A rationally designed agonist defines subfamily IIIA ABA receptors as critical targets for manipulating transpiration. Aditya S. Vaidya1, Francis C. Peterson2, Dmitry Yarmolinsky3, Ebe Merilo3, Inge Verstraeten4, 5, Sang-Youl Park1, Dezi Elzinga1, Amita Kaundal1, 6, Jonathan Helander1, Jorge Lozano-Juste7, Masato Otani1, Kevin Wu1, Davin R. Jensen2, Hannes Kollist3, Brian F. Volkman2, and Sean R. Cutler*,1. 1 Department of Botany and Plant Sciences, Institute of Integrative Genome Biology, University of California, Riverside, CA-92521, USA 2 Department of Biochemistry, Medical College of Wisconsin, Milwaukee, WI-53226, USA 3 Institute of Technology, University of Tartu, Nooruse 1, Tartu 50411, Estonia 4 Current address: Department of Plant Production, Ghent University, B-9000 Ghent, Belgium 5 Current address: Department of Plant Systems Biology, Flanders Institute of Biotechnology (VIB), B-9052 Ghent, Belgium 6 Current address: USDA Salinity Laboratory, Riverside, CA-92507, USA 7 Current address: Instituto de Biología Molecular y Celular de Plantas, Consejo Superior de Investigaciones Científicas -Universidad Politécnica de Valencia, 46022 Valencia, Spain Table S1: Receptor mediated phosphatase inhibition data for different ABA receptor agonists. Data represents IC50 ± s.d. in nM. MIC is the minimum inhibitory concentration of compound to inhibit Arabidopsis seed germination. R1 R2 PYR1 (nM) PYL1 (nM) PYL2 (nM) PYL3 (nM) MIC (µM) 4a Me H 246 ± 60 2494 ±467 >10000 >10000 10 4b Cl H 3909 ± 122 >10000 >10000 >10000 25 4c Br H 2504 ± 151 >10000 >10000 >10000 >25 4d CF3 H 258 ± 19 4796±896 9581 ± 102 >10000 10 4e OMe H 130 ± 9 1341±298 >10000 >10000 10 4f OEt H 112 ± 15 2588±141 7459±469 >10000 10 4g Et H 48 ± 0.3 810±58 2695±64 >10000 10 4h nPr H 100 ± 0.4 1344±130 2909±270 >10000 10 Δ H 87 ± 3 656±109 3266±13 6712±1761 5 4j Me Me 98 ± 7 519±48 2583±222 >10000 10 4k CF3 CF3 >10000 >10000 >10000 >10000 >25 4l Br Me 355 ± 34 2445±314 >10000 >10000 25 4m Me Et 72 ± 15 870±72 969±77 >10000 10 4n Me nPr 220 ± 18 4528±1198 1605±23 >10000 10 4o Me Δ 210 ± 36 799±26 1656±46 >10000 10 1. ABA - - 111 ± 3.8 231±13 39 ± 2.3 16 ± 0.1 1 2. pyrabactin - - 533 ± 63 1012±48 >10000 >10000 ND 3. quinabactin - - 85 ± 6.9 279±28 211±41 935±75 2.5 Ligand 4i.cyanabactin Table S2: IC50 values (nM) for agonist/receptor-mediated PP2C inhibition with representative ABA receptors. The specified recombinant receptors were tested for ligand-mediated inhibition of the PP2C HAB1 using a pNPP substrate, as described in the methods Receptor ABA 4i/cyanabactin Quinabactin PYR1 111 ± 3.8 87 ± 3 85 ± 6.9 PYL1 231 ± 13 656 ± 109 279 ± 28 PYL2 39 ± 2.3 3266 ± 13 211 ± 41 PYL3 16 ± 0.1 6712 ± 1761 935 ± 75 PYL4 29 ± 9 >10000 >10000 PYL5 18 ± 5 150 ± 31 121 ± 7.3 PYL6 11 ± 2 >10000 >10000 PYL8 101 ± 32 >10000 >10000 PYL9 168 ± 31 >10000 >10000 PYL10 116 ± 40 >10000 >10000 PYL11 201 ± 30 >10000 >10000 Table S3: Data collection and refinement statistics PYR1 (1-181):4m PYR1 (1-181):Cyanabactin F222 F222 a, b, c (Å) 82.61,88.22,112.17 83.44,88.22,112.07 α, β, γ (°) 90, 90, 90 90, 90, 90 Resolution (Å) 50-1.93(1.99-1.93) 50-1.63(1.99-1.63) Rmerge 0.054(0.135) 0.052(0.117) Rmeas 0.059(0.146) 0.057(0.127) Rpim 0.022(0.055) 0.022(0.049) I / σI 40.4(19.1) 29.2(20.2) Completeness (%) 100(99.5) 99.1(100) Redundancy 7.2(6.8) 6.7(6.6) Resolution (Å) 34.7-1.93(1.99-1.93) 34.7-1.63(1.67-1.63) No. reflections 15500 25499 Rcryst / Rfree 0.153/0.186 0.187/0.219 No. atoms 1629 1610 Protein 1405 1402 Ligand/ion 82 58 Water 142 150 Protein 22.4 27.0 Ligand 19.1 26.4 Ion 45.1 46.7 Data collection Space group Cell dimensions Refinement B-factors Water 30.5 32.8 Bond lengths (Å) 0.006 0.005 Bond angles (°) 0.762 0.813 Favored 98.8% 98.2% Allowed 1.2% 1.8% R.m.s. deviations Ramachandran Stats Table S4. Primer sequences used in qRT-PCR AGI gene code Abbreviation Forward primer Reverse primer AT1G05100 MAPKKK18 AAGCGGCGCGTGGAGAGAGA GCTGTCCATCTCTCCGTCGC AT5G66400 RAB18 GGCTTGGGAGGAATGCT TTGATCTTTTGTGTTATTCCCTTCT AT5G52300 RD29B TGATCCCACGCATAAAGGTGGAG CATTCTCTCCGGTGTAACCTAG Internal control PEX4 CAGTCCTCTTAACTGCGACTCA GGCGAGGCGTGTATACATTT Table S5. IC50 values (nM) for WT or mutant receptor-mediated PP2C inhibition with ABA and CB. ABA CB Receptor IC50 (nM) IC50 (nM) PYR1 111 ± 3.8 87 ± 3 PYR1I110V 81 ± 0.9 787 ± 36.3 PYL2 39 ± 2.3 3266 ± 13 PYL2V114I 14.4 ± 0.4 919 ± 33.9 Table S6. IC50 values (nM) for inhibition of seed germination with ABA, CB and QB in WT and different receptor mutant lines; ‘–’ indicates that no activity was detected at the highest ligand concentration tested (4.3 µM). ABA 4i/cyanabactin Quinabactin Col-0 499 ± 29 1683 ± 46 922 ± 75 Ler 443 ± 42 1900 ± 97 1033 ± 74 pyl2 627 ± 33 2024 ± 209 1055 ± 177 pyl3 614 ± 95 1910 ± 82 1007 ± 182 pyl5 621 ± 76 1825 ± 139 911 ± 148 pyl1 620 ± 97 1877 ± 76 953 ± 56 pyr1 611 ± 47 – – pyr1;pyl1 705 ± 182 – – Table S7. Normalized mRNA expression levels for Arabidopsis receptors in different tissue types. ATH1 microarray data corresponding to “Developmental maps” and “Guard Cell” data sets were downloaded from the eFP expression browser. The set of 88 microarray experiments was queried to extract expression levels from imbibed seeds, all seed samples (6 experiments), leaf samples (14 exps), all untreated guard cell samples (7 exps), and the averages across all 88 experiments in the data set. Shown are the average normalized expression values. UBQ10 expression levels from the same sources is shown for comparison. These data show hat PYR1 is, on average, the most highly expressed Arabidopsis receptor in imbibed (germinating) seeds, the 4rd most highly expressed receptor in guard cells, and the 2nd most highly expressed receptor in leaves. Gene AGI Imbibed seed All seed samples All guard cell samples All leaf samples PYR1 AT4G17870 1332 617 898 454 PYL1 AT5G46790 24 96 82 93 PYL2 AT2G26040 497 112 984 20 PYL3 AT1G73000 5 5 7 5 PYL4 AT2G38310 1022 703 2486 789 PYL5 AT5G05440 571 388 1469 321 PYL6 AT2G40330 91 58 170 40 PYL7 AT4G01026 14 132 760 155 PYL8 AT5G53160 191 400 473 243 PYL9 AT1G01360 42 102 256 129 UBQ10 AT4G05320 1646 2463 5258 2585 All samples 473 72 136 10 689 457 64 337 228 163 3401 Figure S1. Docking-predicted interactions exhibited by a representative ligand 4i docked into PYR1 (PDB: 3K3K) and PYL2 (PDB: 4LA7) using Glide. Calculated docking scores for 4i with PYR1 and PYL2 are -8.778 and -8.014 respectively. Figure S2. (A) Activity of nitrile agonists in vivo, as measured using a luciferase-based assay. Agonist activity was measured using 8 day old Arabidopsis thaliana transgenic seeds; each well contains 10 - 15 seedlings per well and was treated with 25 µM of test chemicals or a mock control. Luminescence images were captured 6-hours post-treatment. The grey scale images were converted to false color in Photoshop (left) and luminescence quantified relative to the mock treatment. Error bars represent standard deviation for duplicate treatments. (B) CB inhibits seed germination; plates contain either 5 μM ABA, 5 μM CB, or carrier solvent control. Seeds were sown on 1/2× MS agar plates containing chemicals, stratified at 4 °C for 4 d, and then transferred to a growth chamber at 22 °C under continuous illumination. Photographs were taken after a 4-d incubation under constant illumination. Figure S3. Unbiased electron density in the PYR1 binding pocket. The Fo-Fc density in PYR1’s ligand binding pocket after several rounds of refining the PYR11-181:cyanabactin (A) PYR11181 :4m (D) structural models in the absence of ligands. The envelope of the unbiased electron density allowed us to unambiguously place cyanabactin (B) and 4m (E) in their respective structural models. The correct placement of ligands in their corresponding models is supported by a real space correlation coefficients of 0.95 calculated between the unbiased density and the modeled ligand. (C, F) Electron density from anomalous sulfur scattering (magenta) confirms a single binding mode for cyanabactin and 4m. Figure S4. Cyanabactin–PYR1 interactions. (A) Ligplot of cyanabactin interactions with PYR1 in the binary complex (Protein Data Bank accession 5UR6). (B) Ligplot of ABA interactions with PYR1 in the binary complex of previously published coordinates (Protein Data Bank accession 3K3K). Ligplots were made using LigPlot+ (1). Figure S5. (A and B) Dose response curves and IC50s for receptor mediated phosphatase inhibition by PYR1, PYL2, and specified mutants by CB or ABA. The data show that differences in receptor pocket architecture due to variation in I110 / V114 are a major determinant of CB’s selectivity for PYR1. (D) Phosphatase activity with PYL2, HAB1 in presence of ABA (0.5 µM), CB (5 µM), or ABA + CB (same concentrations). The data show %-activity relative to PP2C activity measured in the presence of PYL2 and HAB1 but lacking ABA or CB. CB does not reduce ABA’s inhibitory effect on PYL2 indicating that it is not a PYL2 antagonist. Figure S6. Comparison of transcript level of MAPKKK18, RAB18 and RD29B normalized to constitutive gene expression for PEX4 in Col-0 and different pyr1-1, pyl1, pyl3 and pyl5 mutants. These data suggest that the induction of MAPKKK18, RAB18 and RD29B depends upon PYR1 and PYL1 receptors and not on PYL3 and PYL5. Figure S7. Comparison of transcript level of MAPKKK18, RAB18 and RD29B normalized to constitutive gene expression for PEX4 in Ler and pyl2 mutant. These data suggest that genetic removal of pyl2 does not affect transcript levels of ABA induced genes. Figure S8. Dose response curves for ABA, CB and QB for inhibition of seed germination in Col-0, Ler and different mutant receptor lines. Figure S9. Genetic removal of pyl2, pyl3, pyl5 do not abolish effects of CB, QB and ABA on transpiration. (A) and (C) Wild type Arabidopsis plants were sprayed with 50 µM compounds and imaged by thermography 16 hours post treatment; quantified in (B) and (D) respectively. In graph represented, error bars represent the standard error of mean and asterisks symbols indicate statistical significance and * indicates p ≤ 0.05, ** for p ≤ 0.01 and *** for p ≤ 0.001 Scheme 1. Chemical synthesis of the nitrile-containing ABA agonists. Scheme 1: Reagents and Conditions: (a) p-methylbenzylsulfonyl chloride, DIPEA, DCM, 0°CRT, 12 h; (b) CuCN, t-butylnitrite, Acetonitrile, 70°C, 2 h (c) Zn, Ammonium formate, MeOH, RT, 30 mins; (d) Cyclopropylboronic acid, P(Cy)3, K3PO4, Pd(OAc)2, THF, 100°C, 12 h (e) Triethylborane, CsOAc, Pd(dppf)Cl2, THF, reflux, 12 h; (f) nPrZnBr, Pd(OAc)2, XPhos, THF, 50 °C, 2 h. Supplemental Methods. Chemical Synthesis Unless stated otherwise, all reactions were carried out under an atmosphere of argon in oven-dried glassware. Indicated reaction temperatures refer to those of the reaction bath, while room temperature (rt) is noted as 25 °C. All other solvents were of anhydrous quality purchased from Aldrich Chemical Co. and used as received. Pure reaction products were typically dried under high vacuum .Commercially available starting materials and reagents were purchased from Aldrich, TCI, Fisher Scientific, Combiblocks and AK Scientific and were used as received unless specified otherwise. Analytical thin layer chromatography (TLC) was performed with (5 x20 cm, 60 Å, 250 μm). Visualization was accomplished using a 254 nm UV lamp. 1H NMR spectra were recorded on Inova 400 MHz spectrometer, while 13C NMR spectra were recorded on Bruker 700 MHz spectrometer. Chemical shifts are reported in ppm with the solvent resonance as internal standard ([DMSO-d6 2.5 ppm] for 1H, 13C respectively). Data are reported as follows: chemical shift, multiplicity (s= singlet, d = doublet, dd = doublet of doublet, t = triplet, q = quartet, br = broad, m = multiplet), number of protons, and coupling constants. While anilines 5-9 were commercially available, anilines 10, 11 and 13-15 were synthesized according to protocols specified in literature. Aniline 17 and 19 were synthesized using high yielding Suzuki coupling reactions with either triethylborane or cyclopropylboronic acids using substrate 16. Negishi coupling reactions were performed with substrates 7 and 16, using n-propylzincbromide solution to yield anilines 12 and 18. LC/MS analyses The obtained products were analyzed on an Agilent 6224 TOF LC-MS, using an Agilent Poroshell 120 3x50 mm, C18-column, particle size 2.7 µm (Agilent, Part number: 699975-302) at 45°C. The injection volume was 5µL, flow rate was set to 0.5mL / min, using a mixture of acetonitrile and buffered water (Fisher Chemical, Optima® LCMS L-16978) containing 1mM ammonium fluoride (Aldrich, 338869). Gradients were as follows: 0→2 min: 2% acetonitrile; linear increase to 90% acetonitrile between 2→17min (3min: 15% acetonitrile, 5min: 25% acetonitrile, 10min: 40% acetonitrile, 12 min: 70% acetonitrile, 17 min: 90% acetonitrile); 17→22.5min: 90% acetonitrile; 22.5→23 min: linear decrease to 2% acetonitrile; 23→25.5min: 2% acetonitrile. Elution was monitored by UVabsorption at 254 nm and by MS-TOF. The dual ESI conditions were as follows: gas temperature 325°C, drying gas flow rate 11 L / min, nebulizer 35 psig and VCap 3500V. MS TOF conditions were: fragmentor 120V and skimmer 65V. Data acquisition was performed in an extended dynamic range (2 GHz mode) with a scan range of 100 to 1700 m/z and an acquisition rate of 0.9 spectra/s. Qualitative Analysis of MassHunter Workstation (Agilent Technologies, version B.04.00) was used to determine the exact mass of the compounds, by generating the MS profile for the UVspectrum peak with highest intensity UV spectra were checked as a measure of sample purity. . All compounds submitted for biological testing were found to be ≥ 95 % pure. General Procedure for Sulfonamide Coupling Reaction: To a cold solution of aryl amine (1 equiv) in anhydrous DCM was added (3 equiv) of diisopropylethylamine followed by the desired sulfonyl chloride. The solution is stirred for 12 h and the reaction quenched by adding dilute hydrochloric acid (2N). The reaction mixture is extracted in DCM and dried over anhydrous sodium sulfate and concentrated in vacuo. The residue is purified by silica gel flash chromatography using hexane/ethylacetate gradient from 0%-50% to yield pure compounds as yellowish white powders in 60-80% yields. Procedure for Suzuki coupling with Triethylborane: Triethylborane solution (8.36 mL, 2.8 equiv) was added to a solution of aryl bromide, 16 (0.63g, 1 equiv), Pd(dppf)Cl2 (43.2 mg, 0.02 equiv), CsOAc (1.15g, 2.0 equiv) in THF under an argon atmosphere and the mixture heated at reflux overnight until all the starting material is consumed. After cooling, the reaction mixture was diluted with ethyl acetate and washed with sodium bicarbonate solution and brine, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel flash chromatography hexane/ethyl acetate gradient from 0%-60% to yield 17(0.4g) as a white solid in 85% yield. Procedure for Suzuki coupling with Cyclopropylboronic acid: To a solution of 16 (1 equiv), boronic acid (2.5 equiv), potassium phosphate (4.0 equiv) and tricylohexylphosphine (0.1 equiv) in toluene/water (1:20 v/v/), under an argon atmosphere was added palladium acetate (0.05 equiv). The mixture is heated at 100 ºC overnight and then cooled to room temperature. Water was added to the reactions and the mixture extracted with ethyl acetate, the combined extracts were washed with brine, dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified using silica gel flash chromatography to afford 19 in 75 % yields. General Procedure for Negishi Coupling: To a solution of aryl bromide 7 or 16 (1 equiv), Pd(OAc)2 (0.05 equiv), XPhos (0.1 equiv) at 0 ºC was added a solution of n-propylzinc bromide (1.8 equiv) in THF, under argon atmosphere. The mixture was then heated in an oil bath at 50 ºC for 2 h. The reaction was cooled and quenched slowly by addition of water, the reaction mixture extracted with ethyl acetate, the combined extracts dried over sodium sulfate and concentrated in vacuo. The residue was purified by silica gel flash chromatography using hexanes/ethyl acetate gradient to yield anilines 12 and 18 in 65 and 60% yields respectively. Synthesis of intermediate 21 via diazotization/cyanation of 20: To a solution of CuCN (1.94g, 2.5 equiv), in acetonitrile (50 mL) was added t-butyl nitrite (2.06 mL, 2.0 equiv). The mixture was cooled to 0’C and intermediate 20 (2g, 1 equiv) was added portionwise over 10 mins. The mixture was heated for 2 h at 70’C, quenched with a 10% solution of sodium carbonate and the pH was adjusted to 11 using 1M solution of NaOH. The reaction was extracted with ethyl acetate and the combined organic extracts were washed with brine, dried over sodium sulfate and concentrated in vacuo. The residue was purified using flash chromatography using hexane/ethylacetate gradient (050%) to give compound as a yellow solid in 65% yield. Procedure for reduction of nitro derivative 21: To a cold solution of the aryl nitro derivative (1 equiv) in methanol, was added ammonium formate (10 equiv), followed by slow addition of powdered zinc dust (10 equiv). The reaction was stirred for 30 mins and concentrated in vacuo. The residue was adsorbed on silica gel and purified using flash chromatography (Hexane/Ethyl acetate gradient from 0-60%) to yield products in near quantitative yields. Agonist/receptor-mediated phosphatase inhibition assays. To obtain recombinant receptor fusion proteins for assays, we used the previously described expression constructs(2, 3). 9 of the 14 Arabidopsis ABA receptors were expressed as 6x-His tagged in pET28 (PYR1, PYL1 - PYL6, PYL8 and PYL10). PYL9 and PYL11 we expressed as MBP fusion proteins in the vector pMAL-c. Expression of was conducted in BL21[DE3]pLysS host cells; transformed cells were pre-cultured overnight, transferred to terrific broth (TB) medium, and cultured at 30 °C to an A 600 of ∼0.6, at which point the temperature was lowered to 18° C and isopropyl β-D-1 thiogalactopyranoside (IPTG) (1 mM) was added and the culture stirred overnight. Cells were then harvested, and disrupted using by freeze-thawing between -78°C and room temperature followed by sonication. The recombinant pET28-derived proteins were purified on His60 Ni Superflow; MBP-PYL fusion proteins were purified using amylose resin (New England Biolabs). Mutant PYR1 and PYL2 receptors were constructed previously as described (3) and expressed and purified identically to wild type receptors. A previously described (4) HAB1 Nterminal deletion mutant (ΔNHAB1, lacking the first 178 N-terminal amino acids) was used to obtain His-tagged PP2C for enzyme assays and expressed in BL21[DE3]pLysS host cells; transformed cells were pre-cultured overnight, transferred to terrific broth (TB) medium, and cultured at 30 °C to an A 600 of ∼0.6, at which point the temperature was lowered to 18° C and isopropyl β-D-1 thiogalactopyranoside (IPTG) (1 mM) and MgCl2 (1 mM) were added and culture stirred overnight. Cells were harvested as described above and and the His-tagged protein was purified on His60 Ni Superflow resin. Activity was confirmed by receptor-mediated PP2C inhibition assays with ABA. PP2C activity assays using recombinant receptors and PP2Cs were carried out as follows: Purified proteins were pre-incubated in 160 μl assay buffer containing (100 mM Tris-HCl, pH7.9, 100 mM NaCl, , 3 μg bovine serum albumin and 0.1% 2-mercaptoethanol), 1 mM MnCl2 with ligand at room temperature and the reactions were started by adding 40 μL of a solution containing 250 mM 4-Nitrophenyl phosphate in assay buffer after which absorbance measurements were immediately collected using a 405 nm on Tecan Infinite M200 plate reader. Reactions contained 50 nM PP2C and 100 nM PYR/PYL proteins (except for PYL9 and PYL11 which had 300 nM of receptor). Ligand concentration spanning 50000 nM to 4nM were used to measure PP2C activity. The dose response data was fitted to a log (inhibitor) vs response-(variable slope) model using non-linear regression to infer the IC50s, using GraphPad Prism 6.0 Construction of a transgenic Arabidopsis pMAPKKK18::Luc+ reporter line To generate pMAPKKK18::Luc+ reporter lines, the MAPKKK18 (At1g05100) promoter (≈ 2 Kb upstream region from the ATG) was amplified using the primers MAPKKK18pro forward (5’CACCATAGTAGGTGTTGGTAAAC-3’) and MAPKKK18pro reverse (5’-TTGGAGAATGATACTAAAAAAG3’) as previously described (2). The PCR product was cloned into pENTR/D-TOPO vector (Invitrogen). After sequence validation the plasmid was recombined into the binary plant transformation vector pFlash (courtesy of Maria Angeles Nohales and Steve Kay) with LR clonase II (Invitrogen) resulting in a pMAPKKK18::Luc + fusion. The binary plasmid was transformed into Agrobacterium tumefaciens GV3101 and transformed into Arabidopsis plants (Col-0) by floral dipping (5). Transgenic seeds were selected on medium containing gentamycin and 36 resistant plants were transferred to soil. Single insertion lines were identified by segregation patterns in T 2 progeny of these plants and a homozygous single insert T 2 transgenic plants was identified and its progeny used in the experiments shown. Luciferase imaging MAPKKK18 promoter::Luc+ activity was measured with 8-d-old seedlings that had been grown in plant growth liquid medium (1/2 Murashige and Skoog medium and 0.5% Sucrose) under 16 hour light and 8 hour dark conditions. Seedlings were transferred to new plant growth liquid medium with test chemical at described concentration and 100 µM luciferin. Luciferase assay image were taken every 15 min during 24 hour in dark by camera (SONY a7s) with FE1.8/55 lense (FE 55 mm F1.8 ZA ; SEL55F18Z). The average luminescent intensity was quantified using ImageJ. Average intensity was calculated for duplicates and the error bars on graphs represent the standard deviation. Seed germination assays Germination experiments were performed with Arabidopsis thaliana seeds of wild type Col-0 and Ler or different receptor mutants; seeds were surface sterilized in bleach and plated onto 0.5X MS, 0.5% sucrose agar medium supplemented with compounds of interest. After 4d of stratification at 4°C, plates were transferred to a growth chamber (16h / 8h, 150 µE/m2) or dark and germination scored after 3 days. Seeds were scored positive for germination if emerged radicles were greater than ½ seed length. Doses spanning from 86 nM to 4300 nM were used to generate dose response curves for the different agonists. The dose response curves were fitted to log (inhibitor) vs response-(variable slope) model using non-linear regression to infer the EC50s, using GraphPad Prism 6.0. Protein crystallization. PYR11-181 was expressed in E. coli and purified as described previously (6). Purified protein was stored at -80 °C in a buffer containing 20 mM HEPES (pH 7.6), 50 mM sodium chloride, 10 mM DTT and 30% glycerol. Purified PYR11-181 was exchange into a buffer containing 20 mM HEPES (pH 7.6), 50 mM sodium chloride, 10 mM dithiothreitiol, and 5 mM magnesium chloride, mixed with a 5-fold molar excess of 4m and concentrated to 25 mg/mL. Crystallization of the PYR11-181:4m complex was conducted by sitting drop vapor diffusion at 19 °C. Drops were formed by mixing equal volumes of the PYR1 1-181:4m complex with well solution containing 100 mM sodium acetate (pH 5.0) and 1.5 M ammonium sulfate. The resulting crystals were flash frozen after passing through a cryoprotection solution consisting of well solution plus 20% (w/v) 1,2-propanediol. The PYR11-181:cyanabactin complex was prepared by mixing a 5-fold molar excess of cyanabactin with PYR11-181 in a buffer containing 20 mM HEPES (pH 7.6), 50 mM sodium chloride, 10 mM dithiothreitiol, and 5 mM magnesium chloride and concentrating to 25 mg/mL. Crystallization was conducted by hanging drop vapor diffusion at 19 °C by mixing equal volumes of the PYR11-181:cyanabactin complex with well solution containing 100 mM bis tris (pH 5.5) and 2 M ammonium sulfate. Crystals were flash frozen after passing through perfluoropolyether cryo oil (Hampton Research, Aliso Viejo, CA). X-ray diffraction data for each complex were gathered from a single crystal. Diffraction data was collected at 100 K using a Rigaku MicroMax–007 X-ray generator equipped with VariMax-HF optics and a R-Axis 4++ detector. Diffraction data were indexed, integrated, and scaled using HKL2000 software package (7). Structure Determination The PYR11-181:4m and PYR11-181:cyanabactin complexes were solved by molecular replacement using a PYR1 1181 :pyrabactin complex (PDB ID 5UR4) devoid of ligand and water molecules as the search model to evaluate the initial phases. Phenix.AutoMR solved the initial phases and automatically built the majority of residues for both complexes (8). The resulting models were completed through iterative rounds of manual model building in Coot (9) and refinement with Phenix.refine (8) using translational libration screw-motion (TLS) and individual atomic displacement parameters. Phenix topology files for novel CB and 4m ligands were generated using the PRODRG server (http://davapc1.bioch.dundee.ac.uk/cgi-bin/prodrg/) (10), with a sp3, S=O and S-N bond lengths manually modified to concur with accepted values. Geometry of the final structures were validated using Molprobity (11, 12). Data collection and refinement statistics for the final models are listed in Supplementary Table 3. Isothermal titration calorimetry PYR1 was cloned into a modified pSUMO vector with the addition of a TEV protease cleavage site immediately adjacent to PYR1s initiator methionine and protein expression performed in BL21pLysS cells. Transformed cells were cultured in terrific broth (TB) and grown at 37°C to an OD of approximately 0.7. Isopropyl b-D-1 thiogalactopyranoside (IPTG) was added to 1 mM to induce expression and the culture incubated overnight at 16°C. PYR1 was purified using immobilized metal chromatography (His60 Ni Superflow Resin, Clontech), and subsequently the expression tag cleaved using TEV protease, yielding PYR1 with an N-terminal SerGluPhe extension. Cleaved protein was passed over another IMAC column to remove the tag and the flow through dialyzed against 100 mM MOPS-HCl (pH 7.0) / 1 mM ß-mercaptoethanol and concentrated using an Amicon (10 KDa cutoff) concentrator. Quality of the purified receptor was evaluated using receptor-mediated PP2C inhibition assays with ABA, which revealed an expected IC50, and PYR1’s oligomeric state and purity were evaluated by gel filtration and electrospray ionization (ESI) mass spectrometry; the inferred mass was 21,939.47 Da (0.86 Da delta mass from expected) as deduced from deconvolution using BioConfirm software (Agilent). ITC experiments were performed using a Nano ITC Low Volume calorimeter (TA Instruments), with the data acquisition software ITCRun v3.2 and data analysis software NanoAnalyze v3.6 (TA Instruments). All solutions were degassed to avoid bubbles and equilibrated to the corresponding temperature for each experiment. Reverse titration experiments (receptor injected onto ligand) were performed due to low ligand solubility at 35°C. The ligand solution in the calorimetric cell was titrated with PYR1 protein in dialysis buffer. Optimal stoichiometries were established using test runs with PYR1 from 300-450 µM and CB between 15-30 µM. The final titrations were done in a series of 20 injections of 2.5 µl each using 350 µM PYR1 and 30 µM CB in dialysis buffer (100 mM MOPS-HCl (pH 7.0) / 1 mM ßmercaptoethanol). The heat produced from each injection was acquired from the integration of the calorimetric peak. The heat due to binding was obtained as the difference between the heat of the reaction and the corresponding heat of dilution from buffer into cyanabactin. The resulting binding isotherms were analyzed by blank constant fitting of the data to an independent one-site sites model with NanoAnalyze. Injections of 350 µM PYR1 into buffer were indistinguishable from the buffer into ligand injections used for blank subtractions. Quantitative RT-PCR analysis Plant RNA purification kit (Invitrogen) was used to isolate total RNA from plant tissue according to the manufacturer’s instructions. QantiTec reverse transcription kit (Qiagen) was used to synthesize cDNA from 1 μg of total RNA. Real-time PCR was performed using Maxima SYBR Green/Fluorescein qPCR Master Mix (Thermo Scientific) with the CFX96 Real-Time PCR Systems (Bio-Rad). The relative amounts of target mRNAs were determined using the relative standard curve method and were normalized by relative amount of internal control mRNA. Biological triplicate experiments were performed. The primer sequences used in these experiments are shown in Supplemental Table 3. Thermal Imaging Seeds from Col-0/ Ler or different receptor mutants were surface sterilized in bleach and plated onto 0.5X MS, 0.5% sucrose agar medium. 3-5 day old seedlings were then transferred from agar plates to soil and grown on 16 hour days for 3 weeks. Plants were treated by foliar spraying with a aqueous solutions of 0.1% DMSO carrier solvent, 0.02% Silwet-77 surfactant (Lehle seeds), and 50 µM (3 mL/pot) of ABA, cyanabactin, or mock control. Thermographs were collected with a FLIR camera (T62101) 16 hours after compound applications and quantified using the FLIR camera software by measuring the average leaf temperature of 5 or 6 leaves per plant. Average leaf temperatures were calculated for 10 replicate plants (in 5 pots) per treatment. Statistical comparisons between treated and the mock treated plants were performed using pairwise t-tests. Gas-exchange measurements Seeds of wildtype Col-0 were sown into 2:1 (v:v) peat:vermiculite mixture and grown through a hole in a glass plate covering the pot as described previously(13). Plants were grown in growth chambers (AR-66LX, Percival Scientific, IA, USA and Snijders Scientific, Drogenbos, Belgia) with 12 h photoperiod, 23/18 °C day/night temperature, 100150 μmol m-2 s-1 light and 70% relative humidity. Plants were 24-29 days old during gas-exchange experiments. Stomatal conductance was recorded with a custom-built temperature-controlled gas-exchange device analogous to the one described before(13) consisting of eight flow-through whole-rosette cuvettes at ~60% RH, 150 µmol m-2 s-1 light and 24-25°C air temperature. Plants were inserted into measurement cuvettes and after stomatal conductance had stabilized, they were sprayed with either quinabactin (25 µM), cyanabactin (25 µM), ABA (10 µM) or mock solution. Mock solution was prepared from water containing 0.1% DMSO and 0.02% Silwet L77 (Duchefa). Measurements of ABA-induced stomatal closure have been described previously(14). After spraying, stomatal conductance was followed for 48 min. The time courses of stomatal closure in response to spraying are presented in relative units (i.e. normalized to the pre-treatment stomatal conductance value), while absolute values of stomatal conductance before and 48min after spraying are also shown. Molecular docking For preparing crystal structures, Protein Preparation Wizard (Schrödinger Release 2015-1: Schrödinger Suite 2015-1 Protein Preparation Wizard; Epik version 3.1, Schrödinger, LLC, New York, NY, 2015; Impact version 6.6, Schrödinger, LLC, New York, NY, 2015; Prime version 3.9, Schrödinger, LLC, New York, NY, 2015.) was used with default settings and only the gate-latch water was retained. The glide settings (Small-Molecule Drug Discovery Suite 2015-1: Glide, version 6.6, Schrödinger, LLC, New York, NY, 2015.) were used as default except that “Enhance planarity of conjugated pi groups” was used. The prepared crystal structure of 4LA7 were used docking and posing. Docking poses & hydrogen bond calculations were performed with the UCSF Chimera package. Chimera is developed by the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco (supported by NIGMS P41-GM103311). Analytical data for compounds synthesized N-(4-cyano-3-methylphenyl)-1-(4-methylphenyl)methanesulfonamide (4a) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.25 (s, 3 H), 2.37 (s, 3 H), 4.52 (s, 2 H), 6.99 - 7.07 (m, 2 H), 7.07 - 7.14 (m, 4 H), 7.63 (d, J=8.58 Hz, 1 H), 10.31 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.16, 20.67, 57.40, 105.12, 115.48, 118.12, 118.32, 126.02, 128.94, 130.87, 133.75, 137.83, 142.93, 142.97. ESI HRMS [M+NH 4]+ calcd for C16H16N2O2S 318.1276 found 318.1312 N-(3-chloro-4-cyanophenyl)-1-(4-methylphenyl)methanesulfonamide (4b) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.25 (s, 3 H), 4.60 (s, 2 H), 7.05 - 7.18 (m, 6 H), 7.79 (d, J=8.58 Hz, 1 H), 10.62 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.67, 57.97, 104.81, 116.14, 116.35, 117.45, 125.64, 128.97, 130.97, 135.34, 136.23, 138.05, 144.47. ESI HRMS [M+NH4]+ calcd for C15H13ClN2O2S 338.0730 found 338.0721 N-(3-bromo-4-cyanophenyl)-1-(4-methylphenyl)methanesulfonamide (4c) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.25 (s, 3 H), 4.59 (s, 2 H), 7.05 - 7.20 (m, 5 H), 7.26 (d, J=2.34 Hz, 1 H), 7.76 (d, J=8.58 Hz, 1 H), 10.58 (s, 1H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.70, 58.04, 107.28, 116.69, 117.40, 120.55, 125.22, 125.61, 128.97, 130.96, 135.54, 138.06, 144.31. ESI HRMS [M+NH 4]+ calcd for C15H13BrN2O2S 384.0204 found 384.0338 N-(4-cyano- 3-(trifluoromethyl)-phenyl)-1-(4-methylphenyl)methanesulfonamide (4d) 1 H NMR (400 MHz, DMSO-d6) δ ppm 2.21 (s, 3 H), 4.63 (s, 2 H), 7.01 - 7.15 (m, 4 H), 7.31 - 7.41 (m, 2 H), 7.96 (d, J=7.80 Hz, 1 H), 10.79 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.59, 58.42, 100.85, 114.75, 115.68, 120.49, 125.44, 128.94, 131.03, 131.74, 131.92, 136.52, 138.09, 143.87. ESI HRMS [M+NH 4]+ calcd for C16H13F3N2O2S 372.0993 found 372.0968 N-(4-cyano-3-methoxyphenyl)-1-(4-methylphenyl)methanesulfonamide (4e) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.25 (s, 3 H), 3.79 (s, 3 H), 4.55 (s, 2 H), 6.72 - 6.85 (m, 2 H), 7.11 (s, 4 H), 7.58 (d, J=8.58 Hz, 1 H), 10.36 (s, 1H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.67, 55.86, 57.36, 93.83, 100.41, 109.95, 116.56, 125.96, 128.96, 130.92, 134.53, 137.86, 144.94, 161.72. ESI HRMS [M+NH4]+ calcd for C16H16N2O3S found 334.1225 found 334.1262 N-(4-cyano-3-ethoxyphenyl)-1-(4-methylphenyl)methanesulfonamide (4f) 1H NMR (400 MHz, DMSO-d6) δ ppm 1.33 (t, J=7.02 Hz, 3 H), 2.25 (s, 3 H), 4.03 (d, J=7.02 Hz, 2 H), 4.54 (s, 2 H), 6.72 - 6.83 (m, 2 H), 7.10 (s, 4H), 7.57 (d, J=8.58 Hz, 1 H), 10.33 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 14.21, 20.67, 57.35, 64.26, 94.08, 101.15, 109.91, 116.58, 125.98, 128.95, 130.92, 134.56, 137.86, 144.83, 160.97. ESI HRMS [M+NH4]+ calcd for C17H18N2O3S 348.1381 found 348.1458 N-(4-cyano-3-ethylphenyl)-1-(4-methylphenyl)methanesulfonamide (4g) 1H NMR (400 MHz, DMSO-d6) δ ppm 1.15 (t, J=7.80 Hz, 3 H), 2.24 (s, 3 H), 2.67 (q, J=7.28 Hz, 2 H), 4.52 (s, 2 H), 7.02 - 7.14 (m, 6 H), 7.63 (d, J=8.58 Hz, 1 H), 10.31 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 14.69, 20.68, 27.18, 57.49, 104.35, 115.63, 117.11, 117.97, 125.98, 128.94, 130.86, 134.04, 137.82, 143.24, 148.81. ESI HRMS [M+NH4]+ calcd for C17H18N2O2S 332.1432 found 332.1511 N-(4-cyano-3-propylphenyl)-1-(4-methylphenyl)methanesulfonamide (4h) 1H NMR (400 MHz, DMSO-d6) δ ppm 0.89 (t, J=7.41 Hz, 3 H), 1.57 (m, 2H), 2.24 (s, 3 H), 2.63 (t, J=8 Hz , 2 H), 4.51 (s, 2 H), 7.01 - 7.13 (m, 6 H), 7.64 (d, J=8.58 Hz, 1 H), 10.30 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 13.40, 20.68, 23.38, 35.81, 57.41, 104.70, 115.74, 117.79, 118.11, 126.03, 128.94, 130.84, 133.99, 137.81, 143.15, 147.16. ESI HRMS [M+NH4]+ calcd for C18H20N2O2S 346.1589 found 346.1654 N-(4-cyano-3-cyclopropylphenyl)-1-(4-methylphenyl)methanesulfonamide (4i) 1H NMR (400 MHz, DMSO-d6) δ ppm 0.56 - 0.65 (m, 2 H), 1.03 - 1.12 (m, 2 H), 2.03 - 2.12 (m, 1 H), 2.22(s, 3 H), 4.48 (s, 2 H), 6.63 (d,J=2.34 Hz, 1 H), 6.99 - 7.13 (m, 5 H), 7.61 (d, J=8.58 Hz, 1 H), 10.22 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 9.31, 13.81, 20.69, 57.56, 105.33, 112.88, 115.31, 118.24, 125.93, 128.95, 130.85, 133.85, 137.84, 143.36, 148.57. ESI HRMS [M+NH4]+ calcd for C18H18N2O2S 344.1432 found 344.1499 N-(4-cyano-3, 5-dimethylphenyl)-1-(4-methylphenyl)methanesulfonamide (4j) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.25 (s, 3 H), 2.35 (s, 6 H), 4.52 (s, 2 H), 6.85 (m, 2 H), 7.10 (m, 4 H), 10.22 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.43, 20.67, 57.54, 105.95, 116.01, 117.18, 126.04, 128.92, 130.90, 137.81, 142.43, 142.98. ESI HRMS [M+NH4]+ calcd for C17H18N2O2S 332.1432 found 332.1523 N-(4-cyano-3, 5-(bistrifluoromethyl)phenyl)-1-(4-methylphenyl)methanesulfonamide (4k) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.18 (s, 3 H), 4.73 (s, 2 H), 7.00 (d, J=8.58 Hz, 2 H), 7.11 - 7.27 (m, 3 H), 7.52 (s, 2 H), 11.20 (br. s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.48, 112.208, 117.37, 117.40, 122.35, 124.98, 128.93, 131.30, 134.28, 134.46, 138.38, 144.86. ESI HRMS [M+NH 4]+ calcd for C17H12F6N2O2S 440.0867 found 440.0778 N-(3-bromo-4-cyano-5-methylphenyl)-1-(4-methylphenyl)methanesulfonamide (4l) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.25 (s, 3 H), 2.39 (s, 3 H), 4.59 (s, 2 H), 7.14-7.10(m, 6 H), 10.49 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 20.68, 20.91, 58.13, 108.81, 116.56, 117.21, 118.37, 125.25, 125.65, 128.94, 130.86, 131.00, 138.04, 143.71, 145.42. ESI HRMS [M+NH4]+ calcd for C16H15BrN2O2S 398.0361 found 398.0362 N-(4-cyano-3-ethyl -5-methylphenyl)-1-(4-methylphenyl)methanesulfonamide (4m) 1H NMR (400 MHz, DMSO-d6) δ ppm 1.14 (t, J=7.41 Hz, 3 H), 2.24 (s, 3 H), 2.35 (s, 3 H), 2.66 (q, J=7.80 Hz, 2 H), 4.52 (s, 2 H), 6.87 (d, J=6.24 Hz,2 H), 7.10 (s, 4 H), 10.23 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 14.70, 20.45, 20.67, 27.41, 57.63, 105.15, 114.79, 116.21, 117.01, 126.01, 128.91, 130.90, 137.81, 142.70, 143.19, 148.94. ESI HRMS [M+NH4]+ calcd for C18H20N2O2S 346.1589 found 346.1640 N-(4-cyano-3-methyl -5-propylphenyl)-1-(4-methylphenyl)methanesulfonamide (4n) 1H NMR (400 MHz, DMSO-d6) δ ppm 0.87 (t, J=8 Hz, 3 H), 1.55 (m, 2 H), 2.24 (s, 3 H) ,2.35 (s, 3 H), 2.62 (t, J=8 Hz, 2 H), 4.51 (s, 2 H), 6.81 - 6.92 (m, 2 H), 7.09 (m, 4 H), 10.22 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 13.45, 20.48, 20.67, 23.33, 36.07, 57.56, 105.55, 115.48, 116.29, 117.12, 126.01, 128.92, 130.88, 137.83, 142.49, 143.14, 147.31. ESI HRMS [M+NH4]+ calcd for C19H22N2O2S 360.1745 found 360.1831 N-(4-cyano-3-cyclopropyl-5-methylphenyl)-1-(4-methylphenyl)methanesulfonamide (4o) 1H NMR (400 MHz, DMSO-d6) δ ppm 0.54 - 0.64 (m, 2 H), 0.99 - 1.09 (m, 2 H), 2.01 - 2.12 (m, 1 H), 2.27 (s, 3 H), 2.35 (s, 3 H), 4.48 (s, 2 H), 6.41 - 6.48 (m, 1 H), 6.84 (s, 1 H), 7.04 - 7.11 (m, 4 H), 10.13 (s, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 9.14, 14.01, 20.45, 20.68, 57.67, 106.25, 110.64, 115.97, 117.26, 125.98, 128.91, 130.89, 137.82, 142.83, 142.98, 148.67. ESI HRMS [M+NH4]+ calcd for C19H20N2O2S 358.1589 found 358.1586 4-amino-2-bromo-6-methylbenzonitrile (16) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.27 (s, 3 H), 6.31 (s, 2 H), 6.43 (s, 1 H), 6.69 (d, J=2.34 Hz, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 9.14, 14.01, 20.45, 20.68, 57.67, 106.25, 110.64, 115.97, 117.26, 125.98, 128.91, 130.89, 137.82, 142.83, 142.98, 148.67. 4-amino-2-ethyl-6-methylbenzonitrile (17) 1H NMR (400 MHz, DMSO-d6) δ ppm 1.12 (t, J=8.0 Hz, 3 H), 2.24 (s, 3 H), 2.55 (q, J=7.28 Hz, 2 H), 5.91 (s, 2 H), 6.30 (m, 2 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 14.80, 20.33, 27.30, 96.62, 110.56, 112.10, 118.71, 142.76, 148.78, 152.49. 4-amino-2-methyl-6-propylbenzonitrile (18) 1H NMR (400 MHz, DMSO-d6) δ ppm 0.87 (t, J=8.0 Hz, 3 H), 1.49 1.59 (m, 2 H), 2.24 (s, 3 H), 2.51 (d, J=7.80 Hz, 2 H), 5.90 (s, 2 H), 6.24 - 6.33 (m, 2 H). 13C NMR (176 MHz, DMSO-d6) δ ppm13.58, 20.36, 23.31, 36.12, 97.05, 111.33, 112.21, 118.82, 142.69, 147.09, 152.29. 4-amino-2-cyclopropyl-6-methylbenzonitrile (19) 1H NMR (400 MHz, DMSO-d6) δ ppm 0.54 - 0.63 (m, 2 H), 0.90 - 1.01 (m, 2 H), 1.92 - 2.01 (m, 1 H), 2.24 (s, 3 H), 5.84 (s, 2 H), 5.94 (d, J=1.56 Hz,1 H), 6.26 (d, J=1.56 Hz, 1 H). 13C NMR (176 MHz, DMSO-d6) δ ppm 8.74, 13.78, 20.34, 97.89, 105.91, 112.03, 118.98, 142.49, 148.49, 152.55. 2-bromo-6-methyl-4-nitrobenzonitrile (21) 1H NMR (400 MHz, DMSO-d6) δ ppm 2.63 (s, 3 H), 8.34 (d, J=2.34 Hz, 1 H), 8.45 (d, J=2.34 Hz, 1 H) 13C NMR (176 MHz, DMSO-d6) δ ppm 20.77, 115.37, 120.76, 123.87, 124.86, 125.54, 146.96, 149.69. References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. Laskowski, R. A., and Swindells, M. B. (2011) LigPlot+: multiple ligand-protein interaction diagrams for drug discovery, J. Chem. Inf. Model. 51, 2778–2786. Okamoto, M., Peterson, F. C., Defries, A., Park, S.-Y., Endo, A., Nambara, E., Volkman, B. F., and Cutler, S. R. (2013) Activation of dimeric ABA receptors elicits guard cell closure, ABA-regulated gene expression, and drought tolerance, Proc. Natl. Acad. Sci. U. S. A. 110, 12132–12137. Peterson, F. C., Burgie, E. S., Park, S.-Y., Jensen, D. R., Weiner, J. J., Bingman, C. A., Chang, C.-E. A., Cutler, S. R., Phillips, G. N., Jr, and Volkman, B. F. (2010) Structural basis for selective activation of ABA receptors, Nat. Struct. Mol. Biol. 17, 1109–1113. Saez, A., Rodrigues, A., Santiago, J., Rubio, S., and Rodriguez, P. L. (2008) HAB1--SWI3B interaction reveals a link between abscisic acid signaling and putative SWI/SNF chromatin-remodeling complexes in Arabidopsis, Plant Cell, Am Soc Plant Biol 20, 2972–2988. Clough, S. J., and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana, Plant J. 16, 735–743. Park, S.-Y., Fung, P., Nishimura, N., Jensen, D. R., Fujii, H., Zhao, Y., Lumba, S., Santiago, J., Rodrigues, A., Chow, T.-F. F., Alfred, S. E., Bonetta, D., Finkelstein, R., Provart, N. J., Desveaux, D., Rodriguez, P. L., McCourt, P., Zhu, J.-K., Schroeder, J. I., Volkman, B. F., and Cutler, S. R. (2009) Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins, Science 324, 1068–1071. Minor, W., and Otwinowski, Z. (1997) HKL2000 (Denzo-SMN) Software Package. Processing of X-ray Diffraction Data Collected in Oscillation Mode, Methods in Enzymology, Macromolecular Crystallography, Academic Press, New York. Adams, P. D., Afonine, P. V., Bunkóczi, G., Chen, V. B., Davis, I. W., Echols, N., Headd, J. J., Hung, L.-W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A. J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S., Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python-based system for macromolecular structure solution, Acta Crystallogr. D Biol. Crystallogr. 66, 213–221. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular graphics, Acta Crystallogr. D Biol. Crystallogr. 60, 2126–2132. Schüttelkopf, A. W., and van Aalten, D. M. F. (2004) PRODRG: a tool for high-throughput crystallography of protein-ligand complexes, Acta Crystallogr. D Biol. Crystallogr. 60, 1355–1363. Davis, I. W., Leaver-Fay, A., Chen, V. B., Block, J. N., Kapral, G. J., Wang, X., Murray, L. W., Arendall, W. B., 3rd, Snoeyink, J., Richardson, J. S., and Richardson, D. C. (2007) MolProbity: all-atom contacts and structure validation for proteins and nucleic acids, Nucleic Acids Res. 35, W375–83. Chen, V. B., Arendall, W. B., 3rd, Headd, J. J., Keedy, D. A., Immormino, R. M., Kapral, G. J., Murray, L. W., Richardson, J. S., and Richardson, D. C. (2010) MolProbity: all-atom structure validation for macromolecular crystallography, Acta Crystallogr. D Biol. Crystallogr. 66, 12–21. Kollist, T., Moldau, H., Rasulov, B., Oja, V., Rämma, H., Hüve, K., Jaspers, P., Kangasjärvi, J., and Kollist, H. (2007) A novel device detects a rapid ozone-induced transient stomatal closure in intact Arabidopsis and its absence in abi2 mutant, Physiol. Plant., Wiley Online Library 129, 796–803. Merilo, E., Jalakas, P., Kollist, H., and Brosché, M. (2015) The role of ABA recycling and transporter proteins in rapid stomatal responses to reduced air humidity, elevated CO2, and exogenous ABA, Mol. Plant 8, 657– 659.
