Unit 7 Study Guide 1. __________ make up all living materials. 2. Proteins are composed of ______________, there are about _______ different types. 3. Proteins are manufactured by the _____________ 4. List the 4 functions of proteins: 5. What is the first step of protein synthesis? 6. ____________ of genetic information from DNA to RNA is called ______________ 7. DNA is too ________ to leave the nucleus, but RNA can leave the nucleus because it is ________________ 8. Part of DNA temporarily __________ and is used as a template to assemble complementary _____________ into __________RNA. 9. mRNA goes through the pores of the __________ with the DNA code and attaches to the ____________. 10. What is the second step called of protein synthesis? 11. Decoding of mRNA into a ___________ is called ____________. 12. _____________ carries amino acids from the ___________ to the ribosome. 13. Amino acids come from the ______________. 14. Proteins we eat are _____________ into individual amino acids and then simply _______________ into new proteins according to the needs and directions of our _______. 15. A series of ______ adjacent bases in a mRNA molecule codes for a specific amino acid called a ________ 16. Each tRNA codes for a __________ amino acid. 17. mRNA carries the ____ instructions and tRNA carries __________ to meet in the ribosomes. 18. Amino acids are _________ together to make a protein. 19. The shape of a DNA molecule is usually described as a _____________ 20. The result of translation is the formation of ____________. 21. Transcription goes from _____ to ______ and translation goes from ______ to _______. 22. Which suspect is the culprit? 23. List the base pairs for DNA and RNA. 24. Given the DNA sequence, find the mRNA sequence. ATGCGATCGATGGCCAATT 25. Given a mRNA sequence, find the tRNA sequence. AGUCACUGGAUCAAUCAUC 26. Given a tRNA sequence, find the amino acids for each codon. (3 letters = a codon) AUGACCUACCAAGAUGUCUAA 27. Given a DNA sequence, determine the mRNA, tRNA and amino acids. DNA: A T G T T T C A C A G U U A G mRNA: tRNA: amino acid: