The Journal of Infectious Diseases
MAJOR ARTICLE
Molecular Epidemiology of Mansonella Species in Gabon
Thaisa Lucas Sandri,1,2,a Andrea Kreidenweiss,1,3,4,a Simon Cavallo,1 David Weber,1 Sascha Juhas,1 Miriam Rodi,1 Tamirat Gebru Woldearegai,1,3,4
Markus Gmeiner,1 Luzia Veletzky,3,5 Michael Ramharter,3,5, Gildas B. Tazemda-Kuitsouc,6 Pierre Blaise Matsiegui,6 Benjamin Mordmüller,1,3,4 and Jana Held1,3,4
1
Institute of Tropical Medicine, University of Tübingen, Tübingen, Germany, 2Laboratory of Molecular Immunopathology, Department of Clinical Pathology, Federal University of Paraná, Curitiba,
Brazil, 3Centre de Recherches Médicales de Lambaréné, Lambaréné, Gabon, 4German Center for Infection Research, partner site Tübingen, Tübingen, Germany, 5Department of Tropical Medicine,
Bernhard Nocht Institute for Tropical Medicine and I. Department of Medicine, University Medical Center Hamburg-Eppendorf, Hamburg, Germany, and 6Centre de Recherches Médicales de la
Ngounié, Fougamou, Gabon
Mansonella perstans, a filarial nematode, infects large populations in Africa and Latin America. Recently, a potential new species,
Mansonella sp “DEUX,” was reported. Carriage of endosymbiotic Wolbachia opens treatment options for Mansonella infections. Within a
cross-sectional study, we assessed the prevalence of filarial infections in 834 Gabonese individuals and the presence of the endosymbiont
Wolbachia. Almost half of the participants (400/834 [48%]) were infected with filarial nematodes, with Mansonella sp “DEUX” being the
most frequent (295/400 [74%]), followed by Loa loa (273/400 [68%]) and Mansonella perstans (82/400 [21%]). Being adult/elderly, male,
and living in rural areas was associated with a higher risk of infection. Wolbachia carriage was confirmed in M. perstans and Mansonella
sp “DEUX.” In silico analysis revealed that Mansonella sp “DEUX” is not detected with currently published M. perstans–specific assays.
Mansonella infections are highly prevalent in Gabon and might have been underreported, likely also beyond Gabon.
Keywords. Mansonella perstans; Mansonella sp “DEUX”; Loa loa; Wolbachia; epidemiology; coinfection; real-time polymerase
chain reaction.
Mansonella species are among the most common filarial
nematodes infecting humans and occur widely across Africa
and Latin America. More than 100 million people are infected
with Mansonella perstans in Africa and at least 600 million
are at risk [1]. These filarial nematodes are transmitted by
female midges of the genus Culicoides when taking a blood
meal [2]. While adult worms reside in the body cavities of an
infected host, their offspring circulate as microfilariae in the
peripheral blood.
The complex of human infective Mansonella species includes
M. perstans, Mansonella ozzardi, and Mansonella streptocerca.
Recently, a potentially new species or genotype called
Mansonella sp “DEUX” was discovered in febrile children in
a hospital-based survey in Gabon [3]. Clinical manifestations
and pathology of M. perstans are poorly defined. A variety of
symptoms have been associated with infections, including
itching, swelling, joint pain, enlarged lymph nodes, vague abdominal symptoms, and eosinophilia [4]. While the presence
of adult filarial nematodes is challenging to verify, microfilariae
can be detected by microscopy or polymerase chain reaction
Received 3 August 2020; editorial decision 10 September 2020; accepted 20 October 2020;
published online October 25, 2020.
a
T. L. S. and A. K. contributed equally to this work.
Correspondence: Dr rer nat Jana Held, Institute of Tropical Medicine, Eberhard-Karls
University, Wilhelmstraße 27, D-72074 Tübingen, Germany (janaheld@hotmail.de).
The Journal of Infectious Diseases® 2021;223:287–96
© The Author(s) 2020. Published by Oxford University Press for the Infectious Diseases Society
of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
DOI: 10.1093/infdis/jiaa670
(PCR) and thus serve as diagnostic evidence for infection [4,
5]. Mansonella spp often occur as coinfection as there is a vast
geographic overlap of endemicities with many parasites like
Plasmodium spp and filarial nematodes such as Loa loa, another nonlymphatic filarial species [6]. Observations suggest
that filarial infections could modulate the immune response
and thereby influence the host’s response [7, 8]. Loa loa gained
attention as a disease of public health concern because of its
disease burden [9] and the negative impact on the control of
onchocerciasis and lymphatic filariasis in areas of coendemicity,
as severe complications can occur when ivermectin is given [10,
11]. Highly sensitive diagnosis and filarial species identification
are nowadays based on molecular assays detecting filarial ribosomal internal transcribed spacer 1 region (ITS1) DNA [12].
Interestingly, most filarial nematodes carry the endosymbiont
Wolbachia (Rickettsiales), which is also found in many insects
[13, 14]. Nematode species causing lymphatic filariasis (Brugia
malayi, Wuchereria bancrofti) and river blindness (Onchocerca
volvulus) are known to carry Wolbachia [13, 15], whereas L. loa
does not [16–18]. Wolbachia is often essential for the survival
and reproduction of filarial nematodes and presents an attractive target for antifilarial treatment strategies [13]. Mansonella
perstans was only recently confirmed to harbor Wolbachia (clade
F) [16, 19, 20]. Further evidence comes from a clinical trial
where doxycycline was an effective therapy for M. perstans infections [21, 22]. Nonetheless, Wolbachia cannot always be found
in M. perstans microfilariae samples, most likely due to limited
assay sensitivity. Other possible explanations include the coexistence of Wolbachia-positive and -negative Mansonella strains,
Prevalence of Mansonella sp “DEUX” in Gabon • jid 2021:223 (15 January) • 287
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
(See the Editorial Commentary by Bélard and Gehringer, on pages 187–8.)
were based on the aim of detecting rare infections (<0.5% prevalence), also including accessibility and feasibility. Study population was recruited by convenience, including everybody who
was willing to participate in the selected villages and older than
1 year. Study details and results of Plasmodium spp prevalence
have been previously published [29, 30]. In brief, any individual
≥1 year of age living in the mentioned area was invited to participate in the study; written informed consent was obtained from
individuals aged ≥18 years or parents/legal guardians for children
(aged <18 years) before enrollment. Additionally, written assent
was obtained from adolescents ≥12 years old. The study protocol was approved by the Institutional Ethics Committee at the
Centre de Recherches Médicales de Lambaréné, Gabon (CEI007/2014). At the time of blood collection, axillary body temperature was measured (fever was defined as ≥38°C), and any
symptom as reported by the participants was recorded. Venous
blood was collected in ethylenediaminetetraacetic acid tubes,
thick and thin blood smears were performed, blood spots were
done on Whatman FTA Cards (Merck), and 500 µL blood was
stored in RNAlater (ThermoFisher Scientific).
Microscopy
Extended STROBE (Strengthening the Reporting of
Observational Studies in Epidemiology) guidelines for reporting
molecular epidemiology for infectious diseases (STROME-ID)
studies are followed and applied to this manuscript.
Thick blood smears (TBSs) of 10 µL blood were stained with
Giemsa solution [16] and read on the day of sampling to determine Plasmodium spp parasitemia [29, 30]. TBS of individuals
positive for pan-filaria by PCR were re-read later by 2 independent readers, and microfilaria were counted irrespective of
filarial species (number of microfilariae per milliliter of blood
[mf/mL]). Micrographs from slides of 6 real-time PCR (qPCR)–
confirmed Mansonella sp “DEUX” monoinfections were taken
with a Leica DMBL microscope using ProgRes C10 plus camera
and software (Jenoptik) at ×100 magnification.
Study Population
DNA Extraction
An observational, cross-sectional study was conducted in
February 2016 in 13 villages in the area of Fougamou, Gabon,
including 834 individuals (Table 1). Sample size considerations
DNA of 400 µL blood was extracted by QIAsymphony SP using
the QIAsymphony DSP DNA Mini Kit (Qiagen) for automated
DNA extraction. DNA from blood spots was extracted manually
MATERIALS AND METHODS
Table 1.
Baseline Characteristics of the Study Population
Characteristic
No.
Age, y, median (range)
Sex, female/male
Fever (≥38°C)
Location (rural/semiurban)
Total
Children
834
Adults
365
Elderly
303
166
23
(1–96)
7
(1–17)
38
(18–59)
69
(60–96)
459/375
(55/45)
177/188
(48/52)
173/130
(57/43)
109/57
(66/34)
24
624/210
(3)
(75/25)
(0)
(81/19)
Pan-filaria qPCR positive
400
(48)
130
(36)
171
(56)
99
(60)
Pan-Plasmodium TBS positive
311
(37)
179
(49)
99
(33)
33
(20)
64
(3–57 000)
31
(2–4900)
234
(77)
118
(71)
Pan-Plasmodium, p/µL, median (range)
185
618
(2–417 000)
(74)
433
263
(8–417 000)
(72)
1700
(27)
0
135/31
163
(100–27 300)
82
(1)
(76/24)
1600
400
(5)
4
231/72
Pan-filaria TBS positive
(100–84 600)
17
(5)
(71/29)
Pan-filaria, mf/mL, median (range)
Pan-Plasmodium qPCR positive
(20)
20
258/107
(100–62 700)
64
(39)
1700
(100–84 600)
Data are presented as No. (%) unless otherwise indicated.
Abbreviations: mf/mL, number of microfilariae per milliliter of blood; p/µL, number of Plasmodium spp parasites per microliter of blood; qPCR, real-time polymerase chain reaction; TBS,
thick blood smear.
288 • jid 2021:223 (15 January) • Sandri et al
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
as observed in other nematodes (Loxodontofilaria caprini,
Onchocerca japonica) [23]. Evidence of Wolbachia in filarial
nematodes is based on molecular detection of specific genes,
including the bacteria-specific ftsZ gene (filamenting temperature sensitive protein Z gene) [2, 16, 18–20, 24], responsible for
cell division. This gene is a robust target for Wolbachia identification and characterization across different supergroups [20,
24] that originated through multiple interphylum inserts due to
Wolbachia/host coevolution (as seen in supergroups C, D, F, and
J for Nematoda) [25]. So far, no study has investigated whether
Mansonella sp “DEUX” carries Wolbachia.
Despite M. perstans being among the most frequent filarial
nematodes in Africa, in-depth investigations of phylogeny,
pathogenicity, biology, transmission, and interventions are
scarce [1]. Most of these approaches in Central Africa and Latin
America suffer from bias by data only obtained from selected
populations, for example, during hospital-based surveys [19,
26–28]. Therefore, the purpose of this study was to determine
the prevalence of M. perstans and Mansonella sp “DEUX” infections in the population living in semiurban and rural areas of
Gabon, to assess the status of Wolbachia as an endosymbiont of
the studied Mansonella spp, and to define populations at risk of
infection. A particular focus was set on Mansonella sp “DEUX”
to provide more data on epidemiology and morphology of this
newly reported species/genotype.
Screening for filarial species
- pan-filaria partial ITS1 qPCR
Filarial species
detection
All samples
(Step 1)
Species-specific assays
(Step 3)
L. loa
- specific ITS1qPCR
M. perstans
- specific ITS1qPCR
Endosymbiont
preamplification
(Step A)
Preamplification step
- ftsZ PCR
Endosymbiont detection
(Step B)
Wolbachia supergroup
- specific ftsZ qPCR
M. sp “DEUX”
- specific ITS1qPCR
Figure 1. Flowchart of molecular epidemiologic analysis. Abbreviations: ITS1, internal transcribed spacer 1; PCR, polymerase chain reaction; qPCR, real-time polymerase
chain reaction.
using QIAamp DNA Blood Mini Kit (Qiagen) and eluted with
100 µL elution buffer.
Plasmodium Species Detection
Details of molecular assays for the detection of Plasmodium spp
were described in 2 previous publications [29, 30].
Positive and Negative Controls
DNA from O. volvulus female adult worms (a Wolbachia carrier)
was extracted manually using QIAamp DNA Blood Mini Kit
with a lysing pre-step using Lysing Matrix Z (MP Biomedicals
Europe). Onchocerca volvulus DNA was used as positive control for both pan-filaria detection and Wolbachia assays, and as
a negative control for filarial species–specific assays. DNA from
M. perstans, Mansonella sp “DEUX,” and L. loa was confirmed
by sequencing and used as species-specific positive controls, and
also as a negative control for other filarial species-specific assays.
Nuclease-free water was always included as negative control.
In Silico Analysis of Mansonella sp “DEUX”
Specificity of published M. perstans primers and probes
targeting the ITS1 region were analyzed in silico for the detection of Mansonella sp “DEUX.” Therefore, M. perstans primers/
probes sequences were selected from PubMed publications
until 29 February 2020, using the search terms “mansonella”
OR “mansonella perstans” AND “PCR”. The 34 retrieved publications were screened for molecular diagnosis and primers/
probes sequences targeting the ITS1 region. Seven sets of primers/probes detecting filarial species (Mansonella spp, L. loa)
[3, 12, 20, 32–34] and 4 sets specifically for M. perstans [3, 32,
34, 35] were identified. Oligonucleotide binding specificity
(identity) to the ITS1 region of available Mansonella sp “DEUX”
(GenBank accession numbers KR080185 and KR080186) was
assessed in silico (pairwise alignment) using Geneious. Only
complete alignment was considered as matching and amplifying the gene (Table 2).
Microfilariae Detection
Primers and Probes
All primers, probes, and reaction conditions used are displayed in Supplementary Tables 1 and 2. New oligonucleotides were designed based on the reference sequences listed
in Supplementary Table 3 using Geneious version 11.0.3
(Biomatters) software. Specificity was confirmed in silico using
the BLAST Sequence Analysis Tool [31]. The workflow is displayed in Figure 1. Samples and controls were tested in triplicate
using LightCycler 480 II (Roche Life Sciences). PCR was done
on a Mastercycler Nexus Gradient Cycler (Eppendorf).
All samples were screened by a pan-filarial, singleplex, qPCR
assay (step 1) using primers and probes targeted to the ribosomal ITS1 rDNA with shared homology among all filarial
species. Positive and inconclusive samples were submitted to a
preamplification PCR (step 2) of the complete ITS1 region to
increase sensitivity. To determine the species L. loa, M. perstans,
or Mansonella sp “DEUX,” species-specific qPCR assays
were done (step 3). The distinction between M. perstans and
Mansonella sp “DEUX” was based on probe specificity, using
the same primer set.
Prevalence of Mansonella sp “DEUX” in Gabon • jid 2021:223 (15 January) • 289
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
Wolbachia detection
Preamplification
- complete ITS1PCR
Positive and
inconclusive samples
(Step 2)
Table 2.
In Silico Analysis of Mansonella sp “DEUX” Detection by Published Pan-Filarial and Mansonella perstans Primers and Probes
Target
Oligonucleotide ID
Sequence 5′-3′
Mansonella sp “DEUX” Detection
Reference
Pan-filaria
UNI1R
CGCAGCTAGCTGCGTTCTTCATCG
No
[12, 33]
FIL-1F
GTGCTGTAACCATTACCGAAAGG
FIL-2F
GGTGAACCTGCGGAAGGATC
FIL-2R
TGCTTATTAAGTCTACTTAA
ITS1-F
GGTGAACCTGCGGAAGGATC
ITS1-R
CTCAATGCGTCTGCAATTCGC
CAATTACTAGGAAGGCGTCC
AATAGCGGATTTGGCAGCTA
Mansonella sp and Loa loa probe
CGGTGATATTCGTTGGTGTCT
Pan-filaria forward
GGTGAACCTGCGGAAGGATC
Pan-filaria reverse
CTCAATGCGTCTGCAATTCGC
Mansonella sp forward
CCTGCGGAAGGATCATTAAC
Mansonella sp reverse
ATCGACGGTTTAGGCGATAA
Mansonella sp probe
CGGTGATATTCGTTGGTGTCT
Filaria PreAmp forward
CCTGCGGAAGGATCATTAWC
Filaria PreAmp reverse
TCGCACTATTTATCGCAGCTAG
MPF1
CAATGAAATGTTATCCATA
MPR1
AAATGCTTATTAAGTCTACTTAATTAAT
Primer forward
CCTTCGAGCAATTACTAGGA
Primer reverse
TGACTTAATTGCCACTATAAGC
Probe
TTCACTTTTATTTAGCAACATGCA
Primer forward
AGGATCATTAACGAGCTTCC
Primer reverse
CGAATATCACCGTTAATTCAGT
Probe
TTCACTTTTATTTAGCAACATGCA
Mp_ITS1 forward
GGTGATATTCGTTGGTGTCTAT
Mp_ITS1 reverse
AGCTATCGCTTTATCTTCATCA
Mp_ITS1 probe
TCCAAATTATCGCCTAAACCGTCGA
Probably yesb
[35]
No
Yes
[3]
Yes
[34]
Yes
[20]
No
[35]
No
[3]
No
[34]
Yes
[32]
a
Forward primer binds but reverse primer out of length in the available Mansonella sp “DEUX” sequences. However, this region is very conserved among other Mansonella species.
b
Out of length in the available sequences but very conserved among other Mansonella species.
Wolbachia Detection
Positive samples for M. perstans or Mansonella sp “DEUX”
or both were analyzed for the presence of Wolbachia. After
preamplification of the Wolbachia ftsZ gene by PCR (step A),
Wolbachia-specific qPCR was performed (step B). Both assays
are able to detect Wolbachia from supergroups C, D, F, and J,
known to be endosymbionts of nematodes [25].
Sequencing
Sanger sequencing of filarial species–specific qPCR products
(from step 3) was performed to confirm the qPCR assays’ specificity. To establish the Mansonella sp “DEUX” species–specific
qPCR (step 3), the pan-filarial ITS1 region (from step 2) was
sequenced after preamplification using the KAPA HiFi HotStart
PCR Kit (Roche).
Statistical Analysis
Descriptive statistics such as sociodemographic data of study
participants, numbers of filarial and Plasmodium spp infections,
and coinfections were obtained by direct counting. Microscopic
microfilaria and Plasmodium spp densities are given as median, range, and interquartile range (IQR). χ 2 or Fisher exact
tests were done to identify differences in frequencies of risk
factors between and within age groups (<18 years, children;
290 • jid 2021:223 (15 January) • Sandri et al
18–59 years, adults; and ≥60 years, elderly]), sex (female and
male), environment (rural and semiurban), and fever (≥38°C).
Fougamou was considered as semiurban and the other villages
as rural. Odds ratios (ORs) and 95% confidence intervals (CIs)
were used to specify the association between groups, and the
variable for age, sex, environment, or multiplicity of infection
(monospecies and multiple filarial species infections). Risk
factor analyses were not corrected for multiple comparisons.
P values <.05 were considered significant. All analyses were
done with GraphPad Prism software version 8.4.2 (GraphPad
Software).
RESULTS
Prevalence of Filarial Species
An observational, cross-sectional study was conducted during
the rainy season within 1 month (February 2016) in Fougamou
and surrounding villages, a semiurban to rural region in Gabon.
Peripheral blood was sampled from 834 individuals to assess
the prevalence of filarial and Plasmodium species (see Table 1
for baseline data). Microfilariae of filarial species (Mansonella
spp and L. loa) were detected by microscopy in 20% (163/834)
and by qPCR in 48% (400/834) of individuals; 38% (320/834)
were infected with Mansonella spp (Table 3). Interestingly,
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
Mansonella perstans
Mansonella sp and Loa loa forward
Mansonella sp and Loa loa reverse
Probably yesa
3
8
47
15
7
25
2
30
105
61
24
56
1
0
43
0
16
71
49
64
209
6
3
129
13
57
238
142
84
316
69
35
196
Semiurban
(n = 210)
Rural
(n = 624)
Female
(n = 459)
Location, No.
Male
(n = 375)
204
47
153
144
3
38
37
3
74
11
30
≥60
(n = 166)
99
25
72
77
0
14
24
0
33
5
20
Sex, No.
8
29
5
6
18
55
Mansonella perstans + Mansonella sp “DEUX”
M. perstans + Mansonella sp “DEUX” + Loa loa
58
44
More than half of all pan-filaria–positive individuals (227/400
[57%]) were concomitantly infected by a second or even third
filarial species (Figure 2). Concomitant filarial infection of
Mansonella sp “DEUX” and L. loa was most frequent (135/400
[34%]); another 14% (55/400) were infected by 3 filarial species. The majority (81%) of filarial species–positive individuals of all age groups were coinfected with Plasmodium spp
(Supplementary Table 4). Among Mansonella sp “DEUX”–infected children as well as among L. loa–infected children,
84% (85/101) and 96% (66/69), respectively, were positive for
Plasmodium spp. Of the Mansonella sp “DEUX”/Plasmodium
spp–coinfected children, only 5% (4/85) presented fever,
but 60% (51/85) reported any symptom. Among the
L. loa/Plasmodium spp–positive children, 4% (4/101) had fever
and 61% (62/101) reported any symptom. History of fever was
Pan-filaria positive
Loa- loa
Mansonella sp “DEUX”
Mansonella perstans
80
15*
135
3
55
87
18
6
Pan-filaria negative: 435
Triple infection
Mansonella sp “DEUX” + Loa loa
135
3
0
37
19
Loa loa
3
Double infection
Mansonella perstans + Loa loa
80
27
46
Mansonella sp “DEUX”
87
5
1
127
69
Loa loa
6
Monoinfection
Mansonella perstans
273
122
101
Mansonella sp “DEUX”
295
45
12
171
130
82
Pan-filaria positive
Filarial species
Mansonella perstans
400
18–59
(n = 303)
1–17
(n = 365)
Age, y, No.
Total, No.
(N = 834)
Organism
Infection
Table 3.
Filarial Species Prevalence by Age Group and Demographic Data Based on Real-Time Polymerase Chain Reaction
Parasitic Coinfections
Figure 2. Numbers of filarial infections in the study population. *Filarial species
not determined.
Prevalence of Mansonella sp “DEUX” in Gabon • jid 2021:223 (15 January) • 291
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
among pan-filarial, qPCR-positive individuals, infections
with the newly reported Mansonella sp “DEUX” were most
prevalent, with a proportion of 74% (295/400), followed by L.
loa with 68% (273/400) and M. perstans with 21% (82/400).
Microfilaria density determined by microscopy ranged from
100 to 84 600 mf/mL with a median of 1600 (IQR, 200–6000)
mf/mL blood for all 163 microscopic pan-filarial–positive individuals. Microscopic L. loa–monoinfected participants (n = 55)
had a median microfilaremia of 1900 (IQR, 350–6000) mf/mL,
whereas Mansonella sp “DEUX”–monoinfected participants
(n = 14) had only a median microfilaremia of 100 (IQR, 100–
100) mf/mL. Only 1 participant presented a microscopically
detectable monoinfected M. perstans microfilaremia (100 mf/
mL).
Nineteen samples were positive by pan-filarial qPCR (step
1) but did not reveal any species-specific qPCR result. By
sequencing, 4 of 19 (all 4 were microscopy positive) were confirmed to be L. loa; the remaining 15 samples could not be further specified (1 TBS positive, 100 mf/mL).
B
C
D
Giemsa-stained blood smears with Mansonella perstans (A) and Mansonella sp “DEUX” (B–D) microfilariae (×100 magnification).
the most commonly reported symptom. Coinfections of up to 5
different parasite species frequently occurred in the study population (Supplementary Table 4).
In Silico Analysis of Mansonella sp “DEUX” Assays
Published primer/probe sets for the ITS1 ribosomal DNA
region of pan-filaria and M. perstans for nucleic acid amplification assays (PCR, qPCR) were analyzed in silico to determine their ability to detect Mansonella sp “DEUX” infections
(Table 2). All pan-filarial oligonucleotides were identical to the
related region of available sequences of Mansonella sp “DEUX”
(GenBank accession numbers KR080185 and KR080186). In
contrast, only 1 of 4 M. perstans–specific primer/probe assays
would also specifically detect Mansonella sp “DEUX”; others
presented no matching primer pair [3], 2 mismatches near the
3′ region of primers/probe [35], and primer binding to an 11
bp-deletion site [34]. Thus, a large proportion of Mansonella infections might remain undetected and actual prevalence might
often be higher, at least in Gabon. Here, we established novel
sets of primers and probes to detect Mansonella sp “DEUX”
specifically in a qPCR assay.
Generated sequences of the ITS1 region of monoinfected
Mansonella sp “DEUX” samples were deposited in GenBank.
All 11 Mansonella sp “DEUX” sequences (accession numbers
MN821044, MN821045, MN821046, MN821047, MN821048,
MN821049, MN821050, MN821051, MN821052, MN821053,
and MN821054) were identical to variant 2 (KR080186) reported before [3]. Moreover, generated sequences of M. perstans
(MN821068) and L. loa (MN821065, MN821066, MN821067,
and MN832596) were identical to those previously found in
Gabon.
Wolbachia as Endosymbiont
Depending on the filarial species, colonization by endosymbiotic bacteria Wolbachia has been reported and was also identified for M. perstans but not for L. loa. Here, Wolbachia was
detected in 41% (116/282) of M. perstans and Mansonella
sp “DEUX”–coinfected samples. Additionally, 33% (26/79)
of Mansonella sp “DEUX” monoinfections and all (4/4)
M. perstans monoinfections were positive for Wolbachia. Seven
L. loa–monoinfected samples were investigated for Wolbachia
presence, and all were negative as expected.
Mansonella sp “DEUX”
Risk Factors for Filarial Infections
Morphology of Mansonella sp “DEUX” microfilariae resemble
M. perstans by visual inspection via ×100 magnification by microscopy of Giemsa-stained TBSs (Figure 3). Microfilariae of
both species appear unsheathed and smaller than L. loa.
Microfilaremia was detected in 59% (99/166) of the elderly,
in 56% (171/303) of adults, and in 36% (130/365) of children.
Men were more often found to be infected than women (54%
[204/375] vs 43% [196/459]). 51% of the total rural population
292 • jid 2021:223 (15 January) • Sandri et al
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
Figure 3.
A
…
.8 (.5–2.0); .39
10 (6.3–18.7); <.0001
…
1.1 (.8–1.6); .44
…
…
Compared to children, no significance was found when comparing adult vs elderly.
a
Abbreviations: CI, confidence interval; OR, odds ratio.
Not corrected for multiple comparisons. Numbers in bold show P values smaller than 0.05
…
…
Mansonella sp
“DEUX” infection
…
1.7 (1.2–2.3); .004
1.9 (1.02–3.4); .04
…
…
Semiurban
1.5 (1.1–2.1); .008
5.2 (2.6–10.3); <.0001
2.8 (1.9–4.1); <.0001
Elderly (≥60)
Environment
Rural
1.6 (1–2.8); .08
3.7 (2.5–5.6); <.0001
2 (1.4–2.9); .0005
…
1.5 (.9–2.4); .08
…
3.1 (2.2–4.3); <.0001
1.8 (1.3–2.4); .0007
…
…
1.5 (1.2–2.1); .004
…
…
5.1 (2.7–9.9); <.0001
…
2.3 (1.7–3.2); <.0001
Children (1–17)
Agea, y
Adult (18–59)
1.5 (1–2.3); .04
1.6 (1.2–2.1); .0018
…
1.7 (1.1–2.7); .02
1.6 (1.2–2.1); .0008
…
Female
Male
Sex
…
Multiple vs Monoinfection,
OR (95% CI); P Value
Loa loa, OR (95% CI); P Value
Mansonella sp “DEUX”,
OR (95% CI); P Value
Mansonella perstans,
OR (95% CI); P Value
Filarial Species Infection,
OR (95% CI); P Value
Risk Factor
Risk Factors for Filarial Infections
Table 4.
DISCUSSION
In this study, we assessed the prevalence of M. perstans and
the potential new Mansonella sp “DEUX” genotype/species,
including coinfections and risk factors for filarial infections,
as well as the presence of Wolbachia in Mansonella spp in an
observational, cross-sectional, community-based survey conducted in rural and semiurban areas in Gabon. Additionally, we
evaluated in silico if Mansonella sp “DEUX” microfilariae can be
detected by commonly used pan-filaria; and M. perstans–specific PCR/qPCR assays. As expected, the prevalence of filarial
infections was considerably higher using qPCR in contrast to
microscopy (48% vs 20%, respectively) [36], with 1 of 5 (20%)
of all filarial infections caused by M. perstans. This proportion
increased almost 4-fold (to 74%) when we did a Mansonella sp
“DEUX”–specific qPCR and even exceeded the proportion of
L. loa infections (68%) (coinfections included). Based on our
findings here, we fear that a large proportion of Mansonella spp
infections remain undetected when investigations are PCRbased. Microscopy-based investigations are less sensitive so that
the prevalence estimates are usually lower. For example, an occurrence of M. perstans between 10% and 6% of the individuals
microscopically screened was reported in other publications
from Gabon [37, 38], whereas we report 38% of Mansonella spp
infections (by qPCR) in the overall population.
Here, we provide the first micrographs of Mansonella sp
“DEUX” PCR-confirmed monoinfected individuals, which
appeared very similar to M. perstans. However, as microfilariae of the various filarial species resemble each other, light
microscopy analysis did not allow to identify species-specific
morphological characteristics, and more sophisticated methodologies are required in future investigations. No whole genome
for M. perstans is available that would allow for further genetic
comparisons and investigations regarding whether Mansonella
sp “DEUX” is actually a new species.
Mansonella sp “DEUX” was first described in a hospitalbased study in Gabon done from 2011 to 2014 [3]. This new
parasite was found in 12 febrile children, leading to the hypothesis that fever could be associated with the Mansonella
sp “DEUX” species/genotype. We could not find this
Prevalence of Mansonella sp “DEUX” in Gabon • jid 2021:223 (15 January) • 293
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
and 40% of the semiurban participants presented microfilaremia
(Table 3). For all risk factors assessed, see Table 4.
Men were at higher risk of filarial species coinfections. No
correlation was found between age and microfilaremia. In
addition, each of the 3 filarial species was more frequently
detected in adult and elderly males. In rural areas, participants were more frequently infected with Mansonella species,
but not with L. loa. Individuals infected with Mansonella sp
“DEUX” had a higher risk of being concomitantly infected
with either L. loa and/or M. perstans. Fever (body temperature ≥38°C) was not associated with Mansonella sp “DEUX”
infection.
294 • jid 2021:223 (15 January) • Sandri et al
Supplementary Data
Supplementary materials are available at The Journal of Infectious
Diseases online. Consisting of data provided by the authors to
benefit the reader, the posted materials are not copyedited and
are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.
Notes
Acknowledgments. We acknowledge all of the participants,
medical staff, drivers, community leaders, and professionals
who supported and contributed to the execution of this study.
We also thank Professor Dr Peter Soboslay, who kindly provided Onchocerca volvulus female adult worms to optimize the
reactions and to be used as DNA-positive control.
Financial support. This work was partly supported by the
German Center for Infection Research, within the Neglected
Tropical Diseases group.
Potential conflicts of interest. All authors report no potential
conflicts of interest.
All authors have submitted the ICMJE Form for Disclosure
of Potential Conflicts of Interest. Conflicts that the editors
consider relevant to the content of the manuscript have been
disclosed.
References
1. Simonsen PE, Onapa AW, Asio SM. Mansonella perstans filariasis in Africa. Acta Trop 2011; 120(Suppl 1):S109–20.
2. Ta-Tang TH, Crainey JL, Post RJ, Luz SL, Rubio JM.
Mansonellosis: current perspectives. Res Rep Trop Med
2018; 9:9–24.
3. Mourembou G, Fenollar F, Lekana-Douki JB, et al.
Mansonella, including a potential new species, as common
parasites in children in Gabon. PLoS Negl Trop Dis 2015;
9:e0004155.
4. Mediannikov O, Ranque S. Mansonellosis, the most neglected human filariasis. New Microbes New Infect 2018;
26:19–22.
5. Mathison BA, Couturier MR, Pritt BS. Diagnostic identification and differentiation of microfilariae. J Clin Microbiol
2019; 57:e00706–19.
6. Downes BL, Jacobsen KH. A systematic review of the epidemiology of mansonelliasis. African J Infect Dis 2010;
4:7–14.
7. Green HK, Sousa-Figueiredo JC, Basáñez MG, et al.
Anaemia in Ugandan preschool-aged children: the relative contribution of intestinal parasites and malaria.
Parasitology 2011; 138:1534–45.
8. Soboslay PT, Hamm DM, Pfäfflin F, Fendt J, Banla M,
Schulz-Key H. Cytokine and chemokine responses in patients co-infected with Entamoeba histolytica/dispar, Necator
americanus and Mansonella perstans and changes after antiparasite treatment. Microbes Infect 2006; 8:238–47.
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
association in our study as most Mansonella sp “DEUX”–infected individuals did not present fever. Even in Mansonella
sp “DEUX”/Plasmodium spp–coinfected children, only 5%
had fever, but history of fever was the most common symptom
in the studied population. However, considering the established clinical presentation of malaria and the chronic persistence of Mansonella spp in the human host, fever, and
history of fever reported in our survey are more likely to be
caused by Plasmodium spp infection than mansonellosis.
Triple infections with filarial species occurred in 14% of
all pan-filaria positives among an astonishing 18% of study
participants harboring an infection with 5 different parasite species (eg, Mansonella sp “DEUX,” M. perstans, L. loa,
Plasmodium falciparum, and Plasmodium malariae)—and
not overtly suffering from an acute, severe illness. Certainly,
multiple parasite infections in an individual are due to the
large geographical overlap of endemicity; nevertheless, it is
very remarkable how often coinfections occurred. Following
previous studies for M. perstans, we found Mansonella sp
“DEUX” occurring more frequently in adults and the elderly,
with the highest prevalence in men living in rural areas.
Mansonella sp “DEUX” can be detected by available panfilarial PCR/qPCR assays targeting the shared conserved ITS1
region, but it remains undetected when using specific M. perstans
primers/probes. Curiously, Mansonella rodhaini, also found in
Gabon in human skin biopsy samples, was originally described
as an ape-related filarial species [39]. Unfortunately, no genetic
information of ape-associated Mansonella species is available
to investigate whether Mansonella sp “DEUX” is related to
M. rodhaini or another African ape–associated Mansonella species (eg, M. gorillae, M. lopeensis, M. leopoldi, M. vanhoofi) [40].
With our study, we could confirm that also Mansonella sp
“DEUX” carries Wolbachia. As observed in previous studies
for M. perstans, only a fraction of samples were PCR positive
for this endosymbiotic bacteria, most likely due to limited
quantities of DNA reaching the detection limit of the PCR.
Whether Wolbachia presence is essential for M. perstans
is controversially discussed, but these bacteria provide an
Achilles’ heel to Mansonella spp viability, and the antibiotic
doxycycline was tested successfully in 2 independent clinical
trials [22, 32]. Antibiotic treatment is a promising strategy and
an alternative option to classical drugs (diethylcarbamazine,
ivermectin, and albendazole) commonly used against filarial
parasites, which present limited efficacy against M. perstans
[1, 27, 41].
This is a pioneering study on the community-based prevalence of Mansonella sp “DEUX” in populations of semiurban
and rural areas of Gabon, and on the characteristics of this potential new species/genotype. The new and specific qPCR assay
opens the opportunity for reanalysis of the Mansonella spp epidemiology and pathogenicity in endemic countries of Africa
and beyond.
25. Bordenstein SR, Paraskevopoulos C, Dunning Hotopp JC,
et al. Parasitism and mutualism in Wolbachia: what the
phylogenomic trees can and cannot say. Mol Biol Evol 2009;
26:231–41.
26. Onapa AW, Simonsen PE, Baehr I, Pedersen EM. Rapid
assessment of the geographical distribution of Mansonella
perstans infections in Uganda, by screening schoolchildren for microfilariae. Ann Trop Med Parasitol 2005;
99:383–93.
27. Asio SM, Simonsen PE, Onapa AW. Mansonella perstans filariasis in Uganda: patterns of microfilaraemia and clinical
manifestations in two endemic communities. Trans R Soc
Trop Med Hyg 2009; 103:266–73.
28. Bregani ER, Balzarini L, Mbaïdoum N, Rovellini A.
Prevalence of filariasis in symptomatic patients in Moyen
Chari district, south of Chad. Trop Doct 2007; 37:175–7.
29. Woldearegai TG, Lalremruata A, Nguyen TT, et al.
Characterization of Plasmodium infections among inhabitants of rural areas in Gabon. Sci Rep 2019; 9:9784.
30. Zoleko Manego R, Koehne E, Kreidenweiss A, et al.
Description of Plasmodium falciparum infections in central
Gabon demonstrating high parasite densities among symptomatic adolescents and adults. Malar J 2019; 18:1–6.
31. Madden T. The BLAST sequence analysis tool. BLAST
Seq Anal Tool. Bethesda, MD: National Center for
Biotechnology Information, 2013:1–17.
32. Batsa Debrah L, Phillips RO, Pfarr K, et al. The efficacy of
doxycycline treatment on Mansonella perstans infection: an
open-label, randomized trial in Ghana. Am J Trop Med Hyg
2019; 101:84–92.
33. Jiménez M, González LM, Bailo B, et al. Diagnóstico
diferencial de filariasis importada mediante técnicas
moleculares (2006–2009) [in Spanish]. Enferm Infecc
Microbiol Clin 2011; 29:666–71.
34. Bassene H, Sambou M, Fenollar F, et al. High prevalence of
Mansonella perstans filariasis in rural Senegal. Am J Trop
Med Hyg 2015; 93:601–6.
35. Jiménez M, González LM, Carranza C, et al. Detection
and discrimination of Loa loa, Mansonella perstans and
Wuchereria bancrofti by PCR-RFLP and nested-PCR
of ribosomal DNA ITS1 region. Exp Parasitol 2011;
127:282–6.
36. Raccurt CP, Brasseur P, Cicéron M, Boncy J. Epidemiologic
survey of Mansonella ozzardi in Corail, Haiti. Am J Trop
Med Hyg 2014; 90:1167–9.
37. Akue JP, Nkoghe D, Padilla C, et al. Epidemiology of concomitant infection due to Loa loa and Mansonella perstans
in Gabon. PLoS Negl Trop Dis 2011; 5:e1329.
38. Bouyou Akotet MK, Owono-Medang M, MawiliMboumba DP, et al. The relationship between
microfilaraemic and amicrofilaraemic loiasis involving
co-infection with Mansonella perstans and clinical symptoms
Prevalence of Mansonella sp “DEUX” in Gabon • jid 2021:223 (15 January) • 295
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
9. Veletzky L, Hergeth J, Stelzl DR, et al. Burden of disease in
Gabon caused by loiasis: a cross-sectional survey. Lancet
Infect Dis 2020; 20:1339–46.
10. Twum-Danso NA. Loa loa encephalopathy temporally related to ivermectin administration reported from onchocerciasis mass treatment programs from 1989 to 2001:
implications for the future. Filaria J 2003; 2(Suppl 1):S7.
11. Chippaux JP, Boussinesq M, Gardon J, Gardon-Wendel N,
Ernould JC. Severe adverse reaction risks during mass treatment with ivermectin in loiasis-endemic areas. Parasitol
Today 1996; 12:448–50.
12. Tang THT, López-Vélez R, Lanza M, Shelley AJ, Rubio JM,
Luz SLB. Nested PCR to detect and distinguish the sympatric filarial species Onchocerca volvulus, Mansonella
ozzardi and Mansonella perstans in the Amazon region.
Mem Inst Oswaldo Cruz 2010; 105:823–8.
13. Slatko BE, Luck AN, Dobson SL, Foster JM. Wolbachia
endosymbionts and human disease control. Mol Biochem
Parasitol 2014; 195:88–95.
14. Landmann F. The Wolbachia endosymbionts. Microbiol
Spectr 2019; 7:1–15.
15. Taylor MJ, Hoerauf A. Wolbachia bacteria of filarial nematodes. Parasitol Today 1999; 15:437–42.
16. Grobusch MP, Kombila M, Autenrieth I, Mehlhorn H,
Kremsner PG. No evidence of Wolbachia endosymbiosis
with Loa loa and Mansonella perstans. Parasitol Res 2003;
90:405–8.
17. McGarry HF, Pfarr K, Egerton G, et al. Evidence against
Wolbachia symbiosis in Loa loa. Filaria J 2003; 2:1–7.
18. Büttner DW, Wanji S, Bazzocchi C, Bain O, Fischer P.
Obligatory symbiotic Wolbachia endobacteria are absent
from Loa loa. Filaria J 2003; 2:10.
19. Keiser PB, Coulibaly Y, Kubofcik J, et al. Molecular identification of Wolbachia from the filarial nematode Mansonella
perstans. Mol Biochem Parasitol 2008; 160:123–8.
20. Gehringer C, Kreidenweiss A, Flamen A, Antony JS,
Grobusch MP, Bélard S. Molecular evidence of Wolbachia
endosymbiosis in Mansonella perstans in Gabon, Central
Africa. J Infect Dis 2014; 210:1633–8.
21. Rao RU, Huang Y, Abubucker S, et al. Effects of doxycycline
on gene expression in Wolbachia and Brugia malayi adult
female worms in vivo. J Biomed Sci 2012; 19:21.
22. Coulibaly YI, Dembele B, Diallo AA, et al. A randomized
trial of doxycycline for Mansonella perstans infection. N
Engl J Med 2009; 361:1448–58.
23. Ferri E, Bain O, Barbuto M, et al. New insights into the evolution of Wolbachia infections in filarial nematodes inferred
from a large range of screened species. PLoS One 2011;
6:e20843.
24. Baldo L, Dunning Hotopp JC, Jolley KA, et al. Multilocus
sequence typing system for the endosymbiont Wolbachia
pipientis. Appl Environ Microbiol 2006; 72:7098–110.
in an exposed population from Gabon. J Helminthol 2016;
90:469–75.
39. Richard-Lenoble D, Kombila M, Bain O, Chandenier J,
Mariotte O. Filariasis in Gabon: human infections
with Microfilaria rodhaini. Am J Trop Med Hyg 1988;
39:91–2.
40. Bain O, Moisson P, Huerre M, Landsoud-Soukate J, Tutin C.
Filariae from a wild gorilla in Gabon with description of a
new species of Mansonella. Parasite 1995; 2:315–22.
41. Goljan J, Nahorski W, Tomaszewski R, Felczak-Korzybska I,
Górski J. Diagnosing and treatment of skin filariases based
on own observations. Int Marit Health 2000; 51:51–61.
Downloaded from https://academic.oup.com/jid/article/223/2/287/5939539 by Universitaet Tuebingen user on 11 May 2023
296 • jid 2021:223 (15 January) • Sandri et al