30 year old maize, and ii GM maize from the USA in their study. b Suggest Mexico This research sequences that In c d reasons for two the 2009, in was the Discuss had highly the is presence the ban the third germ government meant reasons of by the the on GM controversial maize. A entered Mexican what the after Mexican DNA Explain years promoter sequence in the and repeat investigation investigations in in 2008 found 2003–04 some, some GM ii countries permitted term do trial plantings of GM grains from southern but did did not find not any confirm of the these DNA original conclusion maize. why: permit the planting permit the planting foc us of Promoter not maize germ line crops others of line. S tudy i genome maize. of GM crops. sequences polymerase ‘upstream’ of engineering be and each must transcribed are attachment sites for transcription factors. The in gene. Any have the a gene promoter host RNA sequences inserted by sequence are genetic to allow it to cell. 123 3 Genetics, variation 5. 1 Variation Learning outcomes completion of this natural selection (1) Types of variation V ariation On and section, refers to differences between the genotypes and phenotypes of you organisms. should be able to: Phenotypic dene the term organisms explain the difference and and in is their obvious to us behaviour . It in is the also physical evident appearance in aspects of of biology between that interspecic variation variation we cannot see so easily, such as biochemistry and in haemoglobin (see physiology. intraspecic Examples of this are the variation page 130) and variation blood describe the continuous difference and between discontinuous group reection colour of antigens of (see genotypic the 4 page 102). variation o’clock plant as (see Some it is page phenotypic with the variation codominance is in a direct ower 96). variation We list examples of can identify phenotypic variation at two levels: discontinuous interspecific variation intraspecific variation variation select and present draw data on bar charts to discontinuous variation. Interspecic to these differences when In this do your differences between between classifying different organisms and different species; when species. We biologists using keys use use to section you will need to know about intraspecic variation. foc us course some eld identication eld the distinguish species. Intraspecic During is differences identify S tudy variation these work key you will probably and use an in the form of between variation individuals. discontinuous continuous is variation There are within two a types species. of It is the intraspecic difference variation: variation a variation guide. Discontinuous variation non- overlapping is the categories. type Y ou of can variation see in examples which of this there type are of clear , variation Link in humans attached Read page 90 for the phenotype the list lobes. on page There are 90. two People either distinct have attached categories with no or non- intermediate differences forms. between in ear and Other features in the list, such as height and hand span, show genotype. continuous variation as there is a range of sizes between two extremes. Discontinuous variation This refers categories. to intermediate variation – This For S tudy population will be in this area at the section. It is all it. of sizes; ABO have blood system intermediates variation the is ability groups there taste by a are wings in are between caused to that long in or clear short humans four contrasting wings, show categories there are no discontinuous – A, B, AB and O them. genes; bitter the environment chemical, PTC, is has no effect. determined of one same species time. in to taste on chromosome PTC; people 7. who The are dominant allele homozygous gives by recessive people The types of food we eat may modify how we taste cannot PTC, but the the make non-tasters into tasters. same Data on because 124 the (T AS2R38) ability cannot organisms in any differences either used taste often wing example, gene the term type ies foc us a The – without qualitative Fruit discontinuous each category variation is a is separate presented group. in the form of bar charts Module 2 Genetics, 60 variation and natural selection Did you know? 53% The percentages of ABO blood noitalupop 50 groups in different populations vary human signicantly. South 40 American Indians are all blood group 35% eht O; Australian Aborigines groups O fo 30 egatnecrep you for and A. What about the the ABO alleles blood are does of in blood this the group all tell gene these 20 populations? 10 8% 4% 0 A B AB blood Figure 5.1.1 O groups Bar chart to show percentages of the population of Portugal with different ABO blood groups Rules for use draw bar drawing most of the the chart charts width; bar can there charts: grid in be provided, do not make the chart too small pencil made must be of lines, space or more between the usually, lines or blocks bars; of they equal do not touch the intervals the y-axis between the blocks on the x-axis should be equidistant Did you know? scale should should be properly usually start at scaled zero with and equidistant this should be intervals; written at the the The base of the axis; if all the numbers are large a displaced origin may blood know used but the start number should be clear at the base of the the y-axis the table of should results be the lines or blocks labelled with the headings and units taken Rhesus U should be arranged in the same order as results or in a logical sequence from left to right that most the ABO in a (increasing system. more people system But there and are negative including which the occurs very in rare people table without of are from many about y-axis the groups be the U antigen. U negative or red blood cells are found in people of decreasing) African each block should be identied descent. clearly. Summary questions 1 Dene the term 4 variation Describe of 2 Distinguish and intraspecic continuous 3 The A between 41%, B Plot b Brazil variation; of these 5 and 9%, AB was 3%, O a as bar in Brazil is: why colony are 6 Explain taste until there. 1822 Suggest different from in variation a the blood and proportion blood the presenting chart. migrated percentages groups 47%. a Portuguese Portuguese State different blood variation groups is an discontinuous example variation. interspecic discontinuous different these gures many pairs: variation. proportion a the following why intraspecic groups steps the bitter you is of would variation chemical a population plotted in take the called as in a bar with chart. determining ability of people and to PTC. and why those in Portugal. 125 5.2 Variation (2) Learning outcomes Continuous variation This On completion should be examples list able of this section, select and of draw data histograms on describe differences within a species. Organism Examples of humans height, environment body mass, hand span, to beef some continuous variation cattle, goats milk yield, e.g. volume of milk per week continuous variation quantitative continuous dairy present to to: variation refers you effects on the of cattle, pigs, sheep, goats body mass, carcass sheep wool thickness soya width weight the phenotype. of leaves, mass of pods, total yield of beans S tudy The type of foc us banana variation shown in below distribution as is the called three a normal measures ‘average’ (mean, median of are all about the leaves, yield of fruit two examples extremes has – no clear shortest categories; and tallest, instead, lightest there and is a range heaviest, etc. of describe continuous variation you need to measure and then collate the and data. mode) these between T o the of the Each histogram length The results are usually collected in a tally table before being same. presented the as range lengths a into of 50 histogram. classes. leaves In For with collating example, a total the if results you range of were 8 to it is necessary collecting 38 mm, to divide information you could divide on the 25 range into nine classes. This is shown in the tally table and histogram. 20 sevael Leaf length/mm Tally Number Percentage 15 frequency fo rebmun 10 8–11 // 2 3 12–15 //// 4 6 5 7 8 11 25 35 13 18 7 10 5 0 34–04 93–63 53–23 13–82 of 72–42 Figure 5.2.1 32–02 91–61 51–21 11–8 length /// leaves/mm Histogram to show the variation in leaves recorded in the tally /// table // //// 4 6 40–43 /// 3 4 Total 71 71 100 Continuous variation Many inuence the genes genes involved the feature. inuence the feature genes, each is determined the have inuence two 126 36–39 same multiple The in an recessive genes alleles separate additive allele by feature so genes add is that and fashion. could and which a 5 mm the many the In by known alleles the polygeny. alleles simple to environment. as at at each each locus example length of Often locus with a leaf just and Module each dominant allele add 10 mm. Leaves would then vary in length 2 Genetics, variation and features 40 mm such as so leaf there length would are be ve different inuenced by classes. many more environmental effects, such as light, water and than two nutrient the effect draw a of line smoothing Histograms scale are between Rules for use draw the through most of the out the be blocks the area the each the variation This table is the are be do with to give not on the a bell-shaped cur ve of use 1, these for 2, 5 or scaling 10 axes, if not use 3 or 6. histogram. variation separate as a continuous categories. not make the histogram too small an appropriate proportional all opposite the labelled, but variable and is continuous; it scale touching table 4.0 to is the in size of the similar-sized class; the classes so the same e.g. is ‘3.0 not; to 4.0 3.9’ will which be means included that in the 3.0 is next 4.9 the equidistant number intervals; discontinuous of genes frequency label and with and should appropriate continuous be properly units. variation. Continuous variation qualitative, quantitative, e.g. mass absence few, the or Discontinuous variation with of are independent drawn or influencing bars graphs, pencil clearly be phenotype number the continuous items the class, campares appearance in represents with of provided, blocks this to y-axis the block in should in 4.0 scaled data the blocks included class: grid should of of present represents leaf-length widths the labelled the centre line multiples histograms: histogram x-axis, should to extremes; drawing used the with availability , do we foc us genes or have selection However , As and natural between S tudy 20 mm and no e.g. of presence a feature and length; a range with intermediates often just one many intermediates gene many (polygenic) Summary questions (monogenic) 1 feature Dene the term continuous variation. effects of different different effects all have the same 2 genes on the feature effect, usually Distinguish following pairs: histogram; effects of alleles at large effects small effects, between the additive bar chart monogenic and and usually polygenic. each locus additive 3 effect of the small or non-existent Explain the steps you would take large in measuring and presenting environment variation in Poinciana, presentation bar chart frequency Suggest cat environment on extreme honey bee case of the colonies. effect Most of the female environment honey bees on phenotype develop into occurs worker they are fed on a diet of pollen has how to become princesses and and then nectar . Y oung female her page in effects occurred genes in to of the an the environment organism organism’s during are its not queens are inheritable lifetime reproductive Siamese markings, kittens 73 for fed royal are not as have but them. none See ideas. Discuss the effects of the bees on the phenotype jelly. of The a female black environment destined Royal bees 5 because of phenotype of An length histogram 4 Effect of the pod Delonix regia. changes that transmitted to have the individual explain why organisms these and effects are not inheritable. organs. 127 5.3 Mutation The Learning outcomes term biology On completion should be able of this section, is you mutation to passed refer to all to explain the describe term Mutations mutation gene mutation and discuss chromosome give an of S tudy in foc us A change that cell suppressor disrupt rise they mutation then the divide by more occurs cells in a germ line derived from occurs by in and a it is single replication and used cell in and mitosis. to this cancers. genes control control mitosis. so that cells divide Mutations that only affect the occur cells carry the as and somatic are not passed on to the next mutations important for may nucleus meiosis. 50% of produced mutant by occur these or this the and chapter that can affect mutations can either structure be are ger m passed whole occur line of to mutations the next chromosomes when change on that occur the a nucleus number individual of or generation. single divides genes. by mitosis chromosomes in or a chromosomes. Gene mutations occur during DNA replication during interphase of the the cycle; these are changes to the number or sequence of base pairs. meiosis allele. Chromosome These may mutation involve: primary cells it cell haploid known Chromosome will tumour genes giving which are meiosis; will and these gamete-forming Changes a of change example. in cell, DNA. descendants meaning mutation Even and If word example generation in a give organism an from to: uncontrollably changes the Proto - oncogenes derives polyploidy – increasing the number of sets of oocyte chromosomes homologous pair of chromosomes metaphase meiosis of 21 aneuploidy – increasing individual I changes in the translocation and homologous pair not during separate anaphase 1st polar with chromosome it chromatids chromosomes of both separate II in syndrome meiosis polar with two such is as a detached an example a child of aneuploidy. has an extra In most chromosome because in homologous anaphase I of chromosomes meiosis. do This most often take over through 40 of in years anaphase the production sperm. to I The proceed (see page of reason from 83) is eggs early to rather that cells meiosis form eggs. than in may and go The II of of Down’s older syndrome The women. is higher chances among rise the steeply after body the two chromosomes 21 is properly production children 2nd with chromosome another . because happens separate incidence ovum chromosome, a syndrome happens This occurs normally a of 21 21 the to of part body the chromosomes of no not both structure when reattached Down’s 21. oocyte meiosis number I cases with the does Down’s chromosomes decreasing chromosomes I secondary or at meiosis age of 35. 21 Figure 5.3.1 separate in existence shows how anaphase of three I a pair and of are chromosomes inherited chromosomes of the fails together . same type to The is fertilisation known normal sperm as because one chromosome of not inherited; meiosis to they arise form Females have had children with with Down’s both Down’s with syndrome and without are fertile Down’s. and Males 21 This diagram shows how a pair of homologous chromosomes fails to separate during meiosis I 128 are during with trisomy Figure 5.3.1 T risomies non-disjunction 21 gametes. zygote trisomy. with syndrome chromosomes X occur , chromosome and are but No. sterile. only 21 T risomies babies survive. with of other trisomies T risomies of of other the Module chromosomes are 5% Down’s be of cases of usually lethal before syndrome are or the around result the of time of birth. translocation 2 Genetics, About that variation Polyploidy the total number of chromosomes have been selection Did you know? some in natural can inherited. Changes and important in is uncommon species of lizard in are animals; an the example. evolution 50% of of plant owering associated with species, plant large especially species size, so are in those polyploid. cultivated that are cultivated. Polyploidy varieties are is often Nearly often much larger Link than the diploid wild relatives from which they evolved. Polyploidy Gene speciation mutation of Changes These to can individual genes involve the sequence of nucleotide how is – this a form see of page happened very abrupt 139 for in details cord grass. bases. be: Link substitution frameshift of one or stutter – a are of page 109). the is template effect strand, this is of is the the sequence the lower is one a duplicated of changes the a it coding the the that of it system becomes bases upper G G G A T A T A G C T A G G T C T C C A T C C C T A T A T C G A T C C A G A G G T arg ser arg A A A G G C A T A T A G C T A G G T C T C C A T T T T C C G T A T A T C G A T C C A G A G G T tyr arg ser arg A A A G G G T A T G A C T A G G T C T C C A T T T T C C C A T A C T G A T C C A G A G G T his thr asp pro glu A A A G G G A T A T A G C A A G G T C T C C A T T T T C C C T A T A T C G T T C C A G A G G T ser leu tyr arg ser arg A A A G G G A T A T T G C T A G G T C T C C A T T T T C C C T A T A T C G A T C C A G A G G T ser Figure 5.3.2 leu you of mutation. gly A phe effects help – A phe the to gly A ser the of 67 gly A val understand details page strand. A ser on in T tyr the strand A leu to code (see T ser back longer disorder of The Look to repeat nervous sequence codes. addition genetic number in so by bases Huntington’s on which the more protein cause for changes or increase for another triplets of which gene for A phe d and of deletion The pair T phe c sequence This acid base A phe b one mutations the amino of the pairs. section shows and the or generation. DNA a base repeated 5.3.2 which these each the in change bases with Figure the more sequences has – – STOP The effects of gene mutations on an amino acid sequence of a polypeptide Summary questions can be: a quite small; b very large; c non-existent; d catastrophic 1 The chances of a mutation are increased by exposure to mutagens, Dene the terms mutation and which mutagen. are environmental are radiation factors that interact with DNA to change it. Examples 2 tobacco known DNA smoke. as not and Agents various that cause chemicals such mutations as that benzpyrene cause cancers polymerase that infallible is has in and a Distinguish between gene in mutations are and chromosome mutations. carcinogens nucleotide is (X-rays) proof-reading the wrong errors place. occur capacity so However , during removes this replication. proof and replaces reading a ability 3 Find 21 out on the the of effects he of phenotype. information the effects as on a trisomy Present table the showing different aspects phenotype. 129 5.4 Sickle cell Learning outcomes anaemia A substitution Sickle On completion of this section, cell be able describe to the sickle of state mutation cell the anaemia explain that leads severe on the of sickle of The the result b-globin of of a substitution haemoglobin. mutation This does in the not sixth sound the gure if but all the shows coding as you see b-globin that strand can the leads in 5.4.1 polypeptides change to Figure the from change A in to from it can like have a haemoglobin T in CTC the to very are sixth template strand and the position hence the substitution of valine for CAC glutamic in the acid in individual global allele for change, cell distribution sixth sickle cell of the primary structure of b-globin. This type of of haemoglobin the is for consequences changed. anaemia effects the gene important triplet the to: very anaemia you triplet should mutation anaemia normal is form known as haemoglobin S (HbS) to distinguish it from the (HbA). S (Hb ) Molecules discuss cell the inheritance of sickle anaemia. The R form groups of haemoglobin with of this R and cells sickling Link of with ow . To remind amino yourself acids, see about page R groups and these These this There can The foc us on page of a substitution in ow Figure 5.3.2a also People pain for are 120 position they an that is 6 area gain on and its of the S beta lose surface hydrophobic. haemoglobin polypeptide are enter sickle-shaped damages get the removed stuck people major in with red or oxygen. that has The globin molecules is to regions of low attracted stick oxygen crescent-shaped. cell from membrane the capillaries this organs feeling and that experiencing many and is and circulation making condition reduced years before cells only tired by they live and cell it have and by The the sickle repeated shortens the spleen. difcult there breathing. enough crisis having sickle the loss can are red for cell be blood crises much destroyed lethargic and in 10 an and at cells days. to live do to to in pain. to a or good spleen the to the medical age. faster rate live liver; of hospital with young cells the rest taken a at blood spleen 20 inability be the without die red the to ow for people but blood Normal between need disease Blood blood Some crises, cell of marrow . for in not transfusions. with bone is sickle without caused in a difculty there blood children is days are fever much produced blood than between 90 sickle-shaped Symptoms strenuous of anaemia exercise. 129. this and 5.4.1 has gene. on shows the Notice organ b-globin Sickle Did you know? the In West Africa anaemia the is incidence 4% of all live of sickle births. because cells They kill to are the against occurs it gene is gives a then taken but malaria anyway the also has and, cascade homozygous multiple the the term on effects on applied the to of for effects the cells, that mutant tissues, genes like organs the phenotype. malaria which little and is effects disorder It is of cycle causes the happens against causes and the the benet red for those people common spends oxygen within. medical to malaria. circulation parasites without that surprisingly life parasite the who is protection out DNA have multiple complex the decrease, cells can Pleiotropy mutation. by in someone against has Invasion change in has anaemia Plasmodium, cells. a that substitution world red body that gene cell the systems. Protection 130 to relief many red Figure cell can be so anaemia they and shown at causing mutant They cells increase facilities is leucine valine when exposes 12. disease example and become happens, blood receive mutation the they cells. which body. An shape of may S tudy of area, unsickling sickle If change attached precipitate. concentration life group hydrophobic together When oxygen phenylalanine hydrophobic to no cells and in some areas The malarial part of it in to become killed. Not the intervention, the blood within the misshapen. only this disorder the of for parasite, red concentration Unfortunately, with homozygous does this protection since condition sickling is lethal. Module gene for β-globin of 2 Genetics, variation and S allele Hb mutation template to sixth strand first his seven leu amino thr pro acids of glu DNA CACGTGGACTGAGGACACCTC glu normal val β-globin first his seven 2 α- and to 2 β-globins make Millions of A A Hb have only red blood low cells oxygen Hb packed in areas valine replacing glutamic red S have of abnormal β-globin both types Hb β-globin S Hb have abnormal only β-globin of concentration sickle-shaped increase to glu cells viscosity from acids of val of into S Hb β-globin pro assembled molecules blood A leads thr haemoglobin. haemoglobin normal leu amino substitution Hb Hb triplet of CACGTGGACTGAGGACTCCTC val selection haemoglobin A allele natural red blood circulation in foetal cells by the removed sickle-shaped liver jaundice capillaries anaemia heart failure red to pain of blood blood cause cells sickle increases get cell stuck in crisis fever kidney damage haemoglobin Figure 5.4.1 Both the The effects of a substitution mutation in the b-globin gene. Viscosity means ‘thickness’ and resistance to ow. normal allele and the mutant allele are active in people who are Summary questions heterozygous. blood They functions produce fairly both normally as forms they of the have polypeptide haemoglobin and their molecules with A 1 two normal b-globins and some with two mutant b-globins and The the with both types. In a carrier , the presence of the malarial gene Hb parasite production red blood cells to rupture prematurely, so the parasite of controls the b-globin causes polypeptide the S /Hb some of haemoglobin. cannot S People reproduce. Furthermore, the polymerisation of haemoglobin affects who are homozygous, Hb the S Hb ability of malaria, forms of the parasite people’s the to digest chances b-globin in of haemoglobin. survival their Therefore, actually haemoglobin. increase This mild if in areas they form have is , Draw a a cell result trait of and natural is common selection in (see places page such as West and known East inherit sickle cell who are heterozygous they are like beta of the anaemia and Some thalassaemia forms cell this. are anaemia carry other thalassaemias and the do genetic also Africa show how in infectious areas disease. of serious the parents mutant report of who allele mild disorders provide forms They world are where also disorder from neither of are are carriers. Explain the often symptoms. of unaware Alpha haemoglobin. protection against thalassaemias are The in malaria important in is (or was) an communities the the from migrants thalassaemias are from Africa whom their has and from the effect DNA inherit parents the of the blood Sickle nucleotide gene for structure mild malaria. serious to that and disorder. change sequence b-globin and function on of the red cells. health The terms and codominant dominant, recessive important that are used to are Mediterranean the relationships area, between where to can People describe descended someone as 3 problems anaemia. 134). from one carriers cell diagram as 2 People sickle genetic both this sickle have with alleles. What term or common. terms do applied for you to think the should alleles b-globin? Justify of be the your gene answer. 131 5.5 Darwin Learning outcomes Galápagos Evolution On completion of this section, be able state the the English be linked naturalist to and the name scientist of Charles whose Darwin journey (1809– around the to: world forever you 1882), should will mockingbirds observations made by a in the ship mechanism by HMS Beagle which between evolution 1831 and 1836 led him to propose occurs. Darwin On explain how these his circumnavigation islands led to Darwin’s conclusions off the west coast the of Africa, globe Darwin South visited America, the Cape islands in V erde the Pacic, about New natural of observations Zealand, Australia and South Africa. While on the Galápagos selection. Islands known in as the Pacic mocking ‘My he made this observation about birds that were then thrushes. attention was first thoroughly aroused, by comparing Galápagos together the numerous specimens .... of the mocking- mockingbird thrushes, when, to my astonishment, I discovered that all Mimus parvulus those one from Charles species Island (Mimus [now called trifasciatus); all Floreana] from belonged Albemarle to Island San Cristóbal [Isabela] to M. parvulus; and all from James Island [Santiago] mockingbird and Chatham Island [San Cristóbal] belonged to M. Mimus melanotis melanotis.’ These they birds are them on the Galápagos Floreana Española mockingbird mockingbird species M. Mimus trifasciatus of now known distributed South birds is as in in related the mockingbirds the American were Mimus macdonaldi Americas. mainland to them. Galápagos, found only on and Darwin – as realised There Española and Darwin are in only an a group had seen that fact saw island the four three as Darwin Mimus macdonaldi did Figure 5.5.1 are widely not visit. This map of the Galápagos Islands shows the The distribution of the four species of mockingbirds that are endemic to these islands – found here and nowhere else The on close the from species occur resemblance mainland the did not led mainland changes amongst sowed populations to variation islands of with seed the for natural between to populate isolated signicant share by Darwin to birds the the four mockingbirds give on idea: on that mockingbird that islands. islands to big the different changes in selection suggest on enough the mockingbirds his He with these other species individuals then had stated different and species migrated that environments populations features led that they islands. Darwin’s finches Darwin collected mockingbirds, London related the by these species nches methods. from the Darwin The on 132 John mainland. an The found that are trees; is he who known nch ground species of perhaps nowhere to else feed best as an to species The food in closely from beaks of gathering remove insects seeds. plants known. known and studied were related nches. spines on than later they from foods and smaller were that Darwin’s cactus animals is realised different uses are These different as nches the which visited. signicantly now adaptations other and nches, (1804–81) woodpecker of of islands were They tortoise island the Gould show bark giant specimens from A found species island nowhere that is endemic else. only found Module On his return evidence and for animal amongst to his and plants England theory plant and in and 1836, Darwin spent communicating breeders. He with compiled 20 years Genetics, collecting scientists, many 2 variation and Did you know? examples of Darwin variation animals. in the was particularly variation selection pigeons, pigeon In 1858, the naturalist and collector Alfred Russel W allace sent essay occur to that species. of the of Species We Linnean can by 19 Natural within offspring each theory there that a ideas 1859, have after organisms were own on changes presented Darwin’s the as book at a On breeders species resemble of is own natural there their of years remain fairly to than elephants 700 is selection competition for meeting the Origin reproduce ever had stable large become the mature; potential from year to to year have with variation stated resources that have the same for water , food, compete for space, water , that: between individuals of the same means to territories, ions, obtain nesting light, those sites carbon resources; and dioxide mates; and, in animals Mimus A Galápagos mockingbird, parvulus plants some foc us pollinators competition leads to high death rates among young animals that Competition starve, are eaten by predators or die of disease; there is a similar mortality among seedling plants that start growing in same species do not absorb enough water , ions, light or carbon dioxide, in this herbivores struggle resources for survive or are killed existence to breed the and by answer this differential individuals best sur vival adapted means to the on best their the best adapted animals are that adapted populations conditions good to resisting disease and consist existing at of could Mendel’s convincing case inheritance selection not paper explain and for natural occurred that how at nding nding variation understood and knowledge it, he selection. this of did not term to use in natural selection. any food, one escaping time the was it inherited. have was provide Mendelian term alleles is used and from genes. All individuals of the same mates. might As foc us those species Darwin useful obtain not predators, a alleles Notice – on S tudy of disease individuals pass members intraspecic are an by is unsuitable competition places, between high the to breeding parents. compete eaten even pigeons. S tudy and as talking that Figure 5.5.2 species cases, time follows: ability individuals pair his spent amongst such published. observations more descendants of was species far In as occurs animals, uctuations His all ideas W allace’s Darwin’s – same London. Selection calculated populations the and in producing million minor Darwin overpopulation Darwin much Society summarise numbers included and that interested Darwin his an selection naturalists domesticated Natural natural made he the genetics If he an thought support would had even that for have differ read Some more ‘blending’ have in the chance of same alleles alleles competitive natural the give edge of genes those they genes. individuals that – the increases their survival. done. Summary questions 1 Dene the term 4 island endemic State Darwin’s four populations 2 Anolis lizards are found throughout why Anolis different to lizard species from St. Lucia Explain the 5 those from Jamaica. Galapágos theory of importance Islands natural in of the the the about natural signicance of each one the mockingbirds development of of theory of natural selection. are Suggest animal 3 observations explain the Caribbean. for Suggest and why and Darwin plant was interested in the work of breeders. the Darwin’s selection. 133 5.6 Natural selection Learning outcomes Evolution When On completion should be state able the of this section, people distinct ideas: and explain factors about idea evolution they are usually referring to two general The theory of evolution states that organisms change over specic As scientists learnt more about the Earth in the eighteenth evolution century talk big to: general of – the you time. theories (1) how act environmental as agents of and there that life came had a general changed realisation over that the Earth was very old time. natural The special theory that evolution occurs by the process of natural selection. selection. Darwin He did proposed not know a mechanism how the by which variation that change he in species described at could great occur . length was Did you know? inherited. Melanism pollution. is not Insects environments so they associated living are absorb become only often heat, in colder melanic warm active faster than melanic forms. There with are up From with ideas have been of Vincent (see on Grenada page natural published biologists selection. have combined Many knowledge investigations of of genetics natural selection including: industrial melanism in antibiotic resistance the peppered moth, Biston betularia and in bacteria. non- melanic Natural bananaquits 1900, and selection in action St The 140). The peppered peppered Isles. It ies moth moth, at and Biston night and industrial betularia , during the is melanism found day throughout settles on trees the where British it is Link camouaged country. See page 140 for relating selection on There are lichens two very that grow distinct on bark forms in unpolluted within this parts species. of One the has experimental fairly evidence against to the effect light white peppered coloured wings speckled with black that makes it look as if its of wings have been dusted with black pepper . This form is well moths. camouaged black As and soon is as predatory against known any on as since lichens the melanic birds background the melanic moths they trees. that so were on trees. The other form is form. appeared were They grow they obvious eaten were against before they likely the to be eaten by speckled had the chance to a reproduce. the In the With of These mutant middle the coal. and Manchester which easily were the soot, 18th by The birds the population melanic of in in and again deposited and by mutation, more in eastern on of but pollution In the of burning the lichen woodlands melanic around peppered moths moths melanics survived and the than the speckled melanic form industrial with where was most speckled around England trees. signicantly. from The offspring areas killed the trees. the century rural the changed pollution which the while 20th air more against left as environment severe woodlands increased now dioxide, eaten the the came more populations although variety and melanics of changed, was camouaged beginning of century, noticed the composition re-appeared inherited. sulphur which people spotted not revolution by 90% Figure 5.6.1 was contains now reproduced. that of melanics industrial Smoke species, b allele no there carried is by little the variety made cities. pollution were up so over The has not pollution prevailing the wind. Speckled and melanic The map shows the situation in the mid 1900s. Now, with the decline of peppered moths settle on trees: a in an heavy industry much less in the UK and the introduction of Clean Air Acts there area free of air pollution and covered with lichen; b in an area heavily polluted with sulphur dioxide and soot 134 form pollution increasing in and the numbers population and the has changed numbers of with melanics the speckled decreasing. is Module 2 Genetics, variation and natural selection Dark form Industrial Light form areas Glasgow Belfast Dublin Manchester Birmingham Cardiff Pr London wind Figure 5.6.2 These maps shows the proportion of populations of peppered moth in the British Isles that were melanics in the mid-1900s In this example, although their consequence bird effect of predators was human due are to acting as pollution the in the agent of natural environment as selection a activity. Did you know? Antibiotic Antibiotics or inhibit are the medicines Penicillin inhibits resistance in substances the works protein ribosomes. produced reproduction 1940s by with kill by by bacteria. the fungi and rather some of with than bacteria were just cell the walls. smaller stopping that developed streptomycin formation combining bacteria and Antibiotics penicillin inhibiting synthesis Both of being kill the rst. them of proteins Streptomycin sub-unit Resistance result as bind. of to streptomycin change so in of streptomycin enzymes is the ribosome cannot Penicillin-resistance result from a that is the break down penicillin. reproducing. When an leaves any antibiotic is taken the susceptible bacteria are survive and killed. This Summary questions bacteria competitors so that make are use resistant. of the These available nutrients in do the not body have any and 1 reproduce so passing on the gene for antibiotic resistance. Under Body colour in B. betularia is normal controlled by a gene. The allele, circumstances when the antibiotic is not present, any bacteria with the B codes for the melanic form, gene for antibiotic resistance do not compete so well because producing a b for the speckled form. Explain protein that is not required puts them at a disadvantage. It takes energy how melanic forms of this species to replicate plasmids and to copy genes that are not essential if the appear in populations composed antibiotic is not in the environment. entirely of the speckled forms. V ertical transmission parent bacterium binary ssion. these can be to As the passing daughter the passed is genes from bacteria for one on of during antibiotic species antibiotic to asexual resistance another by resistance from reproduction are on Use genetic diagrams to show the by results of crosses between melanic plasmids, forms and speckled forms. horizontal 2 transmission . this may Bacteria include antibiotic often plasmids resistance of scavenge from great dead DNA from bacteria. their This surroundings makes the Explain both in response spread of concern. foc us the these 3 mutant advantage cases to the alleles at of natural selective may be selection agents. The selected a certain time. if in action the mutations they provide mutations occur do not melanic which the decreased in the the Explain British has Isles mid-1900s. how of moths antibiotics natural act as selection. appear spontaneously some feature why of agents In detail frequency since S tudy in and and is an 4 Explain can be how antibiotic transmitted resistance vertically and horizontally. 135 5.7 Natural selection Aspects Learning outcomes of the overproduce On completion should be able of this section, you the habitat many to: describe why heritable important to life state to that natural maintain population selection constancy and in explain acts a discuss to this are when as an natural agent of and the for next in Selection The mates. in the such as the predation, as environment, disease does often are often it Scotia this are If at they individuals or die of individuals their are Alleles alleles much in Species the between disease. that population than individuals These survive and factors the most vulnerable compete early for period nesting of successful that In a are sexually different variation they as genes in get to pass advantageous reproducing are the their in alleles in species, produced previous on increase new each generation generation. selection not Stabilising always maintains in crab, lead has to to has as over it Y ucatán largely occurred as has time polyphemus , the remained selection change populations Limulus Canada species in is so with that found Mexico. unchanged the peppered they in We for do the seas know 250 environment moths; not change. from from million has not fossils years. changed. and Research competition, The selection. competition predators population. of horseshoe Nova that of by is of a foc us aspects young There size. generation. producing more These more agents selection change population. S tudy eaten organisms Stabilising acts are support. population combinations so how the frequency how happens there as selection sites so act variation of is environment can starve, control (2) in Sweden on populations of reed warblers, Acrocephalus called scirpaceus, provides evidence for stabilising selection. The wings of young selection pressures reed warblers, nest. At Each bird this reach age was the their wing identied maximum length by in putting length a few millimetres a small ring days of after each around leaving bird one was of the recorded. its legs. Link When rings The genetic variation is the result the was meiosis pages information 128, 84 and to caught identify in net specic traps birds as and adults their the information age. The length The ringing and before it trapping was was recorded for each bird that mean in age the at trapping was calculated for birds of Wing each wing length ringing/mm at Number Mean age In data of birds shows with trapping/ common name not related to crustaceans. It is less than 63 24 closely related to spiders with the 64 72 wing than lengths extremes Records of the the length 65 130 most of 346 167 349 for generations birds. 106 discovered 270 length this 69 more than 70 66 237 23 199 total been = 771 is many of these Scientists that responsible 68 has 297 183 67 common wing 66–67 mm 66 conrm 256 that 136 greater and range. scorpions. a survival 253 at more of L. polyphemus those is had days chance its that wings spite trapped of as at 66–67 mm crustaceans. length table. birds are was released. The Did you know? crabs the time see 98. shown Most on of and fertilisation, identied for further used were of between mutation, birds in for reed are wing warblers another stabilising have genes example selection. so of Module Directional Peter of and the of Rosemary of the bird on birds birds the with before (an increase to 2005 second a the nches, G. number of The drought, The nch seeds was than for rate large quickly beak length/mm mean beak depth/mm selection of for after with the beaks, to reduced able the had to rains length/mm mean beak depth/mm bell-shaped eat birds of 10.68 11.07 9.42 9.66 was size you the can to ground the became leaving of had 2003 seeds high, the than decreased beak as seeds. curve In large small The pre-1977 the greater occurred. drastically to eat returned, was presence reproduce. to beak data The ability large-beaked beaks mean the offspring depth). Now survived many died; were selection larger Birds that died survived. their beak Birds that the very medium see in the Grants growth discovered of the beak 2002 Population 11.2 10.6 9.4 8.6 that so in the this is size an of the beaks inheritable is related to in the 2005 genes feature. Figure 5.7.1 Geospiza Disruptive In natural table. mean for and the and 10.5 mm combined with In on collected Population The variation population bird recovered available. death with this that directional magnirostris, individuals drought for depth 4–5% as a Grants fortis beak a fortis , Galápagos. those larger G. of right large important. ground of and the seeds and beaks size shifted next died studied Geospiza suffered crashed. that body in provide population average few island have nch, Major that population the Only As the plants Grant ground Daphne mid-1970s, Genetics, selection medium island 2 this case A large ground nch, magnirostris, feeding on seeds selection a species may be spread across a geographical range and the Summary questions extremes selected are selected against. in This different gives rise places to two but the types populations in the which middle may are change so 1 much that they are not able to Write types The African equatorial species seedcracker , forests there and Pyrenestes feeds denitions on the ostrinus , seeds of is a sedge bird that plants. lives Within in the small-beaked birds, which have beaks 12 mm wide and feed on selection this section: and disruptive. after’ are: of the different to described stabilising, graphs happens of interbreed. Draw to ‘before illustrate a feature in directional and what that shows soft continuous variation for each seeds type large-beaked hard birds, which have beaks 15–20 mm wide and feed of 2 seeds Explain shows mega-beaked birds, which have even larger beaks so can feed on the parents, wet season all seeds are abundant and all bird forms feed on variation of seed. In the dry season when food becomes scarce the specialise resources seeded on the other S. sedge on the seeds between species soft-seeded soft seeds. racemosa. could yet the to which they are best adapted be different an Birds Scleria sedge The early them. verrucosa , goossensii mega-beaked with stage populations S. Large-beaked beaks in that whereas and birds may so in their the depth isolated on small-beaked on selection become specialise broaden feed intermediate disr uptive birds to to diet even do give pattern not form a feed include seeds survive. new remains adult the to same generation in species. hard- birds to or the dividing harder two within generation many food generation than three from forms new all population types each variation seeds. of In how more very its hard selection. on more of This 3 Predict of the have effects sedge, on African dry the that extinction S. verrucosa, populations seedcracker, of might the P. ostrinus, in seasons. species. 137 5.8 Species and Learning outcomes On completion of this section, how Biological species We the have be able dene the discuss term term the species the that each species group of without really organisms advantages of isolating the unchanged over be and their and not to like this biological of the fertile how allopatric speciation breed species and together from same other time. that specimens occur. dead and to By contrast they concept produce species. species, offspring. single it Did you know? is Swedish biologist, Carl developed the in thought response to that species changes in states a This see biologist is not collected some T o are fertile that all individuals if may two must always see or if naming very if a result system. into Each specic this are of of a species are reproductively individuals will mate are members together and give because: fossil some species cannot breed species reproduce from to observe in the the by asexually parthenogenesis (unfertilised wild, offspring the next egg cells give rise to generation). to fertile these concept. difculties species name They dene most scientists species by the use the morphological possession of common a features as of morphology (outward appearance), behaviour , has physiology, throughout are organisms. organisms and check they distinctive hierarchical difcult behaviour alone species classied and more they possible be known offspring binomial As generic used that Linnaeus see a features specimens mating let He Darwin changed or system for Linnaeus environment. isolated separate from other (1707–78) it. common biological mechanisms species sympatric The dening sharing concept keep explain a could able list term mean remained Mayr ’s to to: disadvantages species used evolve you the should they biochemistry and anatomy. used book. Isolation of different There are various methods species that prevent individuals from different species Did you know? breeding in The biological proposed scientist, by species the Ernst concept naturalist Mayr the with table each other . These isolation mechanisms are summarised opposite. was and (1904–2005) in Speciation 1942. New species happens is Allopatric separated occurs when Over S tudy that foc us time they populations isolated by their of shrimp behaviour. are was very are put of 3 The process by which this when different more populations geographical populations are of a species areas. in the are physically Sympatric same speciation geographical migrate pressures lead to changes interbreed Alpheus, but they with were years when to ago. at in the with the a one they that when on the area. do side these not exposed have to of two of occur species, within so that sometimes a population. individuals occurs are between Usually not the extent different to is the the isthmus populations an abrupt interbreed. species of Panama mate. this able to left. Populations isthmus either from and are they population population. females another area, area isolated Populations and new the original separated males ‘snap’ occupy compared speciation may a or million together in occurs species may similar , Hybridisation 138 a shrimp, Sympatric change species. speciation this Speciation existing speciation two two cannot formed are as in selection snapping These are the individuals different from speciation and Allopatric If arise known of plant. Module Isolating mechanism Pre-mating isolation features such separate or seasonal occurs to structural organs of different of a so the three parts they different differ males times of two between sub-species of Africa species and female do not males mate show mating) differences males mean that and females species are the hybrid fertilisation hybrids offspring prevented does to are sex exoskeleton of pair those of occur sperm the of in crosses develop (often because chromosomes cannot lizards do not of and chromosome fertile. arthropods of male same An and in of one this saltmarshes. species, S. Spartina alterniflora that sterile century S. occurred S. individuals able to doubles breed by speciation In the a is UK maritima (2n = 62), hybridised townsendii to anglica For and double (2n = 62) its to grow between between gives sterile are produced ‘t with failure either of polyploidy in the early (2n = 60). was with parent. meiosis in cord 19th The introduced the which chromosome and key’ – only together’ is immobilised in tract pollen tubes on stigma of goats horse and sheep (female) and donkey (male) no viable males they North native However , spread number to a plant there in the produce vegetatively. to become foc us thought that speciation is a was gradual process. S. anglica is an American accidently species with produced become grass, century are of a species that evolved middle quickly over just a few years. the Polyploidy the fertile species, Summary questions speciation other ‘lock genitalia mule to occur hybrids must be fertile and able to 1 with a Drosophila melanogaster mates D. simulans, (2n = 124). sympatric breed that head species very of of males D. americana example species, and in other displays ignore gives Drosophila viridis long, only pollen each meiosis) viable not number example grows the and female species Darwin that release dewlap S tudy the different pollinate recognise species displays of cross when no if in geographically in California so same arrangement incompatible not sterile homologous sterile elephants methods embryo fails are of separated pine different different hybrids of anolis of pollen fails The are and April of female of selection bobbing prevented breeding natural never and females signals (assortative production at rituals so respond isolation lakes, February courtship mechanical rivers, year species post-mating and meet breeding behaviour as lowlands, forests populations rarely the reproductive variation methods mountains, or Genetics, Example geographical/ecological temporal 2 such hybrids, but not breed with either parental Dene the term biological species. species. A hybrid that is Lonicera which so a is maggot feeds has does be a either to survive parental hybrid that on feeds on which compete feed with in its species. between the The on either and hybrid, the habitat An species blueberries, snowberries. maggots not adapted with which that zephyria also shared y has maggot and must not fruits parent have is Rhagoletis R. as R a habitat 2 the with mendax honeysuckle, Explain to mendax , zephyria, known of or example why: apply concept; a species × Lonicera, in the ii i it is often biological the difcult species morphological concept is easier to apply practice. species. 3 Distinguish and between sympatric allopatric speciation. 139 5.9 Variation and Many Learning outcomes some On completion of this section, natural scientists of these be able investigations analyse are examples presented of selection. The results of here. experiments on peppered moths to: Bernard investigated summary you Kettlewell’s should have selection data about Kettlewell investigated the effect of predation by birds as the natural selective agent in maintaining populations of peppered moths in the selection 1950s apply knowledge understanding of and to investigations explain into and forms, results selection area of suggest how variation investigated agents of might to in lichen. His trapped and and After results are a a in and then wood few the reared released in days a melanic them rural he in area used a and a non-melanic wood where moth in the trap an industrial trees to were recapture the table. in 1 populations He them Birmingham covered moths. 1970s. marked Describe and explain the data shown in the table. be discover Kettlewell the feeding selection. the observed on bark of predation the peppered the by the trees. birds behaviour moths His was of that predatory were observations the agent of birds least well provided selection Number of peppered lmed in them camouaged evidence both Melanism Site of and is that against visual areas. not unusual in animal moths species. An example is the variation woodland within non-melanics melanics populations bananaquit, Grenada non-polluted, marked and released 496 473 the St flaviola, Vincent. The on more 969 form is mainly yellow area with recaptured 62 30 some % of marked moths 12.5 6.3 only and industrial marked and released 64 154 16 82 98 of marked moths 25.0 52.3 of Suggest how discover on Sample you how Grenada it and Percentage of Percentage of yellow unbanded might is investigate inherited St and in sample in sample 1 12 Banded on 3 12 79 They pink others do and alleles at not. two 83 with in birds bannaquits in to populations nemoralis leaf and litter C. hortensis, and exist in yellow. three Some different ground snails colours: These two features have loci on are bands, controlled by In a from survey, different C. woodland nemoralis snails where leaf the litter 21 dark brown and colour adjacent is more grassland variable, but where the mostly 14 yellow 3 mates colour . in amongst separate collected background 58 no mating 70 was 2 is a than 77 were 1 shade There maintained Cepaea ground chromosomes. grassland is for dry have 88 brown, 21 same the disturbed assortative form low snails snails, the vegetation. 2 each at whereas on Melanics birds. for forest on are snails live woodland it live preference melanism how moist and they Vincent. Banded snails the in altitudes yellow which 2 Melanic black Vincent habitat. evidence recaptured St forms stronger the % and high lowland recaptured marking. completely found yellow 218 area Habitat are Grenada recaptured polluted, black 92 forms 22 of and green. yellow-shelled three 140 Coereba and common rural of total samples The table snails from and each shows the unbanded area. percentage snails in Module These results are very similar to those obtained by surveys in 2 Genetics, variation Birds over known birds hold shells are the broken the as in found centre snail their around brown each shells are common beaks the snails of and stones. were the A them Equal collected habitat. around predators strike made each nemoralis . of marked was in C. numbers and count stones of against a stone. banded before after habitat. foc us yellow being a few The Look The online for snails Broken and photos of Cepaea nemoralis C. hortensis in their banded and natural habitat. released days table on shows results. Habitat Banded yellow grassland 23 76 woodland 68 30 3 selection years. thrushes them unbanded into many natural similar S tudy habitats and Use the information maintain different Predation of to shells explain types of ‘spaghetti C. Unbanded dark how selection nemoralis worms’ by in pressures the two shells act to habitats. birds Figure 5.9.1 These snails with different banding patterns are all members of the Y ou can test the effect of visual predation by putting out food for birds. same species, Cepaea Scientists have predation by making brown on each brown and tray eaten recorded. by The Guppies Guppies, of be an with birds. results The are of about in of the on the ‘prey ’ half theory selection and painted that by food grey, were throughout the reticulata, Caribbean. Background Number of Percentage of colour ‘prey’ ‘prey’ effects of predation on brown green brown eaten 147 118 55.5 44.5 green 56 72 43.8 56.2 brown 62 31 66.7 33.3 grey were table. are small David sh that Reznick has live populations of studied these Describe the The Aripo river guppies system living in in sizes; they rivers also predation with predators grow up faster and mature predators. reproduce at a younger age than those in worms’ shown because Guppies they are Explain how in rivers with predators breed as soon at risk of being eaten. The moving individuals from each population out and putting them which them, did others not did have not. guppies. The Some of experiments these were were moved from rivers with new rivers designed predators you the the a would experiment effect population so had over of to selection to of ‘spaghetti time. predators These are all examples of that selection, populations table. into 6 in the investigations worms’ rivers in as on involved data rivers nd possible the ‘spaghetti at continue without explain of T rinidad. 5 smaller and sh on in eaten had 4 the eaten green placed pieces in Trinidad Poecilia hortensis visual ground. the numbers the test pastry were placed pieces until to agent food were green left the method aluminium and 20 and could a coloured Sheets and 20 been birds different colouring. green developed rivers not speciation. without Explain: predators, and from rivers without predators to those with predators. As a a control, rivers populations with lacking were predators, moved and the from same rivers was with done for predators to populations how speciation over a how you from few sh without and were b sexual were monitored predators populations and had for body maturation smaller adopting the occurred matured changed different eleven size of later; earlier . to strategies years. the Over guppy in This maximise depending rivers showed their on that time population with that chances the in had can of presence show has that occurred. rivers increased predators the occur generations rivers predators. speciation The can different the sh guppy reproduction or absence by of predators. 141 5. 10 Practice exam-style Variation This section contains SAQs selection. You accompanies can nd this on variation MCQs on and and the CD questions: natural natural c selection It that is as book. thought T. bicolor Explain given 1 a Describe the differences between the b and Explain how variation of the a NAMED genetic differs from that as seen of of 6 Outline for 2 a Explain of the continuous a of the inheritable variation advantages to crop varieties c modern which disadvantages uniform crop varieties Suggest reasons for breeds and of livestock, Barbados are State agriculture of genetically of over keeping such blackbelly growing large environment many of land. different as Jamaica sheep, for b Explain locus, loci c and can Explain for how ii examples on i the the the the natural of the Hope cattle the future effects phenotype interaction interaction inuence the of of of of a Dene b With the term syndrome, and c of problem in elsewhere alleles of at at an by one of different African the The b phenotypic variation the cell anaemia difference and cell deletion the rst iii the triplet iv the addition the a between gene of Africa and that 7 a as is a serious among are health people descended from Tiaris bicolor, the Caribbean and Colombia. Explain It in is is and related wing T. bicolor on investigated, how it is on as 142 occur to an sequence if the the SECOND base to T base pair T at the triplet changes from G do not called are change neutral substitution the gene how the to C. the amino acid coded mutations. Other types and frameshift mutations behaviour small pregnant males a you of have or described neutral. chromosomes the to length a cause of Down’s syndrome. is has a larger her He marine sh. unusual and have biological species as it brood brood the Reproduction male pouch on that its eggs sperm into onto the the tail. Larger seahorse male’s eggs in becomes pouches. A female unfertilised releases is and brood they are He keeps the developing young for a period coasts several weeks and then gives ‘birth’. Darwin’s in a Caribbean recorded possible that is small male and the a female and to island seahorse remain to populations on season. Within a together as a population a select males by size. Large females pass their to the brood pouches of large males and small presented. determine belongs mating island if the pass their eggs to small males. The selection the mates in this way is known as assortative mating. same the South American breed. mainland. the the are Very few species acid translation substitution, frameshift seahorses of population of base term females b amino in changes from A of the eggs be triplets deleted Dene females would DNA gene for Islands. how variation of is meiosis pair for population the the rst during transfers grassquit, the Galápagos Describe are mutation Explain a A a that Classify of of of base third triplet fertilised. nches to mutations ii Seahorses anaemia world throughout of Venezuela of the Down populations. black-faced bird found gene a pouch. 5 of mutations. organism. mutation. sickle parts in sequence strand produced i in sickle explain why on mutation to chromosome Explain have triplet: Mutations selection. reference may now found the organism. alleles phenotype importance an of c 4 a happens peptide beginning Describe TWO of nch genetically areas v a what the farming. 3 is template following the population CTA ATG TAC CCA ACC TAC CTA AAG DNA Outline small species such octapeptide: uniform. b a 14 birds Islands. islands. The following selection. the having importance the of To answer this question you will need to use the DNA on natural such to population the Galápagos genetic dictionary on page 67. discontinuous variation. c small in organism. control a continuous discontinuous variation phenotype how rise those variation that colonised seahorses of intermediate size survive and Module Two closely related species Hippocampus erectus same coastal length of waters 120 mm, and of of seahorse, H. zosterae Florida. H. zosterae The are found H. erectus has a mean has a in the 2 table females Genetics, summarises of these Name the type of speciation that of Habitat species exist in the same the features of selection males and Body colour of Retina in eyes males of females blue detects when shallow two natural mean length occurs and species. 20 mm. b variation geographical water blue area. light c Use the information erectus and another provided H. zosterae species of may to explain have how H. evolved from Hippocampus in the coastal deep waters d of Explain how isolated 8 sensitivity species other Gonorrhoea is a tests than remain by red detects red light bacterial are reproductively assortative Body mating. and colour vision Females with prefer select the are both males inherited that they mate disease. Antibiotic carried taken from colour features. out on samples people with and coloured males. of a bacteria water Florida. gonorrhoea i The ancestors of red and blue cichlid sh were to brown. ensure that they are treated with an appropriate State how the different body colours of the antibiotic. males a State how bacteria become resistant arose. to ii Suggest the advantages of different cichlid antibiotics. sh b Explain how antibiotic resistance is b from one bacterial cell to being able Many species of Explain why it is important to carry out tests before blue and have red evolved light. prescribing a the information provided in to lakes explain antibiotic how sensitivity detect cichlid sh others. in Africa. Use c to transmitted course speciation may have occurred in these lakes. of c Lake Victoria receives considerable pollution from which the antibiotics. the d Antibiotic resistance is a serious medical surrounding cloudier worldwide. Suggest ways in which this and reduces be a Dene The plant makes penetration water of and explain the likely blue long-term overcome. effects 9 the problem light. Suggest may area, problem the term speciation and of blue the cloudy water on the species of red cichlid sh. Euphorbia tithymaloides is found 11 throughout Central America and the Caribbean. It a Explain why body mass is an example of is continuous variation. thought that the plant spread from Central America Three in two directions – along the north via Cuba separate islands Jamaica and from the east via Trinidad. adjacent islands interbreed successfully, but in the north-east there are two do not Explain across of the world time. The mass. At different were studied researchers over collected a long data the beginning body mass of all on the showed a normal distribution and the mean interbreed. body b on populations mice that mice in St. body Croix of Populations period on populations and the signicance of mass of each population was about the same. the following At the end of the study, these results were obtained: statements. Population A i Populations on adjacent islands no change to the variation in body interbreed mass successfully. Population ii There are two populations on St Croix that B the mean fewer not Explain natural 10 Many why heritable variation is species of in Africa. Some others light cichlid sh live in that that but more with larger mice there were many much larger small mean mass mice, but mice none and with many the live in species deeper penetrate live in water. The live in water lakes. Blue shallow does the features not the original population. Draw graphs for populations A, B and C to show water wavelengths inuence light of Lake the variation in body at the mass at the beginning and of the end of study. of c sh and important for b and increased, mice selection. different Victoria small interbreed. Population C c mass do Name the type of selection that occurred to each penetrate population. far into lake water; red light penetrates much further. 143 3 Reproductive 1. 1 Asexual biology reproduction Asexual Learning outcomes reproduction organism On completion should be able of this section, you this some to: by dene the way terms without form limited random reproduction and binary ssion budding in yeast and variation of gametes. genetically amongst In new All the identical the and from individuals organisms. organisms prokaryotes individuals in a eukaryotes single formed There clone a that in may is replication be caused cells divide and replication is usually free from of DNA errors. in bacteria, number in Spirogyra in mitosis and types occurs of so that daughter chromosomes. This cells receive maintains the In genetic same stability. Aiptasia, Examples of asexual reproduction are: and Rhizopus. binary ssion budding fragmentation spore in food These bacteria are dividing and in as and Aiptasia Spirogyra in in but the circular the two in sea anemone) lamentous nigricans in (a alga) mould fungus). prokaryotes prokaryotes, some fission larger . (a bacteria shares binary grow (a Rhizopus reproduction reproduction eukaryotes known bacteria yeast Binary fission Asexual in production Asexual Figure 1.1.1 of of clone describe spore formation production fusion clone mutation. before eukaryotes, fragmentation the the asexual occurs a is as each When such similarities. a chromosome cell cell as This splits reaches bacteria, type into a of two. certain is simpler than reproduction Bacterial size it cells starts to in is absorb divide: replicates by binary ssion chromosomes separate while held on to the cell surface membrane Link Remember have a that nucleus chromosomes prokaryotes or do those two cell wall the cells see page cell membranes material is form formed across between the the middle new of the cell remain attached for a while and membranes then split apart. of Some eukaryotes, new not linear like bacteria, such as Escherichia coli , divide every 20 minutes under 32. optimum conditions. Asexual reproduction in eukaryotes Did you know? Budding Multiple ssion occurs in Y east organisms; the while malarial many tiny picked up blood divides stages a female when S tudy red parasite infective by mosquito in into that on cells are the 16 the nucleus blood. page foc us divide much by that does binary ssion smaller 144 yeast than the as not the bud parent linear remains a in size but do not divide equally in half. At a certain size: one the is cell. chromosomes begins intact to and replicate divide does not by mitosis, break up as but the shown nuclear in the membrane diagram on 79 small of swelling the bud scar Remember grow cells Anopheles it feeds in yeast some on appears daughter remains the at nuclei attached parent yeast the side enters for cell. a of the the bud while and yeast then cell to breaks form off a bud leaving a bud Module Budding in a 3 Reproductive biology Aiptasia Aiptasia is budding called sea anemone, which reproduces asexually by a form of bud pedal laceration. Small groups of cells from the base of the separates animal grow animal and feed into each small then buds. After develops a about mouth a week these surrounded separate by from tentacles so the it can itself. Fragmentation in bud Spirogyra parent yeast Spirogyra grows is on length. one the Any of many surfaces cell in of the types of ponds. chain multicellular , A can short single enlarge, lamentous chain divide by of alga cells mitosis grows to cell that in form two Figure 1.1.2 cells of and the make the laments. chain New longer . Growth laments form does when not lines happen of just weakness at the ends These yeast cells are budding. The nucleus divides and one of the daughter nuclei enters the bud before develop it breaks off. between When cells. Any conditions disturbance are perfect to for the laments growth, algae causes like them Spirogyra to break. can cover the Did you know? surfaces of owering freshwaters plants also in a thick reproduce growth by called blanket fragmentation, for weed. Many example the Rhizopus nigricans and Mexican Hat plant, K alanchoe daigremontiana grows tiny soft around its leaves. After a while these break off and fall to the rots Leave some damp in sweet damage cannot in cause potatoes. These ground. fungi Spore formation R. tritici plantlets be the potatoes so they sold. Rhizopus bread exposed to the air for 30 minutes, place in a Petri Summary questions dish of and look mould over at it the every day surface for of the the next bread. few This days. is Y ou bread will see mould, a a growth type of 1 fungus. The common bread mould, hyphae, which spread Rhizopus nigricans , has Dene the following terms: branching asexual reproduction, binary ssion, laments, or over the surface and grow into the budding, fragmentation bread. black If you pin heads. reproduction mass of look for white at the These the growth are the fungal with a hand structures body, the lens you carrying mycelium, can out see lots of 2 asexual which you can see as According theory a laments. from of Fungi exhaust their food supplies, often very quickly, so they need to spores hyphae the to colonise known as new sources as sporangiophores of each sporangiophore mitochondria haploid nuclei move from the up hyphae up into the during the cell to form a into the this cycle. happens. Describe the functions air of the sporangium sporangium and in asexual reproduction divide R. nigricans: sporangiophore, mitosis mitosis, of how of by derived number increases Describe following are prokaryotes. The follows: grow swells endosymbiosis to 3 tip the mitochondria interphase produce and spore tiny the columella – the sporangium an extension of the sporangiophore – pushes up it from the rest of the cytoplasm a forms around a group of several Suggest nuclei to form a how forms around each the you might contamination of spore stored wall spore. mycelium prevent and into 4 separating sporangium sweet potato tubers by spore R. nigricans when the spores are ready, the sporangium splits open and the spores 5 dry and are blown away in air Discuss the advantages disadvantages Fungal light; Many spores most may will be not organisms, carried land both on thousands a food prokaryote of source, and miles so as there eukaryote, they is are great produce so small and considerably in their structure so the term spore is spores. difcult such as are best thought of as microscopic, reproductive nuclei. are bodies and one or more They often dispersed, but The as some are for surviving harsh conditions and not really sea anemone, in the same way as the spores of R. nigricans. The owering plants are spores although they are not released embryo nor can into very surviving hash conditions (see page marine aquaria. quickly spread are aquaria causing harm sacs other animals. Suggest why it they spreads for is by for to of Aiptasia introduced not throughout dispersal algae. contain It always and dene. accident cytoplasm microorganisms, They to that asexual bacteria, fungi occasionally They of reproduction for wastage. 6 vary and currents. so easily. 151). 145 1.2 Asexual reproduction Many Learning outcomes owering reproduction On completion should be able of this section, individual you for to: or reproduction outline asexual reproduction in explain the vegetative role of meristems owers. spreading. as it involves vegetative growth Propagation Plants can known is produce a vegetative producing rather word new as new than growth meaning individuals by leaves, e.g. K alanchoe daigremontianum and African violet, in ionantha reproduction describe of is from: Saintpaulia involving or propagation modication This plant by asexually. plants a growth owering reproduce vegetative plants multiplication plants in flowering vegetative stems, e.g. Irish potato, Solanum tuberosum , and ginger , Zingiber propagation ofcinale in crop plants describe how to take roots, e.g. breadfruit, Artocarpus altilis , and dandelion, Taraxacum cuttings ofcinale describe the process of tissue Ginger plants have a swollen horizontal stem known as a rhizome. The culture stem describe the hormones use in propagation of main plant buds vegetative and tissue culture. has short root. at tissue, the can Eventually Link Structures nutrients Meristematic tissue consists cells that the animal page stem are divide equivalent cells as as the through over grow on grow. soil and fragment are from the on the cover into swollen unfavourable it as rhizome. These branches the will that buds leaves rhizomes survival leaf provide rhizome such for to roots from where grows spread buds several with of the year have to too referred store to rhizome plants. reserves when it is and too dry or too cold for growth. Most structures that reproduce are materials like for this. Structures, such as rhizomes, tubers and bulbs, perennation on 76. Plant The hormones growth substances types of and that development are often of called plants plant are inuenced hormones. by There growth are three main hormone. Type of plant Example Source hormone the auxin indolyl acid acetic within Effects on growth plant shoot apex stimulates (IAA) of cells cell by walls absorbs elongation ‘softening’ so stretched they when are cell water Did you know? The Gros was Michel attacked known as by variety of a fungal Panama cytokinin kinetin root apex gibberellin gibberellic roots acid young stimulates cell stimulates cell in (GA ) and leaves elongation is grown in new strain of all over (tropical race four) the Cavendish plant in the variety South-East Asia spread to are used to control the growth of crop auxin naphthaleneacetic the Caribbean for acid (NAA) is used as a rooting cuttings gibberellins are sprayed on seedless grapes in California to increase may size of each grape and increase the distance between grapes and reducing chance of disease spreading through the crop Central America. 146 plants: has and the well hormones that emerged growth stem the compound infects of Panama disease length variety, Cavendish, plantations Synthetic tropics. A and 3 the in 1950s. Another division banana disease disease a axillary ground. energy the not are meristematic The separate stored of does have rhizome. much times it There by vegetatively mitosis. They grow of hot, undifferentiated point which system adventitious Leaves kinetin is used in tissue culture to stimulate cell division. so Module Articial Cuttings are plant taken that from has plants good by removing features that are stems, worth root or leaves propagating. from This done by a stimulate a leaf across e.g. at the a point side the where shoot Joseph’s across coat, root, cuttings suitable roots soil grow stimulate just it below Coleus, e.g. meets the the and point sugar breadfruit, stem, e.g. where cane, African a leaf Artocarrpus the may or be dipped compost from the for base into the growing of the NAA all cuttings cutting and then After the a new placed while plant into a adventitious can once differentiation support genes they which Root been means are genetically which Plants that divided. are new they identical This is have are seeds do grow) of easy are composed have to the parent be to of way at most plants genetically are of plant plants two grow from are functions of that lost they are the specialised some whole the main same and of a all of the and the plants from cells shows this is not are be for triploid reproduction: establish and and plants have which gives plants are helps uniform a appearance reliable uniform harvesting supply size and which packing uniform disadvantage pests epidemic cells case. 5% The or the out cells can removed which carry condition. propagation which bananas, as thorned vegetative to during kept which genotypes. thorns the that only chimeras, different with for base cultivated 157 . propagated. viable clones for their cells genotype structures vegetative not cultivated plants the suckers only can of blackberry grow the sterile, (many varieties produce trees advantages not are shoots naturally plants Some thornless Banana therefore There of the propagation. and taken. that cuttings from growth, page thought cells needed differentiated have shoot on altilis and cuttings. 7 Did you know? rest. Growing they and stem, ofcinarum itself. Not growth violet joins Saccharum to Question Scientists Stem root cutting: refer biology can cytokinins be Reproductive Link propagation Auxins parent 3 is diseases pest or that for genetically which disease they there is a uniform have no chance crops are resistance. that all at If risk there plants with of is bleach solution the an the scalpel identical genotype will be wiped out. explant Micropropagation Many tissue commercially culture . medium or on important Small a pieces solid of plants tissue medium. The are are propagated removed media using and contain methods cultured sucrose as in a a of cells liquid source into of in explant callus grow tissue – undifferentiated energy, nutrients so the plant cells can make all the biological need and plant hormones to regulate the type of growth. At can are Aseptic of of culturing stimulated to technique plants. This implements; precautions the is used involves spores such number differentiate as are to into removed cells stems, ensure sterilising wearing of that the by increases, roots no appropriate but at using the air clothing, the divided end into many to plants cells leaves. contaminants media, ltering and be the grow beginning tissue molecules that they sterile and ruin staff masks the stock containers can and and take gloves. Summary questions 1 Suggest than by the reasons why some plants are propagated vegetatively rather seed. Figure 1.2.1 2 Explain why plant hormones are used in tissue culture. Tissue culture is used to produce large numbers of plants with commercially important features 147 1.3 Sexual reproduction Sexual Learning outcomes reproduction meiosis On completion should be able explain the of this section, you fusion term Most sexual insect structure of pollinated ower detailed and the an owers structure of an a and the anther female Each the formation of and and embryo cycle spores fusion in the are of gametes. production more of complex In owering spores than the into her maphrodite is the as male they part have of both the male ower a Figure is composed Each develop. to The of a lament transport anther are pollen stages end of of is water , composed diploid mother cells, cells . development meiosis mature pollen 1.3.1 and the four grain. make photomicrographs owering plants on the and ions, of which If you you cells Follow life page cycle of sure an anther. sucrose four pollen you pollen divide by meiosis look can see at sections form the cells tetrads in the each production of insect can nd and look at prepared of some the drawings different insect inspect sacs. cell so meiosis I meiosis II of that you parts. Then pollinated owers them carefully with a lens. tetrad four of haploid pollen cells secretion of pollen walls grains separate nuclear division (mitosis) tube generative nucleus nucleus divides pit Figure 1.3.2 later to form two male gametes exine Cross section of an anther intine showing release of mature pollen grains from the four pollen sacs 148 to is contain acids to pollen form anthers stages of slides (diploid) pollinated owers identify hand and carpel where Figure 1.3.1 Pollen grain production in a pollen sac of an anther of which pollen 81. foc us photos by female amino sacs pollen Look for the Filaments and of mother S tudy and and Link of the produced pollen at sacs. At yourself before those pollen different Remind plants 145). stamen phloem anthers. grains, grains are life The the part. stamen xylem the ovule describe the page The involves plants typical grains (see structures. the describe in gametes. Rhizopus to: reproduction occurs of in flowering or meiosis. develops grains in Module Pollen outer grains wall, There are divides have the pits by a thin exine, in the mitosis to inner made exine. form of wall, The a the intine, sporopollenin haploid generative made which nucleus nucleus is of within and cellulose tough a the tube and and a thick the base of the carpel is the ovary, which is swollen to ovules. Each ovule is attached to the inside of the pollen Pollen grain nucleus enclose ovary take one grains soil, so water and nutrients. The integuments enclose the that nucellus are lake or depths very peat it is resistant. If you samples from possible to tell or the vegetation has changed in it an receives biology Did you know? how more Reproductive waterproof. different At 3 and area over time. This is useful in a archaeology. diploid embryo haploid nuclei. mitosis to sac Three form inside the nuclei may eight embryo fuse S tudy mother of these haploid sac to cell that form a that divides degenerate nuclei. you can diploid in meiosis leaving These see by move Figure one to to form nucleus occupy 1.3.3. The four to the two divide by positions polar nucleus. foc us Degenerate here means that the nuclei do not divide again, do not function and probably break down. Degenerate is also used to describe the genetic code where it means that there are more codes than needed for 20 amino acids (see page 67). ovule nucellus stigma integuments 4 haploid cells style micropyle meiosis ovary funicle 1 ovule haploid grows embryo embryo stalk sac sac 3 of mother cell to form cell degenerate (2n) ovule divides by meiosis carpel (funicle) to form containing 4 haploid cells ovule mitosis 3 antipodal cells embryo 2 8 polar 2 which sac at nuclei, nuclei nuclei stage later fuse stage 4 nuclei stage synergid mitosis ovum Figure 1.3.3 (female gamete) mitosis The development of the embryo sac in the carpel Summary questions 1 Describe mature the embryo 2 Explain the 3 Suggest embryo 4 why possible that occur three nuclei mother is to to produce a mature pollen grain and in the owering plant life a sac. advantages of sac Palynology is events the use meiosis occurring degenerate following the meiotic division cycle. of the cell. study of pollen spores, grains to including show pollen how grains. vegetation Suggest has how changed it over Figure 1.3.4 historical time. This shows an embryo sac mother cell at the metaphase II stage of meiosis 149 1.4 Pollination Learning outcomes Self- and Pollen On completion of this section, be able dene the pollination between self- is and the different in which the which as explain in ways is which owering plants from anthers is pollen known sacs as when the anthers dehiscence. Pollen break grains open. are sac page gamete inside 164). transfer anthers of an is ovule. The rst pollen opening transferred the Fertilisation stage grains to to in from release the is gamete, internal transfer anther pollen female the to is as is in pollination, stigma. directly it which onto This the may be stigma in as self-pollination promote Self-pollination stigma how as male in cross-pollination outline the (see the simple happens released the embryo mammals cross-pollination of to: term distinguish are opening way grains you The should cross-pollination in the is the same transfer ower or of in pollen from another the ower anther on the of a same ower to a plant. cross-pollination occurs. Flowers grains Many of are the groundnut, transferred owers are Arachis directly adapted for hypogoea , from anthers do to not open and pollen stigma. cross-pollination so that pollen is Did you know? transferred The world’s titan arum, which smelliest ower is the Cross-pollination Amorphophallus titanum, grows in Indonesia. It gives one plant smell of sweat ies rotting esh as to to a is owers the stigma of on different transfer a ower of plants pollen on in from another a the plant specic anther of the way. of a same ower on species. off There the between are at least ve agents of cross-pollination as shown in the table. attract pollinators. Agent of pollination Ways in which an example is adapted for pollination wind maize, Zea mays, owers; the plant promote insect to separate release male (tassels) pollen are into and female at the the air top of to dispersal periwinkle, owers has male owers Catharanthus roseus, with pollination nectar by at the butteries base that has – long narrow adapted for have long mouthparts bird (e.g. hummingbird) false red bird cannot; water of which paradise owers, a these seagrass, into is the colour are long, Heliconia spp., can see, that is on but are insects tube-shaped owers Thalassia testudinum, water to female owers Figure 1.4.1 birds releases carried from separate pollen male owers plants Many orchid species deceive their pollinators by attracting them with scent but not having nectar as a reward. Others look like female insects, so males come and mate with them! 150 bat seabeans, pungent Mucuna spp., are smelling owers vines to that attract have bats large Module Insect pollinated owers have features that attract insect 3 Reproductive pollinators: S tudy scent brightly coloured nectar – solution provide insects visiting ower of sugars with a honey guides – ‘reward’ for petals lines on Find some owers directing to the centre pollen structure pollination. not are of insect The to an Orchids offer in in deception the by are a insect grains The deception. form of Some nectar , mimicking to source of food for are pollinators the of the the the orchid of for stigmas mate with scent. them Male insects thereby electron are attracted transferring to here. Also nd micrographs plant species that spiky are they so have a of also sticky and as if they should practise insects and S tudy sex the owers emitting and foc us an attempt your knowledge to promote Dioecy . plant avoid of has produce fruits. Dichogamy . reducing Male in sexes trees uvifera , with need Self-pollination Stamens chances protogyny Coccoloba separate owers. of and to is is trees be the page is the ready Bidens period anthers to of accept example for of a overlap are ripe the male female or trees to do not open at the Aristolochia matures and same species accepts time so Summary questions show pilosa is a species that shows pollen before protandry the Dene the following mature them. when and In the release many pollen grains dichogamous anthers are open before species releasing the there to allow self-pollination as a fail Heterostyly a species. as the is the Some style is existence plants very have short; of plants owers other with with plants of two the the dioecy, dichogamy stigma is pollen terms: in and a and self-incompatibility the Distinguish between the safe. following 10 dioecious either 2 stigmas to 155. pollination, which self- 8 impossible. carpels stigma an producing nearby cross-pollination. which open. and to Questions cross- 1 anthers meiosis self-pollination. Seagrape, that female and and to understanding ways stigmatic do pollen. variety of they on pollination that some surfaces. petals. incompatibility Flowering insect insect Others female listed Apply appropriate are the features grains. look not. the so often pollen do on anthers and owers they appearance stages adapted sticky hold but is above are surfaces projections landing owers usually pollen body. small practise food the insect’s covered pollinated stigmas self-pollinate, stick as ower The – of some the that and nd the petals foc us to pollinated biology types anthers same of ower above species within the pairs of terms: pollination and anther stigma; self- cross-pollination; stigma have and protandry and owers protogyny. with anthers insect below pollinators transfer pollen the pick stigma up as pollen the on is long. This different style parts of ensures their that bodies and 3 Describe the different which owering from ways plants in promote cross-pollination. owers with short owers with long styles styles to to owers owers with with long short styles 4 styles. Explain the advantages of cross- pollination. Self-incompatibility. pollen grains Plants germinate and also have grow on genes that stigmatic determine surfaces. whether The S gene 5 has multiple alleles (see page 102). If a pollen grain has an allele Suggest plants, is the same as one on a stigma it will not Male sterility . grains. in the This Some can nucleus be and mutations the also result genes of in result in but the mutations in failure genes mitochondria. to on Plants produce allele cannot self-pollinate so The stamens have to be breeders make use of male sterility by of plants cannot have are hybrids between existing in animals. some cabbage pollen due produce functional to a mutation that the mitochondrial activity cross-pollinated. breeding maize the anthers. Explain why varieties mitochondria that rare in chromosomes that in Plant is pollen affects mutant dioecy common germinate. 6 why that are required to varieties. produce functional 7 Explain sterility the to pollen. advantages plant of male breeders. 151 1.5 Pollination Learning outcomes to After Pollen On completion of this seed formation section, pollination grains germinate. should be able describe between A the sequence pollination fertilisation of events style and grows towards explain stigmas. tube They emerges absorb from water one of and the sucrose pores and through the into the the stigmatic tissue and then down the through the ovule. and in owering plants S tudy on pollen to: exine land you signicance of foc us double fertilisation Both describe a a the zygote plant, b an development into a mature ovule into a of word an ovary into grains and ‘germination’ seeds that you are are said to using germinate. Take it in its correct care when you use the sense. embryo seed, and The c pollen pollen tube may be attracted by molecules secreted by the style and/ a fruit. or ovule. growth Genes This of in proteins embr yo tube to cell divides the the is tube tube needed digest by an a example is the to are by of During give two in which the direction of chemicals. transcribed growth pathway. mitosis chemotropism inuenced nucleus for of the the and tube. growth haploid translated Enzymes male the are to generative gamete provide secreted by the nucleus nuclei. The tube z ygote enters the gamete suspensor ovum the micropyle nuclei nucleus diploid If there by cell is male from more different of form the one nuclei pollen of the centre is ovule same the the the the nucleus embryo ovary so nuclei and sac then pollen pollen species owers, of down the to the male fuses other form a with fuses the with triploid fertilisation different These breaks One zygote of in tube sac. double grains. the of embryo from pollinated tip diploid This than plants wind the the in nucleus. gamete different case to enter nucleus endosper m basal can and grains visited blown by they tubes by could animal the will which wind. all in be fertilised turn have form come pollinators This gives from or , in the the embr yo opportunity for much genetic variation amongst the seeds in the ovary. Double fertilisation The suspensor signicance nucleus divides embryo. before In the of by some double mitosis plants, embryo is fertilisation to give such mature. as In a is that tissue the the that legumes, cereals, such triploid surrounds the as endosperm the endosperm maize, developing is wheat used and up rice, cotyledons the endosperm grain. The sorghum remains signicance and millet, after for the us provide is embryo that most matures these of the crop staple and remains plants, foods and in rye, the in the oats, human diet. plumule After fertilisation radicle Once fertilisation embryo and the with obtains the occurred cell and sucrose This is The shoot), and more zygote ions divides cells. from efcient embryo radicle the suspensor the than continues (embryonic It by xylem root) divide and into and receiving to mitosis grows one and form or form two a an endosperm phloem water to to the through nutrients plumule cotyledons. cell Legume and fat. embryos In develop cereals the two single cotyledons cotyledon is The growth of the embryo of Shepherd’s purse, Capsella 152 water , nucellus. (embryonic Figure 1.5.1 has basal endosperm. from basal a bursa-pastoris absorbs nutrients from the endosperm. that swell thin and with is not starch, a store; protein it Module The changes internal the in to the nucellus the is fertilisation, fruit. The dries may also Seeds testa. they The out. C. Fruits An to were attached As a seed enlarges ovule now retain of a to as form and embryo the the seed ovary accommodate reabsorbs water eshy development the and fruit is is so that orange; Link or testa. a the will each or The and growing eshy biology larger , becomes become an coat the water gets Reproductive 175 you to on some pages 174 exercises compare and development of section includes help fertilisation it fruits summary that internal internal in owering plants and mammals. dry. are the the ovule integuments may released inside remains to the mammals. becomes the are inside in the example from the is pericarp pericarp away are it and bursa-pastoris breaks occur as ovule or bursa-pastoris of seed the wall attachment out. dry Capsella a fruit The seed way squashed After seeds. embryo same 3 of rest of when the ovaries of the the fruit ovule, and plant it have and breaks leaves two one a scars where open. scar – on one the When the where stigma was attached. Genetic Sexual have reproduction been where the variation meiosis that If a the gametes because in owering by meiosis. come from meiosis produces a potentially offspring ower fruit has will the will been show same plants pollen is the same parent. the grain most In nuclei and the form then variation it as is cross-pollination the the that male same gamete inbreeding. this that some the female is pollen be not of for likely all is there recessive gametes self-fertilisation will it allele, of to There and extreme homozygous little plant. fusion leads genes recessive self-pollinated very involves Self-pollination the harmful be pollination ‘shufes’ the Self-fertilisation has the from produced that nucleus. plant consequences of a high If a probability allele. all the seeds gametes grains in originated that brought Figure 1.5.2 the male nuclei could have come from several or many plants Seeds of C. bursa-pastoris and with fruits therefore All the alleles within seeds for each have some or fruit the all there same of could genes, those be but genes. a very there wide could Remember range be that a of wide when genotypes. range we of looked at S tudy the we genetics crossed of plants, two we varieties only such considered as tall and one gene dwarf with pea two plants. alleles This meant Look that in this cross all the pollen grains carry a single allele. But if many different genes the potential for variation within one fruit variation is in large. the This offspring is outbreeding which increases the tomatoes, the avocados to oranges, see that limes they each seeds have in at you and consider foc us when amount two scars. They are fruits. of generation. Link Plants have production a of gene that controls the chlorophyll. Answer Summary questions Question 1 Explain the difference between pollination effect and fertilisation. of 6 Describe the events that occur in the ovule between pollination and page inbreeding expression 2 on of this 156 on to see the the allele in the seed phenotype. dispersal. 3 Explain the signicance of the double fertilisation that occurs in owering plants. 4 State S tudy the functions of the following structures in the ovary between Before pollination and fertilisation: integuments, micropyle, pollen tube, you start generative Make a plants. table to compare Remember 5, make table a list in of answer the nucleus. features 5 your tube to Question nucleus, foc us to asexual include and sexual similarities as reproduction well as in owering differences. to to include compare. Do the features not forget as the rst column. 153 1.6 Plant reproduction The Learning outcomes tasks and knowledge On completion should be able of this section, owering you sequence the reproduction events in compare with this in owering do plants asexual use sexual your test in your with this ability sexual section to will compare reproduction help you sexual in organise your reproduction in humans. a table chapter some to show and the research 144–45 to the different ways nd in out reproduce groups which how they the of organisms reproduce. species described Y ou will mentioned need in to on sexually. reproduction reproduction Generation to and plants Make sexual pages questions to: 1 summary knowledge the time next. The (G) is dened mean as the generation length time is of time from calculated one using generation the following and formula: understanding describe and of pollination explain to the t __ G adaptations of local foc us Don’t forget that mathematics This you is an need in to your apply mathematical = time table shows the rate of of need to biology a topic and division Bacterium you example t n = number of generations n The S tudy where = species. of some species of bacteria. Number of divisions Generation in time/min 24 hours use course. Streptococcus lactis 55 Escherichia coli 72 Staphylococcus aureus 48 Mycobacterium tuberculosis 18 where your knowledge. 2 Copy each A and typical sucrose; medium amino phosphate an 3 auxin Find complete bacterium ions and out these a in for acids; and the table by calculating the generation time for minutes. tissue culture vitamins; trace contains nitrate quantities of ions, iron the following potassium ions and components: ions, copper ions; cytokinin. why the components components and are explain necessary. why they are Make a table required by to the show plant cells. 4 Find out how pollinator(s) their Yucca, Present you Crotalaria, tuberosa , your start making your for Question of 6, make asexual reproduction. You spider diagram Find to knowledge 154 pollinated, adaptations Aristolochia, Bougainvillea , ndings as photomicrographs or a and list of the sequence. sexual might other also make and the Y ou can help of that list they their have main for a poster Cocos nucifera , Euphorbia attracting or other Melicocca pulcherimma , form of bijuga , Ipomoea presentation. topic. the of pollen Annotate photographs formation the and and photographs of pollen arrange embryo with grains and them in sac the information embryo correct about meiosis sacs. a use these photographs and notes to help with your graphic organise this Print development matching organiser the are table formation. features describe owers foc us 5 Before and following pollinators: Ruellia S tudy the them together . your 6 Make table to compare reproduction a in plants, asexual animals reproduction and with sexual microorganisms. revision by Module This 7 is Put you a list of these – it events events is in occur the during correct sexual sequence for reproduction a plant that in owering shows plants protandry. The Letter Event during A cell B ovum, synergids C pollen tube D two E male F pollinator G pollen grain ripens H pollen tube of I generative J tip zygote forms K male endosperm L pollen ower bud pollen insect 3 of 4 reproduction opens cell pollinator divides by meiosis visits ower grains form cells pollen degenerate nucleus generative pollen and sacs dehiscence embryo sac understand plants sexual mother pollen and (A to Reproductive biology X) rst one has been done for A. Event during T o that 3 divides tube by mitosis nuclei form anther mother cell divides by meiosis nucleus forms some animals. of the Now genetics that you that have was in covered Module Module 2, 3 you you divides nuclei by and reaches move to deposits tube to M cells form N micropyle centre with of O embryo sac P ovum pollen on Q stigma R is S divides breaks nucleus fuses apply times antipodal through nucleus pollen needed three Letter germinates grows grain reproduction mitosis nucleus fuses of can sexual with know by T mitosis U open polar compatible the style V nuclei with something knowledge W stigma about from X reproduction this module in to genetics. Self-incompatibility present The in table the is pollen shows determined mother possible by multiple alleles at the S locus. Pollen grains express one of the two alleles cell. pairings between plants with ve different genotypes. A minus sign indicates that no 1 fertilisations are possible. In the others, either half ) ( or all of the pollen is capable of germinating, growing 2 pollen tubes and fertilising the ovules. 1 8 Copy and complete the table by writing ‘ ’ or ‘all’ where appropriate. 2 Genotype of male parent Genotype of female s1s2 s1s2 parent s1s3 s2s3 s2s4 – s1s3 – s2s3 – s2s4 – s3s4 9 Explain 10 Use the s3s4 – why some results in pollen your grains table to can germinate explain the and fertilise advantage of ovules, but others cannot. self-incompatibility. 155 1.7 Practice Plant 1 a With reference TWO b natural Explain Discuss and the growing Irish named areas potatoes asexual describe 5 a reproduction. propagation is used and and with disadvantages crops, sweet such potatoes, as in of by vegetative the i pollination ii ovule and iii ovule and female that Some species, Mexico, have pollinated by such as the following and fertilisation; iv seed ovary; gamete; and fruit. Describe TWO methods to ensure that cross- reproduction. Salvia roemeriana some flowers insect between are pollination 2 differences ginger, b produced Explain pairs: horticulture. advantages large questions: reproduction examples, of why vegetative agriculture c to methods exam-style that pollinators open and from and c are others cross- that Suggest occurs. how inbreeding you on a would species investigate of garden the effects of plant. never 6 The pickerelweed, Pontederia cordata, is an aquatic open. plant a Discuss the benefits of having two types that ponds on the same lives and tropics but has including been originates from introduced the Caribbean. It throughout has the brightly coloured flowers. b Describe THREE ways in such which insect c The plants, apart from flower as the periwinkle, on the of colour, collected from was of C. roseus is the continued for the crosses the table. In each genotype of the Cross number During an wild two albino investigation in an cell, d chromosomes ovule each of is nucellar 16. State the following cells as have and cross-pollinated. This generations. Among seedlings case to each of were the parental appeared as researchers some reported deduced of in the plants. Genotype Number of observed plants the albino cells endosperm integument plants, 1 Aa × AA 149 0 2 Aa × Aa 70 22 3 Aa × Aa 65 28 4 AA 109 0 cell. such internal named contribution parent zygote, cell, in flowering described the percentage female cell, why fertilisation C. roseus, For in after fertilisation: antipodal Explain as e of of species plants green number edges this attract pollinators. diploid water seedlings plant. periwinkle, Catharanthus roseus, Madagascar shallow lakes. Albino been found. The in of flower in c, the state male the parent nucleus following and × Aa cross- fertilisation. a 3 a Compare structure b Outline be c the of the achieved Explain plant, than why such the a Make a a mature ways in of the as which seeds a pollen grain with the may sac. cross-pollination may a show natural outbreeding more variation inbreeder, such drawing of a cross section as of the an anther. b Describe pollen c the mother changes a flowering production 156 pollen cells give rise to grains. Describe of how of plant a that occur in the ovule between fertilisation mature seed. the Explain c genetic why with it is these Discuss THREE researchers the and results diagrams not deduced of to possible each help to pickerelweed ways between flowering Arachis hypogoea labelled b use cross natural how genotypes from plants. of Zea mays, of a embryo in flowering seeds groundnut 4 structure Explain in which plants is the cross. your carry (You answers.) out a test plants. cross-fertilisation promoted. Module 7 Callus tissue is undifferentiated tissue explants culture of plant medium. An tissue are placed investigation was into into the effects of plant callus tissue was on tobacco, prepared from Nicotiana tabacum, and is media containing different and unlikely cultured that there plant hormones, the auxin concentrations IAA and kinetin, results are shown topics from the exam, other but modules. you should are many connections between be topics Learning about owering plant and in human It is much is useful easier to background genetically knowledge for modify cells in Module tissue below. Concentration of plant in of culture Treatment about a 2. cytokinin. The ask happen on reproduction two 8 to leaves Biology. solid 6 callus aware of foc us carried hormones This tissue. The biology a Questions out Reproductive which forms S tudy when 3 Effect of hormones/ than to modify advantage of tissue section genetically whole culture plants, which so you this can is an learn in the plant on modied organisms. hormones on –3 mg dm growth of callus 9 a Describe the changes that occur to the carpel of a tissue flowering IAA kinetin 2.00 0.00 b 1 little or no in c 2.00 0.02 growth of different The 0.20 increased of callus both by no 10 differentiation conditions world’s climates that 0.50 growth of 5 0.00 0.20 little or in reproduction be successful wild flowering may be and strategies plants. of global changing. Outline climate change for self-pollinate. The diagram flowering shows the growth plant Shepherd’s pastoris. The fruits 2.00 can growth with 4 asexual seed consequences plants 2.00 after fertilisation. roots the 3 how reproduction growth 2 Explain plant of this of purse, species an embryo of the Capsella bursa- are non-fleshy and shoots each contains several seeds. A no growth B a State THREE ensure valid the b precautions that comparisons can should be be made taken to between treatments. Summarise the the of growth C effects callus of of the plant hormones on N. tabacum D c Explain be how used to small quantities produce large of callus numbers of tissue can plantlets of N. tabacum d Make THREE described 8 Tissue One culture plant b is a method the of carrying meristems from Describe of the investigation Name b Explain artificial out shoot appearance tissue tips of propagation. culture and cells is culture to c them. Suggest the structures why the taken from a d an advantage of using meristems in B, C and D. plants, described as Explain how and such of embryos in C. bursa-pastoris, is internal. the developing nutrients Describe the as develops. a fruit as changes it embryo receives the requires. that occur in the ovary wall plant 11 a Explain the differences between the following: culture. Outline TWO advantages disadvantages ornamental of and using crop i protandry and Suggest how raising technique to ii self-incompatibility iii self-fertilisation it easy to and male sterility produce and cross-fertilisation. plants. plants in tissue genetically occurs in the life cycle of culture flowering makes protogyny and TWO this Double fertilisation d labelled A, development flowering energy meristem. tissue c a as above. technique for remove a criticisms engineer plants. plants. b c Make a labelled diagram of fertilisation. Indicate structures will fuse Explain that the significance of on a carpel your together of at the diagram time the at fertilisation. double fertilisation. 157 3 Reproductive 2. 1 Female biology reproductive In Learning outcomes common internal On completion should be able of this section, organs to: cycle describe the structure of of the year . mammals occurs on mammals Unlike The is other cycle known average once we of as a have internal mammals changes the human that oestrus month and occurs cycle. is fertilisation In known females in the the are fertile reproductive female as and humans this menstr ual the cycle. human female other development. throughout you with system (The word menstrual is derived from a Greek word for moon and reproductive the Latin word for month.) The female system is coordinated so that the system activities state the functions of the uterus, cervix functions produce transfer the foc us several different most the important Organ Structure ovaries pair of ovaries outer situated germinal cortex oviducts muscular tubes (Fallopian epithelium tubes) tissue uterus inner a site the gametes gametes for (secondary from internal months – lining either table and is and system are to: the oocytes) ovaries to in the the ovaries site of fertilisation in of development the gestation of the period embryo between and then foetus fertilisation and hormones, from oestrogens and progesterone , which are cholesterol. outlines the structure and functions of each organ labelled in 2.1.1. the of uterus medulla lined with ciliated – to endometrium blood – feathery uterus – rich in vessels layer uterus vagina; side lead from mbriae muscular of female produced epithelium surrounding ovary glands from reproductive Functions surrounding neck female is Figure cervix the female nine secrete The outer synchronised. oestrogen oestradiol. with of female steroids hormones. The are birth are uter us oviduct provide for There and and vagina. S tudy ovaries ovaries, The oviducts, of is that consists produces secretes oestrogens, the secondary secretes progesterone transports site transports endometrium myometrium oocytes e.g. secondary oestradiol oocytes to uterus of fertilisation embryo is to site uterus of development contracts during of embryo/foetus birth myometrium separates of ring of uterus muscle secretes cervix mucus appears – consistency to be closed changes except during around each time month of ovulation circular muscle at base of uterus retains contents during pregnancy plug of antibacterial mucus during pregnancy reduces infection vagina muscular tube with folded inner lining muscle epithelium bacteria (pH vulva 158 external genitalia including clitoris and labia 3.8 site of birth many relaxes during secretes produce – 4.5) to birth acid prevent of cervix dilates mucus lactic deposition so to provide growth semen of during acidic other environment microorganisms intercourse canal sensory receptors for arousal during intercourse Module 3 Reproductive endometrium oviduct S tudy This foc us photomicrograph ovary funnel biology at one stage cycle. Search for other stages, of shows the images the menstrual that show of or look for diagrams oviduct that show all the stages. uterus ovary myometrium cervical canal cervix vagina vulva Figure 2.1.1 The human female reproductive system. The structures labelled are primary sexual characteristics and their functions are described in the table. Y ou may through in slides cycle. have the with Y ou to make ovary of a a diagrams will not After ovulation form the see the drawing small as they these cells of from a mammal. often when the prepared Beware show you all look Graafian of slide the at a follicle of a section comparing stages of what the you see ovarian slide. that remain in the ovary Figure 2.1.2 corpus A photomicrograph of an luteum. ovary showing a Graafian follicle The table shows the functions of the regions of the ovary. Summary questions Region Functions 1 Outline in germinal cells lining outside of ovary divide by mitosis (before the the to form cortex outer oogonia region surrounded contains by follicle secondary oocyte primary follicles develops within outer layer is the theca that ovary, 2 and Find diagram a fluid lled antrum creates uterus, the vagina. or changes diagrams that that occur the Graaan follicle secretes the pressure ovary during the oestradiol ovarian oviduct, cervix within follicle the following cells show Graaan of reproductive birth) system: epithelium roles human to burst follicle cycle. Make a series of at simple diagrams of the ovary ovulation to show during stroma forms theca of a contains connective tissue and blood occur show the diagrams development a follicle, ovulation and the vessels: supply nutrients to developing follicles oestrogen and take oestradiol from away progesterone progesterone from corpus secretes and and oestradiol development and degeneration of luteum. cholesterol for the corpus synthesis theca and oestradiol and 3 luteum Explain what happens development 4 corpus cycle. Your that vessels of blood changes maturing follicles should the Describe the of in the the follicle. structure of: i an progesterone ovary; ii the uterus. Outline the luteum functions in The primary follicles complement of reproductive life. how many develop follicles there If you are that before will answer and what birth, last a at woman Question happens so 10 to the on the birth there length page 177 number is of each the different tissues organ. full 5 her you over a of will time. see Explain why synchronise ovary with it is the important changes changes in in the to the uterus. 159 2.2 Male reproductive The Learning outcomes On completion of this section, functions produce of very be able describe the structure of large state male reproductive the functions epididymis, prostate vas gland, of the system testes, deferens, seminal cells produce numbers of male system are gametes to: (singular spermatozoon), but which which are we known will call as sperm for or short a liquid medium, semen, for the delivery of sperm into the vagina secrete from the male hormone, testosterone, which is a steroid produced cholesterol. vesicles, The penis, reproductive the human male to: sperm the you spermatozoa should system production of sperm cells does not involve the synchronisation of urethra. two organs process in as the throughout The table in testes female. so that reproductive outlines reproductive the Instead there millions is upon the control millions of of the sperm production are available life. structure and functions of the organs of the male system. Organ Functions testis (plural the testes) epididymis produces secretes collects fluid scrotum to the male sperm from stores sperm site maturation sac containing cavity inside seminiferous concentrate of gametes seminiferous tubules testosterone where of the tubules and reabsorbs them sperm testes below temperature is the 2–3 °C abdominal cooler than body temperature vas deferens muscular tube that moves sperm peristalsis by during intercourse Cowper’s gland secretes fluid urethra prostate gland contributes that seminal activate secretes lubricates, and during semen seminal fluid that secretes fructose seminal fluid protect and neutralises secreting mucus and chemicals is as part surround to provide alkaline to of the semen that surface energy for neutralise of contains sperm motility contents of of sperm vagina sperm urethra contractile glans lls inserted sensory with by cleans ejaculation sperm to 160 to glycoproteins vesicle (penis) that before tube blood into that to become vagina receptors moves at during the semen through the penis erect intercourse tip for arousal during intercourse Module pubic 3 Reproductive biology bladder bone urethra seminal vesicle shaft S tudy foc us rectum Search for photomicrographs, glans electron prostate gland foreskin of micrographs seminiferous different stages and tubules of drawings to see the spermatogenesis anus urethral epididymis opening Cowper’s scrotum testis vas (testicle) Figure 2.2.1 and the you with Question Sertoli cells. These will help 2. gland deferens (sperm duct) The human male reproductive system. The functions of the primary sexual characteristics are described in the table. Y ou may through The have the table to make testis shows of the a a drawing small from a prepared slide of a section mammal. functions of the regions that are in the testis. Figure 2.2.2 Region Functions tunica outer A photomicrograph of a testis showing seminiferous tubules layer of connective tissue Summary questions albuginea 1 seminiferous site of sperm Outline in tubules of the site meiosis of differentiation of diploid cells to form haploid the human haploid cells to form the following testis, connect together to form a epididymis, sperm scrotum, tubules of reproductive cells system: roles production duct into vas deferens, seminal the vesicle, prostate gland, urethra epididymis and germinal (lining cells divide puberty epithelium by mitosis throughout to form spermatogonia reproductive – from 2 life Make of of penis. a a drawing showing seminiferous cell, tubules) interstitial cells secrete of seminiferous a sector tubule the following: spermatogonia, Sertoli primary spermatocytes, secondary spermatocytes, spermatids and testosterone spermatozoa. blood vessels provide other cholesterol for nutrients for remove testosterone sperm testosterone to synthesis 3 and production distribute around the body Suggest the of the into the cells testes do are scrotum the heat not held ow scrotum loss develop within to from close blood the properly the at body scrotum. together owing so heat back temperature Blood vessels transfers into the which owing from in blood abdomen. This is why and out owing reduces 4 nutrients the sperm Explain think Sperm the required for cells. each Explain nutrient why and temperature kept several of that are production why is how the you required. the testes degrees of is below body temperature. scrotum. 161 2.3 Gametogenesis Gametogenesis Learning outcomes humans, On completion of this section, be able dene the terms spermatogenesis the human is to describe gametogenesis, number and and oogenesis 84 does we the process spermatogenesis to to the process produce between occurs a of the oogenesis the cycle that gametes each involves are are produced. In meiosis. produced increase generation when concerned of is by diploid gametes with production division in the oocytes ovum. the oocyte give differentiate difference secondary to The as well. the fuse details meiosis human and at of gametes the and are haploid. chromosome fertilisation. the nuclear we Sper matogenesis seminiferous and four into haploid mature nucleus cytoplasm eventually nucleus this gametes are On pages division. concerned 82 When is the with production of the sperm produce secondary understand an which tubules. Here the cytoplasm divides sperm equally discuss by of that not were cytoplasmic mature vertebrates, life ensure considering all process to: This in the you In should as is and very sperm divides divides become cells in all little ovum the cells. the unequally. the of size. Oogenesis same This and same way as results three tiny is in in the cells then production of spermatogenesis, one cells These large that cell each that an but may contains a cytoplasm. ovum explain are how adapted the to human gametes spermatogonium oogonium their functions. 2n division 2n 2n by Link division mitosis by 2n When answering Question 3 2n 2n mitosis 2n make cell 2n sure you include similarities division and 2n 2n growth fertilisation nuclear 2n in differences in stimulates primary cytoplasmic meiosis division. primary II oocyte 2n spermatocyte to occur meiosis I meiosis I secondary secondary n first oocyte polar n body meiosis meiosis spermatocytes II II n second polar n n n spermatids body ovum Figure 2.3.1 Oogenesis. Note metamorphosis the unequal division of sperm cytoplasm. Figure 2.3.2 cells Spermatogenesis. Note the equal division of the cytoplasm to give four haploid sperm cells. One sperm cell is enlarged to show its structure. Spermatogenesis about three About begins three Both The cells show functions deliver a the of principle the haploid sperm of are nucleus, structure a related the to to at of to the female a girl, set of restore increase stimulate determine 162 the diploid genetic is the not in from a process the testis each completed and takes spermatogonium. day. until half Oogenesis way functions of an oocyte are to: paternal provide a haploid nucleus with a set of gamete chromosomes number increase provide genetic variation variation meiosis the completed sperm start but maternal is function. The a It mature cycle. chromosomes, puberty. produce spermatogonia birth menstrual to: with million before through begins months II in gender the of secondary the next oocyte generation. energy supply for developing embryo. Module Feature Human linear length dimension overall structure head sperm = nucleus haploid and cell membrane using (23) – very – nucleus), to mid piece movement reduce highly the condensed and oocyte reduce of to the some DNA cell very haploid biology 140 µm and follicle of flagellum mass = Reproductive secondary oocyte spherical mitochondria), flagellum complementary pellucida little and contains to glycoproteins cytoplasm and lashing histones zona width (acrosome (axial lament swims Human 60 µm piece motility cell 3 surrounded by zona pellucida cells limited motility (23) sperm. proteins on microvilli to absorb nutrients; membrane size contains organelles such as RER, SER, Golgi, mitochondria energy store very little from acrosome present and mitochondria most – energy provide one contains spirally enzymes, digesting around energy for below flagellum provided by fructose lipid droplets in cytoplasm vesicle proteases for arranged centriole – seminal e.g. hyaluronidase pathway to absent oocyte axial lament, to many swimming nucleus – forms and forms mitochondria development the centrioles microtubules of of none – to provide energy for after fertilisation centrioles breakdown during oogenesis zygote Secondary oocyte S tudy The oocyte is moved does not with motility. have energy for energy stores any cytoplasm. oviduct within cell comes the all Secondary the secondary from oocyte also needs lipids cell and proteins membranes that form. for These endometrium to the make many sustain and the absorbs oocyte oocyte or as ovum? The it the completion of the tiny polar second has meiosis not cell that completed II followed body and the Cell surface the released from meiosis. an ovum. The also forms ovum even though it has the sperm until from it has the implanted mother ’s Cortical granules are has pronucleus inside in Smooth formed released proteins to absorb lysosomes at endoplasmic after that bind to proteins on Dene the terms nutrients from the made by the Golgi follicle body and Rough fertilisation Explain the role reticulum to make lipids for new 3 membrane Make a table oogenesis reticulum to make proteins required Mitochondria Lipid using First provide are an mRNA produced by transcription body is energy for processes that occur after well a as Make of fertilisation. a energy contains a one very to of Zona again by the small pellucida meiosis is a include Follicle cells form large, sperm labelled cell and diagrams a oocyte. haploid nuclei formed during meiosis Explain quantity of cytoplasm. It how human sperm I secondary oocytes are sometimes their functions. II. region the similarities differences. of glycoprotein secreted by follicle cells. 5 Explain how provides for compare spermatogenesis. adapted for divides humans. reserve. and which in before b polar in to and secondary droplets meiosis immediately 4 of fertilisation. ovulation. oogenesis contain as after and cells. fertilisation. endoplasmic gametogenesis, sperm Remember called it. Summary question the gametogenesis substances to form is blood. 2 a cells embryo microvilli cell is stimulates cytokinesis spermatogenesis cells; ovary Fertilisation unequal larger the new new nutrients membrane by much 1 is supplies an of foc us so involved fertilisation division The the structures After cell along corona gametogenesis genetic variation radiata. amongst the next generation. 163 2.4 Fertilisation The Learning outcomes On completion should be able of this and section, you Graafian of with release the occurs state where fertilisation describe the process of the the about swells liquid of and inside the oocyte the development increases oocyte and time protrudes and follicle of and some cells ovulation from this the side causes surrounding is ovulation. then there is a of the the follicle follicle If ovary. sexual chance to cells. The burst This intercourse that fertilisation occurs will follicle pressure release to: early of occur . releases This an period oocyte of time during is each the fertile menstrual period . Usually one ovary cycle. fertilisation During describe the early The of the stimulation state where implantation occurs each seminal sperm of the male the penis inserts his results in penis into the contraction of woman’s the vas vagina. deferens embryo from intercourse development explain the process testis vesicle to form so sperm and the semen. are moved prostate By by gland further peristalsis release to uids contractions the the urethra. that mix semen is The with the moved along of the urethra, through the penis and into the vagina. implantation The explain the biological vagina tends of is a hostile environment for sperm. The pH is low and this principles to kill sperm. The semen coagulates immediately after ejaculation contraception. and then together liquefies through oviduct help ovarian end the of 5 to the 20 sperm an minutes cervix. on their oviduct. later . They Contractions way During of towards the collect the fertile as cervix, the site period a of the mass uterus and move and fertilisation cervical at the mucus Did you know? forms Oocytes survive for about channels after survive for ovulation; up to 48 sperm hours cells cells through after oviduct ejaculation. hours to of a produce day. One over 100 ejaculation million sperm to 300 million sperm ions occur sperm to fertilise an capacitation . to the that the swim through. the surface removal The cell increase of oocyte As of the they the pass they sperm. also motility This help been the takes from become and have through glycoproteins membranes their until the more the uterus about and seven outer permeable release of acrosome. enter Sperm the cells oviducts cluster and around some the will enter the oviduct with an oocyte. Fertilisation contact with follicle cells, sperm cells are stimulated to release the sperm. All enzymes those of contains On 150 of sperm. from sperm oocyte. able involves the calcium Some not process changes enzymes Did you know? are the and surface Men groups 12–24 Sperm hours which to fertilise in the acrosomes. This is known as the acrosome reaction . one female The acrosome swells and enzymes are released. These enzymes digest a gamete! pathway oocyte. two digests cells cytoplasm. cortical make which the fuse This follicle is it the The through the digests proteins and cells whole cell impenetrable entry of the any cell zona sperm of the surface to the triggers contents the to hyaluronic in immediately reaction. exocytosis and the Hyaluronidase protease the through other more surface acid between pellucida. cell is to This lift of the cells and membranes into the the oocyte vesicles membrane sperm. in follicle The taken changes cortical membrane are the oocyte with the released zona prevents of by pellucida polysper my sperm. Did you know? Fertilisation Sperm by mitochondria proteins the in the embryo for consequence embryo oocyte. are are targeted cytoplasm of destruction. As all mitochondria derived from The the a in those oocyte second in the becoming nuclear The less of the the final divides body (see nucleus tightly membranes chromosomes mitosis 164 polar pronucleus. the triggers nucleus from the assemble new page coiled. of division and the meiosis the The sperm forms pronuclei the cell of of 162). This two on diploid one the in male plate zygote. secondary is extruded nucleus enlarges break the nuclei other the equatorial – new with the the and form female chromatin pronucleus . down at is oocyte. to The the metaphase of the first Module The zygote nuclei form divides divide a four-celled hollow ball Further into again of by embryo. cells, growth two cells mitosis This known occurs as with to and a form the two -celled cells continues blastula. the a two until Each formation embryo. divide the cell by embryo is The two cytokinesis called an inner into the the cell mass embryo foetus, that and grows then The a blastomere. is of: an trophoblast detected before into outer layer trophoblast and of cells that forming later the forms in to nine days endometrium. of the when after The of ovulation cells of the into nutrients, into the blastocyst trophoblast embeds form into the extensions lining from of the endometrium to increase the foc us the the surface methods described small water blood and oxygen. spaces or These lacunae are in trophoblastic the contraception the literally summarised in the Type of means of preventing oocytes by conception. sperm. The other prevent methods villi Contraception fertilisation are that prevent an endometrium. such preventing here area embryo Contraception even the of protrude – menstruation placenta. blastocyst absorption which tests which occur. fertilisation. There for hCG a The surface secretes pregnancy time S tudy Six biology Did you know? should Reproductive to becomes a 3 This biological as implanting the in the uterus, ‘morning-after pill’ and coil. involves principles are table. Biological principle Method Efficiency* contraception Sterilisation vasectomy no sperm in semen each vas sperm tubal ligation no oocyte in oviduct deferens cannot oviducts cannot are pass is cut and pass from cut and along tied testis tied so so to 0 urethra oocytes 0 oviducts Barrier condom (sheath) sperm do not vagina during enter condom intercourse entry femidom femidom entry diaphragm/cap sperm cervix Contraceptive no do not during enter Number prevent the by of pregnancies pills ovulation. combined negative cycle is diaphragm ovulation the surge per are pill, reduce are which to penis ovulation chances before into vagina before is placed over entry to pill pills women from per types contains inhibit that (also contain oestrogens of one to or both prevent and contraceptive oestrogen secretion known causes sperm ovarian 0–2 ovulation of and progestins progestins; GnRH, FSH to pill: and these the act Summary questions mid enter a as the ‘mini thickening the pill’); of this cervical pills taken to are taken allow for 20 days menstruation and to then may mucus skin hormones and may are also also be terms: implantation, and sterilisation. uterus. for five days no hormones Explain cell are what during happens to a sperm capacitation. occur . delivered injected the following contraception to 3 The Dene fertilisation, 2 The 3–15 year synthetic several also 3 cervix 1 but 3 penis LH progestin- only prevent made There feedback of 100 over placed the hormones Contraceptive of placed vagina intercourse pills * is into as into a skin muscle patch, for an slow implant under the Describe the events that occur at fertilisation. release. 165 2.5 Internal development The Learning outcomes zygote moves On completion should be able describe of this section, structure of along the endometrium. you to: the divides some of these born. These many oviduct The times into embryo form tissues to the form uterus. continues that extra-embryonic a will to not tissues multicellular This implants divide be form embryo to part the into produce of the it the new baby trophoblast as cells when at the it and is start of the pregnancy and later form part of the placenta. placenta The explain the functions of extra-embryonic tissues develop into the placenta and the amnion. the Sometimes they are called extra-embryonic membranes, but do not think placenta they describe the functions of are cell membranes, they are layers of cells. the amnion. The The placenta placenta tissue. S tudy foc us The sinuses are chorion The developing human is known as can be until such time seen. At the as the organs point when it and is recognisably one as formed of in the from blood origin, in all foetal the the other extra-embryonic tissue sinuses and and tissues tissues and from the are maternal cells lining foetal. this grows these The of chorionic substances between villi which maternal increase and foetal the surface blood area to form for the exchange systems. has human it blood ows into the placenta from the uterine artery . This is is oxygenated known organ maternal folded Maternal organs an an highly embryo is is endometrium, blood rich in nutrients. The blood ows into blood ‘lakes’ or a foetus. sinuses which placenta in bathe the the uterine villi. Deoxygenated blood ows away from the vein Link Foetal blood The placenta is an organ, for blood to look back to page answer Question 1 the heart arteries along branch the to aorta take into this arteries which deoxygenated carry blood the umbilical in the villi cord and to the placenta. returns as The blood ows oxygenated blood in a through vein that ows opposite. through a small sending oxygenated from Here 34, capillaries then ows legs. more through information the the umbilical volume all the of cord blood blood and ows from the then returns through right the blood foetal ventricle as to the lungs it will foetal as there not be heart. is no Only point oxygenated. blood The foetus mother . has a Without different genotype a separating barrier from the the two, amniotic fluid the mother ’s immune system would reject the placenta foetus. many The pathogens Maternal blood blood pressure. foetal blood Pathogens, uterus placenta worms, the are and in If the too chorionic as barrier uterine to but blood artery entered they to cells, proteins. the would bacteria, large villi, a some this vessels such is some a high burst. some cross has delicate the viruses and epithelium viruses are able of to amnion cross. umbilical Many antibodies that circulate maternal deoxygenated cannot blood cross. If are very they did large molecules likely a cross some that would to do serious cells. There cross the are damage some placenta to to smaller give the foetal red antibodies foetus be to vein umbilical arteries The structure of the placenta showing: a detail of the placental villi; b the umbilical cord with its three blood vessels; c a cross section of the umbilical cord diseases that the mother has blood that immunity c umbilical 166 the b blood Figure 2.5.1 in cord had. Module Exchange of 3 Reproductive gases S tudy Foetal and in red two the blood cells γ-globins. maternal contain This red a binds blood form of oxygen cells, so haemoglobin more readily encouraging with than the two the haemoglobin diffusion the placenta, blood. Carbon down the concentration gradient into of the foc us α-globins The placenta has four separation of in the maternal blood Absorption of Glucose is placenta foetus. soluble acids blood so vitamins vitamins are so it by glycogen Amino maternal in higher concentration diffuses in the in opposite the foetal blood facilitated and are they are much in a are also probably to absorbed transfer direction. exchange of into them blood diffusion. is used higher absorbed. by by active Fats glucose respiration concentration absorbed absorbed in Some and in by fatty foetal acids (see in placenta blood Ions and page stored the transport. pinocytosis is secretion of metabolism blood has absorbed. vesicles into a across lower W ater foetal blood which foetal foetal kidneys the amniotic the transport and foetal blood fat 39). and than and them across the the start potential move from higher to hormones and energy storage. in water soluble Antibodies epithelial foc us cells blood. epithelial water will has between the Nilsson photographer moves substances maternal Lennart W ater systems than S tudy are and foetal nutrients absorbed as is maternal foetal circulatory dioxide roles: oxygen across biology than foetal water function membrane osmosis. maternal blood potential. and by urine to blood is about produced the then maternal After If 11 if is will be the weeks that a Swedish has specialised in foetal water blood is who human development. photos online. Search for his the released into cavity. Link The foetal placenta; bilayers metabolism urea of and the produces bile carbon pigments capillary and also epithelial dioxide diffuse cells which through into the diffuses the across the phospholipid maternal Read blood. pages yourself 38 about to The remind across membranes the placental in villi the have amnion carrier The of to exchanges membranes. Cell epithelium 39 amnion also forms from extra-embryonic tissues to surround proteins for facilitated the diffusion foetus. It is a thin, but tough sheet of tissue that is transparent; cells secretes a uid that has much the same composition as tissue uid. contain fluid providing a affected plasma by fills sterile the mechanical but with amniotic environment lower damage. protein cavity and a The that surrounds cushion uid content. is The for the derived uid the so it is maternal provides transport. The mitochondria energy for active to transport. foetus foetus from active many This provide amniotic and it a not blood constant Summary questions temperature exposed to for the foetus, extremes of which is especially important if the mother is temperature. 1 Explain: organ, The foetus is able to move about within the amniotic uid which development of the skeletal and muscular systems. The tough some and of the liquid impermeable through until the about 20 skin which weeks. The does not foetus uid which helps development of the swallowing passes through the foetal gut and is absorbed; some placenta the is an placenta as as a gas an exchange excretory surface organ. the reex. Explain of it is how the placenta The is liquid the how become drinks 2 amniotic ii foetus and absorbs why helps acts the i and; adapted for exchange of then substances. urinated into movements. for its the amniotic uid. The amniotic cavity independent life as a baby The and after foetus its also uid starts help to breathing prepare the foetus 3 Describe blood birth. heart The amnion breaks during the early stage of in to the pathway taken the foetus from the placenta by the and back. birth. 4 Describe 5 Explain the two the foetus roles ways may composition of of in the which change the amnion. the amniotic fluid. 167 2.6 Hormonal control The Learning outcomes production hormones On completion should be able of this section, you produced or to: breast female dene the name the term explain how sperm control feeding a continuous spermatogenesis intervals and reproductive is of about not on a the systems are is month ‘pill’. process also in so secretion continuous. women The the who changes Oocytes are that of not occur are pregnant in the cyclic. in A hor mone It is is a signalling molecule secreted by an endocrine organ. regulate transported in the blood and inuences the activity of target tissues humans and/or of reproduction hormone hormones that reproduction to at of hormones organs. The hormones that control the activity of the reproductive regulate organs are: gametogenesis describe the role of hormones gonadotrophin hypothalamus the control of the releasing hor mone (GnRH) released by the in with the anterior pituitary gland as the target organ; menstrual it is a decapeptide with 10 amino acids cycle state the role of gonadotrophic in hormonal control of describe the secreting role of the females in their the Figure are activity gonadal the gonads (FSH) interaction and – the testes luteinising and ovaries; hor mone follicle (LH) are between the hormones is complex as you can for GnRH, LH and FSH on the cell membranes of cells. gonadotrophic hor mones secrete the growth ovaries and are steroids oestrogens and released by cells progesterone; the in the testes gonads: the secrete means of the They stimulate gametogenesis, the development of gonads primary the gland 2.6.1. testosterone. – of hor mone receptors target ovaries term pituitary foc us stimulating anterior hormones. There The the placenta see S tudy by glycoproteins. In in the stimulating reproduction released negative inuence feedback hor mones and secondary sexual characteristics, and in females testes. coordinate interacting the activities with transcription of of receptors ovary inside and cells uterus. and They function ‘switching on’ by the genes. Link Cells in have receptors to 73 for testosterone S tudy and detect organs hormones. information on the enomroh page tissues receptor. noitartnecnoc See target oestradiol progesterone foc us 0 14 28 time/days The changes uterus must uterus ovary synchronised ready to receive if fertilisation S tudy and the so that the enomroh embryo be is the occurs. noitartnecnoc the in LH FSH foc us 0 Follow the changes in of the four hormones on these 14 graphs. Figure 2.6.1 This graph shows the changes in the concentration of FSH, LH, oestradiol and progesterone in the blood of a woman during a menstrual cycle 168 28 concentrations Module Before puberty these concentrations. secreted by the concentrations the The gonads of concentration secretion The of table hormones cells in and GnRH. in the the Hormone secreted At puberty blood details of a low the increases. by but hypothalamus maintain gonadotrophins shows are the the very secretion This of biology hormones by GnRH stimulates an releasing low increases increase so in pituitary. that you need Site of Target organ/ production tissue hypothalamus pituitary follicle anterior stimulating pituitary gonadotrophin Reproductive low the concentration anterior hormones at detect 3 to know. Action gland stimulates anterior pituitary ovary stimulates oogenesis testes stimulates Sertoli ovary stimulates release stimulates interstitial to release FSH and LH releasing hormone hormone (GnRH) gland (FSH) luteinising anterior hormone pituitary (LH) cells of to develop secondary sperm oocyte cells at ovulation gland follicle testes cells of testes to secrete testosterone interstitial oestrogen follicle in cells uterus stimulates repair and growth of endometrium ovary stimulates secondary progesterone interstitial testes cells testes epididymis epididymis luteum uterus maintains seminiferous helps in corpus in and regulates growth sexual and development characteristics spermatogenesis and of primary and in females sperm maturation in endometrium ovary testes regulate sperm production tubules increases testosterone ovaries brain one interstitial seminiferous stimulates cells tubules of testes of sperm many factors stimulates secondary inhibin Sertoli cells testis follicle in in hypothalamus and anterior pituitary anterior pituitary motility in determining sex drive spermatogenesis growth sexual and development characteristics inhibits secretion of FSH from inhibits secretion of FSH in of primary and males anterior pituitary ovary 169 Module 3 Reproductive biology Menstrual The changes occur within as the menstrual known as the ovarian Days Hypothalamus Anterior 1–5 secretion secretion of GnRH that known uterine starts cycle cycle . pituitary of FSH These gland and cycle. cycle ; changes oestradiol secretion inhibits follicle concentrations of oestradiol 14 secretion of GnRH FSH are of LH and LH starts inhibits GnRH ovulation gradually of of the of collectively the are ovary known are as the table. cycle menstrual phase: primary secretion one are in Uterine menstruation occurs of proliferative phase: dominant repair into and growth of endometrium – release of oocyte luteal phase: LH corpus decreases secretion decreasing uterus in Graaan follicle secreted concentration in GnRH uterus occur secretion progesterone decrease the summarised develops secondary 15–18 in the that cycle oestradiol; inhibited by low surge and changes changes development FSH secreted, but gradually of GnRH ovary follicular phase: starts follicle 5–13 the Ovarian LH the The secretory phase: luteum secretes glandular activity progesterone, endometrium reduction its in maintains concentrations in oestrogen thickness; oestradiol secretion, decrease corpus concentration in progesterone secretion progesterone and LH inhibits FSH luteum degenerates, progesterone 18–24 secretion not leads to secretion of FSH and less breakdown secreted of endometrium LH inhibited 24–28 Negative feedback The secretion limits In and males of does after hormones not keep puberty, is carefully increasing. the controlled This is hypothalamus so that achieved maintains by the the the concentration principle of concentration in the negative of blood stays within certain feedback . testosterone between 300 and −3 which 1000 µg 100 cm the hypothalamus the anterior In addition, is reduces pituitary the the set the reduces hormone point. the secretion the inhibin If of concentration GnRH secretion secreted by rises: of LH. Sertoli cells inhibits the secretion of FSH from the anterior pituitary. If the concentration In females as follows: Days 1–5: secreted Days low by 6–13: negative the the FSH on a of point, the then hormones progesterone theca cells hypothalamus is a Day 11: there Day 14: concentrations 170 is set and the is hypothalamus more complex. oestradiol; increases The GnRH the changes secreted by secretion during the of GnRH. menstrual hypothalamus; FSH cycle and are LH pituitary. stimulates there the between concentrations anterior time below interaction feedback same falls surge positive in of LH secrete anterior feedback and FSH to and FSH and LH that oestrogen; pituitary causes the as so concentration concentrations concentration of of of LH oestrogen GnRH to increases and FSH there decrease. increase. concentrations peak; ovulation occurs and follicle cells form corpus luteum. is a But at Module Days 15–28: LH stimulates corpus luteum to secrete oestradiol 3 Reproductive and S tudy progesterone; feedback on if the concentrations progesterone another does hypothalamus of FSH decreases concentrations and fertilisation of and and LH occur , leading to progesterone anterior decrease. progesterone cycle not As pituitary a result menstruation. there is no so With a concentration very of You should this section use the The cells has implanted in of the which the trophoblast ensures the foc us pregnancy endometrium, it must announce this example, secrete survival the of hormone the luteum in the ovary cycle so carrying continues to ensuring away gonadotrophin The placenta summarised that the is is in beyond continue the lining implanted taken an over end of the embryo. by endocrine the the to the of secrete by stimulating progesterone. as hCG h as secreting soon a of does of as is the choose set point when on the air adjust the conditioning This the not you the set the temperature for an oven. menstrual break down chorionic it number develops. of hormones as table. gonadotrophin with week secretion placenta organ fourth endometrium The Hormone chorionic the point chorionic embryo or stimulation set concentration. You temperature corpus the its the gonadotrophin in loops. secretion desired arrival. information draw feedback starts. hormones during embryo to low GnRH In Once the of S tudy Secretion of foc us negative that the inhibition exerts biology (often standing for known human) Target organ(s) Function corpus luteum in ovary progesterone stimulates maintain uterus continued maintains inhibits prevents inhibits breasts development uterus stimulates sensitises hypothalamus and secretion pregnancy for rst of progesterone three to months endometrium contraction of myometrium menstruation secretion of GnRH and FSH pituitary oestrogen at anterior and pituitary birth of milk growth glands of uterine myometrium to inhibits stimulates stimulate secretion to wall oxytocin muscle of GnRH that is secreted contraction and FSH hypothalamus breasts growth of ducts Summary questions 1 Dene the following target organ and terms: hormone, endocrine organ, 6 negative feedback Explain how controlling: negative feedback i testosterone is involved secretion; ii the in menstrual cycle. 2 Name the hormones that control reproduction in 7 humans. Describe the role of the placenta in secreting hormones. 3 Outline uterus the changes during one that occur menstrual in the ovary and 8 cycle. Make a large annotate 4 Explain males 5 how hormones control gametogenesis copy them of with the graphs on information page about 168 and where the in hormones are secreted, stimulate. Draw where they act and what they and females. Outline the activities of roles the of hormones ovary and in synchronising uterus. the on the x-axis to a diagram show with changes the in same the timeline uterus and the ovary. 171 2.7 The effect of maternal behaviour on foetal development A Learning outcomes foetus interacts placenta. On completion should be able of this section, you should to: explain the importance nutrition a as the acts good surrounding as its diet, stay overusing behaviour may lungs, entirely through and excretory healthy and not legal affect world gut drugs the and infant take abusing (up to part in illegal one the system. Mothers any risky drugs. year after Effects birth) or of may maternal such maternal with organ maintain behaviour , of This be long-lasting and affect a person throughout their life. during pregnancy Maternal outline the on foetal alcohol, illegal effects of drug development nicotine, other including legal and drugs describe the effects of A woman’s There is on foetal explain why some an and During the increased first risks to any diseases for unborn She is some women talk clinic. This to will understand nutrients this to breasts is pregnant. support and provided the foetus. from the diet; she by the does mother not to make use of stored fat and stores need to of pose at advice such absorbing as calcium it as is nutrients and iron. She also necessary shown in to the from her diet. becomes T owards increase the intake of the more energy end and of certain table. the at help the Comments on intake during pregnancy energy intake antenatal staff you topics Function given energy or when foc us read pregnant clinics and placenta, pregnancy requirements able Nutrient to of energy uterus, changes children. nutrients should for the months additional two’. pregnancy You of many development efficient S tudy six through demand metabolism micronutrients, health goes cigarette ‘eat metabolism growth without smoking nutrition abuse at such (provided by required for growth and should not a carbohydrates, fats metabolism of uterus, and placenta, foetus increase until the last to in this proteins) and three months of section. breasts pregnancy about protein growth as of blood tissues, in both and foetus in calcium uterus growth and such additional mother then by day a day pregnancy muscle and foetus of bones of no as extra haemoglobin in both needed gut is efcient women and foetus calcium absorption from more mother a 6 g throughout foetus iron and 800 kJ at deciency should risk of iron- anaemia take a supplement of iron with vitamin C Women have Link first Read on about page 11. body mass index (BMI) 12 such are per weeks as develop exposed 172 advised 400 µg spina into at to day of the one pregnancy bifida. the take for In brain surface this and of a folic acid month to reduce the condition spinal the cord body supplement before at risks the to becoming of neural does birth. not ensure that pregnant neural tube close tube that and for defects, goes properly they on and to is the Module It is not necessary to increase the food intake by very much during 3 Reproductive the S tudy last are three months overweight or in order obese to gain should sufficient probably energy. not In increase fact, at all women and losing weight during pregnancy. A woman of normal women (BMI of 18.5–24.9) should increase by 11–15 kg in body women and should there is take in sufficient sufficient water water for the so the mother amniotic have important is calcium, diets nutrients, iron and folic acid, such put not the dehydrated in mass. as Pregnant who weight decient range foc us who should Pregnant consider biology health of their children at risk. uid. Try answering Question page 176 to work out 6 the on effect of Drugs such A drug is chemical as any alcohol Alcohol and on to the is it the crosses as the on the illicit A and and very the This so drink rare body enters This the the is the as heroin foetal at a effects blood time are are condition modifies medicines, such alcohol (especially that includes drugs, foetus. who pregnancy syndrome Nicotine and alcohol delivery. into body. placenta Mothers during alcohol effects the metabolise premature taken the throughout adult. alcohol in nicotine, crosses distributed able substance reactions worse caused by eight and affects on the heavy and foetus risk is developing such foetus is is than of intake weeks) the cocaine. the the on foetus. drugs circulation before increasing first or legal deciencies of foetal (FAS). drug in placenta tobacco and products, enters the such foetal as cigarettes. circulation Like having alcohol the same adults: Summary questions increases restricts heart blood rate ow to the increases blood increases stickiness extremities Nicotine through so reduces the the ow of blood increasing through the pressure risk umbilical of of platelets blood arteries 1 clots. Explain is and eat placenta. cocaine pose very serious health risks to unborn to planning and a acid Heroin why given drugs in cross the the same placenta way as the and the foetus mother . This becomes means after on birth, more shows withdrawal common heroin and amongst symptoms, babies of such as women severe shaking; dependent on cot drugs, alcohol; intake deaths such as 2 Find of the out monoxide in cigarette to form haemoglobin to transport the blood smoke combines carboxyhaemoglobin . oxygen by up to irreversibly and monoxide This 10 per reduces cent the and ability affects last three the effects mothers on of the who foetal blood. The combined effects of lead to the umbilical blood placenta restriction vessels are series of of smaller than had blood pregnancy. your ndings bullet Find out as a points. the effects syndrome of foetal and make a list following: them. narrower Summarise the effects of the normal following of during nicotine 4 is drug both of through placenta may stimulate foetal heart to reduced on foetal energy development: intake, nutrient faster deciencies, increased risks increased risk decreased of of miscarriage death of and foetus premature or infant birth just smoking before or after mass at birth as a result (IUGR) decreased of intra-uterine growth retardation to infection. and Pathogens, viruses, which immunity alcohol, illicit cigarette drug taking. birth 5 the thalidomide of the alcohol beat stop increase pregnancy. Summarise with 3 carbon not smoking haemoglobin and until about drug taken maternal do are children Carbon take folic smoking; the cocaine. Cigarette pregnant: the months child diet; stop advice are children. dependent that who become balanced energy drug to tablets; drinking The the following women take as and can infect precautions to bacteria disease. pathogens placenta What such cause prevent and Find out cross the the foetus. can women this? 173 2.8 Human reproduction The Link this Can and you name any flowering mammals Look at page flowering that are fully 150 for an plants of a and live are 1 a that list of have but between in events that Put these you – events it is help time the you follow during the time mammals aspects some to the changes reproduction, a male time of when occur in the sexual sexual sequence. Letter and their they germinal a testes a female conception conceive a to child. epithelium in A produces The spermatogonia to the help you plants 1° foc us organise your parts. The rst gametogenesis underlying in humans first one has been done in part males sexual Letter germinal by epithelium in M produces oogonia stored in B zygote formed C 2° spermatocytes to form D oocytes 2° divide to E oocytes N sperm pass and oogonia divide O spermatids through P uterus grow into 1° Q oocytes sequence will sexual intercourse sperm ejaculated – F sperm enter oviduct G ovulation H sexual intercourse sperm deposited R show in and females; semen the second changes part that will occur show the after fertilisation. spermatids into differentiate into S spermatozoa spermatogonia grow 1° spermatocytes – T in vagina zygote divides 2-celled to form I embryo 1° spermatocytes to form divide U 2° spermatocytes S tudy foc us internal This sequence tells a story. There examples of processes can learn as if they are a beginning, middle of replication, blastocyst forms V vesicles, K birth W stories and gland and end. prostate Think J uterus Cowper’s with in that seminal you development are the many gland release transcription, secretions translation, mitosis, cannot tell able write to 174 to and mitosis form to reproduction here owering Event during cervix need terrestrial, reproduction ovaries fertilisation two their of reproduction reproduction epididymis in to that draw sperm You in understand during correct implantation S tudy of questions reproduction and are adaptations knowledge foc us line for from some are your groups. reproduction occur and organise A. Event during To are sexual both you different There humans to help plants very there similar . apply will X). for S tudy land, reproduction is to on below owering They remarkably principles (A Most land. comparisons sexual This questions area. on dispersal that make plant. and subject they aquatic? example tasks summary the meiosis. story, about it you in If will the you not be exam. embryo foetus develops into a L Module 2 Make a table Include when the precise starts; gametes site of of Identify oogenesis headings time of of for the produced production production length 3 of compare following process number in to from equal rows: cycle each time when cell gonad; or Reproductive biology spermatogenesis. your life within gametes; and 3 from names unequal of the the each of life process diploid other division cycle stops; of cells cell; involved cytoplasm; time. each of A Secreted B Stimulates C Made by the following interstitial secretion from hormones from these statements: cells. of FSH. cholesterol in the corpus luteum to maintain endometrium. D Stimulates repair and growth of the endometrium after menstruation. E Acts by negative pituitary F 4 Secreted The a by negative why it ow give the a Explain chart a meiosis; (single products of and its a Sweet zygote, to the to within of anterior FSH. narrow limits concentration prevent changes of in males. GnRH is polyspermy. that an occur oocyte involved tubal to delivery to of after until with ligation, the a the sperm zygote following barrier cell divides methods methods and a gamete; of that owering for type fuse number internal the the oocyte precise your of of plants table: and site of fertilisation together; site of chromosome development; of mother primary to meiosis mother of (2n = 90) cell, oocyte, trophoblast method the in sets in of a of owering human the of a plant ovum. following and human. mother cell, production a mature each secondary cell, a and pollen endosperm in cell produce location potato zygote, embryo, role megaspore sweet cell, oogonium, male in headings embryo. megaspore 8-celled row fertilisation; primary in reproduction structures site from a of of compare show number sexual following names sac antipodal Human: the of from potato: gamete, secretion the surrounding compare nutrients table from prevented. principles product(s) embryo ploidy LH embryo. fertilisation; meiosis Make to diagrams mature kept how is vasectomy, double); providing Make cells Include fertilisation; of pills. method or show biological table mammals. is important to follicle contraception: Make is two -celled the secretion feedback. Explain a inhibit inhibit show b contraceptive 10 to polyspermy of 9 GnRH loop how Make to to Explain to 8 of cells a reaches 7 Sertoli feedback controlled 6 by feedback ovulation. concentration Draw 5 after cell, male meristematic oocyte (two spermatogonium, cell. locations), primary Link spermatocyte, secondary spermatocyte, spermatozoon (numerous sites). 11 Read Describe how Compare embryo is the the placenta functions of acts the as a life placenta support with the system ways for in the which foetus. a plant page about the making 80 to remind human your life yourself cycle before table. supported. 175 2.9 Practice Human 1 a Compare in b the Sperm after cells i TWO reaching oocyte; in ii TWO the site ovaries 5 of that a systems. corpus capacitation b capacitation. methods that c the and to crosses women drink during gonadotrophin, and progesterone. in which membranes of the placenta. Give why not the following chorionic oestrogen epithelial in the Explain of FOUR different ways substance that prevent in roles human luteum, Describe villi sperm of fertilisation the cross the different prevent Describe pregnancy: reproductive a variety methods reaching and process of happens during work ways. State an testes into the female Describe what oocyte the questions: reproduction reproductive go through the Contraceptives an of and female ejaculation tract. c the functions male exam-style an in are example of a each way you describe. advised alcohol substances chorionic during not to smoke pregnancy. oviduct. 6 2 a Name the cells formed spermatogenesis in oogenesis immediately after a and each of these b State ONE between growth phase, meiosis I, of the amnion and amniotic uid. processes: mitosis, State THREE functions meiosis a II plant similarity the ways embryo in and ONE which receive a difference human foetus nutrients during and their development. b Explain the signicance of mitosis and meiosis in c spermatogenesis. Explain their c Describe the role of Sertoli cells in a Explain how control of negative feedback the menstrual is involved in in woman’s the diet menstrual can expect may adversely in menstrual two cycle. named Explain of cycle to secondary oocyte is questions prepare be of flowering yourself for may surrounded ask you to compare the and type of humans. question Make by sure doing 8–11 in the Summary section on page 175. in which interrupted. released from by plants this cause an ovary a Describe and a zona pellucida explain TWO ways the at composition ovulation that how nutrients 7 A care affect Questions deciencies c take the you the should cycle. reproduction Deciencies a women pregnancy. Link You b pregnant during seminiferous tubules. 3 how diet of the amniotic uid changes during and pregnancy. follicle cells. b i Describe how a sperm cell penetrates Describe of surrounding layers and enters the the a foetus an Explain how polyspermy is a Describe b i State the a human process site of of found implantation. secretion chorionic Explain how of the gonadotrophin the secretion of genes (hCG). hCG in oocytes hormone During are do cycles pregnancy not normal need become to the mother circumstances, to take anaemic. iron ii many iii is iron 300 mg to of iron 8 a the foetus. pregnant supplements Explain necessary for pregnant women unless alcohol; ii a a foetus may excessive diet decient in vitamins mitochondrion. mitochondria only is that (mtDNA) is the Both but inherited from mtDNA is loop of sperm DNA and mitochondrial the oocyte. Explain inherited from the female only. the foetus; if Outline the roles of the following Explain how hormones the are LH and concentrations controlled within hormones in FSH. of these narrow limits. why women suffer each DNA spermatogenesis: GnRH, b they do not the need mother A type which to take supplements; anaemic. 176 i causes c i iron development stop. approximately transported from Under of have are it parent menstrual c the consumes: pregnancy. Mitochondrial how ii mother prevented. c 4 the oocyte. during ii if cytoplasm quantities of consequences for these becomes of female is injected contraceptive into muscle is Depo-Provera tissue every 12 weeks. Suggest: i how this contraceptive ii why one injection last for as long as of 12 prevents this pregnancy contraceptive weeks can Module iii how the may be effectiveness of this contraceptive a i Plot determined. ii 9 The graph shows changes a graph number in the concentrations Calculate hormones during a woman’s menstrual to show Reproductive the changes biology in the mean oocytes. the percentage decrease in between birth the of mean four of 3 number of oocytes and cycle. age iii 42 years. Suggest why enomroh noitartnecnoc numbers b State of there the functions the female was a decrease in the oocytes. of the following reproductive structures in system: oestradiol progesterone 0 14 i oviduct ii uterus iii cervix. 28 time/days c A woman while she is advised is pregnant. Outline to stop smoking the cigarettes reasons for this enomroh noitartnecnoc advice. LH 11 a i Draw a labelled structure FSH ii Explain of a how diagram human the to show sperm sperm is the cell. adapted to its function. 0 14 b 28 time/days Figure 2.9.1 Describe oocyte This graph shows the changes in the It is how the structure differs from estimated that concentration of FSH, LH, oestradiol and progesterone in the that there of are of a a human sperm more secondary cell. than 20 million 3 sperm in each 1 of cm semen. In women who are not blood of a woman during a menstrual cycle pregnant a Describe and LH the changes during the in concentrations menstrual of FSH secondary Explain half of the the roles of FSH menstrual and LH during the rst Describe how the oocytes Explain why change concentrations if are the ‘pill’, one released or each two month. many more sperm are produced than cycle. of a Describe how the woman male gametes are produced in the mammals hormones taking oocytes. 12 c not cycle. c b or (details of the stages of meiosis are not becomes required). pregnant. You may draw a sketch graph to help b your Explain how a owering 10 The table changes the production of male gametes in answer. shows in the numbers results of of a oocytes study in the into the ovaries male gametes in differs from the production of mammals. during c reproductive plant Describe how male gametes reach the site of life. fertilisation Age/years Mean number of oocytes birth 712 000 7 468 635 14 402 067 21 175 700 28 166 231 35 89 145 42 39 874 49 9956 56 3450 in mammals and owering plants. per female 177 Glossary chromosomes move apart reproduction when a cell divides into A (meiosis acrosome sperm sac cell, activation be of enzymes on derived from energy overcome a energy before a head of a lysosome. that the site part of where has a reaction molecules gradient using movement against a to DNA, RNA from main any a and ATP allele an There roots component that other they be two and a). Some alleles, alleles which has e.g. of genes the three (I a (or to resistant use of gene group B I O and I that has four pollen ). biological species interbreeding features in sexually to see by or common a pair together the blastomere that bacteria antibiotic; a mutant with RNA term of and gene to used the on of alleles of a gene have different a nucleotide sequences, the same locus individual. bulk transport to describe the quantities of membranes given as homologous term techniques atoms used used microorganisms tissue chromosomes. embryo formation of a of the species from populations that as a isolated from one another culture conditions unwanted asexual by a zygote. enlarges separate movement substances by is by of large across endocytosis cell or C to and are occur as they to and not viruses, reproduction cells through in reproductive tract so the they are in to fertilise an oocyte. sterile contaminated bacteria sperm pass ensure cells cultured change to compound by when carbon monoxide or fungi. combines are a reproduction outgrowth in formed new that asexual carboxyhaemoglobin speciation of exocytosis. able allopatric cells numbers carbon aseptic technique that on the and I cells formed off on female occupy associate deoxyribose. describe but of of small breaks that DNA they prophase divisions form translation. DNA; the ball repeated and two in one offspring; species. meiosis animal budding when bases codon during the 3′–5′, three blastula hollow antibiotic. pairs of share reproduce blastula. have of and homologous as during capacitation The of of that produce fertile metaphase inhibit population organisms morphological bivalent ability to withstand or group referring produced ability of an polynucleotides 5′–3′ have blood , loss produced kill bacteria gives orientation gene. a of bacteria. antiparallel of involving produce compound messenger grow from A gene of survive tRNA the stems. alternative form multiple a anticodon grow than are result chromosomes. stamen which a chromosomes growth that (adenosine roots may (e.g. A a breakdown that root; and sacs antibiotic to respiration. base, structure (tap) leaves of antibiotic resistance membrane triphosphate). adventitious individual synthetically) of concentration cell energy from purine a chromosomes numbers mutation microorganism across a of all equal grains. takes shape not in part pollen enzyme complementary active transport of an the substrate. adenine gain anther molecule place; present or can proceed. active aneuploidy two. chromosome must reaction I). reproduction irreversibly with in haemoglobin. geography; see sympatric speciation. which new individuals are formed carcinogen amino acid activation attachment of from one parent without fusion cancer, amino acids to specic gametes, tRNA e.g. binary ssion, e.g. vegetative molecules. tissue that autosome surrounds the foetus enclosing a exist in any sex chromosome chromosome; cavity lled with amniotic female homologous in pairs appearance that a polysaccharide may that have one although different amylose forms starch; they or alleles of of branched chain more a ower style, ovary ovules. reactions biological that break molecules down into the ones. carry. catalyst composed in stigma, they smaller with genes of match large amylopectin organ other catabolism exactly uid. and autosomes with amniotic causes radiation. composed than that chemicals reproduction. carpel extra-embryonic agent certain budding, ionising amnion any of any substance that increases of the rate of a chemical reaction; see B α-glucose. enzyme. amylose a polysaccharide that with bell-shaped amylopectin forms starch; describe of unbranched chain of α-glucose a term normal used cellulose to distribution in a a polysaccharide straight chain of composed of β-glucose. in feature a curve composed showing continuous variation centriole organelle that organises helix. in anabolism reactions that build which biological drawn through microtubules of the of a histogram is: symmetrical nuclear division the mean, mode and median all e.g. protists plants do coincide. stage of nuclear division spindle for some and eukaryotes, animals; owering sister chromatids move form of asexual centromere and meiosis II) and have part of centrioles. a chromosome apart where (mitosis not in binary ssion 178 in ones. anaphase which the molecules from and smaller curve up blocks larger the sister chromatids are joined Glossary and to where the chromosome spindle during chemotropism chemical growing by growth gradient, towards is attached nuclear division. response e.g. pollen chemicals to a secreted homologous from I of chromosomes of meiosis crossing chorion attachment that into chorionic maternal tissue tissues to form the structure the number of of a a change chromosome chromosomes to or in to the chromatid one structures of comprise a chromosome; sister the joined at proteins the that packaged and in process, producing tissue asexual and up have or natural genetically culture or or articial, identical of of cells codes for an amino in RNA cytosine acid; see have one; stores of a in of a a plant. and meiosis that is such I; cut complete off of shoot, and usually follows of into division meiosis). like forces of molecules, attraction DNA e.g. between and a a brous protein RNA. to tendons, skin and that has many other more than one amino mutation a substrate for base pairs reducing activity of see or an of both e.g. positive water; see the by a selection in a population of is an rare two glycosidic changes increase in over the allele(s). sugar of which population; molecule formed monosaccharides bond; sucrose is an feature which human any population which two most of may lead to in the selection is in owering nucleus a female male which range species; of other a common form. plants fusion with a e.g. selection extremes of the in categories groups. selection the variation distinct intermediates, blood favours has one male gamete gamete gamete and nucleus diploid nucleus to form a with triploid triplet/ loss of one in a gene; syndrome condition caused (or leads to a chromosome mutation; in most a caused by an additional mutation. chromosome active acid (DNA) No. 21. a an nucleic enzyme; with charges, there joining cases deoxyribonucleic so sets acid. that frameshift with as Down’s more) competes in or endosperm. each tissues substance nucleus rare form by by inhibitor male genetic organs. competitive site the connective deletion and to cross- plants bond. frequency a codon for tissue, refers gives code strength a two double fertilisation D code or selection a result time the that become hermaphrodite. molecule against water. degenerate collagen either having formation base, anticodon. cohesion a disruptive nuclear pyrimidine of promote are negative without plant; form cytoplasm which to example. propagation. component to cell disaccharide as by change discontinuous variation plant, division and a hydrogen as a non-sister during dipole favours homologous of not of process in owering plants directional pollen separate breakage the cells method diploid and endosperm. transfer of parts root a of have before chromosomes. plants chiasma. vegetative (mitosis bases nutrient not the of cytokinesis two; plants a ower on into in individuals three and seeds die cells. pollination female, phase anther of one ower to part grown maintain secretory embryo owering and do grains from in to dioecy which dicotyledonous cross-pollination leaf (see nuclei. reproduction. group that cuttings loosely of of energy in body’ remains organism monocotyledonous results is interphase during chromosomes (see that feature unspecialised ovulation; cotyledons, chromatids histone ‘yellow ovary from after leaf seeds two form show differentiation early cycle. crossing over non- eukaryotic chromatin tightly euchromatin) cloning cotyledon exchange DNA heterochromatin) that sister make the progesterone uterine stigma double-stranded see chromosomes; codon thread-like centromere chromatids. chromatin in two the or not reproducing. intentional ovum literally in the follicle seeds nucleus. that luteum plant; mutation to prevents specialised that forms of that extended that includes endometrium villi. chromosome so of fertilised secretes results often method embryo. of during over. extra-embryonic grows between means; any pregnancy corpus point prophase natural include loss tube ovary. chiasma or acid that is the substance of non-competitive E inheritance; composed of two inhibitor. polynucleotides complementary used to describe hydrogen ‘match’ between two molecules together’, e.g. enzyme bonds in by the form embryo of a that sac mother divides by cell meiosis diploid cell to form four that double ‘t connected the helix. nuclei three of which abort; the and diabetes mellitus disease caused by a remaining nucleus divides by mitosis substrate. lack condensation reaction a type of insulin which results in of a molecule to of that variation in shows a between range two many intermediates, to promote in owering anthers eight embryo sac. nuclei within the cross- embryo sac plants in formed (megaspore) not owering by meiosis in an spore ovule and stigmas do plants; contains in the female of at the same time; see gamete and is the site of double extremes protandry with to form a ripen phenotypes to water. which feature cells insulin. method pollination continuous variation of the dichogamy elimination inability of respond reaction or e.g. and protogyny. fertilisation. human differential survival survival of endocytosis movement of substances height. individuals contraception prevention (fertilisation) a particular into a cell inside vesicles formed of feature conception showing by whereas individuals who do articial 179 Glossary from cell surface phagocytosis endometrium uterus, blood fusion of diploid inner lining of triploid plants a that male nucleus; of gamete grows energy in some wheat, in others, during embryo e.g. within endosymbiosis such as prokaryotes of that reaction the without of it is an substrate; epistasis see one interaction loci in during proteins bilayer or cycle by who has of pituitary up; reading frame mRNA for in a half of pairs in of in loss of germ etc. is genetic and constitution being as to the of alleles considered, for and aa allelic cells or AABB, and aa are pairs.). that an line gene therapy allele into line gamete by future mutation in gestation a give rise to insertion of and it mutation gamete-forming themselves) see be that cells and somatic period may (or in is mutation. length of time (conception) birth. globular is protein soluble or metabolic in near haemoglobin, at so generations. between fertilisation amino having process cloning; restricted cells spherical the of generation replication (AA, Aa: to inherited; in acids G genes genes line that between the gametes its the the occurs effect. site. by and asexual and example AA, Aa germ of codons amino in of DNA generation organism organism inherited that sequence polypeptide catastrophic so bases occur of or to in gametes. and ovulation). gain assembly alters that material mitosis. referred ovaries (before base are an generation AaBb, pregnancy. anterior mutation more generation in reproduction of condition maintenance genetic genotype of hormone during rst used association which of mother changes gametogenesis different a activity a few being to germ ovary acids active is has an of phase frameshift that metabolic and from it and stability identical maintained syndrome secreted inuence changed; enzyme when not rm phospholipid child genetic cells is accid is follicle-stimulating the enzyme-substrate between that chain- spherical arrangement alcohol follicular ancestors proteins, temporary a a testes. and RNA. complex by abused to itself cell water, alcohol (FSH) a than protein has membranes. that organelles, and turgidity. shown seeds, of menstrual of are plant the uid cell water collagen. mosaic seed. catalyst rate its foetal all and cells. enzymes made e.g. development entered biological increases in remains originated from eukaryotic most the theory mitochondria chloroplasts, enzyme and uid a barley legume growth lost by nutrients for seeds, a structural in rather see not full in and and and as such shape shape; and is formed cereals of like the tissue germination used of glands protein insoluble accid the store rice; is vessels. owering a brous see pinocytosis. composed endosperm as membrane; and water protein and spherical has a shape, e.g. enzyme. of forming glycogen expression a polysaccharide composed gametes. of a gene is inuenced by of another. gene equatorial plate see metaphase a length of keeping enzyme solutions separate temperature before codes for to at (such as those for RNA RNA and stains less darkly and covalent animals. bond two sugar molecules, e.g. in not for letters are used hormone secreted structural genes, any hormone to of designate DNA; a and gonadal packed form bacteria, fungi bond sucrose. polypeptides; loosely α-glucose; enzymes), transfer together. euchromatin in between code for of a a some chain structural mixing ribosomal them refers glycosidic but specic that branched found this and genes substrate DNA plate. polypeptide; equilibration a by the gonads, e.g. e.g. A/a, testosterone, than progesterone. B/b. gonadotrophic heterochromatin. gene eukaryote organism that has mutation nuclei and to sequence of a such as mitochondria; gene mutant allele of that adjective from and techniques wall of pollen movement of engineering organism of a cell inside cell surface insert cure or an to (ovaries e.g. LH and FSH. vesicles inuence pituitary nucleus haploid nucleus hypothalamus of in secreting anterior gonadotrophic grain that divides to form the in that fuse hormones – FSH and two LH. male gamete nuclei in pollen tube. guanine code sequences of three of (A, T, C of ovum the 20 and G) amino in DNA acids in that a purine base, a component bases F nucleus by activity disorder. membrane. pronucleus secreted a substances genetic female gonads allele treat to pollen with to to grain. generative out testes), hormone an genetic exocytosis of of eukaryote. into outer activity gonadotrophin-releasing genetic exine hormone pituitary gene. see using anterior giving prokaryote. eukaryotic by inuence gene therapy hormone the membrane-bound a organelles, change released nucleotide with a cells DNA and RNA. code for proteins; H after fertilisation before rst mitosis DNA occurs. fertile the period period menstrual of cycle may about ovulated oviduct. 180 be time during occur as or is of and genetic three oocyte in the is often genes bases codons in engineering gene from when fertilisation to groups one used in to triplets in mRNA. the context of to of a another; moving unrelated bacterium. haemoglobin transfer organism between human are species, composed in a globular of four combination responsible for e.g. and carbon protein polypeptides with a haem transport dioxide. of each group; oxygen Glossary haploid of a organism cell chromosomes organisms sets as (or sex or of industrial an unpaired the stains a stigmas darkly method are number of male in at packed form in the to nucleus. a which heights e.g. homologous same a that position in sequence; same genes two may have of and the be the division and the genes alleles different on of between of transfer bacteria, of a usually also pathogen found species an a (animal) endocrine wall of or tissue; chemical organ activity used one species grain. acts and that is only that between to to maintain of target chemical unspecialised target tissues a tissue lacunae in maternal is and process, such partially negative partially positive collective effect bonds model of a ‘lock’ and site chemical specialise. RNA transcription assembly the of to take amino chemical organisms; of plate plate of a cell arranged and DNA to reactions see nuclear are in division arranged centre region where during of in on cell. across the chromosomes metaphase meiosis; (enzyme) see also of known as plate. and bres arranged made into of globular tubular ‘key’ structures; for the cells divide catabolism. support, shape and induced t. movement of of to of water. type in together proteins, locus hydrolysis which chromosomes proteins (substrate); DNA active substrate t many stabilises ability form stage microtubules and that uterus any faster. hydrogen like hydrogen proceeding key and proteins from all in equatorial and changes enzyme-catalysed atom enzyme atom; make occur mitosis lock a meiosis as are a of separate. therefore biological an is in attraction reaction, between to centre a number blood. that in or meiosis unspecialised cells during metaphase growth the of haploid. ovary retain RNA metaphase any factor to prevents bond the the plant. hydrogen to the cells produce messenger which supply to or released elsewhere to chromosomes division the that metaphase of and rise and chromosome cycle within anabolism, within are the genetically chromatids plants that blood there gives division second II metabolism space which halved ribosomes. organ cells in acids species. any is another diploid instructions for between the and e.g. produced populations released into one in human females. and methods are homologous which occur island. speciate separate to separate in in number that division chromosomes bivalents the rst I which meiosis in variation interbreeding shortest and nuclear nuclear generated; meristematic a limiting factor the in of nucleus. menstrual mechanisms placenta full (plant) inuence meiosis variation is is nuclei halved, pollen in organ; inuence growing when one four parent species. on to form different L to by cycle which allows lacuna by or species. next. populations; to a between individuals. hormone cell of refers breeding populations within of the endemic prevent plasmids; transmission island type homologous variation classication. isolating the pair chromosomes stage and inner within same chromosomes. the form stage grow the which between used for intraspecic variation same the the horizontal transmission genes interphase intine of have centromere the often different their pair meiosis polluted breeding varieties between sugar glucose. pair chromosomes shape, a of as chromosome different replicate; anthers different bodies interspecic variation 6-carbon molecule, against between cells promote adaptation black background. individuals, and in owers. hexose having interbreeding tightly cross-pollination melanism animals camouage polyploid half organs. heterostyly and in set having heterochromatin DNA; nucleus cells). hermaphrodite of a one having body female or having position of a gene on within cytoplasm of cells; a reaction assembled to make the spindle chromosome. in which a covalent bond is broken during luteal by phase changes that occur in the ovary between ovulation and interior of menstruation in of division cilia and also form and agella. the mitosis start nuclear the water. the type of nuclear division that the occurs in growth, asexual reproduction, I menstrual cycle. tissue repair and replacement of cells; inbreeding breeding luteinising between hormone (LH) hormone maintains the chromosome number in individuals of identical, or secreted very by anterior pituitary to the daughter nuclei which are similar, inuence genotypes. activity of ovaries and genetically identical to each other and independent assortment the random testes. to the parent nucleus. arrangement of the alleles of two or mitotic more genes found chromosomes as on a separate result of M occur cell formation chromosomes during model active the ratio moulds itself to at site actual size image such of an object and size of by the substrate that its and and its cytokinesis an of match as drawing two cells. or the photograph; of changes cytokinesis mitosis monosaccharide shape the between between into enzyme all cell meiosis. dividing induced t a pairing magnication of cycle within during compare single molecule of a with an sugar, e.g. glucose and fructose. resolution. enzyme-catalysed reaction; see lock morphological male and key pronucleus the nucleus of species population of sperm model. organisms inside an ovum that share the same after fertilisation. features, such as morphology 181 Glossary (outward appearance), behaviour and multicellular many cells, mutagen having e.g. agent mutation, chemical mutation e.g. a change made and causes and to body of organ a or to a gene more group to a somatic diffusion partially water different DNA major organs perform of potential made group several breeding individuals layer of opposite with of through see a down water genotypes; changes that occur within ovary (owering which natural selection the survival contains plant) one with adapt them to the conditions gametes agent (or agents) of e.g. and and have and a greater chance passing on their of negative feedback a control parameter structure or a the hormone blood within difference carpel ovules; movement cell inside cell surface placenta a is maternal gonad a set kept see through tissues for attaches a drawing organ sizes a secondary tissues; plan ovary; occurs menstrual in the any narrow the as within an ovary in as small part of active activity plant that develops into a the cell from after fertilisation. female and competitive limits; P of and palindromic that cut as site across have substance an site of plumule restriction DNA at sequences these of the same on direction pentose see e.g. inhibitor. two homologous to by one rarely molecules pairs non-sister sub-unit a (e.g. in in bases the 3′–5′ 5-carbon bond amino chromatids grain osmosis. phosphate (purine or molecule and of a a of survival of pentose that sugar and nitrogenous the wall of contents, pyrimidine). a is by mitosis male by obese than if it gamete cell be for than height 30 kg (e.g. a tubular e.g. and vas of and has a BMI site in of an a which has to many to move to move to surface oocyte gene of genes e.g. cancer as it controls cell division; see proto-oncogene. and of long chain nucleotides; of solid food) the features which expression between the into by of are and the many a to form the an amino 182 acids unbranched (> 10) chain. cell three or more sets of cell in nuclei of an polyploidy the feature often result and used controlled maybe used the features of an is common in an but rare in animals. of a complex by to by joining of the refer gene monosaccharides generally for organism.. by glycosidic to to form a branched or under all amylose. completed at fertilisation in an oviduct. RNA interaction genotype environment; study, see particles unbranched that starts in the ovary and is molecule embryo. movement bonds the process of forming ova the height. DNA. many oogenesis grains inuence human carbohydrate formed causes pollen stigma. membrane. individual to grain anther. move organism; potential that in organ vesicle formed phenotype oestrogen. gene cell to form four pollen an polysaccharide oncogene nuclei. diploid transfer anther plants, oestradiol that two conditions. muscle deferens oviduct bacteria, inside m sac; plants) -2 greater nucleus grains. sac chromosomes should spore pollen between polyploidy greater a to form meiosis polypeptide considered in generative mother joined 20% a nutrients for adverse contraction secondary is of molecule, bond (owering energy phagocytosis adult embryo same: O an on phenotype. read and mass effects the direction). covalent through peristalsis sperm body an meiosis composed obesity has of (microspore) by polynucleotide base water acids. perennation storage composed of same feature, sugar, away from of ribose. peptide two of identical. acid, cell they polygeny nucleic of show enzymes sites; from nucleotide not plant. pollination are of loss gene shoot formation chromosomes; do complementary polynucleotides enzyme and enzyme; chromatids of the cytoplasm due vacuole pollen DNA section a pollen of of distribution drawings wall pleiotropy gamete. divides non-sister and showing movement membrane a pollen reduces and of body value point for inhibitor to the a cells. plasmolysis cycle. haploid than into the exchange between fetal relative divides other by blood. an contains that liquid method such positive feedback. non-competitive of vesicle formed plan drawing that secretes formed possible; of membrane. substances pollen parameter bilayer concentration between and and it organ formed from fetal owering parameter making phospholipid different features of hydrophilic regions a is alleles. ovum temperature suitable for has to that of seed keeps of more and of the the owering that attached group these ovule breeding soluble; of phosphate predators, climate; middle individuals base or progesterone. release oocyte from competition often a the ovulation environment, acids, by oestrogen an composed particular features produces that in of (mammals) female individuals is hydrophobic maternal the ovary during a menstrual cycle. N lipid two fatty which water bond e.g. RNA. pinocytosis between different inbreeding. ovarian cycle uterus. covalent nitrogen-containing membrane gradient; bond nucleotides, membranes. outbreeding of and glycerol, that organ. water permeable two phospholipid of see phosphodiester between to potential. mutation. muscular of together tissue. together osmosis chromosome a fungus outer or see system work hyphae. myometrium one functions; composed work major functions; a see gene that perform of plants. some mutation) mutation); mycelium the body radiation, structure tissues compounds. mutation many a animals that (chromosome (gene organ anatomy, physiology. chain, e.g. glycogen and Glossary polyspermy fertilisation of an ovum Q by more ovum than one usually fails to develop if this happens. same at group species the same of living leads to magnitude of happens the in secretion follicular individuals in the of same the area time. positive feedback system qualitative does population of any an that change increase change effect of in in a numerical results, refers taking the end phase colour and of of the menstrual to or anything which recording results, to the e.g. mass and that cell R organism that of an embryo of and DNA DNA from of (e.g. two different the new allelic pairs as a result of or 2 genes the result between of endometrium in the uterine same of crossing chromosomes homologous of chromosomes tightly); nuclear an down at end isolation separation of method to pollination in which are unable see so anthers to with sympatric classied in sometimes in microscopy points the that ability are on do method not stigmas same of as the separate of a points; microscope wavelength light) to stigmas of pollen stigma or within between owers on uid containing sperm seminal and vesicles and gland. of of the replication DNA by using existing the is as templates for about assembly of nucleotides; molecule of DNA each new radiation is one ‘old’ used. as polynucleotide enzyme enzyme that and one DNA at specic one of many base tubules also ‘new’. cuts cross- sequences; which and same transfer anther polynucleotides across in which germinate the seminiferous tubule pollination to in to kingdom promote A plant. production restriction to → close protoctist. method e.g. Aa cross-pollination semi-conservative two and written allele, populations. ripen (e.g. Protoctista, one grains prostate half protogyny only secretions from resolution organism during that allopatric protogyny. protist pair) nuclei interbreed occurs cross- dichogamy (allelic haploid that prophase. promote ovum. separation a. semen together stigmas; organisms condense distinguish before contain the resolution protandry the of membrane of polar an exact division and breaks is rst DNA. successfully; (coil alleles give grains from they which haploid of pair. of and nuclear cell I becomes alleles self-pollination populations in of to same ower of larger genotype. production reproductive stage implantation. of ovulation. rst so to over cycle copy menstruation state unlinked the replication prophase pair grow the a meiosis self-incompatibility assortment prokaryote. between a pollen of uterine 1 see of the ovulation in at (smaller meiosis and adjective from growth in is the if fertilised promote phase embryo produced in after combinations eukaryote. proliferative phase species) membrane- genes the together. independent prokaryotic of hydrocarbon two in cells e.g.bacteria; an segregation of of organelles, with any plant. recombination nuclei acid a translation. has the occurs oogenesis root joined prokaryote fatty between endometrium body); proteins after in phase that accept sources RER acid bonds atoms secretory cycle modication occur and double secondary oocyte recombinant that body no carbon negative feedback. processes bound saturated fatty on owering without which recording length. oestrogen at post-translational Golgi e.g. or chain. numerical as anything taking texture. involves the to involve quantitative LH see refers not radicle cycle; S sperm; fertilised known as in the testis in which restriction ripen spermatogenesis occurs. endonuclease. before anthers; see dichogamy and sex restriction site specic sequence chromosomes bases proto-oncogene gene which in DNA become an usually cut across products of oncogenes are pair of determine known as X sex and Y. both oncogene; sex polynucleotides; that restriction can enzymes and where the of protandry. mutate chromosomes see linkage genes that occur on the palindromic proteins sex chromosomes are sex-linked as site. that control the cell cycle. their rhizome protoplasm contents of cell cell surface membrane, stem which acts of vegetative determination and Y of associated with of sex by the X reproduction cytoplasm sometimes is as the organ and and horizontal including an inheritance perennation, chromosomes; in mammals, e.g. nucleus. the Y chromosome has few genes so ginger. purine a nitrogen-containing sex ribonucleic compound composed of two by carbon and of nucleotides and RNA compound by is composed of one part carbon component of and of ribosome; RNA. an that form on the X chromosome. two chromosome centromere; enzyme identical joined copies together they are at identical peptidyl made catalysing formation any mutation that might of have nitrogen; nucleotides loci chromatids apart from is to RNA ring occurred during replication. of somatic peptide and of nitrogen-containing rRNA for DNA form a the transferase formed (rRNA) RNA. a refers rRNA. of which pyrimidine and that form ribosomal DNA tRNA always polynucleotide; sister mRNA, almost single gene short-lived nitrogen; see component (RNA) rings stranded, formed acid linkage cells non-reproductive (body) bonds. cells e.g. that do muscle not cells give and rise to blood gametes, cells. 183 Glossary somatic gene therapy insertion an testa rise test cross of seed coat. U allele to into a cell gametes; inherited somatic that inserted by future mutation occurs in body inherited; speciation species see idea is be the a cells and molecule has a in seminiferous in sporangium. reproductive which a to small structure in tissue fungi plants; and structure prokaryotes, protists, composed of may longer base, but similar cells culture in be (or all different of RNA. that work several) identical types; a growing sterile see plant assembly of nucleotides template polynucleotide RNA during type amino of a and one or several nuclei as a uterine to but dispersal and/or survival translation; result of translation in acids conditions. body made of Paramecium; one see base, a component DNA. maternal uterus (and blood ows placenta) in this artery. uterine cycle within the a animal changes uterus to see uterine vein mRNA on by a of in this that during occur a menstrual uterus DNA. that (in which the on organism different (and placenta) during the organ and fetus nutrition internal and in develop protection development. that V organism the differences between engineering. assembly ribosomes mammals) embryo receiving ribosomes blood ows uterus anticodon. an genetic maternal the vein. of using (interspecic variation) and amino within unfavourable not artery the species for a pyrimidine RNA variation cytoplasm having Amoeba, away from of RNA acids transgenic organism DNA from or medium. production has of e.g. uracil of not one cell, multicellular. used. a cells transcription transfer produces reproductive by DNA no unicellular cycle. transfers produced note that the now perform mixture tissue hypha of of gene organ. of spores. spore group a is pyrimidine functions; or process vertical plants tissue together testis. a a component new allopatric concerned; an another that recessive for the backcross thymine mutation. a genes term an organism with genotype with homozygous or that mating unknown is not which see the that forms and cannot or function. sperm in sporangium fungi line by that role sporangiophore fungi and germ spermatogenesis tubules give speciation. particular forming allele mutation process specicity not generations. cells is formed; sympatric will species (intraspecic sequences variation). stabilising selection selection of in codons to determine the sequence vector which the proportions of different of amino acids in a is types or forms within a population transmission in genetic used to move not change from generation to microscope uses an electron to generation. organ in view thin subcellular a ower sections to of lament pollen and triglyceride anther of sacs. cells animal cells which retain a glycerol triplet a ability to divide by mitosis and that type and of lipid cells which group of three mutation plants codes for an amino of by increasing articially in asexual reproduction. reproduction acid; asexual DNA in plants in which a see large part of the parent plant codon. specialise. repeat are acids. bases separates stutter vectors composed three fatty fairly produce of propagation of reproduction the vector host study vegetative stem a a plasmids. encouraging with four into structures. number composed examples and vegetative male gene beam viruses stamen a electron organism; do engineering polypeptide. triploid a refers to a nucleus, cell, to become an independent tissue individual. sequence of bases as happens in the or organism having three sets of vertical transmission gene for huntingtin cause Huntington’s which is chromosomes; the see parent change to DNA trisomy (or more) base pairs are by sexual no base pairs are speciation or asexual means of a pathogen from rather than two; Down’s syndrome is lost. mother sympatric also three chromosomes of the same type transmission replaced; offspring condition in which there are reproduction; in which one of to polyploidy. disorder. whether substitution mutation transfer endosperm, genes from of formation to child before or during caused by trisomy of chromosome 21. of birth. new species population; polyploidy within a common occurs; trophoblast single in see plants where that forms embryo allopatric the speciation. at extra-embryonic exchange implantation epithelium of tissue surface for the and, early W later, chorionic villi water in T the tube nucleus controls telophase stage at end of potential potential energy of a placenta. haploid the growth nucleus of the solution in water; is comparison to pure that it a measure of the ability of pollen a nuclear solution to absorb or lose water tube. division in which and chromosomes tumour uncoil and nuclear suppressor around gene a protein that the assembly of a that is used plant during replication the expand plant assembly follows osmosis. the 184 rules of base is turgid when pairing. any further; it occurs and when transcription; cell new: cannot polynucleotide and osmosis. polynucleotide turgid for applied soil inhibits them. mitosis. template is cells absorb to cells, tissues, organs which the codes for reforms gene membrane water by the atmosphere; see Index Key terms are in biochemistry bold biological A biuret solution bivalents acrosomes energy 49 smoking 63, cilia 173 165 30 49 enzymes active transport in 48, cells cloning 165 process 144 49 codominance blastula 165 budding, reproduction 96 39 by 76, 144–5 codons 67 , 71 64 bulk transport adventitious roots and cells cohesion 39 4, 5 146 collagen agriculture, GMOs in 16, 16–17 118–19 C alanine 82–3 164 sites of adenine 80–1, 84 chymotrypsin 19 cigarette blastomeres active and segregation 138 83 blastocyst activation meiosis 2 species competitive inhibitors complementary albinism 108 capacitation alcohol (during 84, 85, pregnancy) 90, 92, 96, 173 capsule, 102–3 cell 32 carbohydrates 3, reaction speciation 138 carbon acid activation 12–13, 70–1 14, carboxyhaemoglobin 66 carcinogens 173 166, 167 carpels 148, 48 catabolism luteum 8, 9 catalase 8, 9 54, catalysts 55, 2 bonds cell nuclear division 79, 83 2, 3, membrane 30, 31, 32, 36–7 , gland 128 38–9, plants, GM 118, division 91 eukaryotic 119 30–1, 32, 33, 36–7 , 68, 72, 12, 13, 151 functions resistance 134, 135 microscopy and 27 , prokaryotic 32–3, 70, 71 and tissues and organs 13 antiparallel cellulose polynucleotides 63 2, centrioles 115 83 146 32, 76 34–5 cytosine antigens 114, 79, 144 cytoplasm anticodons 76, 28–9 cytokinin 135 (CF) 30 cytokinesis antibiotics 67 144–5 cystic brosis antibiotic 85 147 cysteine modied 148, 153 (chromosomes) 76–83 cuttings anthers 150, cells animals genetically 120–1 76 crossing over breeding 64 160 cross-pollination aneuploidy 49, 48 crop anaphase of 152 59 Cowper’s anabolism 171 159 covalent amylose 170, 2 cotyledons amylopectin 159, 151 cortex amylase 59 129 corpus amnion 126–7 165 control variables acids 124, 2 contraception amino 6 6–9 continuous variation allopatric 48 2 condensation alleles molecules 164 compounds amino 57 12 63, 64 8 31, 78, 79, 83 D articial propagation aseptic technique asexual atoms 147 147 reproduction 76, cervix 144–7 CF 2 autosomal recessive autosomes 72, conditions conditions 92 109 108 146 chi-squared 112–13, snails 2 dihybrid solution 79, 82, 83, 85 diploid 72 116–17 survival and 133 147 cell crosses membranes 38 98–101 151 76, 18, cells 80 molecules mutations 128, 128–9 directional 4 selection 137 20 90, 92 disaccharides 6, 7 144 crossing tests dipolar 127 chromosomes biochemical dioecy DNA 140–1 curves binary ssion 171 see 151 differentiation diffusion acid 63 mellitus differential 33 36 chromosome Benedict’s diabetes gonadotrophin chromatin bell-shaped deoxyribose 104–7 31, 67 deoxyribonucleic dichogamy 2, 132–3 code 135 chromatids banded 2 166 chorionic bacteria degenerate 152 test cholesterol chorion 115 83 chloroplasts B Darwin, Charles 114, elements chlorophyll buds 79 164 chemotropism chiasmata 146 axillary 158, 72, (cystic brosis) chemical autosomal dominant auxin centromere over 85 discontinuous variation 124, 124–5 18–21 homologous 68, 72, 95 disruptive selection 137 185 Index disulphide DNA bonds fertilisation 15 (deoxyribonucleic breakage and genetic engineering protein synthesis replication to protein dominant 90 brous 112–13 agella 30, owers and uid 76 168, 169, 128–9 follicular 81, 148–51 syndrome (FAS) 173 syndrome 168, 63, guppies during pregnancy hormone phase of ovarian 64 H (FSH) cycle groups 15, fructose 16, mutation fruit microscopes 26, 109 cells 80, sac embryo sac 149, 150, heterochromatin 97 , 98–9, heterostyly (follicle-stimulating 6 170 histograms 76 human 165, 166, 151 hormone) hexoses 169, 72 100 149 168, embryos 94–5, 151 cells 148 153 28–9 FSH mother 82 6 fruit ies embryo 131 129 hermaphrodites electron 130, 145 haploid E 16 170 haemophilia frameshift 164 170 fragmentation 173 170 159, 141 haemoglobin drugs, 169, 168 hormone 172–3 haem Down’s hormones Graaan follicle guanine 36 166–7 , 152 double fertilisation (GnRH) 32 follicle-stimulating 103 168 gonadotrophin-releasing reproduction alcohol foetus 95 epistasis hormones gonadotrophic 16 43 mosaic foetal 72–3 cells gonadal 164–5 proteins accid phenotype alleles dominant and 62–3, 85 of 66–71 64–5, to acid) exchange 152, 127 homologous 171 pairs of chromosomes G plant 152, endocrine organs endocytosis 168 39 endometrium endosperm 68, 152–3 158, 166 endosymbiosis 6 gametes 80, gene 33 enzyme-substrate 49, 50, 57 factors 48–9 in generative restriction epididymis epistasis epithelial activity activity 56–9 50–5 112 cells genetically 34, plate 36 79, 117 , 83 90, 92, 102–3 116–17 Huntington’s 92, hydrogen 93 regions hydrophobic 50 bonds germ 19 90, 72 line cells 32, 34, 144–5 92, cells 30–1, 32, germ line gene therapy germ line mutations germinal 33, 36–7 , 72 epithelium gestation period gibberellin 132, 134 glans 159, 149 melanism 39 variation glucose 49 glycerol 84 90 169 160, proteins 3, 6, 57 164 compounds 10, 2 16 116–17 8 interphase of exopeptidases cell cycle glycine 12, 8, tubes fat diet the acids 10, pronucleus reproductive period 186 6, 164 (genetically modied 164 system solution 18, 50 8 11 ionic bonds ions 2 2, 15 organisms) 118–21 island 158–9 Gogli fertile bonds 124 72 iodine 117 , female 36, 11 GMOs female 149 intraspecic variation glycosidic fatty 161 36 158 glycoproteins in cells 9 intine glycolipids Fallopian 124 16 interstitial glycogen 83 11 interspecic variation F body 31, 99 134–5 158 insulin exocytosis 134, 146 (penis) globular 92, 48 161 inorganic exine 36 115 inhibitors evolution 15, 153 128 inhibin 68, 11, assortment model inheritance eukaryotic 36 80 inheritable eukaryotes 64 124 industrial euchromatin 11, 63, 7 I induced t ethanol 4, 90–109 genotypes 10 15, interactions independent ester 109 (GMOs) inbreeding equilibration 4, 118–21 genetics 39, 66, 72 135 168–71 139 reaction hydrophilic organisms 158, 158–71 disorder bonds hydrolysis 112–21 76 modied genes 146 reproduction hybrids 101 stability reproduction insulin human 66–7 ratios human plant engineering genetic 129 149 85, diagrams genetic 160 128, 114 84, code genetic 102–3 equatorial genetic 95 hormones 162 162–3 nuclei 72–3, genetic inuencing investigating 148, mutations genes enzymes 92, gene therapy complexes 84, horizontal transmission of galatose gametogenesis 152 72, endemic species 132 Index isolating isotopes mechanisms 138, monosaccharides 139 Morgan, Thomas 2 morphological K mRNA Bernard 71, 7 Hunt pedigree 94 species (messenger 68–9, Kettlewell, 6, penis 138 RNA) diagrams (glans) pentoses 62, 66, 67 , 117 peppered pepsin 160, 6, 164 62 moths 49, 108–9 134–5, 140 59 140 multicellular organisms multiple alleles 34, 76–7 103 peptide bonds peptide synthetase 12, 13 48 L mutagens lacunae LH mutation 165 (luteinising hormone) 168, 169, light perennation 128–9, mycelium 130–1 peristalsis 145 myometrium 170–1 ligase 129 pH 158 26–7 , N 29 phosphatase natural 10–11, selection 132, 133, 124, 58–9 127 12 59 phosphodiester 48 3, 164 activity 90, phenylalanine microscopes lipids 160, enzyme phenotypes 113 lipase and 146 bonds 62, 68 134–7 , phospholipids 19 10, 11, 36 140–1 loci of chromosomes placenta 92 negative feedback lock and key model plan drawings phase of ovarian cycle (during pregnancy) 170 lysosomes 30, inhibitors 35 hormones plants non-reducing sugars 7 , 18–19 breeding non-sister chromatids 83, GM nuclear division 76, 77 , 80, 91 85 M crops 118, nuclear 3 envelope 112–13 48 plasmolysis malaria nuclei, 130–1 cell 31, pronucleus nucleic 164 acids 3, reproductive system nucleolus, 160–1 cell sterility (plants) 151 nucleotides 119–20 null 152 31 pollen male 130 62–3 plumules male 42–3 72 pleiotropy male 146–51 31 plasmids nucleases 26 120–1 82 reproduction magnication 146 57 31 macromolecules 172 173 plant non-competitive 171, 170 48 nicotine luteal (hormones) 166–7 , 62, grains 81, 148–9, 150–1, 152, 64–5 153 medicine, GMOs meiosis 80–1, meiosis I meiosis II 82, in 117 , 82–3, 85, hypothesis nutrition, 162 104 maternal pollen mother pollen sacs 83 82, 134, 150–1, 153 O 83 polygeny 126 140 obesity membrane, 148 148 pollination melanism cells 172 cell 30, 31, 32, 36–7 , polymers 11 3 38–9, oestradiol 158, 159, 170 oestrogen 158, 169, 171 polynucleotides 13, 62–3, 64, 66 76 Mendel, Gregor 90, cycle 158, cells cycle 77 , see nuclear division 79, plate 79, 168 128, polyspermy 162 population 35 12, 67 , 30–1, 33, compounds 8–9 124 positive feedback 36 (hormones) post-translational 2 170 modication of proteins 34–5 38, product 66 43 molecules 50 9 outbreeding microorganisms, GM 26–7 , cycle 149, 79, 31, 158, 159 prokaryotic cycle 158, proliferative 164 164 149, 80, 150, 162, 152, 163 144 32–3 phase of uterine cycle 153 promotor sequences propagation, plant 92, 118 147 77 nuclear division 78, 83 3 P monohybrid 33, 170 prophase of 2, 32, cells 82 ovum cell prokaryotes 170 153, 33 ovules 76–9, 171 83 ovulation mitochondria 169, 28–9 oviducts microtubules 153 158, 147 ovaries microscopes progesterone 119 ovarian micropropagation crosses 94–5, prostate gland 3, 8 160, 164 100 prosthetic monomers 6, 164 71 osmosis molecules 129 polysaccharides 83 organs mitotic 164, 83 organic mitosis polyploidy 163, systems organelles microbrils 158 2 metaphase of methionine 66, mRNA organ metaphase 62, 72–3 78 RNA metabolism 68, 77 162, oogenesis messenger 16, 77 oocytes meristems 14–15, 170 oncogenes meristematic 12–13, 92 oestrus menstrual polypeptides palindromic sites groups 15, 16 112 protandry 151 187 Index proteases 48, protein bres protein 30, synthesis proteins 3, protists 34 self-pollination 50 semen semi-conservative 19, seminal 76 square purines SER 77 151 protoplasm Punnett 62, vesicle replication 160, (smooth chromosomes sex linkage plants sickle Q quantitative 18–19, investigations 160, 161, (genes) transfer RNA reticulum) 31 transmission trioses triploid 130–1 79, reticulum (SER) 31 tRNA 66, 71 71 (chromosomes) 128 microscope 13 DNA 66, 67 nuclei 81, 152 128–9 (transfer RNA) 62, 66, 70, 71 50–1 20–1, somatic gene therapy somatic mutations trophoblast 115 165, 166, 171 52–3 speciation trypsin 128 tube 138 49 nuclei 149 R species R groups radicles rDNA (amino acids) 13, 15, specicity of 49 sperm 152 (recombinant recessive alleles recessive sugars 82, molecules 160, 161, spermatogenesis 113 sporangiophores 95 epistasis reducing DNA) tumour 138–9 sporangium 103 6, spores 18 81, 162, tunica 48 turgor 162 suppressor albuginea turgid 164 cells DNA 64–5, 69, 72, 76 stabilising 161 pressure 43 145 U 148 selection 148, starch 144–7 plants starch 146–53 reproductive isolation stem 138–9 18, 21, synthetase cells 160, (rough endoplasmic reticulum) 31 stigmas uterine artery uterine cycle microscopes restriction enzymes restriction sites 26 170 77 166 151 158, 164 159 structural 112 166 48 uterus resolution of stroma 164 50–3 uterine vein RER 10 8 tests for 158–71 acids 63 urethra human 76 151 uracil asexual 34, 136 unsaturated fatty stamens reproduction 77 43 145 145, genes unicellular organisms replication of genes 92 V stutter 112 reverse transcriptase rhizomes ribose rice, substrates 146 subtilisin 31, genetic RNA substitution 117 63 ribosomes mutation 32, 66, 68, modication (ribonucleic acid) sucrase 71 sucrose 120–1 62–3, 66, 67 , sugars rough endoplasmic rRNA (ribosomal reticulum RNA) (RER) 31 49, 129, 51, 52, 130–1 56–7 48 158, 30 33 43 164 85, deferens vectors 18–19 unit symbiosis 39, variation vas 6–7 , 6–7 , vacuoles vagina 48 sympatric 62 48, 49 Svedberg 68 129 mutation 13, 124–7 , 160, (genetic 140–1 164 engineering) vegetative propagation vegetative reproduction vertical transmission of speciation 138, 138–9 vesicles vulva 146–7 genes 39 158 W saturated fatty SCID (severe acids temperature combined immunodeciency scrotum telophase of 10 syndrome) 114 templates test 160 secondary oocytes secretory phase of seed 153 82, 158, uterine 163, cycle and testa 170 testerone enzymes 79, 57 (polynucleotides) crosses 164 nuclear division 64 83 water 4–5 water potential segregation of testes alleles self-incompatibility 188 84, 151 85, 92, 95 153 Z 160, 160, thymine tissue 40–3 95 161, 169 zygotes coat 38–9, 161, 63, 164 64 culture 147 76, 80, 84, 112 147 T S 28 10 endosperm trisomies 83 mRNA 70, 113 6 triplets, 148–53 endoplasmic 68–9 66, electron triglycerides 97 72, 66, 62, translocation tripeptides anaemia DNA (tRNA) translation of 162 72 chromatids smooth investigations 34 transgenic organisms 158–71 cell sister 65 reproduction human 62 64, 164 endoplasmic sex sexual 95 114 pyrimidines qualitative 164 seminiferous tubules proto-oncogenes protogyny 36 tissues 153 transcription of 31 66–71 12–17 , 160, 150, 164–5 135 Biology for Unit 1 CAPE® Achieve your potential Developed guide in will CAPE® exclusively provide by Biology an syllabus information key ● ● to Engaging the with additional experienced in and an learning designed ● the Caribbean Examinations support to Council®, maximise your this study performance Biology. Written the you with team examination, easy-to-use outcomes enhance activities of your that teachers this study double-page from study help the of you and guide and subject , develop the in covers format . syllabus the experts Each all a CAPE® the topic contains such the essential begins range of with features as: analytical skills required for examination Examination tips with essential advice on succeeding in your assessments Did You Know? boxes to expand your knowledge and encourage further study This study choice also questions examiner Biology The guide and feedback, includes sample to build a fully interactive examination skills and answers confidence Caribbean Examinations Thornes subjects at to CSEC® produce and a Council series (CXC®) of with in O x f o rd has Study multiple- accompanying preparation for the CAPE® worked Guides exclusively across a wide with range of CAPE®. How of incorporating examination. Nelson Pa r t CD, University P re s s to get in touch: web www.oup.com/caribbean email schools.enquiries.uk@oup.com tel +44 (0)1536 452620 fax +44 (0)1865 313472
