SNC2D8A-F2021A
Criterion A: K and U
First and Last Name: ________________________
Biology Unit Test
/42 Criterion B: I and D
/16
True/False
1. Indicate whether the statement is true or false. If you think the statement is false, rewrite it to make it true. (5)
____
1. Mitosis is a process where a single cell divides into two identical daughter cells.
____
2. Water enters the plant through the process of transpiration.
____
3. The mouth breaks down food in one way: mechanically.
____
4. Cancer cells divided more frequently than normal cells.
____
5. Epithelial cells act by shortening or lengthening.
Matching
2. Identify the human organ system that best matches the function described. (5)
a. circulatory
g. endocrine
b. digestive
h. reproductive
c. respiratory
i. integumentary
d. excretory
j. nervous
e. immune
k. skeletal
f. muscular
____
1. creates a waterproof barrier
____
2. produces and releases hormones
____
3. defends the body from infections
____
4. supports the body and helps to move it
____
5. helps move parts of the body
SNC2D8A-F2021A
First and Last Name: ________________________
3. Match each of the images on the left with a description from the list on the right. (5)
____1.
A. Nerve cell
B. Red blood cell
____ 2.
C. Plant Tissue – vascular bundle
D. Cardiac muscle tissue
____3.
E. Bone cell
F. Fat (adipose) tissue
____4.
G. Plant Tissue – leaf cross - section
H. Epidermis Tissue
____5.
I. Ground Tissue
4. Fill in the blanks regarding blood circulation through the heart. (5)
Blood that returns from the body is _______________________ blood. The right ventricle pumps blood
through the _______________________ to the __________________. There the blood eliminates
________________________ and picks up ______________________.
SNC2D8A-F2021A
First and Last Name: ________________________
Short Answer Questions
1. Indicate the number of bonds between the different nucleotides in DNA and write the corresponding base pairs
(only letters) for the following DNA template strand (4)
A
T
G
C
GCTACGGAATATAGCCTTATGCGCCTTGTATGATT
2. The three different plants below grow in three different environments:
∙
∙
∙
Passion fruits grow in tropical rain forests.
Buffalo grass grows in grassland areas.
Desert willows grow in desert environments.
Water vapour can escape through openings in the leaves.
Name this opening and suggest which plant will have the fewest of them. Give a reason for your choice. (4)
3. All plants must perform photosynthesis. What materials are needed for this process? Describe the process
how the plant obtains these materials? (3)
SNC2D8A-F2021A
First and Last Name: ________________________
4. Use a flowchart and diagram to describe how a handful of berries become nutrients for all your cells to use.
(5)