Genetics, 6e (Brooker)
Chapter 1 Overview of Genetics
1) The basic unit of heredity is the ________.
A) individual
B) gene
C) macromolecule
D) trait
E) none of the answers are correct
Answer: B
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 1. Remember
Learning Outcome: 01.01.01 Describe the biochemical composition of cells
Accessibility: Keyboard Navigation
2) A variation of a gene is called a(n) ________.
A) species
B) morph
C) genome
D) allele
E) proteome
Answer: D
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.01 Outline how the expression of genes leads to an organism's traits.
Accessibility: Keyboard Navigation
3) Which of the following acts to accelerate chemical reactions in a cell?
A) Nucleic acids
B) Lipids
C) Carbohydrates
D) Enzymes
E) None of the answers are correct
Answer: D
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 2. Understand
Learning Outcome: 01.01.02 Explain how proteins are largely responsible for cell structure and
function.
Accessibility: Keyboard Navigation
1
Copyright © 2018 McGraw-Hill
4) The building blocks of DNA are the ________.
A) amino acids
B) carbohydrates
C) enzymes
D) nucleotides
E) lipids
Answer: D
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 1. Remember
Learning Outcome: 01.01.03 Outline how DNA stores the information to make proteins
Accessibility: Keyboard Navigation
5) If a carbohydrate is going to be broken down for energy, which of the following molecules
would be directly involved in the breakdown?
A) Catabolic enzymes
B) Nucleotides
C) Anabolic enzymes
D) Lipids
E) Chromosomes
Answer: A
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 2. Understand
Learning Outcome: 01.01.02 Explain how proteins are largely responsible for cell structure and
function.
Accessibility: Keyboard Navigation
6) RNA is formed by the process of ________.
A) transcription
B) translation
C) both transcription and translation
D) None of the answers are correct
Answer: A
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 1. Remember
Learning Outcome: 01.01.03 Outline how DNA stores the information to make proteins
Accessibility: Keyboard Navigation
2
Copyright © 2018 McGraw-Hill
7) A characteristic that an organism displays is called ________.
A) a gene
B) a chromosome
C) DNA
D) gene expression
E) a trait
Answer: E
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.01 Outline how the expression of genes leads to an organism's traits.
Accessibility: Keyboard Navigation
8) If a geneticist is studying the prevalence of a trait in a species, they are at the ________ level
of study.
A) population
B) organismal
C) cellular
D) molecular
Answer: A
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.01 Outline how the expression of genes leads to an organism's traits.
Accessibility: Keyboard Navigation
9) The study of the processes of transcription and translation is at the ________ level of
biological organization.
A) population
B) organismal
C) cellular
D) molecular
Answer: D
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.01 Outline how the expression of genes leads to an organism's traits.
Accessibility: Keyboard Navigation
3
Copyright © 2018 McGraw-Hill
10) Alternate versions of a specific gene are called ________.
A) nucleotides
B) chromosomes
C) alleles
D) traits
E) none of the answers are correct
Answer: C
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.01 Outline how the expression of genes leads to an organism's traits.
Accessibility: Keyboard Navigation
11) Genetic variation is ultimately based upon which of the following?
A) Morphological differences
B) Small variations in nucleotide sequence of the DNA
C) Carbohydrate content of the cell
D) Translation
Answer: B
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.02 Define genetic variation.
Accessibility: Keyboard Navigation
12) A species that contains two copies of each chromosome is called ________.
A) a genetic mutation
B) a morph
C) haploid
D) diploid
E) alleles
Answer: D
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.04 Describe how genes are transmitted in sexually reproducing
species.
Accessibility: Keyboard Navigation
4
Copyright © 2018 McGraw-Hill
13) A cell that makes up the body structure of an organism and is diploid is ________.
A) a gamete
B) a somatic cell
C) an allele
D) rare
E) a sperm cell
Answer: B
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.04 Describe how genes are transmitted in sexually reproducing
species.
Accessibility: Keyboard Navigation
14) In many organisms, one set of chromosomes comes from the maternal parent, while the other
set comes from the paternal parent. Similar chromosomes in these sets are said to be ________.
A) morphs
B) alleles
C) haploid
D) homologs
E) physiological traits
Answer: D
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.04 Describe how genes are transmitted in sexually reproducing
species.
Accessibility: Keyboard Navigation
15) In humans, gametes are different than other cells of the body in that they are ________.
A) diploid
B) haploid
C) genetic mutations
D) morphs
E) none of the answers are correct
Answer: B
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.04 Describe how genes are transmitted in sexually reproducing
species.
Accessibility: Keyboard Navigation
5
Copyright © 2018 McGraw-Hill
16) Which of the following is correct regarding natural selection?
A) It is based on competition for resources
B) Beneficial traits are passed on to the next generation
C) It enables a species to become better adapted to its environment
D) It may drastically change a species over time
E) All of the answers are correct
Answer: E
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.05 Explain the process of evolution.
Accessibility: Keyboard Navigation
17) ________ is the use of a gene sequence to synthesize a functional protein.
A) Loss-of-function mutation
B) Gene expression
C) The human genome project
D) Proteomics
E) None of the answers are correct
Answer: B
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 2. Understand
Learning Outcome: 01.01.03 Outline how DNA stores the information to make proteins
Accessibility: Keyboard Navigation
18) The differences in inherited traits among individuals in a population are called ________.
A) species variation
B) genetic mutations
C) genetic variation
D) natural selection
E) none of the answers are correct
Answer: C
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.02 Define genetic variation.
Accessibility: Keyboard Navigation
6
Copyright © 2018 McGraw-Hill
19) Three populations of an organism, each with drastically different external markings, but still
members of the same species, would be called ________.
A) homologs
B) mutants
C) communities
D) alleles
E) morphs
Answer: E
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.02 Define genetic variation.
Accessibility: Keyboard Navigation
20) The changes in the genetic makeup of a population over time is called ________.
A) homologous recombination
B) model organisms studies
C) genetic crosses
D) biological evolution
E) hypothesis testing
Answer: D
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.05 Explain the process of evolution.
Accessibility: Keyboard Navigation
21) Change in a population over time is called biological evolution.
Answer: TRUE
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.05 Explain the process of evolution.
Accessibility: Keyboard Navigation
22) Gene expression involves the process of transcription and translation.
Answer: TRUE
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 2. Understand
Learning Outcome: 01.01.03 Outline how DNA stores the information to make proteins
Accessibility: Keyboard Navigation
7
Copyright © 2018 McGraw-Hill
23) Sexual reproduction decreases the genetic variation of a species.
Answer: FALSE
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.04 Describe how genes are transmitted in sexually reproducing
species.
Accessibility: Keyboard Navigation
24) Which of the following studies the effects of loss-of-function mutations?
A) Population genetics
B) Transmission genetics
C) Molecular genetics
Answer: C
Section: 01.03
Topic: Fields of Genetics
Bloom's: 2. Understand
Learning Outcome: 01.03.01 Compare and contrast the three major fields of genetics:
transmission, molecular, and population genetics.
Accessibility: Keyboard Navigation
25) Which of the following uses a genetic cross to determine patterns of inheritance?
A) Population genetics
B) Transmission genetics
C) Molecular genetics
Answer: B
Section: 01.03
Topic: Fields of Genetics
Bloom's: 2. Understand
Learning Outcome: 01.03.01 Compare and contrast the three major fields of genetics:
transmission, molecular, and population genetics.
Accessibility: Keyboard Navigation
8
Copyright © 2018 McGraw-Hill
26) Which of the following studies the relationship between genetic variation and the
environment?
A) Population genetics
B) Transmission genetics
C) Molecular genetics
Answer: A
Section: 01.03
Topic: Fields of Genetics
Bloom's: 2. Understand
Learning Outcome: 01.03.01 Compare and contrast the three major fields of genetics:
transmission, molecular, and population genetics.
Accessibility: Keyboard Navigation
27) Which of the following began with the work of Gregor Mendel in the 19th century?
A) Population genetics
B) Transmission genetics
C) Molecular genetics
Answer: B
Section: 01.03
Topic: Fields of Genetics
Bloom's: 1. Remember
Learning Outcome: 01.03.01 Compare and contrast the three major fields of genetics:
transmission, molecular, and population genetics.
Accessibility: Keyboard Navigation
28) Which of the following studies how the forces of nature have influenced the spread of traits?
A) Population genetics
B) Transmission genetics
C) Molecular genetics
Answer: A
Section: 01.03
Topic: Fields of Genetics
Bloom's: 1. Remember
Learning Outcome: 01.03.01 Compare and contrast the three major fields of genetics:
transmission, molecular, and population genetics.
Accessibility: Keyboard Navigation
9
Copyright © 2018 McGraw-Hill
29) ________ influence the physical appearance of an organism.
A) Morphological traits
B) Physiological traits
C) Behavioral traits
Answer: A
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 1. Remember
Learning Outcome: 01.02.01 Outline how the expression of genes leads to an organism's traits.
Accessibility: Keyboard Navigation
30) DNA stores the information needed for the synthesis of cellular ________.
A) proteins
B) carbohydrates
C) lipids
Answer: A
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 2. Understand
Learning Outcome: 01.01.03 Outline how DNA stores the information to make proteins
Accessibility: Keyboard Navigation
31) Both genes and the ________ influence the traits of an organism.
A) genome
B) environment
C) population
Answer: B
Section: 01.02
Topic: The Relationship Between Genes and Traits
Bloom's: 2. Understand
Learning Outcome: 01.02.03 Discuss the relationship between genes and traits.
Accessibility: Keyboard Navigation
10
Copyright © 2018 McGraw-Hill
32) The class of macromolecules that are primarily responsible for catabolic and anabolic
activities in a cell are
A) nucleic acids.
B) proteins.
C) lipids.
D) carbohydrates.
Answer: B
Section: 01.01
Topic: The Molecular Expression of Genes
Bloom's: 1. Remember
Learning Outcome: 01.01.02 Explain how proteins are largely responsible for cell structure and
function.
Accessibility: Keyboard Navigation
33) What is the difference between hypothesis testing and discovery-based research?
A) Hypotheses can be validated or invalidated while discovery-based research relies more on
collection and analysis of data without a hypothesis.
B) Discovery-based science can be validated or invalidated while hypothesis based research
relies more on collection and analysis of data.
C) There is only one type of experimental approach, both terms describe the same approach.
D) Hypothesis-based research results in believable science while discovery-based research
results in unreliable conclusions.
Answer: A
Section: 01.04
Topic: The Science of Genetics
Bloom's: 2. Understand
Learning Outcome: 01.04.01 Discuss how genetics is an experimental science.
Accessibility: Keyboard Navigation
34) A scientist observes two new birds that appear to be morphologically similar. In order to
explain these observations, which strategy should the scientist employ as a first step?
A) Propose a hypothesis
B) Relate structure and function
C) Analyze data
D) Use statistics
Answer: A
Section: 01.04
Topic: The Science of Genetics
Bloom's: 3. Apply
Learning Outcome: 01.04.02 Outline different strategies for solving problems in genetics.
Accessibility: Keyboard Navigation
Chapter 2 Mendelian Inheritance
1) The theory of pangenesis was first proposed by ________.
11
Copyright © 2018 McGraw-Hill
A) Aristotle
B) Galen
C) Mendel
D) Hippocrates
E) None of the answers are correct
Answer: D
Section: 02.01
Topic: Studying Inheritance Patterns in Humans
Bloom's: 1. Remember
Accessibility: Keyboard Navigation
2) Which of the following is correct regarding the blending hypothesis of inheritance?
A) It suggested that hereditary traits blended from one generation to the next.
B) It was possible for the blending to change the trait from one generation to the next.
C) It was supported by early research by Joseph Kölreuter.
D) It was the prevailing hypothesis of inheritance prior to Mendel.
E) All of the answers are correct.
Answer: E
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 2. Understand
Accessibility: Keyboard Navigation
3) Mendel's work was rediscovered in 1900 by which of the following individual(s)?
A) Carl Correns
B) Erich von Tschermak
C) Hugh de Vries
D) All of the answers are correct
Answer: D
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Accessibility: Keyboard Navigation
12
Copyright © 2018 McGraw-Hill
4) Mendel's work on inheritance had an immediate influence on the scientific community and
theories of inheritance.
Answer: FALSE
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 2. Understand
Accessibility: Keyboard Navigation
5) Which of the following characteristics made the pea plant Pisum sativum an ideal organism
for Mendel's studies?
A) It has the ability to self-fertilize
B) It was easy to cross-fertilize one plant with another
C) It has easily identifiable traits
D) All of the answers are correct
Answer: D
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 2. Understand
Learning Outcome: 02.01.01 Describe the characteristics of pea plants that make them a suitable
organism to study genetically.
Accessibility: Keyboard Navigation
6) The anther represents the ________ portion of the plant, while the ovules represent the
________ portion of the plant.
A) Female; male
B) Male; female
C) Female; female
D) Male; male
Answer: B
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Learning Outcome: 02.01.02 Outline the steps that Mendel followed to make crosses between
different strains of pea plants.
Accessibility: Keyboard Navigation
13
Copyright © 2018 McGraw-Hill
7) Differences in plant flower color or plant height are called a variant of a trait.
Answer: TRUE
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Learning Outcome: 02.01.01 Describe the characteristics of pea plants that make them a suitable
organism to study genetically.
Accessibility: Keyboard Navigation
8) Which of the following traits was not studied by Mendel?
A) Flower color
B) Seed color
C) Pod color
D) Pollen color
E) Plant height
Answer: D
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Learning Outcome: 02.01.03 List the seven characteristics of pea plants that Mendel chose to
study.
Accessibility: Keyboard Navigation
9) When studying a genetic cross, the second generation following the initial cross is identified
by which of the following?
A) P generation
B) F1 generation
C) F2 generation
D) F3 generation
E) P3 generation
Answer: C
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.03 Predict the outcome of single-factor crosses using a Punnett
square.
Accessibility: Keyboard Navigation
14
Copyright © 2018 McGraw-Hill
10) A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow
pod plants. All of their offspring have green pods. From this information, it can be stated that the
green color is ________ to the yellow color.
A) recessive
B) dominant
C) subservient
D) blended
E) none of the answers are correct
Answer: B
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 2. Understand
Learning Outcome: 02.01.01 Describe the characteristics of pea plants that make them a suitable
organism to study genetically.
Accessibility: Keyboard Navigation
11) Mendel's work with monohybrid crosses provided proof of which of the following?
A) blending theory of inheritance.
B) particulate theory of inheritance.
C) chromosomal theory of inheritance
D) pangenesis
E) none of the answers are correct
Answer: B
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 2. Understand
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
12) Mendel's work with single-factor crosses resulted in the development of which of the
following?
A) Law of segregation
B) Law of independent assortment
C) Theory of natural selection
D) Law of biological evolution
E) All of the answers are correct
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.02 State Mendel's law of segregation and explain how it is related to
gamete formation and fertilization.
Accessibility: Keyboard Navigation
15
Copyright © 2018 McGraw-Hill
13) When Mendel crossed two plants that were heterozygous for a single trait, what was the
phenotypic ratio of their offspring?
A) 1:2:1
B) 9:3:3:1
C) 3:1
D) 7:4
E) Varied depending on the trait
Answer: C
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
14) When Mendel crossed two plants that were heterozygous for a single trait, what was the
genotypic ratio of their offspring?
A) 1:2:1
B) 9:3:3:1
C) 3:1
D) 1:1
E) Varied depending on the trait
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.03 Predict the outcome of single-factor crosses using a Punnett
square.
Accessibility: Keyboard Navigation
15) An individual who has two identical alleles for a trait is said to be ________.
A) homozygous
B) heterozygous
C) isozygous
D) a variant
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
16
Copyright © 2018 McGraw-Hill
16) The genetic composition of an individual is called its ________.
A) phenotype
B) genotype
C) hybrid
D) dominance
E) none of the answers are correct
Answer: B
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
17) The observable characteristics of an organism are called its ________.
A) phenotype
B) genotype
C) dominance
D) genes
E) none of the answers are correct
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
18) An individual who has two different alleles for a trait is called ________.
A) haploid
B) homozygous
C) heterozygous
D) isozygous
E) true-breeding
Answer: C
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
17
Copyright © 2018 McGraw-Hill
19) In a Punnett square diagram, the outside of the box represents the ________.
A) diploid offspring
B) haploid offspring
C) diploid gametes
D) haploid gametes
Answer: D
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.03 Predict the outcome of single-factor crosses using a Punnett
square.
Accessibility: Keyboard Navigation
20) Mendel's work with two-factor (dihybrid) crosses led directly to which of the following?
A) Chromosomal theory of inheritance
B) Particulate theory of inheritance
C) Law of segregation
D) Law of independent assortment
E) Theory of biological evolution
Answer: D
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 2. Understand
Learning Outcome: 02.03.02 State Mendel's law of independent assortment.
Accessibility: Keyboard Navigation
21) In a dihybrid cross using Mendelian inheritance, if both parents are heterozygous for both
traits, what will be the phenotypic ratio of their offspring?
A) 3:1
B) 1:2:1
C) 1:1
D) 9:3:3:1
Answer: D
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 1. Remember
Learning Outcome: 02.03.01 Analyze Mendel's experiments involving two-factor crosses.
Accessibility: Keyboard Navigation
18
Copyright © 2018 McGraw-Hill
22) In a dihybrid testcross, the individual being examined is crossed to which of the following?
A) An individual who is homozygous dominant for one trait but not the other
B) Self-fertilized
C) An individual who is homozygous recessive for both traits
D) An individual who is heterozygous for both traits
Answer: C
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 1. Remember
Learning Outcome: 02.03.03 Predict the outcome of two-factor crosses using a Punnett square.
Accessibility: Keyboard Navigation
23) In humans, patterns of inheritance are often studied using which of the following?
A) Dihybrid testcrosses
B) Production of true-breeding lines
C) Pedigree analysis
D) Self-fertilization
E) None of the answers are correct
Answer: C
Section: 02.04
Topic: Studying Inheritance Patterns in Humans
Bloom's: 1. Remember
Learning Outcome: 02.04.01 Describe the features of a pedigree.
Accessibility: Keyboard Navigation
24) The chance that a future event will occur is called ________.
A) probability
B) goodness of fit
C) degrees of freedom
D) random selection
E) all of the answers are correct
Answer: A
Section: 02.05
Topic: Probability and Statistics
Bloom's: 1. Remember
Learning Outcome: 02.05.01 Define probability.
Accessibility: Keyboard Navigation
19
Copyright © 2018 McGraw-Hill
25) A coin is flipped 100 times, with a result of 53 heads and 47 tails. The deviation between the
observed numbers and the expected 50-50 results is called ________.
A) Probability
B) Degrees of freedom
C) Goodness of fit
D) Random sampling error
E) Standard error
Answer: D
Section: 02.05
Topic: Probability and Statistics
Bloom's: 1. Remember
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
Accessibility: Keyboard Navigation
26) Which of the following would be used to determine the probability of three independent
events in order?
A) Sum rule
B) Product rule
C) Chi-square test
D) Binomial expansion
E) Random sampling error
Answer: B
Section: 02.05
Topic: Probability and Statistics
Bloom's: 2. Understand
Learning Outcome: 02.05.02 Predict the outcomes of crosses using the product rule and
binomial expansion equation.
Accessibility: Keyboard Navigation
27) A couple would like to know what the probability is that out of five children, three will be
girls. This is solved using which of the following?
A) Sum rule
B) Product rule
C) Chi-square test
D) Binomial expansion
E) Random sampling error
Answer: D
Section: 02.05
Topic: Probability and Statistics
Bloom's: 2. Understand
Learning Outcome: 02.05.02 Predict the outcomes of crosses using the product rule and
binomial expansion equation.
Accessibility: Keyboard Navigation
20
Copyright © 2018 McGraw-Hill
28) Using Mendel's flower color (purple is dominant, white is recessive), if two heterozygous
plants are crossed, what is the probability that the first two offspring will have purple flowers?
A) 1/2
B) 1/4
C) 6/4
D) 9/16
E) 1/16
Answer: D
Section: 02.05
Topic: Probability and Statistics
Bloom's: 3. Apply
Learning Outcome: 02.05.02 Predict the outcomes of crosses using the product rule and
binomial expansion equation.
Accessibility: Keyboard Navigation
29) The Chi-square test is used to prove that a hypothesis is correct.
Answer: FALSE
Section: 02.05
Topic: Probability and Statistics
Bloom's: 2. Understand
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
Accessibility: Keyboard Navigation
30) In a genetic cross, there are n classes of data. What would the degrees of freedom be for a
chi-square test on this data?
A) n
B) n + 1
C) n - 1
D) 2n + 1
E) x(n) where x equals the number of individuals in the cross
Answer: C
Section: 02.05
Topic: Probability and Statistics
Bloom's: 2. Understand
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
Accessibility: Keyboard Navigation
21
Copyright © 2018 McGraw-Hill
31) The ________ indicates the probability that differences between the observed values and the
expected values are due to random chance alone.
A) P value
B) Goodness of fit
C) Degrees of freedom
D) Empirical approach
E) None of the answers are correct
Answer: A
Section: 02.05
Topic: Probability and Statistics
Bloom's: 2. Understand
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
Accessibility: Keyboard Navigation
32) In the biological sciences, the null hypothesis is usually rejected if the P value is ________.
A) Greater than 1
B) Less than 0.30
C) Less than 0.95
D) Less than 0.05
E) Less than 1
Answer: D
Section: 02.05
Topic: Probability and Statistics
Bloom's: 2. Understand
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
Accessibility: Keyboard Navigation
33) ________ is the belief that seeds are produced by all parts of the body and transmitted to the
next generation.
A) Hippocrates
B) Pangenesis
C) Blending
D) Particulate theory
E) Homunculus
Answer: B
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Accessibility: Keyboard Navigation
22
Copyright © 2018 McGraw-Hill
34) Mendel had experience in the fields of ________ and ________.
A) Physics, mathematics
B) English
C) Psychology
D) Biology
E) None of the above
Answer: A
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Learning Outcome: 02.01.02 Outline the steps that Mendel followed to make crosses between
different strains of pea plants.
Accessibility: Keyboard Navigation
35) If two individuals with different distinct characteristics are mated, their offspring is called a
________.
A) strain
B) true-breeding line
C) gamete
D) cross
E) hybrid
Answer: E
Section: 02.02
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
36) If over several generations a trait does not vary in a group of organisms, that group can be
called a ________.
A) dihybrid
B) hybrid
C) true-breeding line
D) variant
E) cross-fertilized line
Answer: C
Section: 02.01
Topic: Mendel's Study of Pea Plants
Bloom's: 1. Remember
Learning Outcome: 02.01.01 Describe the characteristics of pea plants that make them a suitable
organism to study genetically.
Accessibility: Keyboard Navigation
23
Copyright © 2018 McGraw-Hill
37) A cross in which a researcher investigates the patterns of inheritance of a single trait is called
a ________.
A) monohybrid cross
B) dihybrid cross
C) two-factor cross
D) cross-fertilization
E) self-fertilization
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 2. Understand
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
38) A(an) ________ is a variation of a gene.
A) trait
B) character
C) gamete
D) allele
E) variant
Answer: D
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
39) The ________ refers to the genetic composition of an individual.
A) character
B) genotype
C) phenotype
D) dominant trait
E) recessive trait
Answer: B
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
24
Copyright © 2018 McGraw-Hill
40) The ________ is the observable characteristics of an individual.
A) character
B) genotype
C) phenotype
D) dominant trait
E) recessive trait
Answer: C
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
41) In a genetic cross, the ________ represent offspring with genetic combinations that were not
found in the parental lines.
A) P generation
B) nonrecombinates
C) parentals
D) nonparentals
E) none of the above
Answer: D
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 1. Remember
Learning Outcome: 02.03.03 Predict the outcome of two-factor crosses using a Punnett square.
Accessibility: Keyboard Navigation
42) The study of family trees in humans is called a ________ analysis.
A) pedigree
B) monohybrid
C) dihybrid
D) statistical
E) probability
Answer: A
Section: 02.04
Topic: Studying Inheritance Patterns in Humans
Bloom's: 1. Remember
Learning Outcome: 02.04.01 Describe the features of a pedigree.
Accessibility: Keyboard Navigation
25
Copyright © 2018 McGraw-Hill
43) Statistical analysis determines the ________ between observed data and what was expected
from the original hypothesis.
A) testcross
B) degrees of freedom
C) P values
D) complete hypothesis
E) goodness of fit
Answer: E
Section: 02.05
Topic: Probability and Statistics
Bloom's: 1. Remember
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
Accessibility: Keyboard Navigation
44) If a Punnett square is used to visualize a three-factor cross (trihybrid cross) how many boxes
would be inside of the square?
A) 3
B) 8
C) 48
D) 64
E) Can't be determined
Answer: D
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 3. Apply
Learning Outcome: 02.03.03 Predict the outcome of two-factor crosses using a Punnett square.
Accessibility: Keyboard Navigation
45) The results that demonstrated that traits were not blended were the ones where
A) The F2 plants were selfed
B) The true-breeding parents were crossed
C) The F1 generation plants were selfed
D) None of these experiments refuted the blending hypothesis
Answer: C
Section: 02.02
Topic: Law of Segregation
Bloom's: 4. Analyze
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
26
Copyright © 2018 McGraw-Hill
46) According to the Law of Segregation allele segregation into gametes is
A) based on whether the allele is dominant or recessive
B) random
C) based on whether the individual is homozygotic or heterozygotic
D) based on whether the individual is male or female
Answer: B
Section: 02.02
Topic: Law of Segregation
Bloom's: 1. Remember
Learning Outcome: 02.02.02 State Mendel's law of segregation and explain how it is related to
gamete formation and fertilization.
Accessibility: Keyboard Navigation
47) The following question refers to the Punnett square below. Which letter represents a
homozygotic dominant progeny?
A) A
B) B
C) C
D) D
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 2. Understand
Learning Outcome: 02.02.03 Predict the outcome of single-factor crosses using a Punnett
square.
27
Copyright © 2018 McGraw-Hill
48) What was the conclusion from Mendel's two factor crosses?
A) Genes randomly assort into the gametes
B) Alleles for one gene randomly assort into the gametes
C) The ratio of the phenotypes of the progeny depends on the phenotype of the male parent
D) The ratio of the phenotypes of the progeny depends on the phenotype of the female parent
Answer: A
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 1. Remember
Learning Outcome: 02.03.02 State Mendel's law of independent assortment.
Accessibility: Keyboard Navigation
49) The Law of Independent Assortment states that
A) two different genes will randomly assort their alleles during the formation of haploid cells.
B) two different alleles will randomly assort during the formation of haploid cells.
C) two different genes will NOT randomly assort their alleles during the formation of haploid
cells.
D) two different genes will randomly assort their alleles during the formation of diploid cells.
Answer: A
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 1. Remember
Learning Outcome: 02.03.02 State Mendel's law of independent assortment.
Accessibility: Keyboard Navigation
50) An allele that produces an inactive enzyme would be classified as what kind of allele?
A) Loss of function
B) Gain of function
C) Dominant
D) These do not occur and therefore there is no classification for them.
Answer: A
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 1. Remember
Learning Outcome: 02.03.04 Define loss-of-function allele and explain why such alleles are
useful to study.
Accessibility: Keyboard Navigation
28
Copyright © 2018 McGraw-Hill
51) What is a feature of a pedigree? Check all that apply.
A) It represents the relationship between individuals in successive generations.
B) They can be used to deduce if a gene may be sex-linked.
C) They are not useful for human genetic disease studies.
Answer: A, B
Section: 02.04
Topic: Studying Inheritance Patterns in Humans
Bloom's: 1. Remember
Learning Outcome: 02.04.01 Describe the features of a pedigree.
Accessibility: Keyboard Navigation
52) Which definition below is the best definition for probability?
A) The chance that an outcome will occur in the future.
B) The frequency at which homozygous recessive traits are seen in an individual mating.
C) The number of times homozygotic recessives appear through successive generations of a
family as compared to heterozygotes.
D) The number of times a coin is flipped.
Answer: A
Section: 02.05
Topic: Probability and Statistics
Bloom's: 1. Remember
Learning Outcome: 02.05.01 Define probability.
Accessibility: Keyboard Navigation
53) What is the probability that an offspring will have an ss/RR genotype from a cross of two
Ss/Rr individuals?
A) 6.25%
B) 12.5%
C) 25%
D) 3.12%
Answer: A
Section: 02.05
Topic: Probability and Statistics
Bloom's: 4. Analyze
Learning Outcome: 02.05.02 Predict the outcomes of crosses using the product rule and
binomial expansion equation.
Accessibility: Keyboard Navigation
29
Copyright © 2018 McGraw-Hill
54) If an individual that phenotypically has dominant traits is mated to another individual that
also has dominant traits and the progeny have both dominant and recessive traits it indicates that
A) Both parents are heterozygotic
B) One parent is heterozygotic and one is homozygotic
C) Both parents are homozygotic
D) No conclusions can be made about the genotypes of the parents
Answer: A
Section: 02.02
Topic: Law of Segregation
Bloom's: 4. Analyze
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
Accessibility: Keyboard Navigation
55) The results of a study of a population is presented in the following table. The "-" indicates
that the other allele is unknown
Which of the conclusions listed below is correct?
A) The ratios of the offspring in the S- X S - matings conform to the expected ratio for a
monohybrid cross.
B) The ratios of the offspring in the S - X S - matings are due to some S - parents being
homozygotic and some being heterozygotic.
C) If the S- offspring of the S - X S - matings were mated to the S - offspring from the S - X ss
matings there would be no ss offspring all would be S -.
D) All of the S - offspring from the S - X S - matings are homozygotic.
Answer: B
Section: 02.02
Topic: Law of Segregation
Bloom's: 5. Evaluate
Learning Outcome: 02.02.01 Analyze Mendel's experiments involving single-factor crosses.
30
Copyright © 2018 McGraw-Hill
56) The results of a dihybrid cross of plants is given in the table below. What conclusions would
you make?
A) More progeny should be counted since the number of progeny is too low to make this type of
analysis.
B) The chi square value is so close to the p value at 0.05 a conclusion should not be drawn and
another mating should be performed.
C) The results are statistically the same as the expected results.
D) The results are statistically significantly different than the expected results.
Answer: D
Section: 02.05
Topic: Probability and Statistics
Bloom's: 4. Analyze
Learning Outcome: 02.05.03 Evaluate the validity of a hypothesis using a chi square test.
57) Select which of the following results would most closely conform to a test cross of a
dyhybrid plant
A) A
B) B
C) C
D) D
Answer: D
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 4. Analyze
Learning Outcome: 02.03.03 Predict the outcome of two-factor crosses using a Punnett square.
31
Copyright © 2018 McGraw-Hill
58) Cystic fibrosis is caused by mutations in the CF gene, and there are several different
mutations that are known to result in CF disease. The CF mutations behave as recessive alleles
to the WT CF allele. If two carriers that have different mutations in their CF genes have children
what is the probability that one of their children will have CF disease?
A) 100%
B) 25%
C) 50%
D) 75%
Answer: B
Section: 02.02
Topic: Law of Segregation; Studying Inheritance Patterns in Humans
Bloom's: 4. Analyze
Learning Outcome: 02.02.03 Predict the outcome of single-factor crosses using a Punnett
square.
Accessibility: Keyboard Navigation
59) Polymerase chain reaction (PCR) can be used for many different purposes, including
determining paternity. PCR amplifies specific DNA sequences from complex mixtures and can
be used to amplify sequences that although they may not have any known function may have
several unique sizes and these different forms are inherited according to the Law of
Segregation. Below is a diagram of an agarose gel of PCR samples from a mother, and several
children. Which letters represent children that could be biologically related to the mother?
A) A, B, and C
B) B, C, and D
C) A, B, and D
D) All of the children could be related to the mother
Answer: B
Explanation: A child would be expected to have at least 1 band in common with the mother
Section: 02.04
Topic: Studying Inheritance Patterns in Humans
Bloom's: 4. Analyze
Learning Outcome: 02.04.02 Analyze a pedigree to determine if a trait or disease is dominant or
recessive.
32
Copyright © 2018 McGraw-Hill
60) Huntington's disease is a fatal syndrome caused by a mutation in the HD gene. The disease
has an average age of onset of 35 and the majority of individuals that are affected are
heterozygotes. What is the probability that a 25-year-old woman with no symptoms and who is
the daughter of a man that has HD and a mother who does not will have a child that will have the
mutant HD allele?
A) 25%
B) 50%
C) 75%
D) 100%
Answer: A
Section: 02.04
Topic: Studying Inheritance Patterns in Humans
Bloom's: 3. Apply
Learning Outcome: 02.04.02 Analyze a pedigree to determine if a trait or disease is dominant or
recessive.
Accessibility: Keyboard Navigation
33
Copyright © 2018 McGraw-Hill
61) Two heterozygous plants are bred. The enzyme that controls the phenotype that is being
studied is measured in the progeny and represented in the graph below. What are the expected
ratios of the different progeny based on their enzyme levels?
A) A: 33.3%
B: 33.3%
C: 33.3%
B) A: 50%
B: 25%
C :25%
C) A: 25%
B:50%
C: 25%
D) A: 25%
B: 25%
C: 50%
Answer: C
Explanation: Remember genotypic ratios and differences in allelic products
Section: 02.02
Topic: Law of Segregation
Bloom's: 4. Analyze
Learning Outcome: 02.02.03 Predict the outcome of single-factor crosses using a Punnett
square.
34
Copyright © 2018 McGraw-Hill
62) Two dihybrid pea plants (both tall and with purple flowers) are mated. The cross resulted in
9866 progeny, of which 5550 were tall with purple flowers. What are the expected ratios of the
other phenotypic classes?
A) 1850 Short/white flower
616 Tall/white flower
1850 Short/purple flower
B) 1850 Short/white flower
1850 Tall/white flower
1850 Short/purple flower
C) 616 Short/white flower
1850 Tall/white flower
1850 Short/purple flower
D) 5550 Short/white flower
5550 Tall/white flower
5550 Short/purple flower
Answer: C
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 4. Analyze
Learning Outcome: 02.03.03 Predict the outcome of two-factor crosses using a Punnett square.
Accessibility: Keyboard Navigation
63) If the progeny of a mating of pea plants have the following ratios 1342 smooth seed/green
pod, 447 wrinkled seed/yellow pod, 429 smooth seed/ yellow pod, 1361 wrinkled seed/green
pod what are the genotypes of the parents?
A) Parent 1: Homozygous for seed shape and pod color
Parent 2: Heterozygous for seed shape and homozygous for pod color
B) Both parents are heterozygous for seed shape and pod color
C) Parent 1: Heterozygous for seed shape and pod color
Parent 2: Homozygous seed shape and heterozygous for pod color
D) Parent 1: Heterozygous for both seed shape and pod color
Parent 2: Homozygous for both seed shape and pod color
Answer: C
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 4. Analyze
Learning Outcome: 02.03.03 Predict the outcome of two-factor crosses using a Punnett square.
Accessibility: Keyboard Navigation
35
Copyright © 2018 McGraw-Hill
64) If a plant is test-crossed which of the following genes are linked?
A) Flower color and height
B) Flower color and flower placement
C) Flower placement and height
D) None of these genes appear to be linked
Answer: A
Section: 02.03
Topic: Law of Independent Assortment
Bloom's: 4. Analyze
Learning Outcome: 02.03.02 State Mendel's law of independent assortment.
Genetics, 6e (Brooker)
Chapter 3 Chromosome Transmission During Cell Division and Sexual Reproduction
1) Check all that apply. In prokaryotic cells
A) genetic information is contained within a nucleoid region.
B) genetic material is organized as a single circular chromosome.
C) membrane bound organelles are found in the cytoplasm.
D) a cell wall surrounds the plasma membrane.
Answer: A, B, D
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 2. Understand
Learning Outcome: 03.01.02 Outline key differences between prokaryotic and eukaryotic cells.
Accessibility: Keyboard Navigation
2) Organelles are
A) structures that contain the genetic material.
B) membrane-bound compartments of eukaryotic cells.
C) the region that contains the DNA in prokaryotic cells.
D) the outer, rigid covering of a prokaryotic cell.
Answer: B
36
Copyright © 2018 McGraw-Hill
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 1. Remember
Learning Outcome: 03.01.02 Outline key differences between prokaryotic and eukaryotic cells.
Accessibility: Keyboard Navigation
3) A karyotype is a(n)
A) organelle of eukaryotic cells.
B) stage of prophase I in meiosis.
C) division of the cytoplasmic material following mitosis.
D) organized representation of the chromosomes within a cell.
E) none of the answers are correct
Answer: D
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 1. Remember
Learning Outcome: 03.01.03 Describe the procedure for making a karyotype.
Accessibility: Keyboard Navigation
37
Copyright © 2018 McGraw-Hill
4) You are performing a karyotype for the first time and you forget to add the colchicine. How
do you predict this will affect your karyotype?
A) No affect - your karyotype will look normal.
B) You will be unable to see any chromosomes under the microscope.
C) You will only be able to see one of each chromosome.
D) The chromosomes in some cells will look normal (highly compacted) but in other cells
distinct chromosomes will be hard to identify.
Answer: D
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 3. Apply
Learning Outcome: 03.01.03 Describe the procedure for making a karyotype.
Accessibility: Keyboard Navigation
5) During sexual reproduction, each parent contributes one set of chromosomes. Members of a
pair of chromosomes (one from each parent) are called ________.
A) karyotypes
B) sister chromatids
C) homologs
D) sex chromosomes
Answer: C
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 2. Understand
Learning Outcome: 03.01.04 Compare and contrast the similarities and differences between
homologous chromosomes.
Accessibility: Keyboard Navigation
6) Which of the following would contain genetic material that is 100% identical?
A) Homologous chromosomes
B) Sister chromatids
C) X and Y chromosomes
D) All of the answers are identical
Answer: B
Section: 03.02
Topic: Cell Division
Bloom's: 2. Understand
Learning Outcome: 03.02.02 List and outline the phases of the eukaryotic cell cycle.
Accessibility: Keyboard Navigation
38
Copyright © 2018 McGraw-Hill
7) You are studying a diploid organism that has 14 pairs of chromosomes. How many
chromatids would this cell have in G2 phase?
A) 7
B) 14
C) 28
D) 56
Answer: D
Section: 03.02
Topic: Cell Division
Bloom's: 4. Analyze
Learning Outcome: 03.02.02 List and outline the phases of the eukaryotic cell cycle.
Accessibility: Keyboard Navigation
8) You are studying a diploid organism that has 14 pairs of chromosomes. How many
chromatids will a gamete from this organism have?
A) 7
B) 14
C) 28
D) 56
Answer: B
Section: 03.02
Topic: Cell Division
Bloom's: 4. Analyze
Learning Outcome: 03.02.02 List and outline the phases of the eukaryotic cell cycle.
Accessibility: Keyboard Navigation
9) You are studying a diploid organism that has 14 pairs of chromosomes. How many
chromatids will a cell from this organism have in metaphase of meiosis II?
A) 7
B) 14
C) 28
D) 56
Answer: C
Section: 03.04
Topic: Meiosis
Bloom's: 4. Analyze
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
39
Copyright © 2018 McGraw-Hill
10) The location of a gene on a chromosome is called its ________.
A) karyotype
B) allele
C) locus
D) homolog
Answer: C
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 1. Remember
Learning Outcome: 03.01.04 Compare and contrast the similarities and differences between
homologous chromosomes.
Accessibility: Keyboard Navigation
11) Cell division in prokaryotic cells is called ________, while in eukaryotic cells it is called
________.
A) binary fission; binary fission
B) binary fission; mitosis
C) meiosis; mitosis
D) mitosis; binary fission
Answer: B
Section: 03.02
Topic: Cell Division
Bloom's: 1. Remember
Learning Outcome: 03.02.01 Describe the process of binary fission in bacteria.
Accessibility: Keyboard Navigation
12) During this phase of the cell cycle, the sister chromatids are formed.
A) G1 phase
B) G2 phase
C) S phase
D) Prophase
E) Cytokinesis
Answer: C
Section: 03.02
Topic: Cell Division
Bloom's: 2. Understand
Learning Outcome: 03.02.02 List and outline the phases of the eukaryotic cell cycle.
Accessibility: Keyboard Navigation
40
Copyright © 2018 McGraw-Hill
13) During this phase of the cell cycle chromosomes start to condense.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: E
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
14) During this phase of the cell cycle sister chromatids separate and head towards opposite
poles of the cell.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: D
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
15) During this phase of the cell cycle the chromosomes line up in the center of the cell.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: A
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
41
Copyright © 2018 McGraw-Hill
16) During this phase of the cell cycle the nuclear membrane starts to disassociate.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: E
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
17) During this phase of the cell cycle the nuclear membrane reforms around the chromosomes.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: C
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
18) During this phase of the cell cycle the microtubules of the spindle fiber attach to the
kinetochore.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: B
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
42
Copyright © 2018 McGraw-Hill
19) During this phase of the cell cycle the separated sister chromatids are considered independent
chromosomes.
A) Metaphase
B) Prometaphase
C) Telophase
D) Anaphase
E) Prophase
Answer: D
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
20) Which of the following indicates the correct order of these events?
A) Anaphase - Telophase - Prophase - Prometaphase - Metaphase
B) Telophase - Prometaphase - Prophase - Metaphase - Anaphase
C) Metaphase - Prometaphase - Prophase - Anaphase - Telophase
D) Prophase - Prometaphase - Metaphase - Anaphase - Telophase
Answer: D
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.02 List and describe the phases of mitosis.
Accessibility: Keyboard Navigation
21) In animals, somatic cells are ________ and germ cells are ________.
A) diploid; diploid
B) diploid; haploid
C) haploid; diploid
D) haploid; haploid
Answer: B
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.02 Describe how animals make sperm and egg cells.
Accessibility: Keyboard Navigation
43
Copyright © 2018 McGraw-Hill
22) If the gametes of an organism are different morphologically, they are said to be ________.
A) isogamous
B) heterogamous
C) diploid
D) haploid
Answer: B
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.02 Describe how animals make sperm and egg cells.
Accessibility: Keyboard Navigation
23) The general purpose of the synaptonemal complex is to
A) provide a link between homologous chromosomes in meiosis.
B) enable the reformation of the cell wall during cytokinesis.
C) separate the sister chromatids during anaphase.
D) independently assort the chromosomes during metaphase of meiosis.
E) None of the answers are correct.
Answer: A
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
24) What occurs during leptotene of prophase I?
A) The homologous chromosomes recognize one another by synapsis.
B) Crossing over occurs.
C) The replicated chromosomes condense.
D) The synaptonemal complex dissociates.
E) None of the answers are correct.
Answer: C
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
44
Copyright © 2018 McGraw-Hill
25) A bivalent contains how many chromatids?
A) 2
B) 4
C) 8
D) Depends on the cell
Answer: B
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
26) The process of crossing over occurs during which phase of meiosis?
A) Diakinesis
B) Diplotene
C) Pachytene
D) Zygotene
E) Leptotene
Answer: C
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
27) What represents the correct order of events during prophase I?
A) Pachytene - diplotene - diakinesis - leptotene - zygotene
B) Leptotene - zygotene - pachytene - diplotene - diakinesis
C) Zygotene - leptotene - pachytene - diakinesis - diplotene
D) Diplotene - pachytene - leptotene - diakinesis - zygotene
Answer: B
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
45
Copyright © 2018 McGraw-Hill
28) The physical structure that is formed when two chromatids cross over is called a(n)
________.
A) synaptonemal complex
B) bivalent
C) karyotype
D) chiasma
Answer: D
Section: 03.04
Topic: Meiosis
Bloom's: 1. Remember
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
29) If an organism has five pairs of chromosomes, how many chromosomal combinations are
possible at metaphase I of meiosis?
A) 52
B) 105
C) 510
D) 25
E) None of the answers are correct
Answer: D
Section: 03.04
Topic: Meiosis
Bloom's: 4. Analyze
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
30) The end result of meiosis in animals is ________.
A) two diploid cells
B) two haploid cells
C) four diploid cells
D) four haploid cells
E) None of the answers are correct
Answer: D
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
46
Copyright © 2018 McGraw-Hill
31) Oogenesis is a gametogenic process involving ________ that produces ________.
A) binary fission; sperm cells
B) mitosis; egg cells
C) meiosis; egg cells
D) meiosis; sperm cells
E) mitosis; sperm cells
Answer: C
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.02 Describe how animals make sperm and egg cells.
Accessibility: Keyboard Navigation
32) In plants, the haploid generation is called the ________ and the diploid generation is called
the ________.
A) sporophyte; spermatogenesis
B) gametophyte; sporophyte
C) sporophyte; gametophyte
D) oogenesis; gametophyte
Answer: B
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.03 Explain how plants alternate between haploid and diploid
generations.
Accessibility: Keyboard Navigation
33) In plants, spores are produced by the process of ________.
A) spermatogenesis
B) meiosis
C) mitosis
D) binary fission
E) oogenesis
Answer: B
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.03 Explain how plants alternate between haploid and diploid
generations.
Accessibility: Keyboard Navigation
47
Copyright © 2018 McGraw-Hill
34) A pollen grain in a plant represents the ________.
A) male gametophyte
B) female gametophyte
C) male sporophyte
D) female sporophyte
Answer: A
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.03 Explain how plants alternate between haploid and diploid
generations.
Accessibility: Keyboard Navigation
35) In a plant, which of the following is triploid (3n)?
A) Pollen grain
B) Embryo sac
C) Seed
D) Endosperm
E) None of the answers are triploid
Answer: D
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 2. Understand
Learning Outcome: 03.05.03 Explain how plants alternate between haploid and diploid
generations.
Accessibility: Keyboard Navigation
36) Which microtubule type is paired to its correct function?
A) Polar microtubules - positioning of the spindle apparatus
B) Aster microtubules - positioning of the spindle apparatus
C) Kinetochore microtubules - separate the poles
D) Polar microtubules - bind kinetochore to centromere
Answer: B
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 2. Understand
Learning Outcome: 03.03.01 Describe the structure and function of the mitotic spindle.
Accessibility: Keyboard Navigation
48
Copyright © 2018 McGraw-Hill
37) The chromosomal theory of inheritance was first proposed by ________.
A) Mendel
B) Boveri and Sutton
C) Darwin and Mendel
D) Weismann and Boveri
Answer: B
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 1. Remember
Learning Outcome: 03.06.01 List the key tenets of the chromosome theory of inheritance.
Accessibility: Keyboard Navigation
38) In a species of turtles you are studying, you find that when eggs are incubated at a low
temperature, the hatched turtle will be male. Eggs incubated at a high temperature yield females,
and intermediate temperatures lead to both male and female offpsring. This mode of sex
determination is most similar to that in
A) insects.
B) birds.
C) bees.
D) alligators.
Answer: D
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 3. Apply
Learning Outcome: 03.06.03 Outline different mechanisms of sex determination.
Accessibility: Keyboard Navigation
39) A male produced from an unfertilized haploid egg is an example of what type of sex
determination system?
A) X-Y
B) Z-W
C) X-O
D) Haplo-diploid
E) None of the answers are correct
Answer: D
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 2. Understand
Learning Outcome: 03.06.03 Outline different mechanisms of sex determination.
Accessibility: Keyboard Navigation
49
Copyright © 2018 McGraw-Hill
40) In several mammals, including some rat and shrew species, the presence of two X
chromosomes means the animal will be a female, whereas having just one X chromosome
dictates maleness. This type of sex determination is most similar to
A) other mammals.
B) insects.
C) bees.
D) birds.
Answer: B
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 3. Apply
Learning Outcome: 03.06.03 Outline different mechanisms of sex determination.
Accessibility: Keyboard Navigation
41) If an allele is inherited on the X chromosome, but not the Y, it is said to be an example of
________.
A) autosomal inheritance
B) X-linked inheritance
C) chromosome theory of inheritance
D) homogametic sex
E) heterogametic sex
Answer: B
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 2. Understand
Learning Outcome: 03.06.04 Analyze the results of Morgan's experiment, which showed that a
gene affecting eye color in fruit flies is located on the X chromosome.
Accessibility: Keyboard Navigation
42) Based on what you know about the biochemical composition of cells, the primary
information containing building blocks of chromosomes are likely
A) amino acids.
B) lipids.
C) nucleotides.
D) carbohydrates.
Answer: C
Section: 03.01
Topic: General Features of Chromosomes
Bloom's: 3. Apply
Learning Outcome: 03.01.01 Define the term chromosome.
Accessibility: Keyboard Navigation
50
Copyright © 2018 McGraw-Hill
43) You are studying a type of cell that you don't know much about. You want to determine
what organism the cell comes from. You decide to watch cell division in this plant using the
appropriate cell biology tools. After some experimentation, you determine that cytokinesis in
this cell is sensitive to myosin inhibitors. You are likely studying
A) a plant cell.
B) an animal cell.
C) a bacterial cell.
D) a cell type that has not been previously studied.
Answer: B
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 3. Apply
Learning Outcome: 03.03.03 Outline the key differences between cytokinesis in animal and
plant cells.
Accessibility: Keyboard Navigation
44) The process where two gametes fuse with each other in the process of fertilization to begin
the life of a new organism is called
A) sexual reproduction.
B) gametogenesis.
C) asexual reproduction.
D) X-linked inheritance.
E) multicellularity.
Answer: A
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 1. Remember
Learning Outcome: 03.05.01 Define sexual reproduction.
Accessibility: Keyboard Navigation
51
Copyright © 2018 McGraw-Hill
45) You are studying a new species of plant similar to Mendel's pea plants. You are specifically
interested in two genes that are located on two different chromosomes. In this plant, the gene for
height has two alleles, T (tall) and t (short). The gene for leaf color has two alleles P (purple) and
p (pink). What meiotic products do you expect from diploid cells that are homozyous for the tall
allele and heterozygous for the purple allele?
A) An equal number of Tp, tP, tp, and TP gametes
B) An equal number of TP and Tp gametes
C) An equal number of TP and tp gametes
D) 2 TP gametes for every 1 Tp gamete
Answer: B
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 4. Analyze
Learning Outcome: 03.06.02 Explain the relationship between meiosis and Mendel's laws of
inheritance.
Accessibility: Keyboard Navigation
46) You are performing a fruit fly cross similar to those that Morgan performed. Unfortunately,
you forgot to write down the parents of your cross. You count the progeny, and find you have 40
red-eyed males, 80 red-eyed females, and 40 white-eyed males. Assuming that all genotypes
from this cross should have equal survival rates, what are the genotypes of the parent flies?
A) XwY and Xw+Xw+
B) XwY and Xw+Xw
C) Xw+Y and Xw+Xw
D) Xw+Y and XwXw
Answer: C
Section: 03.06
Topic: The Chromosome Theory of Inheritance and Sex Chromosomes
Bloom's: 4. Analyze
Learning Outcome: 03.06.04 Analyze the results of Morgan's experiment, which showed that a
gene affecting eye color in fruit flies is located on the X chromosome.
Accessibility: Keyboard Navigation
52
Copyright © 2018 McGraw-Hill
47) Zip1 is a protein in yeast that is required for synaptonemal complex formation. Assuming
synaptonemal complexes are required for meiosis in yeast, where do you predict that cells
lacking Zip1 will arrest (stop progressing through meiosis)?
A) Prometaphase of meiosis I
B) Metaphase of meiosis I
C) Metaphase of meiosis II
D) Between the zygotene and pachytene stages
E) Diakinesis
Answer: D
Section: 03.04
Topic: Meiosis
Bloom's: 4. Analyze
Learning Outcome: 03.04.01 List and describe the phases of meiosis.
Accessibility: Keyboard Navigation
48) Vincristine is a cancer chemotherapy drug. It binds to tubulin dimers, inhibiting assembly of
microtubules. Where do you predict that vincristine stops the cell cycle?
A) S phase
B) Prophase
C) Metaphase
D) Telophase
Answer: C
Section: 03.03
Topic: Mitosis and Cytokinesis
Bloom's: 4. Analyze
Learning Outcome: 03.03.01 Describe the structure and function of the mitotic spindle.
Accessibility: Keyboard Navigation
49) The yeast Saccharomyces cerevisiae produces haploid cells of two mating types, a and α,
which are morphologically similar. Cells of opposite mating types can mate. Saccharomyces
cerevisiae is a(n) ________ species.
A) isogamous
B) heterogamous
C) prokaryotic
D) asexual
Answer: A
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 3. Apply
Learning Outcome: 03.05.02 Describe how animals make sperm and egg cells.
Accessibility: Keyboard Navigation
53
Copyright © 2018 McGraw-Hill
50) A diploid organism that you are studying has 17 pairs of chromosomes. How many total
chromosomes are found in a somatic cell from this organism? A sperm cell? An egg cell?
A) 17; 16; 16
B) 17; 17; 17
C) 34; 17; 34
D) 34; 17; 17
Answer: D
Section: 03.05
Topic: Sexual Reproduction
Bloom's: 3. Apply
Learning Outcome: 03.05.02 Describe how animals make sperm and egg cells.
Accessibility: Keyboard Navigation
51) Check all that apply. Sister chromatids are separated during anaphase of
A) mitosis.
B) meiosis II.
C) meiosis I.
D) cytokinesis.
Answer: A, B
Section: 03.04
Topic: Meiosis
Bloom's: 2. Understand
Learning Outcome: 03.04.02 Compare and contrast the key differences between mitosis and
meiosis.
Accessibility: Keyboard Navigation
54
Copyright © 2018 McGraw-Hill
Genetics, 6e (Brooker)
Chapter 5,6,8, and 9 Non-Mendelian Inheritance
1) Which of the following is primarily responsible for the maternal effect?
A) Sperm cells
B) Oocytes
C) Nurse cells
D) Placenta
Answer: C
Section: 05.01
Topic: Maternal Effect
Bloom's: 1. Remember
Learning Outcome: 05.01.03 Explain the molecular mechanism of maternal effect.
Accessibility: Keyboard Navigation
2) In the gene that affects snail coiling, the ________ is responsible for the phenotype of the
offspring.
A) mother's phenotype
B) father's phenotype
C) mother's genotype
D) father's genotype
Answer: C
Section: 05.01
Topic: Maternal Effect
Bloom's: 2. Understand
Learning Outcome: 05.01.02 Predict the outcome of crosses for genes that exhibit a maternal
effect pattern of inheritance.
Accessibility: Keyboard Navigation
3) Which of the following does not inactivate an X chromosome?
A) Mammals
B) Drosophila
C) C. elegans
D) Marsupials
Answer: B
Section: 05.02
Topic: Epigenetics: Genomic Imprinting
Bloom's: 1. Remember
Learning Outcome: 05.02.02 Compare and contrast the mechanisms of dosage compensation in
different animal species.
Accessibility: Keyboard Navigation
1
Copyright © 2018 McGraw-Hill
4) Who originally identified a highly condensed structure in the interphase of nuclei?
A) Lyon
B) Barr
C) Ohno
D) None of the answers are correct
Answer: B
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 1. Remember
Learning Outcome: 05.02.03 Describe the process of X-chromosome inactivation in mammals.
Accessibility: Keyboard Navigation
5) Both parents usually imprint the same gene.
Answer: FALSE
Section: 05.03
Topic: Epigenetics: Genomic Imprinting
Bloom's: 2. Understand
Learning Outcome: 05.03.03 Explain the molecular mechanism of imprinting.
Accessibility: Keyboard Navigation
6) In the Igf2 gene, which allele is expressed?
A) Paternal
B) Maternal
C) Both maternal and paternal
D) Neither allele is expressed
Answer: A
Section: 05.03
Topic: Epigenetics: Genomic Imprinting
Bloom's: 2. Understand
Learning Outcome: 05.03.02 Predict the outcome of crosses involving imprinted genes.
Accessibility: Keyboard Navigation
7) What is the molecular mechanism for imprinting a gene?
A) Acetylation
B) Nitration
C) Phosphorylation
D) Methylation
Answer: D
Section: 05.03
Topic: Epigenetics: Genomic Imprinting
Bloom's: 2. Understand
Learning Outcome: 05.03.03 Explain the molecular mechanism of imprinting.
Accessibility: Keyboard Navigation
2
Copyright © 2018 McGraw-Hill
8) Which diseases are associated with imprinting?
A) Angelman Syndrome
B) LHON
C) Alzheimer's Disease
D) All of the answers are correct
Answer: A
Section: 05.03
Topic: Epigenetics: Genomic Imprinting
Bloom's: 1. Remember
Learning Outcome: 05.03.03 Explain the molecular mechanism of imprinting.
Accessibility: Keyboard Navigation
9) In which cells do erasure and re-establishment of imprinting marks typically not occur?
A) Nurse cells
B) Sperm cells
C) Oocytes
D) Somatic cells
Answer: D
Section: 05.03
Topic: Epigenetics: Genomic Imprinting
Bloom's: 2. Understand
Learning Outcome: 05.03.03 Explain the molecular mechanism of imprinting.
Accessibility: Keyboard Navigation
10) Where is extranuclear DNA located in mammalian cells?
A) Endoplasmic reticulum
B) Mitochondria
C) Ribosome
D) Plasma membrane
Answer: B
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 2. Understand
Learning Outcome: 05.04.01 Describe the general features of the mitochondrial and chloroplast
genomes.
Accessibility: Keyboard Navigation
3
Copyright © 2018 McGraw-Hill
11) What type of inheritance is observed with extranuclear DNA?
A) Mendelian inheritance
B) Sex-linked inheritance
C) Paternal inheritance
D) Maternal inheritance
E) Maternal effect
Answer: D
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 2. Understand
Learning Outcome: 05.04.02 Predict the outcome of crosses involving extranuclear inheritance.
Accessibility: Keyboard Navigation
12) What is a disease associated with extra nuclear inheritance?
A) Angelman Syndrome
B) Prader-Willi Syndrome
C) LHON
D) Muscular Dystrophy
Answer: C
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.03 Explain how mutations in mitochondrial genes cause human
diseases.
Accessibility: Keyboard Navigation
13) What is thought to be the origin of mitochondria and chloroplasts?
A) Cyanobacteria for mitochondria, purple bacteria for chloroplasts
B) Purple bacteria for mitochondria, fungi for chloroplasts
C) Purple bacteria for mitochondria, cyanobacteria for chloroplasts
D) Algae for mitochondria, cyanobacteria for chloroplasts
Answer: C
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.04 Evaluate the endosymbiosis theory.
Accessibility: Keyboard Navigation
4
Copyright © 2018 McGraw-Hill
14) Who is largely responsible for proposing the endosymbiosis theory?
A) Schimper, Wallin, Margulis
B) Lyon, Margulis, Schimper
C) Schimper, Wallin, Barr
D) Barr, Lyon, Margulis
Answer: A
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.04 Evaluate the endosymbiosis theory.
Accessibility: Keyboard Navigation
15) Which inheritance pattern is common to oogenesis, spermatogenesis, and embryogenesis?
A) Maternal inheritance
B) Epigenetic inheritance
C) Maternal effect
D) Paternal inheritance
Answer: B
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 2. Understand
Learning Outcome: 05.02.01 Define epigenetics.
Accessibility: Keyboard Navigation
16) How many Barr bodies would an individual with a XXY genotype possess?
A) 0
B) 1
C) 2
D) None of the answers are correct
Answer: B
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 2. Understand
Learning Outcome: 05.02.03 Describe the process of X-chromosome inactivation in mammals.
Accessibility: Keyboard Navigation
5
Copyright © 2018 McGraw-Hill
17) The coat color of calico cats is a result of ________.
A) maternal inheritance
B) X-inactivation
C) imprinting
D) extranuclear inheritance
Answer: B
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 2. Understand
Learning Outcome: 05.02.04 Explain how X-chromosome inactivation may affect the
phenotype of female mammals.
Accessibility: Keyboard Navigation
18) The Lyon hypothesis attempts to explain the molecular mechanism of ________.
A) X-inactivation
B) genomic imprinting
C) maternal inheritance
D) extranuclear inheritance
Answer: A
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 1. Remember
Learning Outcome: 05.02.03 Describe the process of X-chromosome inactivation in mammals.
Accessibility: Keyboard Navigation
19) Monoallelic expression is associated with which of the following?
A) X-inactivation
B) Genomic imprinting
C) Maternal inheritance
D) Extranuclear inheritance
Answer: B
Section: 05.03
Topic: Epigenetics: Genomic Imprinting
Bloom's: 2. Understand
Learning Outcome: 05.03.01 Define genomic imprinting.
Accessibility: Keyboard Navigation
6
Copyright © 2018 McGraw-Hill
20) Which of the following is false regarding human mtDNA?
A) It is around 17,000 bp in length.
B) It is a linear chromosome.
C) Multiple copies exist in each mitochondria.
D) It mostly contains rRNA and tRNA genes, and genes for mitochondrial function.
Answer: B
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.01 Describe the general features of the mitochondrial and chloroplast
genomes.
Accessibility: Keyboard Navigation
21) mtDNA contains all of the genes necessary for the complete function of mitochondrial
metabolism.
Answer: FALSE
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 2. Understand
Learning Outcome: 05.04.01 Describe the general features of the mitochondrial and chloroplast
genomes.
Accessibility: Keyboard Navigation
22) Which of the following categories of genes is typically NOT encoded in cpDNA?
A) Genes encoding rRNA.
B) Genes encoding tRNA.
C) Genes for photosynthetic pathway enzymes.
D) Genes encoding nuclear proteins.
Answer: D
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 2. Understand
Learning Outcome: 05.04.01 Describe the general features of the mitochondrial and chloroplast
genomes.
Accessibility: Keyboard Navigation
7
Copyright © 2018 McGraw-Hill
23) The inheritance of leaf pigmentation in the four-o'clock plant Mirabilis jalapa is an example
of ________.
A) maternal effect
B) maternal inheritance
C) epigenetic inheritance
D) imprinting
Answer: B
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 2. Understand
Learning Outcome: 05.04.02 Predict the outcome of crosses involving extranuclear inheritance.
Accessibility: Keyboard Navigation
24) In maternal effect, the ________ of the mother determines the ________ of the offspring.
A) phenotype, genotype
B) genotype, phenotype
C) rRNA, tRNA
D) imprinting, genotype
Answer: B
Section: 05.01
Topic: Maternal Effect
Bloom's: 2. Understand
Learning Outcome: 05.01.01 Define maternal effect.
Accessibility: Keyboard Navigation
25) A modification that occurs to a nuclear gene that alters gene expression without modifying
the DNA sequence is called ________ inheritance.
A) extranuclear
B) cytoplasmic
C) maternal effect
D) epigenetic
E) nuclear
Answer: D
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 1. Remember
Learning Outcome: 05.02.01 Define epigenetics.
Accessibility: Keyboard Navigation
8
Copyright © 2018 McGraw-Hill
26) Dosage compensation offsets the problems associated with differences in the number of
________ chromosomes in many species.
A) cytoplasmic
B) autosome
C) sex
D) extranuclear
E) mitochondrial
Answer: C
Section: 05.02
Topic: Epigenetics: Dosage Compensation
Bloom's: 2. Understand
Learning Outcome: 05.02.02 Compare and contrast the mechanisms of dosage compensation in
different animal species.
Accessibility: Keyboard Navigation
27) The inheritance patterns of genetic material that is not contained in the nucleus of the cell is
called ________.
A) extranuclear inheritance
B) maternal effect
C) imprinting
D) nuclear
E) epigenetic
Answer: A
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.02 Predict the outcome of crosses involving extranuclear inheritance.
Accessibility: Keyboard Navigation
28) mtDNA stands for ________ and cpDNA stands for ________.
A) extranuclear DNA, cytoplasmic DNA
B) maternal DNA, paternal DNA
C) marked DNA, copied DNA
D) nuclear, cytoplasmic
E) mitochondrial DNA, chloroplast DNA
Answer: E
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.01 Describe the general features of the mitochondrial and chloroplast
genomes.
Accessibility: Keyboard Navigation
9
Copyright © 2018 McGraw-Hill
29) Heteroplasmy is associated with inheritance patterns involving
A) nuclear.
B) paternal DNA.
C) chloroplasts.
D) ribosomes.
E) imprinted.
Answer: C
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 2. Understand
Learning Outcome: 05.04.02 Predict the outcome of crosses involving extranuclear inheritance.
Accessibility: Keyboard Navigation
30) If the sperm cell contributes mitochondria to the oocyte, it is called ________.
A) paternal leakage
B) maternal leakage
C) paternal inheritance
D) mitochondria
E) imprinting
Answer: A
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.02 Predict the outcome of crosses involving extranuclear inheritance.
Accessibility: Keyboard Navigation
31) A symbiotic relationship where one organism lives inside another species is called
________.
A) cytoplasmic inheritance
B) heteroplasmy
C) paternal leakage
D) endosymbiosis
Answer: D
Section: 05.04
Topic: Extranuclear Inheritance
Bloom's: 1. Remember
Learning Outcome: 05.04.04 Evaluate the endosymbiosis theory.
Accessibility: Keyboard Navigation
Genetics, 6e (Brooker)
Chapter 6 Genetic Linkage and Mapping in Eukaryotes
1) Which of the following defines the principle of linkage?
10
Copyright © 2018 McGraw-Hill
A) Two or more genes that are physically connected on a chromosome.
B) Genes that are transmitted to the next generation as a group.
C) The process by which genetic information is exchanged between homologous chromosomes.
D) All of the answers are correct.
E) Both two or more genes that are physically connected on a chromosome and genes that are
transmitted to the next generation as a group.
Answer: E
Section: 06.01
Topic: Overview of Linkage
Bloom's: 2. Understand
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
2) Assume that genes C and D are located on the same chromosome. On one chromosome,
alleles C and D are found, while the homologue contains alleles c and d. Which of the following
would be evidence of a recombination event?
A) Alleles C and D together on one chromosome.
B) Alleles c and d together on one chromosome.
C) Alleles C and d together on one chromosome.
D) Alleles c and D together on one chromosome.
E) Both alleles C and d together on one chromosome and alleles c and D together on one
chromosome.
Answer: E
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 3. Apply
Learning Outcome: 06.02.01 Describe how crossing over can change the arrangements of
alleles along a chromosome.
Accessibility: Keyboard Navigation
11
Copyright © 2018 McGraw-Hill
3) The first observational evidence that genes may be inherited together rather than by simple
Mendelian inheritance was provided by ________.
A) Mendel
B) Morgan and Bridges
C) Bateson and Punnett
D) Boveri and Sutton
E) None of the answers are correct
Answer: C
Section: 06.01
Topic: Overview of Linkage
Bloom's: 1. Remember
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
4) Experimental evidence that crossing over occurs between the X chromosomes of female
Drosophila was provided by ________.
A) Morgan
B) Punnett
C) Darwin
D) Bateson
Answer: A
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.01 Describe how crossing over can change the arrangements of
alleles along a chromosome.
Accessibility: Keyboard Navigation
5) Which of the following statistical tests is used to determine if two genes are linked or
assorting independently?
A) Sum rule
B) Binomial expansion
C) Product rule
D) Chi-square test
Answer: D
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 2. Understand
Learning Outcome: 06.02.03 Apply a chi square analysis to distinguish between linkage and
independent assortment.
Accessibility: Keyboard Navigation
12
Copyright © 2018 McGraw-Hill
6) In a chi-square test to determine if two genes are linked or assorting independently, what is the
default (null) hypothesis that is tested?
A) The genes are linked to one another.
B) The genes are assorting independently.
C) The genes are located on the sex chromosomes.
D) No crossing over occurs.
E) The distance between the genes is very small.
Answer: B
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.03 Apply a chi square analysis to distinguish between linkage and
independent assortment.
Accessibility: Keyboard Navigation
7) The visual proof that chromosomes exchange pieces of information during crossing over was
provided by ________.
A) Bateson and Punnett
B) Morgan and Bridges
C) Creighton and McClintock
D) Watson and Crick
Answer: C
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.01 Describe how crossing over can change the arrangements of
alleles along a chromosome.
Accessibility: Keyboard Navigation
8) The process of recombination may rarely occur during mitosis.
Answer: TRUE
Section: 06.05
Topic: Mitotic Recombination
Bloom's: 1. Remember
Learning Outcome: 06.05.01 Describe the process of mitotic recombination and explain how it
can produce a twin spot.
Accessibility: Keyboard Navigation
13
Copyright © 2018 McGraw-Hill
9) Twin spotting provides evidence of what genetic event?
A) Meiotic recombination
B) Mitotic recombination
C) Linkage
D) Mutation
E) Biological evolution
Answer: B
Section: 06.05
Topic: Mitotic Recombination
Bloom's: 1. Remember
Learning Outcome: 06.05.01 Describe the process of mitotic recombination and explain how it
can produce a twin spot.
Accessibility: Keyboard Navigation
10) An organism that contains patches of tissue that vary for a specific characteristic such as a
pigment, can be an example of which of the following?
A) Linkage
B) Meiotic recombination
C) Mitotic recombination
D) Translocations
E) None of the answers are correct
Answer: C
Section: 06.05
Topic: Mitotic Recombination
Bloom's: 2. Understand
Learning Outcome: 06.05.01 Describe the process of mitotic recombination and explain how it
can produce a twin spot.
Accessibility: Keyboard Navigation
11) Which of the following are highly desirable characteristics of an organism that make it
relatively easy to construct a genetic linkage map?
A) Short generation times
B) Produces large numbers of offspring
C) Easily crossed
D) All of the answers are correct
Answer: D
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 2. Understand
Learning Outcome: 06.03.01 Describe why genetic mapping is useful.
Accessibility: Keyboard Navigation
14
Copyright © 2018 McGraw-Hill
12) A genetic linkage map indicates that precise distance between two genes of interest.
Answer: FALSE
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 2. Understand
Learning Outcome: 06.03.01 Describe why genetic mapping is useful.
Accessibility: Keyboard Navigation
13) Crossing over is more likely to occur between genes that are ________ on a chromosome.
A) Close together
B) Far apart
Answer: B
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
14) A testcross is always performed between the individual that is heterozygous for the genes to
be mapped and an individual who is ________.
A) Heterozygous for the genes
B) Homozygous dominant for the genes
C) Homozygous recessive for the genes
D) Lacking the genes
E) None of the answers are correct
Answer: C
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 2. Understand
Learning Outcome: 06.03.02 Calculate the map distance between linked genes using data from
a testcross.
Accessibility: Keyboard Navigation
15
Copyright © 2018 McGraw-Hill
15) While mapping two genes in Drosophila, you observe 30 recombinants among 200 total
offspring. What is the distance between these genes?
A) 30 map units
B) 6.67 map units
C) 200 map units
D) 15 map units
Answer: D
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 3. Apply
Learning Outcome: 06.03.02 Calculate the map distance between linked genes using data from
a testcross.
Accessibility: Keyboard Navigation
16) A map distance of 23.6 between two genes indicates which of the following?
A) The genes are 23.6 millimeters apart.
B) There are 23.6 other genes between the two genes of interest.
C) 23.6% of the offspring exhibit recombination between the two genes.
D) 23.6% of the offspring do not survive.
Answer: C
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 2. Understand
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
17) In a mapping experiment with three linked genes, which phenotype should occur most often
in the F2 offspring?
A) Parental phenotypes.
B) Phenotypes of individuals with single crossover events.
C) Phenotypes of individuals with double crossover events.
D) All of the phenotypes should occur equally in the F2 generation.
Answer: A
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
16
Copyright © 2018 McGraw-Hill
18) The middle gene of a three gene mapping experiment can be determined by examining the
genotypes of which of the following?
A) Offspring that resemble the parents.
B) Offspring that exhibit a single crossover event.
C) Offspring that exhibit double crossover events.
D) None of the answers are correct.
Answer: C
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 2. Understand
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
19) In a given mapping experiment, you expect that incidence of double crossovers is 3.5%, but
you only observe 2.5%. This can be explained by ________.
A) interference
B) linkage
C) coincidence
D) segregation
Answer: A
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 2. Understand
Learning Outcome: 06.03.03 Explain how interference affects the number of double
crossovers.
Accessibility: Keyboard Navigation
20) You have calculated the interference value for a given mapping experiment to be 30%. What
does this mean?
A) 30% more double crossovers occurred than expected.
B) 30% fewer double crossovers occurred than expected.
C) 70% more double crossovers occurred than expected.
D) 70% fewer double crossovers occurred than expected.
Answer: B
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 2. Understand
Learning Outcome: 06.03.03 Explain how interference affects the number of double
crossovers.
Accessibility: Keyboard Navigation
17
Copyright © 2018 McGraw-Hill
21) Which of the following is not one of the principles of linkage that Morgan obtained from his
experiments?
A) Genes that are on the same chromosome may be inherited together.
B) Crossing over exchanges pieces of chromosomes and creates new allele combinations.
C) The likelihood of crossing over occurring between two genes is dependent on the distance of
the genes from one another.
D) Genes that are on the same chromosome are always transmitted together as a unit.
Answer: D
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 2. Understand
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
22) In humans, there are ________ autosomal linkage groups, plus an X and Y chromosome
linkage group.
A) 23
B) 46
C) 22
D) 92
Answer: C
Section: 06.01
Topic: Overview of Linkage
Bloom's: 1. Remember
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
23) Another name for a chromosome is a ________, since it contains genes that are often
inherited together.
A) linkage group
B) crossing over group
C) genetic recombinant
D) bivalent
Answer: A
Section: 06.01
Topic: Overview of Linkage
Bloom's: 1. Remember
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
18
Copyright © 2018 McGraw-Hill
24) Two genes that are located on the same chromosome are said to be ________.
A) physically linked
B) recombinant
C) parental-like
D) nonparental-like
Answer: A
Section: 06.01
Topic: Overview of Linkage
Bloom's: 1. Remember
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
25) Creighton and McClintock worked with ________ and their model system to show that
homologous chromosomes physically exchange genetic information during crossing over.
A) fruit flies
B) peas
C) corn
D) tobacco
Answer: C
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.01 Describe how crossing over can change the arrangements of
alleles along a chromosome.
Accessibility: Keyboard Navigation
26) A negative interference value indicates that the first crossover event enhanced the occurrence
of additional crossover events in the region.
Answer: TRUE
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 1. Remember
Learning Outcome: 06.03.03 Explain how interference affects the number of double
crossovers.
Accessibility: Keyboard Navigation
27) The rearrangement of alleles by the process of crossing over is called genetic linkage.
Answer: FALSE
Section: 06.01
Topic: Overview of Linkage
Bloom's: 2. Understand
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
19
Copyright © 2018 McGraw-Hill
20
Copyright © 2018 McGraw-Hill
28) Map distance is the number of recombinant offspring divided by the total number of
nonrecombinant offspring.
Answer: FALSE
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 2. Understand
Learning Outcome: 06.03.02 Calculate the map distance between linked genes using data from
a testcross.
Accessibility: Keyboard Navigation
29) Following crossing-over, chromosomes with genetic combinations that resemble the parents'
chromosomes are called nonrecombinant.
Answer: TRUE
Section: 06.01
Topic: Overview of Linkage
Bloom's: 1. Remember
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
30) A map unit or centimorgan is equal to a 10% recombination frequency.
Answer: FALSE
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
31) Map distances above 50 are considered unreliable due to the occurrence of double-crossovers
between the genes.
Answer: TRUE
Section: 06.03
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 1. Remember
Learning Outcome: 06.03.02 Calculate the map distance between linked genes using data from
a testcross.
Accessibility: Keyboard Navigation
21
Copyright © 2018 McGraw-Hill
32) The locus is the physical place of a gene on a chromosome.
Answer: TRUE
Section: 06.03
Topic: Overview of Linkage
Bloom's: 1. Remember
Learning Outcome: 06.03.01 Describe why genetic mapping is useful.
Accessibility: Keyboard Navigation
33) In certain algae and in most ascomycete fungi, the nuclei in the cells present in the majority
of their life cycle are in the ________ condition.
A) Diploid
B) Haploid
C) Triploid
D) Tetraploid
Answer: B
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
34) In ascomycete fungi, the arrangement of the spores in the ascus that directly reflects the
order in which they were produced during meiosis is called an ________.
A) Unordered tetrad
B) Unordered octad
C) Ordered tetrad
D) Ordered pentad
Answer: C
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
22
Copyright © 2018 McGraw-Hill
35) Which of the following procedures may be used to map genes in a fungi with an unordered
tetrad ascus?
A) Testcross
B) Monohybrid cross
C) Dihybrid cross
D) Chi-square analysis
E) Analysis of interference
Answer: C
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 06.04.02 Calculate the map distance between genes in fungi using tetrad
analysis.
Accessibility: Keyboard Navigation
36) In fungi like Neurospora crassa, the diploid structures are called spores.
Answer: FALSE
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
37) The end result of meiosis in fungi is a tetrad of spores.
Answer: TRUE
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 06.04.02 Calculate the map distance between genes in fungi using tetrad
analysis.
Accessibility: Keyboard Navigation
38) A fungal reproductive structure that contains all of the products of a single meiotic division
is called the ascus.
Answer: TRUE
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
23
Copyright © 2018 McGraw-Hill
39) In fungal gene mapping, the abbreviation NPD stands for new parental ditype.
Answer: FALSE
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 06.04.02 Calculate the map distance between genes in fungi using tetrad
analysis.
Accessibility: Keyboard Navigation
40) An ascus that contains two parental spores and two nonparental spores is called a tetratype.
Answer: TRUE
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
41) The percentage of recombination associated with independent assortment should
approximate 50%.
Answer: TRUE
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 2. Understand
Learning Outcome: 06.02.03 Apply a chi square analysis to distinguish between linkage and
independent assortment.
Accessibility: Keyboard Navigation
42) The diploid garden pea plant has 14 chromosomes. The haploid fungus Neurospora crassa
has 7 chromosomes. Neither organism has separate male and female individuals. Therefore,
the number of linkage groups in these two organisms is
A) Garden pea has 14 linkage groups, and Neurospora has 7.
B) Garden pea has 7 linkage groups, and Neurospora has 7.
C) Garden pea has 8 linkage groups, and Neurospora has 8.
D) Gardent pea has 15 linkage groups, and Neurospora has 8.
Answer: B
Section: 06.01
Topic: Overview of Linkage
Bloom's: 3. Apply
Learning Outcome: 06.01.01 Define genetic linkage.
Accessibility: Keyboard Navigation
24
Copyright © 2018 McGraw-Hill
43) The number of linkage groups in an organism with sex chromosomes equals ________,
where n equals the haploid number of autosomes.
A) 1n
B) 2n +1
C) 1n + 1
D) 2n + 2
Answer: C
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 3. Apply
Learning Outcome: 06.03.01 Describe why genetic mapping is useful.
Accessibility: Keyboard Navigation
44) The number of linkage groups in a species that does not have sex chromosomes is: Where n
equals the haploid number of autosomes.
A) 1n
B) 1n + 1
C) 2n
D) 2n + 2
Answer: A
Section: 06.03
Topic: Genetic Mapping in Plants and Animals
Bloom's: 3. Apply
Learning Outcome: 06.03.01 Describe why genetic mapping is useful.
Accessibility: Keyboard Navigation
45) The locus B on the X chromosome of a malaria-carrying mosquito shows a 49%
recombination rate with respect to the locus M. Since a recombination rate of 50% is essentially
indistinguishable from independent assortment, you might be tempted to look for a locus that
falls between B and M. Before you decide to do all that work, you run a chi square test to
determine the P value of your experiment. Which of the following P values would be most
likely to tell you that you should accept the conclusion that locus B and locus M are, indeed,
49mu apart and that another locus is not necessary?
A) P = 0.45
B) P = 0.01
C) P = 0.005
D) P = 0.0007
Answer: A
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 3. Apply
Learning Outcome: 06.02.03 Apply a chi square analysis to distinguish between linkage and
independent assortment.
Accessibility: Keyboard Navigation
25
Copyright © 2018 McGraw-Hill
46) In a mapping cross, you determine that the recombination frequency between:
loci Q and P is 12%
loci Q and L is 15%.
If locus Q is in between loci P and L, then the recombination frequency between P and L should
be approximately
A) 3%.
B) 27%.
C) 50%.
D) 75%.
Answer: B
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 3. Apply
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
26
Copyright © 2018 McGraw-Hill
47) You notice that in most biology and genetics textbooks, the authors show that Gregor
Mendel used flower color as one of his pairs of traits. The purple flower phenotype is dominant
to the white flower phenotype. However, if you go back to Mendel's experiments, you see that he
actually studied seed coat color. The purple seed coat phenotype was dominant to the white seed
coat phenotype. Mendel did note that plants with purple seed coats had purple flowers and
plants with white seed coats had white flowers.
Is the gene for seed coat color pleiotropic because it also affects flower color, or are the seed coat
color gene and the flower color gene very closely linked? To find out the answer to this question,
you assume that the genes for flower color and seed coat color are different genes, and your null
hypothesis is that they assort independently. You designate the flower color gene wf and the seed
coat color gene sw. Plants that are WF__, SW___ have purple flowers and purple seed
coats. Plants that are wf wf, ws ws have white flowers and white seed coats.
You do the testcross WF wf, SW sw X wf wf, sw sw and collect 15,206 offspring. What result
would tell you that the wf and sw loci are probably the same, pleiotropic locus?
A) One of the offspring had white flowers and purple seed coats.
B) About half of the offspring had purple flowers and purple seed coats, and all the rest had
white flowers and white seed coats.
C) All of the offspring had purple flowers and purple seed coats.
D) None of the offspring had white flowers and white seed coats.
Answer: B
Section: 06.02
Topic: Relationship Between Linkage and Crossing Over
Bloom's: 5. Evaluate
Learning Outcome: 06.02.02 Explain how the distance between linked genes affects the
proportions of recombinant and nonrecombinant offspring.
Accessibility: Keyboard Navigation
48) If you want to determine how the alleles of different loci interact in their various
combinations, it is best to have a system where you do not have to worry about dominance and
recessiveness. Which of the following would represent a system where you do not have to
worry about dominance and recessiveness?
A) Homo sapiens
B) Garden peas
C) Drosophila melanogaster
D) Chlamydomonas reinhardtii
Answer: D
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
27
Copyright © 2018 McGraw-Hill
49) The genotype hsp+ HSP- is something that you could easily expect to find in the fungus
Neurospora crassa.
Answer: FALSE
Section: 06.04
Topic: Genetic Mapping in Haploid Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
50) Mitotic recombination occurs between homologous chromosomes. In which of the
following would you not expect to encounter mitotic recombination?
A) The fungus, Aspergillus nidulans
B) Tobacco plants
C) Homo sapiens
D) Drosophila melanogaster
Answer: A
Section: 06.05
Topic: Genetic Mapping in Haploid Eukaryotes; Mitotic Recombination
Bloom's: 2. Understand
Learning Outcome: 06.04.01 Explain the experimental advantage of genetic mapping of fungi.
Accessibility: Keyboard Navigation
51) If two loci are extremely linked, then no recombination is expected.
Answer: TRUE
Section: 06.01
Topic: Overview of Linkage
Bloom's: 2. Understand
Learning Outcome: 06.01.02 Explain how linkage affects the outcome of crosses.
Accessibility: Keyboard Navigation
52) Stern was able to demonstrate crossing over by using the X chromosomes in corn.
Answer: FALSE
Explanation: Read the Stern experiment and the organism
Section: 06.02
Topic: Genetic Mapping in Plants and Animals
Bloom's: 1. Remember
Learning Outcome: 06.02.04 Analyze the experiment of Stern, and explain how it indicated
that recombinant offspring carry chromosomes that are the result of crossing over.
Accessibility: Keyboard Navigation
Genetics, 6e (Brooker)
Chapter 8 Variation in Chromosome Structure and Number
1) Which type of chromosome has the longest p arm of the chromosome?
28
Copyright © 2018 McGraw-Hill
A) Acrocentric
B) Metacentric
C) Telocentric
D) Submetacentric
Answer: B
Section: 08.01
Topic: Microscopic Examination of Eukaryotic Chromosomes
Bloom's: 2. Understand
Learning Outcome: 08.01.01 Describe the characteristics that are used to classify and identify
chromosomes.
Accessibility: Keyboard Navigation
2) A loss of an internal piece of a chromosome is called a ________.
A) reciprocal translocation
B) terminal deficiency
C) interstitial deletion
D) gene duplication
Answer: C
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 1. Remember
Learning Outcome: 08.03.01 Explain how deletions and duplications occur.
Accessibility: Keyboard Navigation
3) Human genetic diseases such a Cri-du-chat, Angelman syndrome and Prader-Willi syndrome
are the result of which type of chromosomal change?
A) Translocations
B) Duplications
C) Deletions
D) Inversions
Answer: C
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 1. Remember
Learning Outcome: 08.03.02 Describe how deletions and duplications may affect the
phenotype of an organism.
Accessibility: Keyboard Navigation
29
Copyright © 2018 McGraw-Hill
4) Given the following sequence of genes on a chromosome, determine what change in
chromosome structure occurred. (the * indicates the centromere)
before A B C D * E F G H
after A C D * E F G H
A) Terminal deletion
B) Interstitial deletion
C) Inversion
D) Gene duplication
Answer: B
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 3. Apply
Learning Outcome: 08.03.01 Explain how deletions and duplications occur.
Accessibility: Keyboard Navigation
5) The effects of a deficiency on an organism is dependent on the size of the deletion and the
importance of the missing genetic material to the organism.
Answer: TRUE
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 2. Understand
Learning Outcome: 08.03.02 Describe how deletions and duplications may affect the
phenotype of an organism.
Accessibility: Keyboard Navigation
6) Given the following sequence of genes on a chromosome, determine what change in
chromosome structure occurred. (the * indicates the centromere)
before A B C D * E F G H
after A B C D * E F E F G H
A) Terminal deficiency
B) Interstitial deficiency
C) Inversion
D) Gene duplication
Answer: D
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 3. Apply
Learning Outcome: 08.03.01 Explain how deletions and duplications occur.
Accessibility: Keyboard Navigation
30
Copyright © 2018 McGraw-Hill
7) Gene duplications may be caused by
A) the crossing over of misaligned chromosomes.
B) deletion of important genetic information.
C) reciprocal translocations.
D) position effect.
E) None of the answers are correct
Answer: A
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 2. Understand
Learning Outcome: 08.03.01 Explain how deletions and duplications occur.
Accessibility: Keyboard Navigation
8) The production of gene families, such as the globin genes is the result of ________.
A) inversions
B) deficiencies
C) gene duplications
D) simple translocations
E) None of the answers are correct
Answer: C
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 2. Understand
Learning Outcome: 08.03.02 Describe how deletions and duplications may affect the
phenotype of an organism.
Accessibility: Keyboard Navigation
9) Given the following sequence of genes on a chromosome, determine what change in
chromosome structure occurred. (the * indicates the centromere)
before A B C D * E F G H
after A B G F E * D C H
A) Reciprocal translocation
B) Pericentric inversion
C) Paracentric inversion
D) Gene duplication
E) None of the answers are correct
Answer: B
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 3. Apply
Learning Outcome: 08.04.01 Define pericentric inversion and paracentric inversion.
Accessibility: Keyboard Navigation
31
Copyright © 2018 McGraw-Hill
10) Inversions are contained within what percent of the human population?
A) Less than 1%
B) Approximately 2%
C) Approximately 5%
D) Greater than 10%
Answer: B
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 1. Remember
Learning Outcome: 08.04.01 Define pericentric inversion and paracentric inversion.
Accessibility: Keyboard Navigation
11) Inversion loops can occur in
A) paracentric inversions.
B) pericentric inversions.
C) gene duplications.
D) reciprocal translocations.
E) both paracentric inversions and pericentric inversions.
Answer: E
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 2. Understand
Learning Outcome: 08.04.02 Diagram the production of abnormal chromosomes due to
crossing over in inversion heterozygotes.
Accessibility: Keyboard Navigation
12) An inversion heterozygote contains
A) two homologous chromosomes with inversions.
B) two normal chromosomes.
C) one normal chromosome and one chromosome with an inversion.
D) None of the answers are correct
Answer: C
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 1. Remember
Learning Outcome: 08.04.01 Define pericentric inversion and paracentric inversion.
Accessibility: Keyboard Navigation
32
Copyright © 2018 McGraw-Hill
13) Familial Down syndrome is a result of
A) inversion.
B) deficiency.
C) gene duplication.
D) translocation.
Answer: D
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 2. Understand
Learning Outcome: 08.04.03 Explain two mechanisms that result in reciprocal translocations.
Accessibility: Keyboard Navigation
14) Which chromosomal change rarely has an effect on the phenotype of the individual who
carries it?
A) Robertsonian translocation
B) Unbalanced translocation
C) Balanced translocation
D) Chromosome loss
Answer: C
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 4. Analyze
Learning Outcome: 08.04.03 Explain two mechanisms that result in reciprocal translocations.
Accessibility: Keyboard Navigation
15) Robertsonian translocations usually occur between what types of chromosomes?
A) Metacentric
B) Acrocentric
C) Telocentric
D) Submetacentric
Answer: B
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 1. Remember
Learning Outcome: 08.04.03 Explain two mechanisms that result in reciprocal translocations.
Accessibility: Keyboard Navigation
33
Copyright © 2018 McGraw-Hill
16) A translocation cross may occur in an individual that has a(n)
A) reciprocal translocation.
B) unbalanced translocation.
C) simple translocation.
D) All of the answers are correct
Answer: A
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 2. Understand
Learning Outcome: 08.04.03 Explain two mechanisms that result in reciprocal translocations.
Accessibility: Keyboard Navigation
17) Which of the following is not an example of euploidy?
A) Tetraploid
B) Polyploid
C) Triploid
D) Diploid
E) Aneuploid
Answer: E
Section: 08.05
Topic: Changes in Chromosome Number: An Overview
Bloom's: 2. Understand
Learning Outcome: 08.05.01 Define euploid and aneuploid.
Accessibility: Keyboard Navigation
18) Which algebraic expression would be used to denote a trisomic organism?
A) 3n
B) 2n − 1
C) 2n + 1
D) 2n + 2
Answer: C
Section: 08.05
Topic: Changes in Chromosome Number: An Overview
Bloom's: 2. Understand
Learning Outcome: 08.05.01 Define euploid and aneuploid.
Accessibility: Keyboard Navigation
34
Copyright © 2018 McGraw-Hill
19) Edward and Patau syndromes are examples of ________.
A) aneuploidy
B) allopolyploidy
C) autopolyploidy
D) translocations
Answer: A
Section: 08.06
Topic: Variation in the Number of Chromosomes Within a Set: Aneuploidy
Bloom's: 1. Remember
Learning Outcome: 08.06.02 Describe examples of aneuploidy in humans.
Accessibility: Keyboard Navigation
20) Klinefelter and Turner syndromes are examples of
A) sex chromosome aneuploidy.
B) autosomal aneuploidy.
C) reciprocal translocations.
D) paracentric inversions.
Answer: A
Section: 08.06
Topic: Variation in the Number of Chromosomes Within a Set: Aneuploidy
Bloom's: 1. Remember
Learning Outcome: 08.06.02 Describe examples of aneuploidy in humans.
Accessibility: Keyboard Navigation
21) Trisomy 8 usually leads to early miscarriage of a fetus. However, adult individuals have
been found with cells that have three copies of chromosome 8 in them. How can this be?
A) The trisomic 8 adults likely have a mosaic region with trisomy 8.
B) The trisomic cells underwent complete nondisjunction.
C) The trisomic cells underwent a meiotic nondisjunction.
D) This individual must be triploid.
Answer: A
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 3. Apply
Learning Outcome: 08.08.01 Describe how meiotic and mitotic nondisjunction occur and
identify their possible phenotypic consequences.
Accessibility: Keyboard Navigation
35
Copyright © 2018 McGraw-Hill
22) Which syndrome is not correctly matched to its aneuploid condition?
A) Down syndrome—trisomy 21
B) Edward syndrome—trisomy 18
C) Klinefelter syndrome—XO
D) Jacobs syndrome—XYY
Answer: C
Explanation: Klinefelter syndrome is not correctly matched with the XO condition. Klinefelter
syndrome is an XXY condition, while the XO condition is called Turner syndrome. All the rest
of the syndromes are correctly matched with their aneuploid conditions.
Section: 08.06
Topic: Variation in the Number of Chromosomes Within a Set: Aneuploidy
Bloom's: 1. Remember
Learning Outcome: 08.06.02 Describe examples of aneuploidy in humans.
Accessibility: Keyboard Navigation
23) In meiotic nondisjunction, meiotic products can be n+1, n-1, or n depending on when
nondisjunction occurs. If non disjunction occurs in Meiosis I, what is the outcome?
A) two trisomic and two monosomic products
B) one trisomic and three monosomic products
C) one trisomic, one monosomic, and two normal products
D) None of these answers are correct
Answer: A
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 3. Apply
Learning Outcome: 08.08.01 Describe how meiotic and mitotic nondisjunction occur and
identify their possible phenotypic consequences.
Accessibility: Keyboard Navigation
24) The majority of autosomal aneuploid conditions are lethal, but sex chromosome aneuploids
are usually not lethal.
Answer: TRUE
Section: 08.07
Topic: Variation in the Number of Sets of Chromosomes
Bloom's: 2. Understand
Learning Outcome: 08.07.01 Describe examples in animals that involve variation in euploidy.
Accessibility: Keyboard Navigation
36
Copyright © 2018 McGraw-Hill
25) Which human cells exhibit endopolyploidy?
A) Sex cells
B) Nerve cells
C) All somatic cells
D) Liver cells
E) Red blood cells
Answer: D
Section: 08.07
Topic: Variation in the Number of Sets of Chromosomes
Bloom's: 1. Remember
Learning Outcome: 08.07.02 Define endopolyploidy.
Accessibility: Keyboard Navigation
26) The polytene chromosomes of Drosophila are an example of ________.
A) aneuploidy
B) polyploidy
C) translocations
D) inversion loops
E) None of the answers are correct
Answer: B
Section: 08.07
Topic: Variation in the Number of Sets of Chromosomes
Bloom's: 2. Understand
Learning Outcome: 08.07.03 Outline the process of polytene chromosome formation.
Accessibility: Keyboard Navigation
27) What type of plants are usually seedless?
A) Aneuploid
B) Diploid
C) Triploid
D) Tetraploid
Answer: C
Section: 08.07
Topic: Variation in the Number of Sets of Chromosomes
Bloom's: 2. Understand
Learning Outcome: 08.07.04 Discuss the effects of polyploidy among plant species and its
impact in agriculture.
Accessibility: Keyboard Navigation
37
Copyright © 2018 McGraw-Hill
28) The failure of chromosomes to separate during anaphase is called ________.
A) synapsis
B) maternal effect
C) epistasis
D) nondisjunction
Answer: D
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 2. Understand
Learning Outcome: 08.08.01 Describe how meiotic and mitotic nondisjunction occur and
identify their possible phenotypic consequences.
Accessibility: Keyboard Navigation
29) What term describes an organism with two complete sets of chromosomes from two different
species?
A) Tetraploid
B) Aneuploid
C) Allodiploid
D) Allotetraploid
Answer: D
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 1. Remember
Learning Outcome: 08.08.02 Compare and contrast autopolyploidy, alloploidy, and
allopolyploidy.
Accessibility: Keyboard Navigation
30) The short arm of a chromosome is denoted by the letter ________ and the long arm by the
letter ________.
A) p, q
B) s, l
C) q, p
D) c, d
Answer: A
Section: 08.01
Topic: Microscopic Examination of Eukaryotic Chromosomes
Bloom's: 1. Remember
Learning Outcome: 08.01.01 Describe the characteristics that are used to classify and identify
chromosomes.
Accessibility: Keyboard Navigation
38
Copyright © 2018 McGraw-Hill
31) A photographic representation of the chromosomes of an organism is called a(n) ________.
A) allele variation
B) chromosomal spreading
C) chromosome picture
D) karyotype
Answer: D
Section: 08.02
Topic: Changes in Chromosome Structure: An Overview
Bloom's: 1. Remember
Learning Outcome: 08.02.01 Compare and contrast the four types of changes in chromosome
structure.
Accessibility: Keyboard Navigation
32) A diploid organism has a total of 36 chromosomes. Assuming all possible chromosome
combinations are viable, if a mutant tetraploid version of this organism was created how many
chromosomes would it have? If a mutant version of this organism was monosomic for
chromosome 9 how many chomosomes would it have?
A) 144; 35
B) 72; 35
C) 144; 37
D) 72; 37
Answer: B
Section: 08.08
Topic: Variation in the Number of Sets of Chromosomes
Bloom's: 4. Analyze
Learning Outcome: 08.08.02 Compare and contrast autopolyploidy, alloploidy, and
allopolyploidy.
Accessibility: Keyboard Navigation
33) Hemophilia A is an X-linked blood clotting disorder. A normal man and a woman with
hemophilia A have a child with Turner Syndrome. This child does not have hemophilia. In
whom did non-disjunction occur? In meiosis I or meiosis II?
A) Woman; meiosis I
B) Woman; meiosis II
C) Man; meiosis I
D) Man; meiosis II
E) Woman; there is not enough information to tell if the nondisjunction happened in meiosis I or
II.
Answer: E
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 4. Analyze
Learning Outcome: 08.08.01 Describe how meiotic and mitotic nondisjunction occur and
identify their possible phenotypic consequences.
39
Copyright © 2018 McGraw-Hill
Accessibility:
Keyboard Navigation
34) A ________ translocation represents when a piece of one chromosome is attached to another
chromosome.
A) simple
B) complex
C) reciprocal
D) balanced
Answer: A
Section: 08.02
Topic: Changes in Chromosome Structure: An Overview
Bloom's: 1. Remember
Learning Outcome: 08.02.01 Compare and contrast the four types of changes in chromosome
structure.
Accessibility: Keyboard Navigation
35) ________ is a drug that is used to experimentally produce polyploidy in organisms.
A) Penicillin
B) Colchicine
C) Polymosca
D) Karyocine
Answer: B
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 1. Remember
Learning Outcome: 08.08.04 Describe how colchicine is used to produce polyploid species.
Accessibility: Keyboard Navigation
36) Translocations and inversions represent a change in the total amount of genetic material in
chromosomes.
Answer: FALSE
Section: 08.02
Topic: Changes in Chromosome Structure: An Overview
Bloom's: 2. Understand
Learning Outcome: 08.02.01 Compare and contrast the four types of changes in chromosome
structure.
Accessibility: Keyboard Navigation
40
Copyright © 2018 McGraw-Hill
37) Polyploid plants tend to produce fewer fruits and flowers, be smaller in size, and not adapt as
well to extreme environmental conditions as normal varieties.
Answer: FALSE
Section: 08.07
Topic: Variation in the Number of Sets of Chromosomes
Bloom's: 1. Remember
Learning Outcome: 08.07.04 Discuss the effects of polyploidy among plant species and its
impact in agriculture.
Accessibility: Keyboard Navigation
38) Due to the formation of an inversion loop, sections of DNA may either be duplicated or
deleted depending on the size of the inversion.
Answer: TRUE
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 2. Understand
Learning Outcome: 08.04.02 Diagram the production of abnormal chromosomes due to
crossing over in inversion heterozygotes.
Accessibility: Keyboard Navigation
39) Homologous genes within a species are called paralogs.
Answer: TRUE
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 1. Remember
Learning Outcome: 08.03.03 Define copy number variation.
Accessibility: Keyboard Navigation
40) The ends of chromosomes have areas of repeated DNA called centromeres.
Answer: FALSE
Section: 08.01
Topic: Microscopic Examination of Eukaryotic Chromosomes
Bloom's: 1. Remember
Learning Outcome: 08.01.01 Describe the characteristics that are used to classify and identify
chromosomes.
Accessibility: Keyboard Navigation
41
Copyright © 2018 McGraw-Hill
41) The aneuploid condition frequently affects the phenotype of an organism.
Answer: TRUE
Section: 08.06
Topic: Variation in the Number of Chromosomes Within a Set: Aneuploidy
Bloom's: 2. Understand
Learning Outcome: 08.06.01 Explain why aneuploidy usually has a detrimental effect on
phenotype.
Accessibility: Keyboard Navigation
42) Genetic abnormalities that occur before fertilization may result in some tissues of the body
differing in their genetic composition. This is called mosaicism.
Answer: FALSE
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 1. Remember
Learning Outcome: 08.08.01 Describe how meiotic and mitotic nondisjunction occur and
identify their possible phenotypic consequences.
Accessibility: Keyboard Navigation
43) The salivary amylase gene (AMY1) is present in two diploid copies in
chimpanzees. Humans are known to have between 6-15 copies, an adaptation that is thought to
be related to the high-starch diet of humans. This difference among humans is an example of
A) G banding.
B) copy number variation.
C) a simple translocation.
D) a reciprocal translocation.
Answer: B
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 3. Apply
Learning Outcome: 08.03.03 Define copy number variation.
Accessibility: Keyboard Navigation
42
Copyright © 2018 McGraw-Hill
44) SMAD4 is a tumor suppressor gene located on chromosome 18 that is known to be
homozygously deleted in human lung cancer. If you were to perform comparative genomic
hybridization using tissue from a lung cancer patient with a homozygous negative SMAD4
tumor, what ratio of green to red fluorescence would you expect?
A) A ratio of 1 on all of chromosome 18.
B) A ratio of 2 on the part of chromosome 18 containing the SMAD4 gene, with a value of 1 on
the remainder of the chromosome.
C) A ratio of 0 on all of chromosome 18.
D) A ratio of 0 on the part of chromosome 18 containing the SMAD4 gene, with a value of 1 on
the remainder of the chromosome.
E) A ratio of 1 on the part of chromosome 18 containing the SMAD4 gene, with a value of 0 on
the remainder of the chromosome.
F) A ratio of 0.5 on the part of chromosome 18 containing the SMAD gene, with a value of 1 on
the remainder of the chromosome.
Answer: A
Explanation: When an area is deleted on both chromosomes, as in the homozygous deletion of
SMAD4, the green to red ratio is 0. But because the deletion only occurs in the area of the
SMAD4 gene, the rest of the chromosome will have a ratio of 1; these other chromosomal
regions are the same between the lung cancer patient cells and normal cells.
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 4. Analyze
Learning Outcome: 08.03.04 Interpret the results of an experiment that uses the technique of
comparative genomic hybridization.
Accessibility: Keyboard Navigation
45) The common goldfish Carassius auratus has 100 chromosomes and is tetraploid. The
goldfish therefore has ________ sets of chromosomes containing ________ chromosomes each.
A) 4; 25
B) 2; 50
C) 4; 100
D) 1; 100
Answer: A
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 3. Apply
Learning Outcome: 08.08.02 Compare and contrast autopolyploidy, alloploidy, and
allopolyploidy.
Accessibility: Keyboard Navigation
43
Copyright © 2018 McGraw-Hill
46) The African clawed frog (Xenopus laevis) is allotetraploid, likely as a result of an
interspecies mating long ago, followed by a duplication of the entire genome. Xenopus laevis is
fertile and has a normal life cycle. In contrast, mules, the allodiploid offspring of a male donkey
and a female horse, are generally sterile. Why can Xenopus reproduce and mules cannot?
A) Frogs are less sensitive to multiple copies of the genome than mammals.
B) In allotetraploid organisms each chromosome has a chromosome to pair up with in meiosis,
whereas in allodiploid organisms they do not.
C) The two frogs that interbred to form the Xenopus laevis must have been more closely
genetically related than the donkey and horse are.
D) The mule must have a genetic mutation that prevents it from reproducing.
Answer: B
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 2. Understand
Learning Outcome: 08.08.03 Explain why allotetraploids are more likely than allodiploids to
be fertile.
Accessibility: Keyboard Navigation
47) You perform comparative genomic hybridization. You correctly synthesize your red and
green DNA, but you forget to treat the DNA with heat before you apply the samples to
metaphase chromosomes. What will the ratio of green fluorescence to red fluorescence be?
A) 0
B) 1
C) 2
D) There will be no signal.
Answer: D
Section: 08.03
Topic: Deletions and Duplications
Bloom's: 3. Apply
Learning Outcome: 08.03.04 Interpret the results of an experiment that uses the technique of
comparative genomic hybridization.
Accessibility: Keyboard Navigation
44
Copyright © 2018 McGraw-Hill
48) A wholphin is a rare hybrid animal born from mating a female bottlenose dolphin with a
male false killer whale. Wholphins are diploid. Interestingly, wholphins are fertile. What can
you conclude from the fact that wholphins are fertile?
A) Wholphins are allotetraploid.
B) Dolphins and false killer whales likely have the same number of chromosomes.
C) Dolphins and false killer whales are actually the same species.
D) One of the parents must have been aneuploid.
Answer: B
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 3. Apply
Learning Outcome: 08.08.03 Explain why allotetraploids are more likely than allodiploids to
be fertile.
Accessibility: Keyboard Navigation
49) When scientists apply colchicine to plants to induce polyploidy, often tetraploid Is
it possible that these tetraploids to be fertile, hence becoming a new species?
A) No, because all autotetraploids are sterile.
B) Yes, the tetraploids can produce diploid eggs and pollen.
Answer: B
Section: 08.08
Topic: Natural and Experimental Mechanisms That Produce Variation in Chromosome
Number
Bloom's: 3. Apply
Learning Outcome: 08.08.04 Describe how colchicine is used to produce polyploid species.
Accessibility: Keyboard Navigation
50) In individuals with reciprocal tranlocations, meiosis can produce unbalanced gametes.
Answer: TRUE
Section: 08.04
Topic: Inversions and Translocations
Bloom's: 2. Understand
Learning Outcome: 08.04.04 Describe how reciprocal translocations align during meiosis and
how they segregate.
Accessibility: Keyboard Navigation
51) In polyploids, the chromosomal number is an integral multiple, whereas in aneuploids the
number is plus or minus one or more from the diploid number.
Answer: TRUE
Section: 08.05
Topic: Changes in Chromosome Number: An Overview
Bloom's: 2. Understand
Learning Outcome: 08.05.02 Compare and contrast polyploidy and aneuploidy.
45
Copyright © 2018 McGraw-Hill
Accessibility:
Keyboard Navigation
Genetics, 6e (Brooker)
Chapter 9 Molecular Structure of DNA and RNA
1) Frederick Griffith is responsible for discovering what process?
A) Replication
B) Transmission
C) Transformation
D) Transduction
Answer: C
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 1. Remember
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
2) The fact that the type R and S strains of Streptococcus pneumoniae that Griffith worked with
possessed small differences in capsule structure satisfies which of the following criteria for
genetic material?
A) Transmission
B) Replication
C) Information
D) Variation
Answer: D
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 2. Understand
Learning Outcome: 09.01.01 Describe the four criteria that the genetic material must meet.
Accessibility: Keyboard Navigation
3) The individuals who determined that Griffith's transforming principle was DNA were
________.
A) Hershey and Chase
B) Avery, Macleod, and McCarty
C) Watson and Crick
D) Creighton and McClintock
Answer: B
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 1. Remember
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
46
Copyright © 2018 McGraw-Hill
material.
Accessibility:
Keyboard Navigation
4) These individuals determined that DNA was responsible for the process of transduction in T2
phage.
A) Hershey and Chase
B) Avery, Macleod, and McCarty
C) Watson and Crick
D) Creighton and McClintock
Answer: A
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 1. Remember
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
5) What is a characteristic of T2 bacteriophage?
A) It does not require a host cell for replication.
B) The phage attaches to the cell wall of a target eukaryotic cell.
C) The phages injects its DNA into the host cell.
D) The new phages are formed outside the host cell.
Answer: C
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 2. Understand
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
6) What was the conclusion of the Hershey-Chase experiments?
A) Their results suggested the presence of a transforming principle.
B) Their results suggested that DNA is a double helix.
C) Their results suggested that A+G=T+C.
D) Their results suggested that the DNA is the genetic material.
Answer: D
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 2. Understand
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
47
Copyright © 2018 McGraw-Hill
48
Copyright © 2018 McGraw-Hill
7) The building blocks of DNA are called ________.
A) amino acids
B) codons
C) nucleotides
D) alleles
Answer: C
Section: 09.02
Topic: Overview of DNA and RNA Structure
Bloom's: 1. Remember
Learning Outcome: 09.02.01 Define nucleic acid.
Accessibility: Keyboard Navigation
8) What is a component of a single nucleotide?
A) A phosphate group
B) A six carbon sugar
C) All five nitrogenous bases
Answer: A
Section: 09.03
Topic: Nucleotide Structure
Bloom's: 2. Understand
Learning Outcome: 09.03.01 Describe the structure of a nucleotide.
Accessibility: Keyboard Navigation
9) How does DNA differ from RNA?
A) RNA uses only purines.
B) RNA uses a different five-carbon sugar.
C) RNA has a contains different sized phosphate groups.
D) RNA has multiple bases attached to the sugar.
Answer: B
Section: 09.03
Topic: Nucleotide Structure
Bloom's: 2. Understand
Learning Outcome: 09.03.02 Compare and contrast the structures of nucleotides found in DNA
and in RNA.
Accessibility: Keyboard Navigation
49
Copyright © 2018 McGraw-Hill
10) Which base is not found in DNA?
A) Cytosine
B) Guanine
C) Thymidine
D) Adenine
E) Uracil
Answer: E
Section: 09.03
Topic: Nucleotide Structure
Bloom's: 1. Remember
Learning Outcome: 09.03.02 Compare and contrast the structures of nucleotides found in DNA
and in RNA.
Accessibility: Keyboard Navigation
11) The backbone of the DNA molecule is formed by ________.
A) peptide bonds
B) ribose sugars
C) nitrogenous bases
D) phosphodiester bonds
Answer: D
Section: 09.04
Topic: Structure of a DNA Strand
Bloom's: 1. Remember
Learning Outcome: 09.04.01 Describe the structural features of a DNA strand.
Accessibility: Keyboard Navigation
12) The individual(s) who used ball and stick models to identify the three-dimensional structure
of proteins was ________.
A) Franklin
B) Watson and Crick
C) Hershey and Chase
D) Pauling
E) Chargaff
Answer: D
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
50
Copyright © 2018 McGraw-Hill
13) What is the directionality of the DNA molecule?
A) Front to back
B) Top to bottom
C) 5' to 3'
D) 3' to 5'
E) All DNA molecules are different in their directionality
Answer: C
Section: 09.04
Topic: Structure of a DNA Strand
Bloom's: 1. Remember
Learning Outcome: 09.04.01 Describe the structural features of a DNA strand.
Accessibility: Keyboard Navigation
14) The researcher(s) who initially used X-ray diffraction to gather information on the DNA
molecule was ________.
A) Franklin
B) Watson and Crick
C) Hershey and Chase
D) Pauling
E) Chargaff
Answer: A
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
15) What were the conclusions of Franklin's work regarding the structure of DNA?
A) It did not have a helical structure.
B) The helix had more than one strand.
C) The helix contained about 1 bases per turn.
D) The helix had only one strand.
Answer: B
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
51
Copyright © 2018 McGraw-Hill
16) According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of
guanine will it contain?
A) 20%
B) 30%
C) 50%
D) 75%
Answer: B
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 4. Analyze
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
17) The first group of researchers to correctly identify the double-helix structure of DNA were
________.
A) McClintock and Franklin
B) Hershey and Chase
C) Pauling and Avery
D) Watson and Crick
Answer: D
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
18) In a double-helix DNA strand, the adenine on one strand forms a hydrogen bond with a(n)
________ on the other strand.
A) adenine
B) guanine
C) thymine
D) cytosine
Answer: C
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 2. Understand
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
52
Copyright © 2018 McGraw-Hill
19) How many bases are necessary to complete three complete twists (1080 degrees) of a DNA
helix?
A) 5
B) 10
C) 30
D) 60
Answer: C
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 3. Apply
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
20) The fact that the helixes of the DNA strand are arranged in opposite directions gives DNA its
________ characteristics.
A) antiparallel
B) complementary
C) redundant
D) water-soluble
Answer: A
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 2. Understand
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
21) One strand of DNA is 5'–AGGCCTTA–3'. What is the opposite strand?
A) 5'–AGGCCTTA–3'
B) 5'–TCCGGAAT–3'
C) 3'–AGGCCTTA–5'
D) 3'–TCCGGAAT–5'
Answer: D
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 3. Apply
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
53
Copyright © 2018 McGraw-Hill
22) What DNA form is most common in living organisms?
A) B DNA
B) Z DNA
C) Triplex DNA
Answer: A
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.06.02 Compare and contrast B DNA and Z DNA.
Accessibility: Keyboard Navigation
23) Which DNA molecule form is a left-handed?
A) B DNA
B) Z DNA
C) R DNA
Answer: B
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.06.02 Compare and contrast B DNA and Z DNA.
Accessibility: Keyboard Navigation
24) In the Hershey-Chase experiments, the protein coat of the bacteriophage was labeled with the
32P radioisotope.
Answer: FALSE
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 1. Remember
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
25) A nucleoside consists of only a five-carbon sugar and a phosphate group.
Answer: FALSE
Section: 09.03
Topic: Nucleotide Structure
Bloom's: 1. Remember
Learning Outcome: 09.03.01 Describe the structure of a nucleotide.
Accessibility: Keyboard Navigation
54
Copyright © 2018 McGraw-Hill
26) B DNA is recognized as a left-handed molecule.
Answer: FALSE
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
27) A purine on one strand of the DNA is always paired with a pyrimidine on the other strand.
Answer: TRUE
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
28) The helical shape of the DNA contains major and minor grooves, which assist in the
regulating of gene expression.
Answer: TRUE
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
29) A DNA strand can be described as antiparallel but uncomplementary.
Answer: FALSE
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 2. Understand
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
55
Copyright © 2018 McGraw-Hill
30) Avery used the enzyme ________ to remove the proteins from the cell extracts.
A) protease
B) DNase
C) RNase
D) All of the answers are correct
Answer: A
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 1. Remember
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
31) The ________ was labeled using the radioisotope 32P in the Hershey-Chase experiments.
A) RNA
B) DNA
C) protein
D) carbohydrates
Answer: B
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 1. Remember
Learning Outcome: 09.01.02 Analyze the results of (1) Griffith, (2) Avery, MacLeod, and
McCarty, and (3) Hershey and Chase, and explain how they indicate that DNA is the genetic
material.
Accessibility: Keyboard Navigation
32) Cells are treated with a drug that blocks purine synthesis. Which bases would not be made
in those treated cells?
A) cytosine, thymine, and uracil
B) adenine and guanine
C) adenine and thymine
D) cytosine and guanine
Answer: B
Section: 09.03
Topic: Nucleotide Structure
Bloom's: 3. Apply
Learning Outcome: 09.03.01 Describe the structure of a nucleotide.
Accessibility: Keyboard Navigation
56
Copyright © 2018 McGraw-Hill
33) The pyrimidine bases are ________.
A) cytosine, thymine, and uracil
B) adenine and guanine
C) adenine and thymine
D) cytosine and guanine
Answer: A
Section: 09.03
Topic: Nucleotide Structure
Bloom's: 1. Remember
Learning Outcome: 09.03.01 Describe the structure of a nucleotide.
Accessibility: Keyboard Navigation
34) The idea that the adenine and thymine bases of the DNA interact in some manner was first
proposed by ________.
A) Watson and Crick
B) Franklin
C) Pauling
D) Chargaff
Answer: D
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
35) Adenine and thymine form ________ hydrogen bonds between them, while cytosine and
guanine form ________ bonds.
A) 2, 3
B) 3, 4
C) 3, 2
D) 4, 3
Answer: A
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 1. Remember
Learning Outcome: 09.06.01 Outline the key structural features of the DNA double helix.
Accessibility: Keyboard Navigation
57
Copyright © 2018 McGraw-Hill
36) What is one of the criteria that all genetic material must meet?
A) It does not contain the information necessary to construct the entire organism.
B) It must be passed from offspring to parent.
C) It must be able to be copied.
D) It must have a limited amount of variation.
Answer: C
Section: 09.01
Topic: Identification of DNA as the Genetic Material
Bloom's: 2. Understand
Learning Outcome: 09.01.01 Describe the four criteria that the genetic material must meet.
Accessibility: Keyboard Navigation
37) Which of the following is a correct matching of the researcher with their discovery?
A) Pauling provided information on primary structure in biological molecules.
B) Franklin suggested that DNA was a helix with more than one strand and that there were about
10 bases per turn of the DNA.
C) Watson and Crick collected a large amount of X-ray data on the structure of DNA.
D) Chargaff demonstrated that the adenine and cytosine bases and the uracil and guanine bases
interacted in some manner.
Answer: B
Section: 09.05
Topic: Discovery of the Double Helix
Bloom's: 2. Understand
Learning Outcome: 09.05.01 Outline the key experiments that led to the discovery of the DNA
double helix.
Accessibility: Keyboard Navigation
38) What is the most complex structure DNA can form?
A) Individual nucleotides
B) A folded and bended double helix
C) A single strand of DNA
D) A DNA double helix
Answer: B
Section: 09.02
Topic: Overview of DNA and RNA Structure
Bloom's: 2. Understand
Learning Outcome: 09.02.02 Describe the four levels of complexity of DNA.
Accessibility: Keyboard Navigation
58
Copyright © 2018 McGraw-Hill
39) An RNA strand with sequence 5'–GUACAAUGACUUAUGUAC–3' can potentially form
which structure?
A) Bulge loop
B) Internal loop
C) Multibranched junction
D) Stem-loop
Answer: A
Section: 09.07
Topic: RNA Structure
Bloom's: 4. Analyze
Learning Outcome: 09.07.01 Outline the key structural features of RNA.
Accessibility: Keyboard Navigation
40) Select the DNA strand that would form a triple helix with the following double helix.
5'–CTACTTAGAAGGGGAAATACG–3'
3'–GATGAATCTTCCCCTTTACGC–5'
A) 3'–TTTCCCCTTCT–5'
B) 5'–TTTCCCCTTCT–3'
C) 3'–AAAGGGGAAGA–5'
D) 5'–AAAGGGGAAGA–3'
Answer: A
Section: 09.06
Topic: Structure of the DNA Double Helix
Bloom's: 3. Apply
Learning Outcome: 09.06.03 Describe how triplex DNA is formed.
Accessibility: Keyboard Navigation
59
Copyright © 2018 McGraw-Hill
Genetics, 6e (Brooker)
Chapter 10 Chromosome Organization and Molecular Structure
1) How many origins of replication are there in bacteria?
A) 0
B) 1
C) 2
D) More than two
Answer: B
Section: 10.01
Topic: Organization of Sites Along Bacterial Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.01.01 Describe the organization of sites along bacterial chromosomes.
Accessibility: Keyboard Navigation
2) Where is the bacterial chromosome located?
A) Nucleus
B) Nucleolus
C) Nucleoid
D) Nuclear envelope
Answer: C
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.
Accessibility: Keyboard Navigation
3) What is a mechanism of condensation shared by both prokaryotes and eukaryotes?
A) Nucleosomes
B) Loop domains
C) 30 nm fiber
D) None of the answers are correct
Answer: B
Section: 10.02; 10.05
Topic: Structure of Bacterial Chromosomes; Structure of Eukaryotic Chromosomes in
Nondividing Cells
Bloom's: 3. Apply
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.; 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial loop
domains.
Accessibility: Keyboard Navigation
1
Copyright © 2018 McGraw-Hill
4) Loop domains in prokaryotes involve how many base pairs?
A) 10,000
B) 100,000
C) 1000
D) 50,000
Answer: A
Explanation: See Section 10.2
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.
Accessibility: Keyboard Navigation
5) Negative Supercoiling in bacteria
A) makes the chromosomal DNA more compact.
B) creates tension because of the underwinding of the DNA.
C) can promote DNA strand separations in small regions.
D) All of the answers are correct.
Answer: D
Explanation: See Section 10.2 and Figures 10.4 and 10.5.
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 3. Apply
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.; 10.02.02 Describe how DNA gyrase causes DNA supercoiling.
Accessibility: Keyboard Navigation
6) Turning the DNA helix to the right causes
A) positive supercoiling.
B) overwinding.
C) All of the answers are correct.
Answer: C
Explanation: See Figure 10.4
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 2. Understand
Learning Outcome: 10.02.02 Describe how DNA gyrase causes DNA supercoiling.
Accessibility: Keyboard Navigation
2
Copyright © 2018 McGraw-Hill
7) One would expect heterochromatic regions of DNA to be more compacted than euchromatic
regions.
Answer: TRUE
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.01 Define chromatin.
Accessibility: Keyboard Navigation
8) DNA topoisomerase I does which of the following?
A) Relax negative supercoils
B) Relax positive supercoils
C) Introduce negative supercoils
D) More than one of the answers are correct
Answer: A
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 2. Understand
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.; 10.02.02 Describe how DNA gyrase causes DNA supercoiling.
Accessibility: Keyboard Navigation
9) Chemicals such as quinolones are antibacterial. How does it kill bacteria?
A) It inhibits DNA gyrase.
B) It inhibits DNA compaction.
C) It inhibits DNA replication.
D) All of the answers are correct.
Answer: A
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 2. Understand
Learning Outcome: 10.02.02 Describe how DNA gyrase causes DNA supercoiling.
Accessibility: Keyboard Navigation
3
Copyright © 2018 McGraw-Hill
10) Why do amphibians have so much more DNA than humans?
A) Amphibians have more repetitive sequences than do humans.
B) Amphibians are more biologically complex than mammals.
C) Amphibians have more genes than do humans.
D) Amphibians are tetraploid, while humans are diploid.
Answer: A
Section: 10.04
Topic: Sizes of Eukaryotic Genomes and Repetitive Sequences
Bloom's: 2. Understand
Learning Outcome: 10.04.02 Define repetitive sequence and explain how this type of sequence
affects genome sizes.
Accessibility: Keyboard Navigation
11) Where do kinetochores attach to chromosomes?
A) Telomeres
B) Specific genes on the chromosome
C) Centromeres
D) They don't attach to DNA
Answer: C
Section: 10.03
Topic: Organization of Sites Along Eukaryotic Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.03.01 Describe the organization of sites along a eukaryotic
chromosome.
Accessibility: Keyboard Navigation
12) Which of the following is found at the end of a eukaryotic chromosome?
A) Telomeres
B) Centromeres
C) Kinetochores
D) Origins of replication
Answer: A
Section: 10.03
Topic: Organization of Sites Along Eukaryotic Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.03.01 Describe the organization of sites along a eukaryotic
chromosome.
Accessibility: Keyboard Navigation
4
Copyright © 2018 McGraw-Hill
13) An Alu sequence is an example of what?
A) Retroelement
B) Transposable element
C) Highly repetitive DNA
D) All of the answers are correct
Answer: D
Section: 10.04
Topic: Sizes of Eukaryotic Genomes and Repetitive Sequences
Bloom's: 1. Remember
Learning Outcome: 10.04.02 Define repetitive sequence and explain how this type of sequence
affects genome sizes.
Accessibility: Keyboard Navigation
14) The majority of the nonrepetitive genes in an organism are found in which of the following?
A) Unique sequences
B) Moderately repetitive sequences
C) Highly repetitive sequences
D) None of the answers are correct
Answer: A
Section: 10.04
Topic: Sizes of Eukaryotic Genomes and Repetitive Sequences
Bloom's: 3. Apply
Learning Outcome: 10.04.02 Define repetitive sequence and explain how this type of sequence
affects genome sizes.
Accessibility: Keyboard Navigation
15) Unique sequences make up approximately what percent of the human genome?
A) 5%
B) 25%
C) 40%
D) 80%
Answer: C
Section: 10.04
Topic: Sizes of Eukaryotic Genomes and Repetitive Sequences
Bloom's: 1. Remember
Learning Outcome: 10.04.02 Define repetitive sequence and explain how this type of sequence
affects genome sizes.
Accessibility: Keyboard Navigation
5
Copyright © 2018 McGraw-Hill
16) How many types of histone proteins are there?
A) 4
B) 5
C) 7
D) 8
Answer: B
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember; 2. Understand
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
17) What types of amino acids are most responsible for the binding of DNA to histones?
A) Hydrophobic amino acids
B) Polar amino acids
C) Positively charged amino acids
D) Negatively charged amino acids
Answer: C
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
18) About how many bases of DNA wrap around a histone complex?
A) < 50
B) 150
C) 200
D) > 1,000
Answer: B
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember; 2. Understand
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
6
Copyright © 2018 McGraw-Hill
19) Digesting chromatin with a high concentration of DNAse I would yield fragments of what
approximate size?
A) 200
B) 400
C) 600
D) 1100
Answer: A
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.03 Analyze Noll's results and explain how they support the beadson-a-string model.
Accessibility: Keyboard Navigation
20) What is the purpose of MARs and SARs?
A) To bind to the nuclear matrix
B) To form loop structure
C) To condense DNA
D) All of the answers are correct
Answer: D
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.04 Describe the structure of a chromosome territory.
Accessibility: Keyboard Navigation
21) The two processes of wrapping DNA on nucleosomes and arranging them into a 30 nm fiber
shorten the DNA by how much?
A) 30-fold
B) 50 fold
C) 1 million-fold
D) 3 million-fold
Answer: B
Explanation: See Section 10.5
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 4. Analyze
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
7
Copyright © 2018 McGraw-Hill
22) A Barr body is an example of what?
A) Constitutive heterochromatin
B) Facultative heterochromatin
C) Constitutive euchromatin
D) Facultative euchromatin
Answer: B
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.04 Describe the structure of a chromosome territory.
Accessibility: Keyboard Navigation
23) Areas of the chromosome that remain highly condensed are called ________.
A) Euchromatin
B) Facultative heterochromatin
C) Constitutive heterochromatin
D) Barr body
Answer: C
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.04 Describe the structure of a chromosome territory.
Accessibility: Keyboard Navigation
24) Which of the following assists the alignment of sister chromatids during metaphase?
A) Radial loop domains
B) Cohesin
C) Centromeres
D) Nucleosomes
E) Condensin
Answer: B
Section: 10.06
Topic: Structure of Eukaryotic Chromosomes During Cell Division
Bloom's: 1. Remember
Learning Outcome: 10.06.02 Explain the functions of condensin and cohesin.
Accessibility: Keyboard Navigation
8
Copyright © 2018 McGraw-Hill
25) Which of the following represents the lowest level of chromosome condensation?
A) Radial loop domain
B) 30 nm fibers
C) Heterochromatin
D) Nucleosome
E) Euchromatin
Answer: D
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
26) Which of the following represents the highest level of chromosome condensation?
A) Radial loop domain
B) 30 nm fibers
C) Double helix
D) Nucleosome
E) Heterochromatin
Answer: E
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
27) The function of condensin is to
A) cause the chromosomes to uncompact following mitosis.
B) coat the chromosomes and condense them into heterochromatin through the compaction of
radial loops.
C) hold the DNA to the histone proteins in the nucleosome core particle.
D) trigger DNA to be compacted in a nucleosome core particle.
E) None of the answers are correct.
Answer: B
Section: 10.06
Topic: Structure of Eukaryotic Chromosomes During Cell Division
Bloom's: 1. Remember
Learning Outcome: 10.06.02 Explain the functions of condensin and cohesin.
Accessibility: Keyboard Navigation
9
Copyright © 2018 McGraw-Hill
28) Which of the following is not part of the structure of the nucleosome core particle?
A) It is composed of an octamer of proteins.
B) There is a linker region between two nucleosomes of about 200 base pairs.
C) There are two copies each of H2A, H2B, H3 and H4.
D) The DNA is wrapped around the core slightly over two complete turns.
E) The DNA wrapped around the core contains 146-147 base pairs.
Answer: D
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 3. Apply
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
29) Which of the following is correctly matched with its description?
A) Highly repetitive DNA contains transposable elements and genes that are expressed in
abundance and thus have many copies.
B) Moderately repetitive DNA contains unique sequences, such as genes found in one or a few
copies.
C) Nonrepetitive DNA is composed of thousands of copies of many short repeats.
D) Moderately repetitive DNA contains retro elements, such as the Alu sequence.
E) Moderately repetitive DNA contains transposable elements and genes that are expressed in
abundance and thus have many copies.
Answer: E
Section: 10.04
Topic: Sizes of Eukaryotic Genomes and Repetitive Sequences
Bloom's: 3. Apply
Learning Outcome: 10.04.02 Define repetitive sequence and explain how this type of sequence
affects genome sizes.
Accessibility: Keyboard Navigation
30) Which of the following is not a mechanism used by bacteria to condense their DNA?
A) Super coiling.
B) Packaging the DNA with histone proteins.
C) Looping of the DNA.
D) Increase or decrease the number of turns in the DNA.
E) Anchoring the DNA loops with DNA-binding proteins.
Answer: B
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 3. Apply
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.
Accessibility: Keyboard Navigation
10
Copyright © 2018 McGraw-Hill
31) The DNA of a bacterial cell must be compacted about ________ fold to fit within the
confines of the cell.
A) 10B) 100C) 150D) 1000E) 1,000,000Answer: D
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.
Accessibility: Keyboard Navigation
32) The zig-zag and solenoid models are associated with the ________ level of DNA
organization.
A) histone
B) 11nm fiber
C) beads-on-a-string
D) 30 nm fiber
E) scaffold protein
Answer: D
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
33) The origins of replication in eukaryotic chromosomes are spaced about every ________ base
pairs.
A) 100,000
B) 1000
C) 100
D) 10
E) 500
Answer: A
Section: 10.03
Topic: Organization of Sites Along Eukaryotic Chromosomes
Bloom's: 1. Remember
Learning Outcome: 10.03.01 Describe the organization of sites along a eukaryotic
chromosome.
Accessibility: Keyboard Navigation
11
Copyright © 2018 McGraw-Hill
12
Copyright © 2018 McGraw-Hill
34) A nucleosome is a combination of ________ and ________.
A) histone proteins, scaffold proteins
B) RNA, transcription proteins
C) DNA, histone proteins
D) RNA, histone proteins
E) DNA, scaffold proteins
Answer: C
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
35) Over winding of the DNA decreases the number of turns in the double helix, and thus results
in super coils in the DNA.
Answer: FALSE
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 3. Apply
Learning Outcome: 10.02.02 Describe how DNA gyrase causes DNA supercoiling.
Accessibility: Keyboard Navigation
36) The term genome refers to the complete complement of sequences and genes that an
organism possesses.
Answer: TRUE
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.01 Define chromatin.
Accessibility: Keyboard Navigation
37) Each radial loop domain may contain between 10 and 100 base pairs of DNA.
Answer: FALSE
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
13
Copyright © 2018 McGraw-Hill
38) The majority of bacterial DNA is negatively super coiled.
Answer: TRUE
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 1. Remember; 2. Understand
Learning Outcome: 10.02.01 Outline the processes that make a bacterial chromosome more
compact.
Accessibility: Keyboard Navigation
39) The 30 nm fiber is formed from arrays of nucleosomes.
Answer: TRUE
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
40) The different DNA configurations that are generated by super coiling are called topoisomers
of one another.
Answer: TRUE
Section: 10.02
Topic: Structure of Bacterial Chromosomes
Bloom's: 2. Understand
Learning Outcome: 10.02.02 Describe how DNA gyrase causes DNA supercoiling.
Accessibility: Keyboard Navigation
41) The DNA-protein complex in eukaryotic chromosomes is called the genome.
Answer: FALSE
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 1. Remember
Learning Outcome: 10.05.01 Define chromatin.
Accessibility: Keyboard Navigation
14
Copyright © 2018 McGraw-Hill
42) Why do positively charged amino acids appear more often than usual in histone proteins?
A) Histones have a higher molecular mass, which improves DNA compaction.
B) Histones are strongly attracted to the positively charged phosphate backbone of DNA.
C) Histones and DNA have opposite charges, which improves the compaction of DNA into
nucleosomes.
D) Histones and DNA have the same charge, which improves the compaction of DNA into
nucleosomes.
Answer: C
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 3. Apply
Learning Outcome: 10.05.02 Outline the structures of nucleosomes, the 30-nm fiber, and radial
loop domains.
Accessibility: Keyboard Navigation
43) The is a strong relationship between organism complexity and genome size in eukaryotes
Answer: FALSE
Explanation: See Section 10.4
Section: 10.04
Topic: Sizes of Eukaryotic Genomes and Repetitive Sequences
Bloom's: 2. Understand
Learning Outcome: 10.04.01 Describe the variation in size of eukaryotic genomes.
Accessibility: Keyboard Navigation
44) Because of entropy, chromosomes overlap in an interphase nucleus in a random way
Answer: FALSE
Explanation: See chromosome territory, Section 10.5
Section: 10.05
Topic: Structure of Eukaryotic Chromosomes in Nondividing Cells
Bloom's: 2. Understand
Learning Outcome: 10.05.04 Describe the structure of a chromosome territory.
Accessibility: Keyboard Navigation
Genetics, 6e (Brooker)
Chapter 11 DNA Replication
1) Which of the following best describes the double-helix of DNA?
A) It has directionality
B) The strands are arranged in an anti-parallel arrangement
C) The strands are complementary
D) All of the answers are correct
Answer:
D
15
Copyright © 2018 McGraw-Hill
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 1. Remember
Learning Outcome: 11.01.01 Describe the structural features of DNA that enable it to be
replicated.
Accessibility: Keyboard Navigation
2) The purpose of DNA replication is to produce ________.
A) Two daughter strands
B) Two parental strands
C) Two template strands
D) None of the answers are correct
Answer: A
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.01.01 Describe the structural features of DNA that enable it to be
replicated.
Accessibility: Keyboard Navigation
3) Which of the following best describes the mechanism of DNA replication in which both
parental strands remain together following replication?
A) Dispersive
B) Semiconservative
C) Conservative
D) All of the answers are correct
Answer: C
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.01.02 Analyze the experiment of Meselson and Stahl and explain how
the results were consistent with the semiconservative model of DNA replication.
Accessibility: Keyboard Navigation
16
Copyright © 2018 McGraw-Hill
4) What is the name for the mechanism of DNA replication in which one parental strand and one
daughter strand are combined following replication?
A) Dispersive
B) Semiconservative
C) Conservative
D) All of the answers are correct
Answer: B
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.01.02 Analyze the experiment of Meselson and Stahl and explain how
the results were consistent with the semiconservative model of DNA replication.
Accessibility: Keyboard Navigation
5) The first round of replication in the Meselson and Stahl experiment disproved which theory of
replication?
A) Semiconservative
B) Conservative
C) Dispersive
D) None—it took more than one round to disprove the theory
Answer: B
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.01.02 Analyze the experiment of Meselson and Stahl and explain how
the results were consistent with the semiconservative model of DNA replication.
Accessibility: Keyboard Navigation
6) You have isolated what appears to be alien DNA. While studying its replication, you
performed the exact experiment Meselson and Stahl did. After three generations, the DNA is
subjected to a CsCl gradient and only one band appears. What type of replication does this DNA
undergo?
A) Semiconservative
B) Conservative
C) Dispersive
Answer: C
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 5. Evaluate
Learning Outcome: 11.01.02 Analyze the experiment of Meselson and Stahl and explain how
the results were consistent with the semiconservative model of DNA replication.
Accessibility: Keyboard Navigation
17
Copyright © 2018 McGraw-Hill
7) Bacterial DNA has how many origins of replication per chromosome?
A) 0
B) 1
C) 10
D) Depends on the size of the DNA
Answer: B
Section: 11.02
Topic: Bacterial DNA Replication: The Formation of Two Replication Forks at the Origin of
Replication
Bloom's: 1. Remember
Learning Outcome: 11.02.01 Describe the key features of a bacterial origin of replication.
Accessibility: Keyboard Navigation
8) Which of the following is not correct concerning the initiation of bacterial replication?
A) It involves a region of the DNA called oriC
B) DnaA proteins bind to the DNA to begin separation of the strands
C) The strands are initially separated at GC-rich regions of DNA
D) Following initial separation, DNA helicase enzymes continue to unwrap the DNA
Answer: C
Section: 11.02
Topic: Bacterial DNA Replication: The Formation of Two Replication Forks at the Origin of
Replication
Bloom's: 2. Understand
Learning Outcome: 11.02.02 Explain how DnaA protein initiates DNA replication.
Accessibility: Keyboard Navigation
9) DNA helicase enzymes move in what direction along the DNA during DNA replication?
A) 5' to 3'
B) 3' to 5'
C) They remain stationary
Answer: A
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.01 Describe how helicase, topoisomerase, and single-strand binding
protein are important for the unwinding of the DNA double helix.
Accessibility: Keyboard Navigation
18
Copyright © 2018 McGraw-Hill
10) Removes supercoiling ahead of the replication fork.
A) DNA ligase
B) DNA primase
C) Topoisomerase
D) DNA polymerase I
E) DNA polymerase III
Answer: C
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.01 Describe how helicase, topoisomerase, and single-strand binding
protein are important for the unwinding of the DNA double helix.
Accessibility: Keyboard Navigation
11) Manufactures a 10-12 base segment of RNA.
A) DNA ligase
B) Primase
C) Topoisomerase
D) DNA polymerase I
E) DNA polymerase III
Answer: B
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
12) Fills in small regions of DNA where the RNA primers were located.
A) DNA ligase
B) DNA primase
C) Topoisomerase
D) DNA polymerase I
E) DNA polymerase III
Answer: D
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
19
Copyright © 2018 McGraw-Hill
13) Responsible for the majority of DNA replication.
A) DNA ligase
B) DNA primase
C) Topoisomerase
D) DNA polymerase I
E) DNA polymerase III
Answer: E
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
14) Attaches adjacent Okazaki fragments, forming a continuous DNA strand.
A) DNA ligase
B) DNA primase
C) Topoisomerase
D) DNA polymerase I
E) DNA polymerase III
Answer: A
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
15) Synthesizes the lagging strand of the DNA.
A) DNA ligase
B) DNA primase
C) Topoisomerase
D) DNA polymerase I
E) DNA polymerase III
Answer: E
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.03 Compare and contrast the synthesis of the leading and lagging
strands.
Accessibility: Keyboard Navigation
20
Copyright © 2018 McGraw-Hill
16) How many DNA polymerases are found in prokaryotes?
A) 5
B) 7
C) 9
D) 12
Answer: A
Explanation: There are five DNA polymerases in prokaryotes but note not all DNA
polymerases are involved in DNA replication. DNA polymerases I and III are involved in
replication whereas DNA polymerases II, IV, and V play roles in DNA repair and replication of
damaged DNA.
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
17) DNA polymerases add new nucleotides in what direction?
A) 5' to 3'
B) 3 ' to 5'
C) Both directions
Answer: A
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
18) DNA polymerase III has the ability to begin synthesis of the new daughter strands
immediately following the formation of the replication fork.
Answer: FALSE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
21
Copyright © 2018 McGraw-Hill
19) You have discovered a strain of E. coli that grows very slowly—the generation time is nearly
12 hours compared to the normal 20-30 minutes. Upon further investigation, you find a mutation
in the DNA polymerase III gene. What subunit of the holoenzyme does this mutation affect the
most?
A) α
B) β
C) ε
D) δ
Answer: B
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 5. Evaluate
Learning Outcome: 11.04.02 Define processivity.
Accessibility: Keyboard Navigation
20) Okazaki fragments do which of the following?
A) Assist in forming the replication fork
B) Bind to the oriC region
C) Assist in the synthesis of DNA from the lagging strand
D) Reform the double-helix following replication
E) None of the answers are correct
Answer: C
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.03 Compare and contrast the synthesis of the leading and lagging
strands.
Accessibility: Keyboard Navigation
21) Which of the following is an example of a processive enzyme?
A) DNA polymerase I
B) DNA polymerase III
C) DNA ligase
D) Okazaki fragments
Answer: B
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 2. Understand
Learning Outcome: 11.04.02 Define processivity.
Accessibility: Keyboard Navigation
22
Copyright © 2018 McGraw-Hill
22) Which of the following stops the replication of DNA in prokaryotes?
A) Tus proteins
B) DNA ligase
C) Okazaki fragments
D) The end of the chromosome
Answer: A
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.05 Describe how DNA replication is terminated.
Accessibility: Keyboard Navigation
23) What functions are accomplished by the primosome?
A) Tracking along DNA
B) Tracking along DNA, separating double stranded DNA
C) Tracking along DNA, separating double stranded DNA, synthesizing RNA primers
D) Tracking along DNA, separating double stranded DNA, synthesizing RNA primers, adding
nucleotides
Answer: C
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
24) The proofreading of newly synthesized DNA by DNA Pol III occurs in the ________.
A) 5' to 3' direction
B) 3' to 5' direction
C) Both directions
Answer: B
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 1. Remember
Learning Outcome: 11.04.03 Explain the proofreading function of DNA polymerase.
Accessibility: Keyboard Navigation
23
Copyright © 2018 McGraw-Hill
25) You extract DNA from an E. coli cell and observe it is hemimethylated (only methylated on
one strand). Which strand of DNA is older?
A) The methylated strand
B) The strand that is not methylated
C) Neither—they are the same "age."
Answer: A
Section: 11.02
Topic: Bacterial DNA Replication: The Formation of Two Replication Forks at the Origin of
Replication
Bloom's: 4. Analyze
Learning Outcome: 11.02.01 Describe the key features of a bacterial origin of replication.
Accessibility: Keyboard Navigation
26) What types of mutants were essential to the discovery of new replication enzymes?
A) Gain-of-function mutations
B) Lethal mutations
C) Temperature-sensitive mutations
D) None of the answers are correct
Answer: C
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.06 Explain how the isolation of mutants was instrumental in our
understanding of DNA replication.
Accessibility: Keyboard Navigation
27) In eukaryotes, which of the following is similar to the oriC region of prokaryotes?
A) Dam
B) ARS elements
C) Promoters
D) Telomeres
Answer: B
Section: 11.05
Topic: Eukaryotic DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.05.01 Compare and contrast the origins of replication in bacteria and
eukaryotes.
Accessibility: Keyboard Navigation
24
Copyright © 2018 McGraw-Hill
28) DNA polymerase is a primer-dependent enzyme that functions only in the 5'-3' direction.
These are the two most fundamental concepts to understanding this enzyme. Based on this,
which of the following enzyme pairs are analogous in prokaryotes and eukaryotes?
A) DNA pol I : DNA pol α
B) DNA pol II : DNA pol β
C) DNA pol III : DNA pol δ
D) All of the answers are correct
Answer: B
Section: 11.05
Topic: Eukaryotic DNA Replication
Bloom's: 4. Analyze
Learning Outcome: 11.05.02 Outline the functions of different DNA polymerases in
eukaryotes.
Accessibility: Keyboard Navigation
29) Translesion-replicating polymerases are ________.
A) only active in skin cells
B) used to replicate damaged DNA
C) used to induce genetic diversity
D) None of the answers are correct
Answer: B
Section: 11.05
Topic: Eukaryotic DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.05.02 Outline the functions of different DNA polymerases in
eukaryotes.
Accessibility: Keyboard Navigation
30) Which of the following is NOT a reason for the high fidelity of DNA synthesis of DNA Pol
III?
A) The hydrogen bonding between purines and pyrimidines is stable.
B) The DNA polymerase is unlikely to form bonds between nucleotides if they are mismatched.
C) The DNA polymerase has exonuclease functions.
D) The DNA polymerase has the ability to change the structure of the base in order to form the
correct bond.
Answer: D
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 2. Understand
Learning Outcome: 11.04.03 Explain the proofreading function of DNA polymerase.
Accessibility: Keyboard Navigation
25
Copyright © 2018 McGraw-Hill
31) Which of the following is a restriction placed on DNA polymerase?
A) DNA polymerase can attach new nucleotides only in the 5' to 3' direction.
B) DNA polymerases must begin synthesis using an RNA primer.
C) DNA polymerases must have a template strand to copy from.
D) All of the above are restrictions of DNA polymerase.
Answer: D
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
32) DNA polymerases are unable to replicate what areas of the chromosome?
A) Centromeres
B) 3' end of telomeres
C) Origins of replication
Answer: B
Section: 11.05
Topic: Eukaryotic DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.05.04 Explain how DNA replication occurs at the ends of eukaryotic
chromosomes.
Accessibility: Keyboard Navigation
33) The Meselson-Stahl experiments used 35S radioisotopes to determine the mechanism of
DNA replication.
Answer: FALSE
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 2. Understand
Learning Outcome: 11.01.02 Analyze the experiment of Meselson and Stahl and explain how
the results were consistent with the semiconservative model of DNA replication.
Accessibility: Keyboard Navigation
34) The Meselson-Stahl experiments supported the model of dispersive DNA replication.
Answer: FALSE
Section: 11.01
Topic: Structural Overview of DNA Replication
Bloom's: 1. Remember
Learning Outcome: 11.01.02 Analyze the experiment of Meselson and Stahl and explain how
the results were consistent with the semiconservative model of DNA replication.
Accessibility: Keyboard Navigation
26
Copyright © 2018 McGraw-Hill
35) The origin of replication in bacteria is called OriC.
Answer: TRUE
Section: 11.02
Topic: Bacterial DNA Replication: The Formation of Two Replication Forks at the Origin of
Replication
Bloom's: 1. Remember
Learning Outcome: 11.02.01 Describe the key features of a bacterial origin of replication.
Accessibility: Keyboard Navigation
36) Replication usually begins in GC rich regions due to the presence of only 2 hydrogen bonds
between the bases.
Answer: FALSE
Section: 11.02
Topic: Bacterial DNA Replication: The Formation of Two Replication Forks at the Origin of
Replication
Bloom's: 2. Understand
Learning Outcome: 11.02.01 Describe the key features of a bacterial origin of replication.
Accessibility: Keyboard Navigation
37) The movement of the replication fork in bacterial replication is unidirectional.
Answer: FALSE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.03 Compare and contrast the synthesis of the leading and lagging
strands.
Accessibility: Keyboard Navigation
38) After the action of the helicase, single-stranded binding proteins keep the parental DNA
strands from reforming a double-helix.
Answer: TRUE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.01 Describe how helicase, topoisomerase, and single-strand binding
protein are important for the unwinding of the DNA double helix.
Accessibility: Keyboard Navigation
27
Copyright © 2018 McGraw-Hill
39) The synthesis of the daughter strand of DNA occurs away from the replication fork in the
leading strand.
Answer: FALSE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.03 Compare and contrast the synthesis of the leading and lagging
strands.
Accessibility: Keyboard Navigation
40) DNA polymerase III has an error in replication once every 100 million nucleotides.
Answer: TRUE
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 1. Remember
Learning Outcome: 11.04.03 Explain the proofreading function of DNA polymerase.
Accessibility: Keyboard Navigation
41) DNA polymerase III synthesizes DNA at the rate of 300 nucleotides per minute.
Answer: FALSE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 1. Remember
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
42) Catenanes can only form in cells with circular chromosomes, such as bacteria.
Answer: TRUE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.01 Describe how helicase, topoisomerase, and single-strand binding
protein are important for the unwinding of the DNA double helix.
Accessibility: Keyboard Navigation
28
Copyright © 2018 McGraw-Hill
43) A primosome consists of a polymerase and a single-stranded binding protein.
Answer: FALSE
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 2. Understand
Learning Outcome: 11.03.02 Outline how primase, DNA polymerase, and DNA ligase are
needed to make strands of DNA at the replication fork.
Accessibility: Keyboard Navigation
44) The ability of the DNA polymerase to remove mismatched bases is called exonuclease
cleavage (proofreading).
Answer: TRUE
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 1. Remember
Learning Outcome: 11.04.03 Explain the proofreading function of DNA polymerase.
Accessibility: Keyboard Navigation
45) The problem in synthesizing the 3' end of chromosomes is solved by the use of the
telomerase enzyme.
Answer: TRUE
Section: 11.05
Topic: Eukaryotic DNA Replication
Bloom's: 1. Remember
Learning Outcome: 11.05.04 Explain how DNA replication occurs at the ends of eukaryotic
chromosomes.
Accessibility: Keyboard Navigation
46) If eukaryotic cells evolved such that lagging strand DNA synthesis could occur continuously
(without the use of Okazaki fragments), what enzyme would likely no longer be needed for DNA
replication?
A) Flap endonuclease
B) Helicase
C) Primase
D) Topoisomerase
Answer: A
Section: 11.05
Topic: Eukaryotic DNA Replication
Bloom's: 3. Apply
Learning Outcome: 11.05.03 Describe how RNA primers are removed in eukaryotes.
Accessibility: Keyboard Navigation
29
Copyright © 2018 McGraw-Hill
47) You are performing a biochemical purification of enzymes involved in DNA replication.
You have purified the replisome. You wish to purify the primosome. You perform further
separation techniques on your purified replisome. How will you test to determine that you have
purified the primosome?
A) You should confirm that your sample has helicase and primase activity, but not the ability to
synthesize DNA.
B) You should confirm that your sample has the ability to synthesize DNA and has primase
activity, but no helicase activity.
C) You should confirm that your sample has helicase and primase activity. This is the only test
that is needed.
D) You should confirm that your sample has primase activity and can synthesize DNA. This is
the only test that is needed.
Answer: A
Section: 11.03
Topic: Bacterial DNA Replication: Synthesis of New DNA Strands
Bloom's: 3. Apply
Learning Outcome: 11.03.04 List the components of the replisome.
Accessibility: Keyboard Navigation
48) You are in the lab trying to synthesize DNA in vitro. You are upset because the lab seems to
be out of dNTPs (deoxynucleoside triphosphates) but you find a tube of
dNMPs (deoxynucleoside monophosphates) in the freezer. You add this to your replication
reaction instead of dNTPs. Will your reaction work? Why or why not?
A) No, cleavage of dNTP drives the formation of the covalent bond between the nucleoside
monophosphate and the growing DNA strand.
B) Yes, only the nucleoside monophosphate ultimately is incorporated into the growing DNA
strand.
C) No, all three phosphates on the nucleoside triphosphate are incorporated into the growing
DNA strand.
D) Yes, the formation of the covalent bond between the nucleoside monophosphate and the
growing DNA strand is energetically favorable.
Answer: A
Section: 11.04
Topic: Bacterial DNA Replication: Chemistry and Accuracy
Bloom's: 4. Analyze
Learning Outcome: 11.04.01 Describe how nucleotides are connected to a growing DNA
strand.
Accessibility: Keyboard Navigation
Genetics, 6e (Brooker)
Chapter 12 Gene Transcription and RNA Modification
1) Where does the process of transcription initiate?
A) Promoter
B) Terminator
C) Regulation sequences
30
Copyright © 2018 McGraw-Hill
D) Transcription factors
Answer: A
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 1. Remember
Learning Outcome: 12.02.01 Describe the characteristics of a bacterial promoter.
Accessibility: Keyboard Navigation
2) The RNA transcript is complimentary to
A) Regulatory sequences
B) Termination sequences
C) The coding strand of DNA
D) The template strand of DNA
Answer: D
Section: 12.01
Topic: Overview of Transcription
Bloom's: 1. Remember
Learning Outcome: 12.01.01 Describe the organization of a protein-encoding gene and its
mRNA transcript.
Accessibility: Keyboard Navigation
3) Which molecules are not part of the closed promoter complex?
A) RNA polymerase
B) Transcription factors
C) Double helix DNA
D) Single-stranded DNA
Answer: D
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 2. Understand
Learning Outcome: 12.02.02 Explain how RNA polymerase transcribes a bacterial gene.
Accessibility: Keyboard Navigation
31
Copyright © 2018 McGraw-Hill
4) Which RNA encodes the sequence of amino acids for a functional protein?
A) tRNA
B) snRNA
C) mRNA
D) rRNA
E) scRNA
Answer: C
Section: 12.01
Topic: Overview of Transcription
Bloom's: 2. Understand
Learning Outcome: 12.01.01 Describe the organization of a protein-encoding gene and its
mRNA transcript.
Accessibility: Keyboard Navigation
5) The holozyme is formed when the core enzyme associates with
A) Start codons
B) b
C) b'
D) σ
E) a
Answer: D
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 2. Understand
Learning Outcome: 12.02.02 Explain how RNA polymerase transcribes a bacterial gene.
Accessibility: Keyboard Navigation
6) What sequences are not considered to be regulatory elements?
A) Enhancers
B) Silencers
C) Core promoters
D) Cis-acting elements
E) General transcription factors
Answer: E
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 12.03.03 Explain how general transcription factors and RNA polymerase
assemble at the promoter and form an open complex.
Accessibility: Keyboard Navigation
32
Copyright © 2018 McGraw-Hill
7) What RNAs do each eukaryotic RNA polymerase produce?
A) RNA pol I - mRNA
RNA pol II - tRNA and 5s rRNA
RNA pol III - rRNA
B) RNA pol I - rRNA
RNA pol II - tRNA and 5s rRNA
RNA pol III - mRNA
C) RNA pol I - mRNA
RNA pol II - rRNA
RNA pol III - tRNA and 5s rRNA
D) RNA pol I - rRNA
RNA pol II - mRNA
RNA pol III - tRNA and 5s rRNA
Answer: D
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.03.01 List the functions of the three types of RNA polymerases in
eukaryotes.
Accessibility: Keyboard Navigation
8) A mutation in TFIIIE could result in
A) a failure of the RNA polymerase to bind to TFIIB
B) a failure of the RNA polymerase to maintain an closed complex
C) a failure of the RNA polymerase to maintain an open complex
D) no effect on transcription
Answer: C
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 12.03.03 Explain how general transcription factors and RNA polymerase
assemble at the promoter and form an open complex.
Accessibility: Keyboard Navigation
33
Copyright © 2018 McGraw-Hill
9) What is the difference between the allosteric and torpedo models of eukaryotic transcriptional
termination?
A) The allosteric model is that RNA pol II becomes destabilized after transcription of the poly A
signal sequence while the torpedo model is that the polymerase is physically removed from the
DNA
B) The torpedo model is that RNA pol II becomes destabilized after transcription of the poly A
signal sequence while the allosteric model is that the polymerase is physically removed from the
DNA
C) The allosteric model is that RNA pol II becomes destabilized after transcription of the stop
codon sequence while the torpedo model is that the polymerase is physically removed from the
DNA
D) The torpedo model is that RNA pol II becomes destabilized after transcription of the stop
codon while the allosteric model is that the polymerase is physically removed from the DNA
E) The only difference between the two models is the proteins that are involved in removing the
RNA pol II from the DNA
Answer: A
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 3. Apply
Learning Outcome: 12.03.04 Compare and contrast two possible mechanisms for
transcriptional termination in eukaryotes.
Accessibility: Keyboard Navigation
10) Which region of DNA contains the coding information for a protein in a eukaryote?
A) Exons
B) Introns
C) Enhancers
D) Promoters
Answer: A
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.06 Describe the process of RNA editing.
Accessibility: Keyboard Navigation
34
Copyright © 2018 McGraw-Hill
11) What modification acts to stabilize eukaryotic mRNA?
A) Alternative splicing
B) RNA editing
C) RNA interference
D) Polyadenylation
E) Trimming
Answer: D
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.05 Explain how eukaryotic mRNAs are modified to have a cap and a
tail.
Accessibility: Keyboard Navigation
12) If a nucleotide in a eukaryotic mRNA coding sequence does not appear in the genomic DNA
sequence the most likely modification to have occurred is
A) Alternative splicing
B) RNA editing
C) 5' capping
D) Polyadenylation
E) Trimming
Answer: B
Section: 12.04
Topic: RNA Modification
Bloom's: 2. Understand
Learning Outcome: 12.04.06 Describe the process of RNA editing.
Accessibility: Keyboard Navigation
13) In eukaryotic organisms, the processing of the 45S rRNA into 5.8S, 18S, and 28S rRNA
occurs where?
A) In the cytoplasm
B) In the nucleolus
C) In the endoplasmic reticulum
D) In the Golgi body
E) Throughout the cell
Answer: B
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.02 Describe the processing of ribosomal RNAs and tRNAs.
Accessibility: Keyboard Navigation
35
Copyright © 2018 McGraw-Hill
14) RNaseP is not a protein but a ribozyme
Answer: TRUE
Explanation: See Figure 12.17
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember; 2. Understand
Learning Outcome: 12.04.06 Describe the process of RNA editing.
Accessibility: Keyboard Navigation
15) The consensus sequences are 5'TTGACA3' and 5'TATAAT3' at -35 and -10 respectively.
Which of the following would be most easily recognized by σ factor?
A) 5'TTGAAA3'
B) 5'TAAATT3'
C) 5'TATATA3'
D) 5'TTCAGA3'
Answer: A
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 3. Apply
Learning Outcome: 12.02.01 Describe the characteristics of a bacterial promoter.
Accessibility: Keyboard Navigation
16) A gene that undergoes rho-dependent termination has a mutation in the rut site. How will this
influence transcriptional activity?
A) Transcription will terminate normally as Rho termination relies on the rut site to enhance
termination; it is not essential for termination
B) Transcription will stop immediately because RNA polymerase will sense there is a mutation
C) Transcription will continue until another termination sequence, either Rho dependent or
independent is reached
D) There will be no transcription initiation
Answer: C
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 4. Analyze
Learning Outcome: 12.02.03 Compare and contrast two mechanisms for transcriptional
termination in bacteria.
Accessibility: Keyboard Navigation
36
Copyright © 2018 McGraw-Hill
17) What region in eukaryotic genes usually contains the majority of regulatory elements such as
GC and CAAT boxes?
A) 0 to 50
B) -50 to 0
C) -50 to -100
D) -100 to -150
Answer: C
Explanation: See Figure 12.13
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.03.02 Describe the characteristics of a eukaryotic promoter for a
protein-encoding gene.
Accessibility: Keyboard Navigation
18) What basal transcription factor is a helicase?
A) TFIID
B) TFIIH
C) TFIIF
D) TFIIB
Answer: B
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.03.03 Explain how general transcription factors and RNA polymerase
assemble at the promoter and form an open complex.
Accessibility: Keyboard Navigation
19) Prokaryotic genes are colinear with their proteins, but this is not true for most eukaryotic
genes
A) True
B) False
C) It is unknown at this time
Answer: B
Explanation: See Section 12.5
Section: 12.05
Topic: A Comparison of Transcription and RNA Modification in Bacteria and Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.05.01 Compare and contrast the processes of transcription and RNA
modification in bacteria and eukaryotes.
Accessibility: Keyboard Navigation
37
Copyright © 2018 McGraw-Hill
20) What enables the splicing of group I and II introns?
A) Spliceosomes
B) Ribozymes
C) snRNA
D) Poly-A tail
Answer: B
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.03 Compare and contrast different mechanisms of RNA splicing.
Accessibility: Keyboard Navigation
21) What do both the rho-dependent and rho-independent mechanisms of termination have in
common?
A) Terminate transcription immediately after the stop codon
B) A sequence rich with A-U base pairs
C) Both require a helicase to separate the DNA-RNA complex
D) Formation of a stem-loop structure
Answer: D
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 1. Remember
Learning Outcome: 12.02.03 Compare and contrast two mechanisms for transcriptional
termination in bacteria.
Accessibility: Keyboard Navigation
22) What is the purpose of phosphorylating the carboxy terminal domain (CTD)?
A) Convert from initiation to the elongation stage
B) To aid in transcriptional initiation
C) Phosphorylate transcription factors
D) To aid in promoter recognition
Answer: A
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.03.03 Explain how general transcription factors and RNA polymerase
assemble at the promoter and form an open complex.
Accessibility: Keyboard Navigation
38
Copyright © 2018 McGraw-Hill
23) A main function of TFIID is
A) to recognize the TATA box
B) to act as a helicase
C) to terminate RNA polymerase II binding
D) to phosphorylate the CTD of RNA polymerase II
Answer: A
Explanation: See Table 12.1
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 2. Understand
Learning Outcome: 12.03.03 Explain how general transcription factors and RNA polymerase
assemble at the promoter and form an open complex.
Accessibility: Keyboard Navigation
24) What structural motif is most commonly used by transcription factors in binding to DNA?
A) Zinc-finger
B) Helix-turn-helix
C) Leucine zipper
D) Homeodomain
Answer: B
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 2. Understand
Learning Outcome: 12.02.02 Explain how RNA polymerase transcribes a bacterial gene.
Accessibility: Keyboard Navigation
25) What snRNP holds the exons in place so that they can be connected after the intron is
removed?
A) U1
B) U2
C) U5
D) U6
Answer: C
Section: 12.04
Topic: RNA Modification
Bloom's: 2. Understand
Learning Outcome: 12.04.03 Compare and contrast different mechanisms of RNA splicing.
Accessibility: Keyboard Navigation
39
Copyright © 2018 McGraw-Hill
26) What is a mechanism by which tRNA is processed in E. coli?
A) RNaseP acts as an endonuclease
B) The recognition sequence of RNaseD is 3'CCA5'
C) RNAseD acts as an endonuclease
D) tRNA is not processed in E. coli
Answer: A
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.02 Describe the processing of ribosomal RNAs and tRNAs.
Accessibility: Keyboard Navigation
27) In prokaryotes elongation requires the release of the sigma factor, while in eukaryotes the
Mediator is involved.
Answer: TRUE
Explanation: See Table 12.5
Section: 12.05
Topic: A Comparison of Transcription and RNA Modification in Bacteria and Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.05.01 Compare and contrast the processes of transcription and RNA
modification in bacteria and eukaryotes.
Accessibility: Keyboard Navigation
28) The RNA polymerase forms a closed complex during the process of elongation during
transcription.
Answer: FALSE
Section: 12.01
Topic: Overview of Transcription
Bloom's: 1. Remember
Learning Outcome: 12.01.02 Outline the three stages of transcription.
Accessibility: Keyboard Navigation
29) The Prinbow box contains a CACAAC consensus sequence located in the -100 region of the
promoter.
Answer: FALSE
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 1. Remember
Learning Outcome: 12.02.01 Describe the characteristics of a bacterial promoter.
Accessibility: Keyboard Navigation
40
Copyright © 2018 McGraw-Hill
30) During the initiation phase of transcription the sigma (σ) factor, which is bound to RNA
polymerase, binds into the major groove of DNA and recognizes sequence elements at the
promoter. This process forms a closed complex
Answer: TRUE
Explanation: See Figures 12.6 and 12.7
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 2. Understand
Learning Outcome: 12.02.02 Explain how RNA polymerase transcribes a bacterial gene.
Accessibility: Keyboard Navigation
31) The formation of open complex usually forms in GC rich regions of DNA due to the
decreased number of hydrogen bonds.
Answer: FALSE
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 3. Apply
Learning Outcome: 12.02.01 Describe the characteristics of a bacterial promoter.
Accessibility: Keyboard Navigation
32) In eukaryotes, enhancers must be close to the promoter to have an effect
Answer: FALSE
Explanation: See Section 12.3
Section: 12.03
Topic: Transcription in Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.03.02 Describe the characteristics of a eukaryotic promoter for a
protein-encoding gene.
Accessibility: Keyboard Navigation
33) The process of RNA editing can alter the base sequence of the mRNA following
transcription.
Answer: TRUE
Section: 12.04
Topic: RNA Modification
Bloom's: 2. Understand
Learning Outcome: 12.04.01 List the different types of RNA modifications.
Accessibility: Keyboard Navigation
41
Copyright © 2018 McGraw-Hill
34) The term ribozyme is given to catalytic RNA molecules.
Answer: TRUE
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.03 Compare and contrast different mechanisms of RNA splicing.
Accessibility: Keyboard Navigation
35) What is the correct order of elements that comprise a functional protein encoding gene in a
prokaryote?
A) Promoter, regulatory region, transcribed region, terminator
B) Regulatory region, promoter, transcribed region, terminator
C) Regulatory region, promoter, terminator, transcribed region
D) Promoter, transcribed region, regulatory region, terminator
Answer: B
Section: 12.01
Topic: Overview of Transcription
Bloom's: 1. Remember
Learning Outcome: 12.01.01 Describe the organization of a protein-encoding gene and its
mRNA transcript.
Accessibility: Keyboard Navigation
36) What is unusual about the 5' cap found on almost all eukaryotic mRNAs?
A) The nucleotide added is a guanine methylated at N7 and the bond is created between the
phosphate group on the guanine and the phosphate on the terminal nucleotide
B) The nucleotide added is a guanine methylated at N7 and the bond is a typical phosphodiester
bond with the terminal nucleotide
C) The nucleotide added is an adenine methylated at N7 and the bond is created between the
phosphate group on the guanine and the phosphate on the terminal nucleotide
D) The nucleotide added is an adenine methylated at N7 and the bond is typical phosphodiester
bond with the terminal nucleotide
Answer: A
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.05 Explain how eukaryotic mRNAs are modified to have a cap and a
tail.
Accessibility: Keyboard Navigation
42
Copyright © 2018 McGraw-Hill
37) In the process of RNA editing adenine or cytosine may be deaminated and the result is
A) Adenine is changed to inosine and cytosine is changed to thymidine
B) Although both bases are covalently changed there is no alteration in the tRNAs the modified
bases may engage
C) The new bases effectively result in new codons
D) Answers A and C are correct (B is incorrect)
E) Answers A and B are correct (C is incorrect)
Answer: D
Section: 12.04
Topic: RNA Modification
Bloom's: 1. Remember
Learning Outcome: 12.04.01 List the different types of RNA modifications.
Accessibility: Keyboard Navigation
38) What occurs In both prokaryotic and eukaryotic tRNA maturation?
A) The pre tRNA molecule is trimmed by exo and endonucleases
B) The pre tRNA is spliced
C) The mature tRNA is capped at the 5' end
D) There is extensive RNA editing
Answer: A
Section: 12.05
Topic: A Comparison of Transcription and RNA Modification in Bacteria and Eukaryotes
Bloom's: 1. Remember
Learning Outcome: 12.05.01 Compare and contrast the processes of transcription and RNA
modification in bacteria and eukaryotes.
Accessibility: Keyboard Navigation
39) In bacterial RNA polymerase, the catalytic subunits are Beta and Beta'
Answer: TRUE
Explanation: See section 12.2
Section: 12.02
Topic: Transcription in Bacteria
Bloom's: 2. Understand
Learning Outcome: 12.02.02 Explain how RNA polymerase transcribes a bacterial gene.
Accessibility: Keyboard Navigation
43
Copyright © 2018 McGraw-Hill
40) What percentage of human pre-mRNA is alternatively spliced
A) 70 %
B) 23%
C) 5%
D) 2%
Answer: A
Explanation: See Section 12.4
Section: 12.04
Topic: RNA Modification
Bloom's: 2. Understand
Learning Outcome: 12.04.04 Outline how alternative splicing occurs, and describe its benefits.
Accessibility: Keyboard Navigation
41) Because of alternative splicing, a pre-mRNA could generate a dozen different mRNAs
Answer: TRUE
Explanation: See Section 12.4 and Figure 12.21
Section: 12.04
Topic: RNA Modification
Bloom's: 2. Understand
Learning Outcome: 12.04.04 Outline how alternative splicing occurs, and describe its benefits.
Accessibility: Keyboard Navigation
Genetics, 6e (Brooker)
Chapter 13 Translation of mRNA
1) Select the statements that are true regarding the experiments by Beadle and Tatum (check all
that apply).
A) They used the mold Neurospora as a model organism.
B) They isolated strains that could not grow on minimal media.
C) They established the link between a gene and an enzyme or protein.
D) They were able to create loss-of-function mutations in any enzyme they chose.
Answer: A, B, C
Section: 13.01
Topic: The Genetic Basis for Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.01.02 Analyze the experiments of Beadle and Tatum, and explain how
their results were consistent with the idea that certain genes encode a single enzyme.
Accessibility: Keyboard Navigation
2) Select all stop codons.
A) UGA
B) UAA
C) UAG
D) AUG
E) UUA
44
Copyright © 2018 McGraw-Hill
Answer: A, B, C
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 1. Remember
Learning Outcome: 13.02.02 Explain the function of the genetic code.
Accessibility: Keyboard Navigation
3) What is true according to the adaptor hypothesis?
A) The anticodon and amino acid have no relationship.
B) A given tRNA can carry any of the twenty amino acids.
C) The position of an amino acid within a polypeptide is determined by the binding of mRNA
with a tRNA carrying a specific amino acid.
D) An amino acid recognizes the codon in mRNA.
Answer: C
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 2. Understand
Learning Outcome: 13.04.01 Describe the specificity between the amino acid carried by a
tRNA and a codon in mRNA.
Accessibility: Keyboard Navigation
45
Copyright © 2018 McGraw-Hill
4) Select the codon that is not synonymous with CUU.
A) CUC
B) UUG
C) CUA
D) AUU
E) UUA
Answer: D
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 3. Apply
Learning Outcome: 13.02.02 Explain the function of the genetic code.
Accessibility: Keyboard Navigation
5) The genetic code is nearly universal in nuclear DNA from bacteria to mammals.
Answer: TRUE
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.02.03 List a few exceptions to the genetic code.
Accessibility: Keyboard Navigation
6) The primary structure of a protein is directly associated with ________.
A) regular repeating shapes, such as beta-sheets
B) the three-dimensional shape of the protein
C) the linear sequence of the amino acids
D) the interaction of two or more peptide chains
Answer: C
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.02.04 Describe the four levels of protein structure.
Accessibility: Keyboard Navigation
46
Copyright © 2018 McGraw-Hill
7) α-helices and β-sheets are examples of what level of protein structure?
A) Primary structure
B) Secondary structure
C) Tertiary structure
D) Quaternary structure
Answer: B
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.02.04 Describe the four levels of protein structure.
Accessibility: Keyboard Navigation
8) An anticodon is located on ________.
A) DNA
B) mRNA
C) rRNA
D) tRNA
E) snRNA
Answer: D
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.02.01 Outline how the information within DNA is used to make mRNA
and a polypeptide.
Accessibility: Keyboard Navigation
9) Taking into account your knowledge of wobble rules, select all anticodons that can pair with
the codon 5'-UAC-3' (Check all that apply).
A) 5'-AUG-3'
B) 5'-IUA-3'
C) 5'-AUA-3'
D) 5'-GUA-3'
E) 5'-GUI-3'
Answer: B, C, D
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 3. Apply
Learning Outcome: 13.04.04 Outline the wobble rules.
Accessibility: Keyboard Navigation
47
Copyright © 2018 McGraw-Hill
10) A tRNA that has an amino acid attached is called ________.
A) an rRNA
B) a degenerate tRNA
C) a coding tRNA
D) a charged tRNA
E) None of the answers are correct
Answer: D
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 1. Remember
Learning Outcome: 13.04.03 Explain how an amino acid is attached to a tRNA via aminoacyltRNA synthetase.
Accessibility: Keyboard Navigation
11) Kozak's rules for translation are similar to those for transcription in prokaryotes in that they
both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at -35
and -10. Where is the consensus sequence for translational initiation according to Kozak's rules?
A) -6 to +4
B) -12 to -2
C) +1 to +10
D) -9 to +1
Answer: A
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
12) Select the amino acid that has been activated by aminoacyl-tRNA synthetase.
A) Amino acid · ATP · aminoacyl-tRNA synthetase
B) Amino acid · aminoacyl-tRNA synthetase
C) Amino acid + AMP + PPi
D) Amino acid · AMP
Answer: D
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 2. Understand
Learning Outcome: 13.04.03 Explain how an amino acid is attached to a tRNA via aminoacyltRNA synthetase.
Accessibility: Keyboard Navigation
48
Copyright © 2018 McGraw-Hill
13) All mature polypeptides contain a methionine at the N-terminus.
Answer: FALSE
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
14) What site on the ribosome is primarily responsible for holding the growing polypeptide?
A) A
B) E
C) P
Answer: C
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
15) What site does the initiator tRNA bind to on the ribosome?
A) A
B) E
C) P
Answer: C
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
16) 61 different tRNAs are required for translation both in vivo and in vitro.
Answer: FALSE
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 2. Understand
Learning Outcome: 13.04.04 Outline the wobble rules.
Accessibility: Keyboard Navigation
49
Copyright © 2018 McGraw-Hill
17) What is responsible for binding the initiator tRNA in eukaryotes?
A) eIF2
B) EF-Tu
C) eIF3
D) EF-G
Answer: A
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.03 Compare and contrast bacterial and eukaryotic translation.
Accessibility: Keyboard Navigation
18) How many amino acids would be included in the polypeptide encoded by the following
mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'
A) 7
B) 8
C) 10
D) 13
Answer: B
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 3. Apply
Learning Outcome: 13.02.01 Outline how the information within DNA is used to make mRNA
and a polypeptide.
Accessibility: Keyboard Navigation
19) Where are the ribosomal subunits assembled in eukaryotes?
A) Nucleus
B) Nucleoid
C) Nucleolus
D) Nuclear envelope
Answer: C
Section: 13.05
Topic: Ribosome Structure and Assembly
Bloom's: 2. Understand
Learning Outcome: 13.05.01 Outline the structural features of ribosomes.
Accessibility: Keyboard Navigation
50
Copyright © 2018 McGraw-Hill
20) A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?
A) Glycine
B) Proline
C) Alanine
D) Arginine
Answer: C
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 4. Analyze
Learning Outcome: 13.04.01 Describe the specificity between the amino acid carried by a
tRNA and a codon in mRNA.
Accessibility: Keyboard Navigation
21) Where does mRNA/tRNA codon-anticodon recognition take place?
A) 30S
B) 40S
C) 50S
D) The surface between the two ribosomal subunits
Answer: D
Section: 13.05
Topic: Ribosome Structure and Assembly
Bloom's: 2. Understand
Learning Outcome: 13.05.01 Outline the structural features of ribosomes.
Accessibility: Keyboard Navigation
22) The structure of the ribosome is uniform throughout a eukaryotic cell.
Answer: FALSE
Section: 13.05
Topic: Ribosome Structure and Assembly
Bloom's: 2. Understand
Learning Outcome: 13.05.01 Outline the structural features of ribosomes.
Accessibility: Keyboard Navigation
51
Copyright © 2018 McGraw-Hill
23) What typically stops the process of translation?
A) Rho proteins
B) Aminoacyl tRNA synthase
C) rRNA
D) Stop codons
E) Introns
Answer: D
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.01 Outline the three stages of translation.
Accessibility: Keyboard Navigation
24) The decoding function is conducted by
A) the 16S rRNA.
B) tRNA.
C) mRNA.
D) snRNA.
E) aminoacyl-tRNA synthetase.
Answer: A
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
25) The peptidyl transferase is a component of
A) DNA.
B) tRNA.
C) the ribosome.
D) the protein being translated.
E) mRNA.
Answer: C
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
52
Copyright © 2018 McGraw-Hill
26) The C-terminus of a polypeptide always contains
A) a stop codon.
B) a carboxyl group.
C) an amino group.
D) carbon dioxide.
E) None of the answers are correct.
Answer: B
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.02.01 Outline how the information within DNA is used to make mRNA
and a polypeptide.
Accessibility: Keyboard Navigation
27) RF1 and RF2 are active during ________.
A) initiation
B) elongation
C) termination
D) peptidyl transfer
Answer: C
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
28) The anticodon on the mRNA recognizes the codon on the tRNA.
Answer: FALSE
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 2. Understand
Learning Outcome: 13.02.01 Outline how the information within DNA is used to make mRNA
and a polypeptide.
Accessibility: Keyboard Navigation
53
Copyright © 2018 McGraw-Hill
29) During elongation, the polypeptide is removed from the tRNA in the P site and transferred to
the amino acid in the A site.
Answer: TRUE
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
30) Transcription and translation may occur simultaneously in prokaryotic cells.
Answer: TRUE
Section: 13.06
Topic: Stages of Translation
Bloom's: 2. Understand
Learning Outcome: 13.06.03 Compare and contrast bacterial and eukaryotic translation.
Accessibility: Keyboard Navigation
31) You are studying the DNA of a person who you know has two defective copies of the gene
that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries
two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will
this person exhibit? (Assume pathway intermediates are not available from sources outside the
phenylalanine breakdown pathway.)
A) This person will exhibit symptoms of alkaptonuria.
B) This person will exhibit symptoms of tyrosinosis.
C) This person will exhibit symptoms of phenylketonuria.
D) This person will exhibit symptoms of alkaptonuria and phenylketonuria.
E) This person will be phenotypically normal.
Answer: C
Section: 13.01
Topic: The Genetic Basis for Protein Synthesis
Bloom's: 3. Apply
Learning Outcome: 13.01.01 Explain how the work of Garrod indicated that some genes
encode enzymes.
Accessibility: Keyboard Navigation
54
Copyright © 2018 McGraw-Hill
32) In the digestive system of animals, proteins called amylases and proteases break down large
molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by
the intestine. What category of protein function do these proteins fall into?
A) Cell shape or organization
B) Transport
C) Movement
D) Cell signaling
E) Cell surface recognition
F) Enzymes
Answer: F
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 3. Apply
Learning Outcome: 13.02.05 Compare and contrast the functions of several types of proteins.
Accessibility: Keyboard Navigation
33) You perform a cell free translation experiment like Nirenberg and Matthaei, but you forget to
write down what nucleotides you added to make the mRNA. You precipitate the translated
polypeptides and measure the relative amount of radiolabeled amino acids incorporated into
them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine,
and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA?
A) Equal amounts of A, C, U, and G
B) 50% C and 50% A
C) 70% C and 30% A
D) 50% C and 50% U
E) 50% A and 50% G
Answer: B
Section: 13.03
Topic: Experimental Determination of the Genetic Code
Bloom's: 4. Analyze
Learning Outcome: 13.03.01 Compare and contrast the experiments of (1) Nirenberg and
Matthaei, (2) Khorana, and (3) Nirenberg and Leder that were instrumental in deciphering the
genetic code.
Accessibility: Keyboard Navigation
55
Copyright © 2018 McGraw-Hill
34) What is the name of the enzyme that adds CCA to the 3' end of tRNAs?
A) tRNA nucleotidyltransferase
B) Aminoacyl-tRNA synthetase
C) RNA polymerase
D) Peptidyl transferase
Answer: A
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 1. Remember
Learning Outcome: 13.04.02 Describe the key structural features of a tRNA molecule.
Accessibility: Keyboard Navigation
35) Consider the following mRNA from a eukaryotic species. Which AUG codon is translation
most likely to begin from?
5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'
A) 1st
B) 2nd
C) 3rd
D) 4th
Answer: B
Section: 13.06
Topic: Stages of Translation
Bloom's: 4. Analyze
Learning Outcome: 13.06.02 Describe the steps that occur during the initiation, elongation, and
termination stages of translation.
Accessibility: Keyboard Navigation
36) What is the minimal number of tRNAs that can be used to recognize all of the codons for
threonine?
A) 1
B) 2
C) 3
D) 4
Answer: B
Section: 13.04
Topic: Structure and Function of tRNA
Bloom's: 4. Analyze
Learning Outcome: 13.04.04 Outline the wobble rules.
Accessibility: Keyboard Navigation
56
Copyright © 2018 McGraw-Hill
37) You perform a cell free translation experiment like Nirenberg and Matthaei. You start with
60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated
polypeptides?
A) 36%
B) 22%
C) 14%
D) 28%
Answer: A
Section: 13.03
Topic: Experimental Determination of the Genetic Code
Bloom's: 4. Analyze
Learning Outcome: 13.03.01 Compare and contrast the experiments of (1) Nirenberg and
Matthaei, (2) Khorana, and (3) Nirenberg and Leder that were instrumental in deciphering the
genetic code.
Accessibility: Keyboard Navigation
38) Suppose you performed a triplet binding assay with the triplet 5'-UAA-3'. What radiolabeled
amino acids do you expect to find bound to the filter?
A) Tyrosine
B) Asparagine
C) Methionine
D) None
Answer: D
Section: 13.03
Topic: Experimental Determination of the Genetic Code
Bloom's: 3. Apply
Learning Outcome: 13.03.01 Compare and contrast the experiments of (1) Nirenberg and
Matthaei, (2) Khorana, and (3) Nirenberg and Leder that were instrumental in deciphering the
genetic code.
Accessibility: Keyboard Navigation
39) A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than
A) 125 nucleotides.
B) 376 nucleotides.
C) 1128 nucleotides.
D) 3384 nucleotides.
Answer: C
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 3. Apply
Learning Outcome: 13.02.01 Outline how the information within DNA is used to make mRNA
and a polypeptide.
Accessibility: Keyboard Navigation
57
Copyright © 2018 McGraw-Hill
40) You have cloned a gene for a mammalian mitochondrial protein that is rich in tryptophan. If
you translate this protein in the cytoplasm rather than the mitochondria, what result do you
expect?
A) The protein will be shorter than its mitochondrial counterpart.
B) The protein will be longer than its mitochondrial counterpart.
C) The protein will be the same as its mitochondrial counterpart.
D) The protein will contain completely different amino acids when compared to its
mitochondrial counterpart.
Answer: A
Section: 13.02
Topic: The Relationship Between the Genetic Code and Protein Synthesis
Bloom's: 4. Analyze
Learning Outcome: 13.02.03 List a few exceptions to the genetic code.
Accessibility: Keyboard Navigation
58
Copyright © 2018 McGraw-Hill
Genetics, 6e (Brooker)
Chapter 14 Gene Regulation in Bacteria
1) A gene is inducible and under negative control. Which of the following pairs will allow
expression of this gene?
A) Activator + repressor
B) Activator + inhibitor
C) Repressor + inducer
D) Repressor + co-repressor
Answer: C
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.01 Describe the function of activators and repressors.
Accessibility: Keyboard Navigation
2) An activator is present and results in the increase in transcription of the target gene. This is
an example of ________.
A) termination
B) positive control
C) negative control
D) feedback inhibition
Answer: B
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.01 Describe the function of activators and repressors.
Accessibility: Keyboard Navigation
3) How many promoters are in an operon?
A) 1
B) 2
C) 3
D) It depends on how many genes are present in the operon
Answer: A
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 1. Remember
Learning Outcome: 14.02.01 Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
1
Copyright © 2018 McGraw-Hill
4) A deletion in an operon removes the terminator. How will that affect the transcript that is
produced from the operon?
A) The transcript will be produced and normal in length
B) The transcript will be produced, but shorter than normal
C) The transcript will be produced, but longer than normal
D) The transcript will produced, but will contain a deletion
E) The transcript will not be produced
Answer: C
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 3. Apply
Learning Outcome: 14.02.03 Analyze the results of Jacob, Monod, and Pardee, and explain
how they indicated that the lacI gene encodes a diffusible repressor protein.
Accessibility: Keyboard Navigation
5) A deletion in an operon removes the promoter. How will that affect the transcript that is
produced from the operon?
A) The transcript will be produced and normal in length
B) The transcript will be produced, but shorter than normal
C) The transcript will be produced, but longer than normal
D) The transcript will produced, but will contain a deletion
E) The transcript will not be produced
Answer: E
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 3. Apply
Learning Outcome: 14.02.01 Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
6) Allosteric regulation is accomplished by
A) a small molecule that fits into an enzyme's active site.
B) a large protein that blocks an enzyme's active site.
C) a small molecule that fits into a site on the enzyme that is not the active site.
D) a small molecule that covalently modifies a site on the enzyme that is not the active site.
Answer: C
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
2
Copyright © 2018 McGraw-Hill
7) What is the gene responsible for attenuation in the trp operon?
A) trpL
B) trpR
C) trpD
D) trpC
Answer: A
Section: 14.03
Topic: Regulation of the trp Operon
Bloom's: 1. Remember
Learning Outcome: 14.03.02 Explain how the trp operon is regulated by trp repressor and by
attenuation.
Accessibility: Keyboard Navigation
8) What stem-loop conformations favor attenuation?
A) 1-2
B) 1-2 and 2-3
C) 2-3
D) 1-2 and 3-4
Answer: D
Section: 14.03
Topic: Regulation of the trp Operon
Bloom's: 2. Understand
Learning Outcome: 14.03.02 Explain how the trp operon is regulated by trp repressor and by
attenuation.
Accessibility: Keyboard Navigation
9) If CAP could not bind to its CAP site, then what would be the result? Assume lactose is
present in each scenario.
A) Transcription would be difficult to repress in the presence of glucose
B) Transcription would be difficult to activate in the presence of glucose
C) Transcription would be difficult to activate in the absence of glucose
Answer: C
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 3. Apply
Learning Outcome: 14.02.02 Explain how the lac operon is regulated by lac repressor and by
catabolite activator protein.
Accessibility: Keyboard Navigation
3
Copyright © 2018 McGraw-Hill
10) In Jacob, Monod, and Pardee's experiment, how many functional copies of lacI were there in
the merozygote?
A) 0
B) 1
C) 2
D) 3
Answer: B
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 1. Remember
Learning Outcome: 14.02.03 Analyze the results of Jacob, Monod, and Pardee, and explain
how they indicated that the lacI gene encodes a diffusible repressor protein.
Accessibility: Keyboard Navigation
11) In Jacob, Monod, and Pardee's experiment, what would have been the conclusion if all four
tubes produced a yellow color when b-ONPG was added?
A) Expression of the lac operon is constitutive whether lacI is functional or not
B) LacI provides the binding site for the repressor
C) LacI encodes a diffusible repressor
D) The researcher added too much b-ONPG
Answer: A
Explanation: See Figure 14.7
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 4. Analyze
Learning Outcome: 14.02.03 Analyze the results of Jacob, Monod, and Pardee, and explain
how they indicated that the lacI gene encodes a diffusible repressor protein.
Accessibility: Keyboard Navigation
12) In the lac operon, the CAP site is located next to the ________. When both lactose and
glucose are present, this leads to a rate of transcription that is ________.
A) terminator, low
B) promoter, high
C) terminator, high
D) promoter, low
Answer: D
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 3. Apply
Learning Outcome: 14.02.02 Explain how the lac operon is regulated by lac repressor and by
catabolite activator protein.
Accessibility: Keyboard Navigation
4
Copyright © 2018 McGraw-Hill
13) What would be the result if the U-rich sequence after the fourth stem loop in the trp operon
was replaced by a UG-rich sequence?
A) Attenuation would occur if tryptophan was high
B) Attenuation would occur if tryptophan is low
C) Attenuation would not occur if tryptophan was high
Answer: C
Section: 14.03
Topic: Regulation of the trp Operon
Bloom's: 3. Apply
Learning Outcome: 14.03.01 Describe the organization of the trp operon.; 14.03.02 Explain
how the trp operon is regulated by trp repressor and by attenuation.
Accessibility: Keyboard Navigation
14) Which of the following is an example of post translational regulation in prokaryotes?
A) Sterically blocking the ribosome
B) Phosphorylation of an enzyme
C) Incorporation of antisense RNA
D) Altering the structure of the mRNA
Answer: B
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.04.02 Summarize how feedback inhibition and posttranslational
modifications regulate protein function.
Accessibility: Keyboard Navigation
15) Enzymes involved in metabolism are most likely regulated via ________.
A) feedback inhibition
B) acetylation
C) methylation
D) none of the answers are correct
Answer: A
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.04.02 Summarize how feedback inhibition and posttranslational
modifications regulate protein function.
Accessibility: Keyboard Navigation
5
Copyright © 2018 McGraw-Hill
For these questions, match the following to its appropriate letter. Use each letter only once.
A) lacI gene product
B) Operator
C) Allolactose
D) Lac operon
E) Trp operon
F) Tryptophan
16) Repressible
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
17) Inducer
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
18) Co-repressor
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
19) Inducible
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
20) Cis-acting element
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
6
Copyright © 2018 McGraw-Hill
21) Trans-acting element
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 3. Apply
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
Answers: 16) E 17) C 18) F 19) D 20) B 21) A
22) In the lac operon, the operator is an example of a trans-effect genetic regulation.
Answer: FALSE
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 2. Understand
Learning Outcome: 14.02.01 Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
23) If a bacteria is placed in an environment that contains both glucose and lactose, the
regulation of the lac operon will allow which nutrient to be processed first?
A) Glucose
B) Lactose
C) Both will be processed equally
D) Neither will be processed in this environment
Answer: A
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 3. Apply
Learning Outcome: 14.02.02 Explain how the lac operon is regulated by lac repressor and by
catabolite activator protein.
Accessibility: Keyboard Navigation
24) The regulation of protein function is called ________.
A) posttranslational regulation
B) transcriptional regulation
C) translational regulation
D) posttranscriptional regulation
Answer: A
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.04.02 Summarize how feedback inhibition and posttranslational
modifications regulate protein function.
Accessibility: Keyboard Navigation
7
Copyright © 2018 McGraw-Hill
25) Translational regulatory proteins recognize specific areas of what molecule?
A) tRNA
B) ribosome
C) rRNA
D) mRNA
Answer: D
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.04.01 Explain how translational regulatory proteins and antisense
RNAs regulate translation.
Accessibility: Keyboard Navigation
26) Antisense RNA does which of the following?
A) Inhibits the formation of the open complex in transcription
B) Occupies the A and P sites of the ribosome
C) Binds to the mRNA and prevents translation
D) Prevents the correct folding of a newly formed peptide
Answer: C
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.04.01 Explain how translational regulatory proteins and antisense
RNAs regulate translation.
Accessibility: Keyboard Navigation
27) Constitutive genes are those that have constant levels of expression.
Answer: TRUE
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 1. Remember
Learning Outcome: 14.01.01 Describe the function of activators and repressors.
Accessibility: Keyboard Navigation
28) Negative transcriptional regulation is conducted by activator proteins.
Answer: FALSE
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
8
Copyright © 2018 McGraw-Hill
29) Repressor proteins are responsible for negative transcriptional regulation.
Answer: TRUE
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.
Accessibility: Keyboard Navigation
30) The term enzyme adaptation is used to describe an enzyme that appears in a living cell
following exposure to a specific substrate.
Answer: TRUE
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 1. Remember
Learning Outcome: 14.01.01 Describe the function of activators and repressors.
Accessibility: Keyboard Navigation
31) DNA that contains instructions for two or more structural genes produces monocistronic
mRNA.
Answer: FALSE
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 2. Understand
Learning Outcome: 14.02.01 Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
32) In the lac operon, the operator site is recognized by an activator protein.
Answer: FALSE
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 2. Understand
Learning Outcome: 14.02.01 Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
33) The regulation of the CAP complex using cAMP is an example of inducible genetic
regulation.
Answer: TRUE
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 2. Understand
Learning Outcome: 14.02.02 Explain how the lac operon is regulated by lac repressor and by
catabolite activator protein.
9
Copyright © 2018 McGraw-Hill
Accessibility:
Keyboard Navigation
34) Operons that code for catabolic enzyme systems are typically regulated by repressors.
Answer: FALSE
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.01 Describe the function of activators and repressors.
Accessibility: Keyboard Navigation
35) Operons that code for anabolic enzyme systems are typically regulated by inducers.
Answer: FALSE
Section: 14.01
Topic: Overview of Transcriptional Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.01 Describe the function of activators and repressors.; 14.02.01
Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
36) The form of regulation that involves a physical change in the shape of an enzyme is called
allosteric regulation.
Answer: TRUE
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.04.02 Summarize how feedback inhibition and posttranslational
modifications regulate protein function.
Accessibility: Keyboard Navigation
37) Regulation of gene expression may occur at which of the following levels? Check all that
apply.
A) post translation
B) constitutive expression
C) translation
D) transcription
Answer: A, C, D
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 2. Understand
Learning Outcome: 14.01.02 Explain how small effector molecules affect the function of
activators and repressors.; 14.04.02 Summarize how feedback inhibition and posttranslational
modifications regulate protein function.
Accessibility: Keyboard Navigation
10
Copyright © 2018 McGraw-Hill
11
Copyright © 2018 McGraw-Hill
38) Which of the following encode polycistronic mRNA? Check all that apply.
A) Lac operon
B) operator site
C) Trp operon
D) CAP site
Answer: A, C
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 2. Understand
Learning Outcome: 14.02.01 Describe the organization of the lac operon.
Accessibility: Keyboard Navigation
39) A mutation in the lacI gene prevents the gene product from binding allolactose. What will
the expression level of the operon be in the absence of lactose?
A) no transcription
B) positive regulation
C) constitutively active
D) transcription will occur only in the presence of glucose
Answer: A
Section: 14.02
Topic: Regulation of the lac Operon
Bloom's: 3. Apply
Learning Outcome: 14.02.02 Explain how the lac operon is regulated by lac repressor and by
catabolite activator protein.
Accessibility: Keyboard Navigation
40) An enzyme catalyzes a substrate into a final product. When the concentration of the final
product is high enough, it binds to a regulatory site on the enzyme. This binding at the
regulatory site changes the shape of the enzyme, which prevents it from binding the substrate and
prevents formation of more final product. This is an example of a(n) ________.
A) posttranslational modification
B) allosteric enzyme
C) translational repressor
D) methylation
Answer: B
Section: 14.04
Topic: Translational and Posttranslational Regulation
Bloom's: 3. Apply
Learning Outcome: 14.04.02 Summarize how feedback inhibition and posttranslational
modifications regulate protein function.
Accessibility: Keyboard Navigation
12
Copyright © 2018 McGraw-Hill
41) In a particular E. coli strain, a mutation in the thiMD operon results in improper formation of
the stem loop secondary structure making it impossible to bind TPP. There are two enzymes
encoded by the thiMD operon. How many of the enzymes encoded in the thiMD operon are
translated?
A) two
B) zero
C) three
D) one
Answer: A
Section: 14.05
Bloom's: 3. Apply
Learning Outcome: 14.05.01 Explain how riboswitches can regulate transcription and
translation.
Accessibility: Keyboard Navigation
42) A riboswitch only affects translation of an operon.
Answer: FALSE
Section: 14.05
Topic: Riboswitches
Bloom's: 2. Understand
Learning Outcome: 14.05.01 Explain how riboswitches can regulate transcription and
translation.
Accessibility: Keyboard Navigation
13
Copyright © 2018 McGraw-Hill