Name: _____________________________________ Period: _____ DNA Fingerprinting and Restriction Enzymes Humans have DNA packaged into 23 pairs of chromosomes. Most of this DNA is identical between individuals, but there are small sequence differences called polymorphisms. These polymorphisms include single base pair changes and repetitive DNA elements. Analyzing several polymorphisms within a person’s genome generates a unique DNA fingerprint. The best known application of DNA fingerprinting is in forensic science. DNA fingerprinting techniques are used to analyze blood, tissue, and other body fluids from crime scenes. DNA is extracted from these samples and compared to the DNA fingerprints of suspects. DNA fingerprinting can also be used to match DNA samples to known sequences of different species. A technique called polymerase chain reaction (PCR) is used to amplify the sequences of DNA. Analysis also involves treating DNA with special enzymes called restriction enzymes, which act like molecular scissors to cut DNA at specific sites. Digestion by these enzymes will produce fragments of varying lengths. If a restriction site occurs within the sample sequence, the probe will reveal multiple bands of DNA that have different sizes. This technique is called restriction fragment length polymorphism (RFLP). The samples are transferred with a micropipet to agarose gel. When electricity is applied, the fragments will move through the gel. Shorter fragments will move farther. This technique, called gel electrophoresis, separates DNA fragments by size. ___ PCR amplification ___DNA extracted from tissue. ___DNA fragments move across gel ___DNA sample loaded into wells ___DNA stained with fluorescent dye ___Electricity applied to gel The HaeIII is a restriction enzyme that attaches at the restriction site GGCC and cuts between the second G and the first C ( GG / CC ). The DNA fragments below match one of 6 different species of penguin. Mark the sites in each fragment where the HaeIII enzyme cuts and then fill in the chart to identify each penguin sample. (1) CGATAGCTCGATAGCCCGCGGATGTCTGTGCTGGGCCATTACCCCGATGATGCCT (2) CGATAGCTCGATAGGCCGCGGATGTCTGTGCTGCGCCTGGCCATTACCCCGATGATGCCT (3) CCGGCGCCGGCCGATAGCCCGCGGATGTTGCTGGGCCATTACCCCGATGATGCCT (4) CCGGGCCCTCGATAGCCCGCGGATGTCTTGCTGGGCCATTACCCCGATGATGCCT (5) CCGGCGCCGCCGATTAGCCCGCGGATGTTTGCTGGCCCCTACCGGCCTCT (6) CCGGGCGCCGCCGATAGCCCGCGGATGTTTGCTGGCCCATTACCTACCGGCCTCT Fragment Length Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Humbol dt Galapag os African Adelie Emperor 35 bp 30 bp 25 bp 20 bp 15 bp 10 bp 5 bp Sample 1: _________________________ Sample 2: _________________________ Sample 3: _________________________ Sample 4: _________________________ Sample 5: _________________________ Sample 6: _________________________ Learn more about penguins at : https://seaworld.org/animals/all-about/penguins/appendix/ Little Blue