Name___________________________ Date______________________ Penney LE 8 DNA “Fingerprinting” Lab Background: Gel Electrophoresis is a DNA tool used in many different situations. One reason for the DNA tool is to prove who the father of a child is during a paternity test. Gel electrophoresis can also be used to isolate genes. This is helpful in determining if an individual has a specific gene that makes them prone to a disease like cancer. Lastly, Gel electrophoresis can be used as a way of DNA “fingerprinting”. Scientists can use the test to compare DNA found at a crime scene with that of several suspects. The more similarities that appear, the more likely the suspect committed the crime. Restriction enzymes are used to “cut” the DNA sequence at specific spots. Every individual has a different DNA sequence, so the DNA strand of several individuals will be cut at different lengths. The Story: Natalie Johnson was a 19 year old college student. Natalie majored in Psychology at Mount Saint Mary’s College. Natalie paid for college by working in the campus clinic, filing paperwork where she had access to personal records. Natalie was at the top of her class, her boyfriend was the captain of the soccer team, and she had just joined a sorority. One night, Natalie’s roommate reported that Natalie had not returned home after her shift at the clinic. Professors admitted to not seeing Natalie in class for the next few days. Three days after Natalie’s roommate reported her missing, Natalie’s body was found in the woods surrounding the college campus. Natalie had been beaten and strangled to death. Investigators collected as much evidence as possible. There were signs of struggle, but investigators only found blood from Natalie. Investigators went on to search Natalie and the surrounding areas for DNA other than Natalie’s. They were in luck. Whoever killed Natalie left behind traces of DNA on her skin and clothes. The only problem? Who would do this to a young, well-liked college student. Suspects and motives included: The Roommate, Kelly White: Natalie had accidentally spilled coffee on her research project, ruining it. The Boyfriend, Jacob Stinson: Rumors that he had been physically abusive lately Patient at Clinic: Sarah Jones: Claims Natalie had stolen her personal file and was using it to black male Sarah. Professor Paul Adams: Admitted that Natalie caught him drinking alcohol at work and threatened to tell the dean. Name___________________________ Date______________________ Penney LE 8 Investigators gathered DNA from each of the suspects and performed a DNA “fingerprint” test to find the killer. The DNA of each suspect was put in a test tube with a restriction enzyme. The particular enzyme “cut” DNA strands between the A and T in the sequence AATT. Your Job: Use the following DNA strands to find the killer. Fill in the table to support your decision. DNA Kelly White: TCGAATTCGTACTGATAATTCGTACGAATTCGAATT Jacob Stinson: CAATTCGATGTAATTTGCAGATGTAATTCGAATTGCC Sarah Jones: ATGAATTCGTAATTCACTGCTTAATTCGTGATAATTA Paul Adams: AATAATTATGGATCG CTAATTCTACGATAATTCCGTC Name___________________________ Date______________________ Bands Murderer Kelly Penney LE 8 Jacob Sarah Paul 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Analysis Questions 1. Who was the murderer? How can you tell? 2. What else (other than DNA “Fingerprinting” ) can this test be used for? 3. What is used to “cut” the DNA sequences? Name___________________________ Date______________________ Penney LE 8 4. Which test do you think would be more reliable, DNA “Fingerprinting,” or Blood Typing? Explain your reasoning using your knowledge of Biology. 5. How are the DNA segments separated during Gel Electrophoresis?