The Commission on Higher Education
in collaboration with the Philippine Normal University
Teaching Guide for Senior High School
GENERAL
BIOLOGY 1
SPECIALIZED SUBJECT | ACADEMIC-STEM
This Teaching Guide was collaboratively developed and reviewed by
educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at k12@ched.gov.ph. We value your feedback and
recommendations.
Development Team
Team Leaders: Florencia G. Claveria, Ph.D.,
Dawn T. Crisologo
Writers: Doreen D. Domingo, Ph.D., Aileen C. dela
Cruz, Chuckie Fer A. Calsado, Doreen D.
Domingo, Janet S. Estacion, Justin Ray M. Guce,
Mary Jane C. Flores, Nolasco H. Sablan
Technical Editors: Annalee S. Hadsall, Ph.D.
Published by the Commission on Higher Education, 2016
Chairperson: Patricia B. Licuanan, Ph.D.
Copy Reader: Caroline H. Pajaron
Commission on Higher Education
K to 12 Transition Program Management Unit
Office Address: 4th Floor, Commission on Higher Education,
C.P. Garcia Ave., Diliman, Quezon City
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz
Illustrator: Ma. Daniella Louise F. Borrero
Senior High School Support Team
CHED K to 12 Transition Program Management Unit
Program Director: Karol Mark R. Yee
Consultants
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY.
University President: Ester B. Ogena, Ph.D.
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D.
Ma. Cynthia Rose B. Bautista, Ph.D., CHED
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University
Carmela C. Oracion, Ph.D., Ateneo de Manila University
Minella C. Alarcon, Ph.D., CHED
Gareth Price, Sheffield Hallam University
Stuart Bevins, Ph.D., Sheffield Hallam University
Lead for Senior High School Support:
Gerson M. Abesamis
Lead for Policy Advocacy and Communications:
Averill M. Pizarro
Course Development Officers:
John Carlo P. Fernando, Danie Son D. Gonzalvo
Teacher Training Officers:
Ma. Theresa C. Carlos, Mylene E. Dones
Monitoring and Evaluation Officer:
Robert Adrian N. Daulat
Administrative Officers:
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City,
ectec_com@yahoo.com
This Teaching Guide by the
Commission on Higher Education is
licensed under a Creative
Commons AttributionNonCommercial-ShareAlike 4.0
International License. This means
you are free to:
Share — copy and redistribute the
material in any medium or format
Adapt — remix, transform, and
build upon the material.
The licensor, CHED, cannot revoke
these freedoms as long as you
follow the license terms. However,
under the following terms:
Attribution — You must give
appropriate credit, provide a link to
the license, and indicate if changes
were made. You may do so in any
reasonable manner, but not in any
way that suggests the licensor
endorses you or your use.
NonCommercial — You may not use
the material for commercial
purposes.
ShareAlike — If you remix,
transform, or build upon the
material, you must distribute your
contributions under the same license
as the original.
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1
DepEd General Biology 1 Curriculum Guide . . . . . . . . . . . . . 5
Chapter 3: Energy Transformation
Chapter 1: Cell
Lesson 11: Photosynthesis and Cellular Respiration . . . . . . . . . . .
86
Lesson 1: The Cell: Endomembrane System, Mitochondria,
99
Chloroplasts, Cytoskeleton, and Extracellular Components . . .
9
Lesson 12: Forms of Energy, Laws of Energy Transformation
and Role of ATP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Lesson 2: Mitochondria and Chloroplasts . . . . . . . . . . . . . . . . .
15
Lesson 13: Energy Transformation Part 1 . . . . . . . . . . . . . . . . . . . . 111
Lesson 14: Energy Transformation Part 2 . . . . . . . . . . . . . . . . . . . . 120
Lesson 3: Structure and Functions of Animal Tissues and Cell
Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
28
Lesson 15: Energy Transformation Part 3 . . . . . . . . . . . . . . . . . . . . 128
Lesson 4: Cell Cycle and Cell Division . . . . . . . . . . . . . . . . . . . . 36
Lesson 16: Cellular Respiration Part 1 . . . . . . . . . . . . . . . . . . . . . .
133
Lesson 5: Transport Mechanisms Part 1 . . . . . . . . . . . . . . . . . . . 46
Lesson 17: Cellular Respiration Part 2 . . . . . . . . . . . . . . . . . . . . . .
150
Lesson 6: Transport Mechanisms Part 2 . . . . . . . . . . . . . . . . . . . 50
Lesson 18: Cellular Respiration Part 3 . . . . . . . . . . . . . . . . . . . . . .
165
Chapter 2: Biological Molecules
Lesson 19: ATP in Cellular Metabolism and Photosynthesis . . . . .
176
Lesson 7: Carbohydrates and Lipids . . . . . . . . . . . . . . . . . . . . .
57
Lesson 8: Amino Acids and Proteins Part 1 . . . . . . . . . . . . . . . .
70
Lesson 9: Amino Acids and Proteins Part 2 . . . . . . . . . . . . . . . .
73
Lesson 10: Biological Molecules: Enzymes . . . . . . . . . . . . . . . .
78
Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
Introduction
As the Commission supports DepEd’s implementation of Senior High School (SHS), it upholds the vision
and mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
Education Act of 2013, that “every graduate of basic education be an empowered individual, through a
program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.”
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with
appropriate methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards deeper
content areas and competencies. Thus, the introduction of the SHS for SHS Framework.
SHS for SHS
Framework
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at the
core of this book. The lessons, which combine high-quality content with flexible elements to
accommodate diversity of teachers and environments, promote these three fundamental concepts:
SAYSAY: MEANING
HUSAY: MASTERY
SARILI: OWNERSHIP
Why is this important?
How will I deeply understand this?
What can I do with this?
Through this Teaching Guide,
teachers will be able to facilitate
an understanding of the value
of the lessons, for each learner
to fully engage in the content
on both the cognitive and
affective levels.
Given that developing mastery
goes beyond memorization,
teachers should also aim for
deep understanding of the
subject matter where they lead
learners to analyze and
synthesize knowledge.
When teachers empower
learners to take ownership of
their learning, they develop
independence and selfdirection, learning about both
the subject matter and
themselves.
About this
Teaching Guide
Biology I is a Science, Technology, Engineering and Mathematics (STEM) Specialized Subject
taken in the first half of Grades 11/12. Learners go on a journey geared toward the deeper
understanding and appreciation of life processes at the cellular and molecular levels
previously introduced in Grades 7-10. They will also apply basic chemistry and physics
principles as they examine the transformation of energy in organisms.
Implementing this course at the senior high school level is subject to numerous challenges
with mastery of content among educators tapped to facilitate learning and a lack of
resources to deliver the necessary content and develop skills and attitudes in the learners,
being foremost among these.
In support of the SHS for SHS framework developed by CHED, these teaching guides were
crafted and refined by biologists and biology educators in partnership with educators from
focus groups all over the Philippines to provide opportunities to develop the following:
1.
Saysay through meaningful, updated, and context-specific content that highlights
important points and common misconceptions so that learners can connect to their realworld experiences and future careers;
2.
Husay through diverse learning experiences that can be implemented in a resourcepoor classroom or makeshift laboratory that tap cognitive, affective, and psychomotor
domains are accompanied by field-tested teaching tips that aid in facilitating discovery and
development of higher-order thinking skills; and
3.
Sarili through flexible and relevant content and performance standards allow
learners the freedom to innovate, make their own decisions, and initiate activities to fully
develop their academic and personal potential.
These ready-to-use guides are helpful to educators new to either the content or biologists
new to the experience of teaching Senior High School due to their enriched content
presented as lesson plans or guides. Veteran educators may also add ideas from these
guides to their repertoire. The Biology Team hopes that this resource may aid in easing the
transition of the different stakeholders into the new curriculum as we move towards the
constant improvement of Philippine education.
2
Parts of the
Teaching Guide
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
innovative pedagogies. All of these elements are presented in the following parts:
1.
•
•
•
•
•
2.
•
•
•
•
3.
•
•
•
•
4.
•
•
•
•
5.
•
•
•
•
6.
•
•
Introduction
Highlight key concepts and identify the essential questions
Show the big picture
Connect and/or review prerequisite knowledge
Clearly communicate learning competencies and objectives
Motivate through applications and connections to real-life
Motivation
Give local examples and applications
Engage in a game or movement activity
Provide a hands-on/laboratory activity
Connect to a real-life problem
Instruction/Delivery
Give a demonstration/lecture/simulation/hands-on activity
Show step-by-step solutions to sample problems
Give applications of the theory
Connect to a real-life problem if applicable
Practice
Discuss worked-out examples
Provide easy-medium-hard questions
Give time for hands-on unguided classroom work and discovery
Use formative assessment to give feedback
Enrichment
Provide additional examples and applications
Introduce extensions or generalisations of concepts
Engage in reflection questions
Encourage analysis through higher order thinking prompts
Evaluation
Supply a diverse question bank for written work and exercises
Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of
the Senior High School program, it is of paramount importance to
align Functional Skills set by DepEd with the College Readiness
Standards stated by CHED.
On the other hand, the Commission declared the College
Readiness Standards that consist of the combination of knowledge,
skills, and reflective thinking necessary to participate and succeed without remediation - in entry-level undergraduate courses in
college.
The DepEd articulated a set of 21st century skills that should be
embedded in the SHS curriculum across various subjects and tracks.
These skills are desired outcomes that K to 12 graduates should
possess in order to proceed to either higher education,
employment, entrepreneurship, or middle-level skills development.
The alignment of both standards, shown below, is also presented in
this Teaching Guide - prepares Senior High School graduates to the
revised college curriculum which will initially be implemented by AY
2018-2019.
College Readiness Standards Foundational Skills
DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1.
2.
3.
4.
5.
Solid grounding on Philippine experience and culture;
An understanding of the self, community, and nation;
Visual and information literacies, media literacy, critical thinking
Application of critical and creative thinking and doing processes;
and problem solving skills, creativity, initiative and self-direction
Competency in formulating ideas/arguments logically, scientifically, and creatively; and
Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and a
diverse world;
Systematically apply knowledge, understanding, theory, and skills for the development of
the self, local, and global communities using prior learning, inquiry, and experimentation
Global awareness, scientific and economic literacy, curiosity,
critical thinking and problem solving skills, risk taking, flexibility
and adaptability, initiative and self-direction
Work comfortably with relevant technologies and develop adaptations and innovations for
significant use in local and global communities
Global awareness, media literacy, technological literacy,
creativity, flexibility and adaptability, productivity and
accountability
Communicate with local and global communities with proficiency, orally, in writing, and
through new technologies of communication
Global awareness, multicultural literacy, collaboration and
interpersonal skills, social and cross-cultural skills, leadership
and responsibility
Interact meaningfully in a social setting and contribute to the fulfilment of individual and
shared goals, respecting the fundamental humanity of all persons and the diversity of
groups and communities
Media literacy, multicultural literacy, global awareness,
collaboration and interpersonal skills, social and cross-cultural
skills, leadership and responsibility, ethical, moral, and spiritual
values
4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12
Subject Title: Biology I
Quarters: 1st to 2nd Quarter
No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly life processes at the cellular
and molecular levels. It also covers the transformation of energy in organisms.
Content
Cell
Content Standard
The learners demonstrate an
understanding of:
1. Cell Theory
2. Cell Structure and
Functions
3. Prokaryotic vs Eukaryotic
Cells
4. Cell Types
5. Cell Modifications
Performance Standard
The learners shall be able
to:
1. construct a 3D model of
a plant/animal/
bacterial cell using
recyclable materials
2. construct a cell
membrane model from
indigenous or recyclable
materials
6. Cell Cycle
a. Mitosis
b. Meiosis
Learning Competencies
The learners...
1. explain the postulates of the cell theory
STEM_BIO11/12
-Ia-c-1
2. describe the structure and function of major and
subcellular organelles
STEM_BIO11/12
-Ia-c-2
3. distinguish prokaryotic and eukaryotic cells according to
their distinguishing features
STEM_BIO11/12
-Ia-c-3
4. classify different cell types (plant/animal tissues) and
specify the function(s) of each
STEM_BIO11/12
-Ia-c-4
5. describe some cell modifications that lead to adaptation
to carry out specialized functions (e.g., microvilli, root
hair)
STEM_BIO11/12
-Ia-c-5
1. characterize the phases of the cell cycle and their control
points
STEM_BIO11/12
-Id-f-6
2. describe the stages of mitosis/meiosis given 2n=6
STEM_BIO11/12
-Id-f-7
STEM_BIO11/12
-Id-f-8
STEM_BIO11/12
-Id-f-9
3. discuss crossing over and recombination in meiosis
4. explain the significance or applications of mitosis/meiosis
7. Transport Mechanisms
a. Simple Diffusion
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
Code
5. identify disorders and diseases that result from the
malfunction of the cell during the cell cycle
STEM_BIO11/12
-Id-f-10
1. describe the structural components of the cell
STEM_BIO11/12
-Ig-h-11
Page 1 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Content
Content Standard
Performance Standard
b. Facilitated Transport
c. Active Transport
d. Bulk/Vesicular
Transport
Biological
Molecules
Learning Competencies
membrane
Structures and Functions of
Biological Molecules
- Carbohydrates
- Lipids
- Proteins
- Enzymes
- Nucleic Acids
2. relate the structure and composition of the cell
membrane to its function
STEM_BIO11/12
-Ig-h-12
3. explain transport mechanisms in cells (diffusion osmosis,
facilitated transport, active transport)
STEM_BIO11/12
-Ig-h-13
4. differentiate exocytosis and endocytosis
STEM_BIO11/12
-Ig-h-14
1. categorize the biological molecules(lipids, carbohydrates,
proteins, and nucleic acids) according to their structure
and function
STEM_BIO11/12
-Ii-j-15
2. explain the role of each biological molecule in specific
metabolic processes
STEM_BIO11/12
-Ii-j-16
3. describe the components of an enzyme
STEM_BIO11/12
-Ii-j-17
STEM_BIO11/12
-Ii-j-18
4. explain oxidation/reduction reactions
Energy
Transformation
1. ATP- ADP Cycle
2. Photosynthesis
3. Respiration
Code
prepare simple fermentation
setup using common fruits
to produce wine or vinegar
via microorganisms
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
5. determine how factors such as pH, temperature, and
substrate affect enzyme activity
STEM_BIO11/12
-Ii-j-19
1. explain coupled reaction processes and describe the role
of ATP in energy coupling and transfer
STEM_BIO11/12
-IIa-j-1
2. describe the major features and chemical events in
photosynthesis and respiration
STEM_BIO11/12
-IIa-j-2
3. explain the importance of chlorophyll and other
pigments
STEM_BIO11/12
-IIa-j-3
4. describe the patterns of electron flow through light
reaction events
STEM_BIO11/12
-IIa-j-4
5. describe the significant events of the Calvin cycle
STEM_BIO11/12
-IIa-j-5
Page 2 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Content
Content Standard
Performance Standard
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
Learning Competencies
Code
6. differentiate aerobic from anaerobic respiration
STEM_BIO11/12
-IIa-j-6
7. explain the major features and sequence the chemical
events of cellular respiration
STEM_BIO11/12
-IIa-j-7
8. distinguish major features of glycolysis, Krebs cycle,
electron transport system, and chemiosmosis
STEM_BIO11/12
-IIa-j-8
9. describe reactions that produce and consume ATP
STEM_BIO11/12
-IIa-j-9
10. describe the role of oxygen in respiration and describe
pathways of electron flow in the absence of oxygen
STEM_BIO11/12
-IIa-j-10
11. compute the number of ATPs needed or gained in
photosynthesis and respiration
STEM_BIO11/12
-IIa-j-11
12. explain the advantages and disadvantages of
fermentation and aerobic respiration
STEM_BIO11/12
-IIa-j-12
Page 3 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Code Book Legend
Sample: STEM_BIO11/12-IIa-j-12
LEGEND
SAMPLE
Learning Area and Strand/ Subject or
Specialization
Science, Technology, Engineering and
Mathematics
Grade Level
Grade 11 or 12
Domain/Content/
Component/ Topic
General Biology
First Entry
Uppercase Letter/s
STEM_BIO11/12
Roman Numeral
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate
more than a specific week
Quarter
Second Quarter
II
Week
Weeks one to ten
a-j
-
Arabic Number
Competency
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
explain the advantages and disadvantages
of fermentation and aerobic respiration
12
Page 4 of 4
General Biology 1
60 MINS
The Cell: Endomembrane System, Mitochondria,
Chloroplasts, Cytoskeleton, and Extracellular Components
Content Standards
The learners demonstrate an understanding of (1) Composition of the
endomembrane system; (2) Structure and function of organelles involved in
energy transformation; (3) Structure and functions of the cytoskeleton; and, (4)
Composition and functions of the extracellular components or matrix.
Performance Standards
The learners shall be able to construct three-dimensional models of whole cells
using indigenous or recyclable materials. The models shall show the following
cell parts: (1) Endomembrane System, (2) Mitochondria, and (3) Chloroplast
Learning Competencies
The learners: (1) explain the postulates of the cell theory (STEM_BIO11/12-1ac-1); (2) describe the structure and function of major and subcellular organelles
(STEM_BIO11/12-Ia-c-2); (3) describe the structural components of the cell
membrane (STEM_BIO11/12-Ig-h-11); and (4) relate the structure and
composition of the cell membrane to its function (STEM_BIO11/12-Ig-h-12)
Specific Learning Outcomes
At the end of the unit lesson, the learners shall be able to:
•
•
•
•
•
illustrate the structure of the endomembrane system, label its parts, and
understand how the system works
illustrate the structure of the mitochondria, label its parts, and understand
the importance of the enfolding of the inner mitochondrial membrane
illustrate the structure of the chloroplast, label its parts, and relate these
parts to photosynthesis
understand the connection of the endomembrane system to other cell
parts such as the lysosomes, peroxisomes, endosomes, and cell membrane
understand how the extracellular components or matrix determine the
appearance and function of the tissues
LESSON OUTLINE
Introduction Review on the differences between
5
prokaryotic and eukaryotic cells; submission
and discussion of responses to the pre-topic
homework assigned before the lecture.
Motivation
5
Brief class activity on prokaryotic and
eukaryotic cells.
Instruction/ Lecture. Board work on cell parts, structure,
Practice
and function. Examination of cheek cells and
40
Hydrilla cells under a microscope. Class
activity on identifying the parts and functions
of the endomembrane system.
Enrichment Class discussion on cell size and relationship
of surface area and volume
Evaluation
Assessment of learners’ knowledge;
assignment of homework for next lecture
Materials
microscope (slide, cover slip), hand-held
lens, work books, methylene blue, plastic
spoon/popsicle stick, Hydrilla plansts,
colored chalk/white board marker
5
5
Resources (continued at the end of Teaching Guide)
(1) (n.d.). Retrieved from <http://www.phschool.com/science/
biology_place/biocoach/cells/common.html>
(2) (n.d.). Retrieved from <http://biology.tutorvista.com/animal-and-plant(3) (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-thecell-as-a-system/>
INTRODUCTION (5 MINS)
Teacher Tip
1. Ask the learners to make a recap of the differences between prokaryotic and eukaryotic cells.
2. Discuss the learners’ responses to the pre-topic assignment on the functions of the following cell
parts:
• Nucleus
The review on the differences between
prokaryotic and eukaryotic cells is needed
to connect prerequisite knowledge to the
present lesson. Remind the learners that the
cell parts are found in eukaryotic cells.
Remind the learners of the pre-topic
assignment that shall be submitted before
the lecture. This is to ensure the learners
read on the topic before the lecture.
• Smooth Endoplasmic Reticulum
• Rough Endoplasmic Reticulum
• Golgi Apparatus
• Ribosomes
Briefly discuss the structure of the cell
membrane in order to provide basic
knowledge on said structure to the learners.
Do not fully elaborate on this topic since the
structure and function of the cell membrane
shall further be discussed in the succeeding
parts of the lesson.
• Lysosomes
• Mitochondria
• Chloroplast
3. Present an overview of the cell membrane, its structure, and functions.
4. Define what an ‘organelle’ is and differentiate membrane-bound organelles from non-membranebound organelles.
5. Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The
compartmentalization of the cell into membrane-bound organelles:
• allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur
simultaneously without interference from each other
• separates the DNA material of the nucleus, mitochondria, and chloroplast
• increases the surface area-volume ratio of the cell
6. Encourage the learners to look at the cell as both a system and subsystem. They should develop an
understanding of how the parts of a cell interact with one another and how these parts help to do the
‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-asa-system/>)
10
The cell’s parts should be discussed as a
system, emphasizing on the
interconnectedness of each part to the
others.
To clarify common misconceptions,
emphasize the following to the learners:
• Not all organelles are surrounded by a
membrane.
• The plasma or cell membrane is different
from the cell wall.
• Not all cell parts are present in all kinds of
cells.
MOTIVATION (5 MINS)
Briefly review the differences between prokaryotic and eukaryotic cells by asking questions to the
learners.
Sample question: What cell parts can be found in both prokaryotic and eukaryotic cells? Discuss
the function/s of each part.
Sample Responses:
•
DNA
•
Cell membrane
•
Protoplasm (nucleoloid region and cytosol)
•
Ribosomes
Compare the cell to a big city. Ask the learners what the requirements of the city would be in order for
it to function. Relate these requirements to the parts of the cell. Relate the learners’ responses to the
functions of the different parts of a cell.
Sample responses:
•
The city will need power. What generates power for the city? Relate this to the function of
the mitochondria and the chloroplast.
•
The city generates waste. How does it minimize its waste? How does the city handle its
garbage? Relate this to the function of the lysosome.
•
The city requires raw materials to process into food, clothing, and housing materials. Where
are these raw materials processed? Relate this to the functions of the Golgi Apparatus.
Compare animal cells from plant cells. For the animal cells, scrape cheek cells using a toothpick. Ask
the learners to place the scrapings on a microscope slide and add a drop of water to the scrapings.
Tease the scrapings into a thin layer and cover with a slip. Examine under HPO. Instruct the learners to
draw the cells on their workbooks and to label the cell parts that they were able to observe under the
microscope.
For the plant cells, instruct the learners to obtain a Hydrilla leaf and place it on a microscope slide.
Examine under LPO. Ask the learners to draw the cells on their workbooks and to label the cell parts
that they were able to observe under the microscope.
Teacher tip
If the number of available microscopes is
limited, ask the learners to group
themselves according to the number of
microscopes available or set-up a
demonstration scope for the whole class
and facilitate the examination of cells so
that all the learners will get a chance to
observe the cells under the microscope.
Orient the learners on the proper use and
care of the microscopes, particularly on
focusing first on LPO before shifting to
HPO.
Cheek cells are very transparent. Adjust the
iris diaphragm or add a small amount of dye
(i.e., methylene blue) to the scrapings.
The learners will only see the cell membrane
and the nucleus. Remind the learners to
draw what they observe. Students may
observe cytoplasmic streaming in the plant
cell.
INSTRUCTION/PRACTICE (30 MINS)
1. Draw the cell membrane on one end of the board.
2. Draw the double membrane of the nucleus (nuclear membrane) on the other end of the board.
3. From the nuclear membrane, draw the reticulated structure of the endoplasmic reticulum. Ask the
learners what the two types of endoplasmic reticulum are and their corresponding functions.
4. Draw the ribosomes as separate units.
5. Draw a DNA and an mRNA. Explain that the mRNA is a copy of the DNA that will be sent to the
cytoplasm for protein synthesis.
6. Explain to the learners that the mRNA leaves the nucleus and goes to where the ribosomes are
located (i.e., mRNA + functional ribosome)
7. Explain the possible ‘pathways’ for protein synthesis (e.g., within the cytosol or the endoplasmic
reticulum)
8. Draw the mRNA + functional ribosome on the endoplasmic reticulum. With a lot of these, the
endoplasmic reticulum becomes a rough endoplasmic reticulum.
9. Draw the formed polypeptide inside the rough endoplasmic reticulum. Discuss the formation of a
cisternae and pinching off as a vesicle.
10. Draw the Golgi Apparatus and then a vesicle from the rough endoplasmic reticulum that travels to
the Golgi Apparatus and attaches to the part which is nearest the rough endoplasmic reticulum.
11. Ask the learners what the function of the Golgi Apparatus is. Synthesize their answers and compare
the Golgi Apparatus to a factory with an assembly manufacturing line.
12. Draw the polypeptide travelling along the Golgi Apparatus stack; pinching off as a vesicle to travel
to the next stack. Repeat the process while increasing the complexity of the polypeptide drawing.
13. On the last stack, explain the ‘pathways’ that the vesicle may follow: become a lysosome through
fusion with an endosome (i.e., formed by endocytosis), or travel to the cell membrane, fuse with it,
and empty its contents.
14. Present the composition of the endomembrane system and discuss how these parts are connected
to each other by structure and by function.
15. Draw the mitochondria and label its parts. Explain the importance of the enfolding (cristae) in
increasing the surface area of the inner mitochondrial membrane. Further explain to the class that
Teacher tip
Use chalk or white board markers with
different colors. Explain the structure and
function of each cell part as you draw them.
Explain to the learners that a more detailed
discussion of the structure and functions of
the cell membrane, mitochondria, and
chloroplast will be given in succeeding
lessons.
enfolding is a common structural strategy to increase surface area. As an example, you may draw a
cross-sectional structure of the small intestine.
16. Draw the chloroplast and label its parts. Explain the function that each part performs in the process
of photosynthesis.
17. Discuss the similarities of the mitochondria and chloroplast (e.g., both are involved in energy
transformation, both have DNA, high surface area, and double membranes).income accounts and
lastly, expenses accounts.
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to
his/her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
ENRICHMENT (30 MINS)
Facilitate a class discussion on why cells are generally small in size. Explain the relationship between
surface area and volume.
EVALUATION (60 MINS
Ask questions to the learners. Sample questions can be found in the following electronic resources:
Teacher tip
• (n.d.). Retrieved from< http://www.proprofs.com/quiz-school/story.php?title=cell-structure-test >
• (n.d.). Retrieved from< http://study.com/academy/exam/topic/cell-biology.html>
Assign a research assignment on this question: How do environmental toxins like lead and mercury
affect the functions of the cell? The assignment shall be submitted one week after this lesson.
Assignments should be handwritten.
RESOURCES (CONTINUED):
(4) (n.d.). Retrieved from <http://www.schools.manatee.k12.fl.us/072JOCONNOR/celllessonplans/
lesson_plan__cell_structure_and_function.html>
(5) (n.d.). Retrieved from <http://www.phschool.com/science/biology_place/biocoach/cells/endo.html>
(6) (n.d.). Retrieved from <http://study.com/academy/lesson/the-endomembrane-system-functionscomponents.html>
(7) (n.d.). Retrieved from <http://www.ncbi.nlm.nih.gov/books/NBK26907/>
(8) (n.d.). Retrieved from <http://staff.um.edu.mt/acus1/01Compart.pdf>
This strategy is aimed at ensuring that the
learners have read the topic rather than just
copying and printing from a source.
ASSESSMENT
Learning Competency
Assessment Tool
Exemplary
Learner was able to
Learner
participation (during answer all the question/s
without referring to his/
1. describe the structure and lecture)
her notes
function of major and
The learners shall be able
to:
subcellular organelles
(STEM_BIO11/12-Ia-c-2)
The learners shall be able
to:
2. describe the structural
components of the cell
membrane
(STEM_BIO11/12-Ig-h-11)
The learners shall be able
to:
3. relate the structure and
composition of the cell
membrane to its function
(STEM_BIO11/12-Ig-h12)
Assignment
Learner submitted an
assignment beyond the
requirements
Learner was able to
Learner
participation (during concisely answer all the
questions
practice)
Satisfactory
Developing
Learner was able to answer
the main question without
referring to his/her notes
but was not able to answer
follow-up question/s
Learner was able to
answer the questions
but he/she referred
to his/her notes
(1) Learner was not
able to answer the
question/s
Learner submitted a
comprehensive and wellwritten assignment
Learner submitted a
well written report
but some responses
lack details
(1) Learner did not
submit an assignment
Learner was able to answer
the main question without
referring to his/her notes
but was not able to answer
follow-up question/s
Learner was able to
answer the questions
but he/she referred
to his/her notes
Learner submitted drawings
that fulfilled the
requirements (complete
and detailed)
Learner submitted
drawings that were
incomplete
(1) Learner was not
able to submit
drawings
(2) Learner’s drawings
were haphazardly
done
Learner obtained less
that 50% correct
answers in the
examination
Laboratory
(Examination of
Animal and Plant
Cells)
Learner submitted
drawings that were
beyond the requirements
Examination
Learner obtained 90% to
100% correct answers in
the examination
Learner obtained 70% to
89.99% correct answers in
the examination
Learner obtained
50% to 69.99%
correct answers in the
examination
Research
Assignment
Learner submitted a
research assignment
beyond the requirements
Learner submitted a
comprehensive and wellwritten research assignment
Learner submitted a
well written report
but some responses
lack details
14
Beginnning
(2) Learner read notes
of his/her classmate
(2) Learner submitted
a partially-finished
assignment
(1) Learner was not
able to answer the
question/s
(2) Learner read notes
of his/her classmate
(1) Learner did not
submit an assignment
(2) Learner submitted
a partially-finished
assignment
General Biology 1
60 MINS
Mitochondria and Chloroplasts
Content Standards
LESSON OUTLINE
The learners demonstrate an understanding of the structure and function of the
mitochondria and chloroplasts, the organelles involved in energy
Introduction Review of relevant terminologies and
definitions
transformation.
5
Performance Standards
The learners shall be able to construct three-dimensional models of whole cells
using indigenous or recyclable materials. These models should show the
mitochondria and chloroplasts.
Motivation
Instruction/ Discussion and lecture proper
Delivery
30
Learning Competencies
The learners describe the structure and function of major and subcellular
organelles (STEM_BIO11/12-Ia-c-2) and distinguish prokaryotic and eukaryotic
cells according to their distinguishing features (STEM_BIO11/12 -Ia-c-3)
Practice
10
5
Understanding of key concepts using real-life
situations
Drawing (with label) activity
Enrichment Computation of surface area vs volume
5
Evaluation
5
Answering practice questions and homework
Resources (continued at the end of Teaching Guide)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
illustrate the structure of the mitochondria, label its parts, and understand
the importance of the enfolding of the inner mitochondrial membrane
illustrate the structure of the chloroplast, label its parts, and relate these
parts to photosynthesis
(1) http://scienceaid.co.uk/biology/biochemistry/atp.html
(2) http://www.britannica.com/list/6-cell-organelles)
(3) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
(4) http://www.britannica.com/list/6-cell-organelles
(5) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
(6) http://biology.tutorvista.com/animal-and-plant-cells/chloroplasts.html
(7) ttp://www.nature.com/scitable/topicpage/mitochondria-14053590
INTRODUCTION (5 MINS)
Facilitate a review of the following concepts:
•
•
•
•
•
Differences between prokaryotic and eukaryotic cells
Definition of an ‘organelle’
Differences between membrane-bound organelles and non-membrane-bound organelles
Functions of the different parts of a cell
The endomembrane system
MEMBRANE-BOUND ORGANELLES
NON-MEMBRANE-BOUND ORGANELLES
Nucleus
Ribosomes
Smooth ER
Centrioles
Rough ER
Cytoskeleton
Golgi Apparatus
Vacuoles and Vesicles
Mitochondria
Chloroplast and other plastids
Lysosomes
Peroxisomes
Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The compartmentalization of the cell into
membrane-bound organelles:
•
•
•
allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur simultaneously without interference from
each other
separates the DNA material of the nucleus, mitochondria, and chloroplast
increases the surface area-volume ratio of the cell
16
Encourage the learners to look at the cell as both a system and subsystem. They should develop an
understanding of how the parts of a cell interact with one another and how these parts help to do the
‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-asa-system/>)
Emphasize to the learners that energy transformation is one of the characteristics of life. This refers to
the ability to obtain and use energy. This characterizes the main function of the mitochondria and the
chloroplasts.
MOTIVATION (5 MINS)
Ask the learners how they understand the concept of compartmentalization. Relate the concept to how
the cell is compartmentalized into organelles.
Compare compartmentalization to the division of a house into a receiving room or sala, kitchen, dining
room, comfort rooms, bedrooms, etc.
Teacher tip
Ask the learners why they think a house is divided into several rooms.
A possible response is that partitioning of the house into different parts facilitates the simultaneous
occurrence of several activities without interfering with one another. Also, materials needed for each
activity can be stored at their specific areas. For example, pots and pans are being stored in the kitchen
and not in the bedroom. Beds and pillows are found in the bedroom and not in the toilet/bath.
Explain to the learners that the mitochondria and chloroplasts have a small amount of DNA. Although
most of the proteins of these organelles are imported from the cytosol and are thus programmed by
the nuclear DNA, their DNA programs the synthesis of the proteins made on the organelles’ ribosomes
(Source: Campbell et al). Compartmentalization separates the DNA material of the nucleus,
mitochondria, and chloroplast.
Ask the learners if they have experienced going to a city/municipal hall and if they have observed that
the Mayor, Vice-Mayor, and the City/Municipal Administrator have separate offices. You can use other
examples such as the University President, VP for Academic Affairs, VP for Finance; Philippine
President, Vice President, Senators, etc.
Compare the nuclear DNA to the Mayor and the mitochondrial DNA and chloroplast DNA to the Vice
Explain to the learner that this is how the
cell is able to allow conflicting functions
(e.g., synthesis vs breakdown) and several
cellular activities to occur simultaneously
without interference from each other.
Mayor. The Mayor runs the city/municipality but the Vice Mayor also performs functions that are
specific to their positions. They need different offices (or compartments) to avoid conflict in their
functions.
Teacher tip
Select a fruit that can be easily peeled like
calamansi or dalandan
Introduce the concept of surface area-volume ratio/relationship to the learners. Show a fruit to the
learners and explain that the outer surface of the fruit is the surface area. Peel the fruit and show them
what’s inside, explaining that the inside of the fruit is the volume.
Explain to the learners that surface area (SA) and volume (V) do not increase in the same manner. As an
object increases in size, its volume increases as the cube of its linear dimensions while surface area
increases as the square of its linear dimensions.
Example: If the initial starting point is the same: SA = 2; Volume = 2 (Ratio = 1:1)
A one-step increase will result to: SA = 22 = 4 while V = 23 = 8 (Ratio = 1:2)
Teacher tip
Ask questions to the learners while giving
the lecture.
INSTRUCTION/DELIVERY (30 MINS)
Explain and discuss the nature and functions of the Adenosine Triphosphate (ATP) to the learners.
Adenosine Triphosphate (ATP)—It is the major energy currency of the cell that provides the energy for
most of the energy-consuming activities of the cell. The ATP regulates many biochemical pathways.
Mechanism: When the third phosphate group of ATP is removed by hydrolysis, a substantial amount of
free energy is released.
ATP + H2O → ADP + Pi where ADP is adenosine diphosphate and Pi is inorganic phosphate
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to his/
her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
18
If an LCD projector is not available, draw
the structure of the mitochondria and
chloroplast on the board.
Illustration 1: Energy release in Hydrolysis (Source: (n.d.). Retrieved from http://scienceaid.co.uk/biology/biochemistry/atp.html)
Illustration 2: Chemical Energy and ATP (Source: (n.d.). Retrieved from http://winklebiology.weebly.com/chemical-energyatp.html)
Synthesis of ATP
• ADP + Pi → ATP + H2O
• requires energy: 7.3 kcal/mole
• occurs in the cytosol by glycolysis
•
•
occurs in mitochondria by cellular respiration
occurs in chloroplasts by photosynthesis
Consumption of ATP
ATP powers most energy-consuming activities of cells, such as:
•
•
•
•
•
•
•
•
anabolic (synthesis) reactions, such as:
joining transfer RNAs to amino acids for assembly into proteins
synthesis of nucleoside triphosphates for assembly into DNA and RNA
synthesis of polysaccharides
synthesis of fats
active transport of molecules and ions
conduction of nerve impulses
maintenance of cell volume by osmosis
•
addition of phosphate groups (phosphorylation) to different proteins (e.g., to alter their activity in cell
signaling)
•
•
•
muscle contraction
beating of cilia and flagella (including sperm)
bioluminescence
Extracellular ATP
In mammals, ATP also functions outside of cells. ATP is released in the following examples:
•
•
•
•
from damaged cells to elicit inflammation and pain
from the carotid body to signal a shortage of oxygen in the blood
from taste receptor cells to trigger action potentials in the sensory nerves leading back to the brain
from the stretched wall of the urinary bladder to signal when the bladder needs emptying
In eukaryotic cells, the mitochondria and chloroplasts are the organelles that convert energy to other
forms which cells can use for their functions.
Discuss the function and structure of the mitochondria.
20
Mitochondria (singular, mitochondrion)—Mitochondria are the sites of cellular respiration, the
metabolic process that uses oxygen to drive the generation of ATP by extracting energy from sugars,
fats, and other fuels.
The mitochondria are oval-shaped organelles found in most eukaryotic cells. They are considered to be
the ‘powerhouses’ of the cell. As the site of cellular respiration, mitochondria serve to transform
molecules such as glucose into an energy molecule known as adenosine triphosphate (ATP). ATP fuels
cellular processes by breaking its high-energy chemical bonds. Mitochondria are most plentiful in cells
that require significant amounts of energy to function, such as liver and muscle cells.
Figure 1: Structure of the Mitochonsdria (Source: (n.d.). Retrieved from http://www.britannica.com/list/
6-cell-organelles)
The mitochondria has two membranes that are similar in composition to the cell membrane:
•
•
Outer membrane—is a selectively permeable membrane that surrounds the mitochondria. It is the
site of attachment for the respiratory assembly of the electron transport chain and ATP Synthase. It
has integral proteins and pores for transporting molecules just like the cell membrane
Inner membrane—folds inward (called cristae) to increase surfaces for cellular metabolism. It
contains ribosomes and the DNA of the mitochondria. The inner membrane creates two enclosed
spaces within the mitochondria:
• intermembrane space between the outer membrane and the inner membrane; and
• matrix that is enclosed within the inner membrane.
Ask questions to the learners on the structure of the mitochondria. A sample question could be: What
is the importance of the enfolding of the mitochondria? The response would be to increase the surface
area that can be ‘packed’ into such a small space.
Discuss the purpose of the mitochondrial membranes.
22
As mentioned, the mitochondria has two membranes: the outer and inner mitochondrial membranes.
•
•
Outer Membrane
• fully surrounds the inner membrane, with a small intermembrane space in between
• has many protein-based pores that are big enough to allow the passage of ions and
molecules as large as a small protein
Inner membrane
• has restricted permeability like the plasma membrane
• is loaded with proteins involved in electron transport and ATP synthesis
• surrounds the mitochondrial matrix, where the citric acid cycle produces the electrons that
travel from one protein complex to the next in the inner membrane. At the end of this
electron transport chain, the final electron acceptor is oxygen, and this ultimately forms
water (H20). At the same time, the electron transport chain produces ATP in a process called
oxidative phosphorylation
During electron transport, the participating protein complexes push protons from the matrix out to the
intermembrane space. This creates a concentration gradient of protons that another protein complex,
called ATP synthase, uses to power synthesis of the energy carrier molecule ATP.
Figure 4: The Electrochemical Proton Gradient and the ATP Synthase (Source: (n.d.). Retrieved from
http://www.nature.com/scitable/topicpage/mitochondria-14053590)
Explain and discuss the structure and functions of the Chloroplasts.
Chloroplasts—Chloroplasts, which are found in plants and algae, are the sites of photosynthesis. This
process converts solar energy to chemical energy by absorbing sunlight and using it to drive the
synthesis of organic compounds such as sugars from carbon dioxide and water.
The word chloroplast is derived from the Greek word chloros which means ‘green’ and plastes which
means ‘the one who forms’. The chloroplasts are cellular organelles of green plants and some
eukaryotic organisms. These organelles conduct photosynthesis. They absorb sunlight and convert it
into sugar molecules. They also produce free energy stored in the form of ATP and NADPH through
photosynthesis.
Chloroplasts are double membrane-bound organelles and are the sites of photosynthesis. The
22
Teacher tip
Lecture on mitochondrial membranes can
be accessed at (n.d.). Retrieved from
<http://www.nature.com/scitable/
topicpage/mitochondria-14053590>.
chloroplast has a system of three membranes: the outer membrane, the inner membrane, and the
thylakoid system. The outer and the inner membranes of the chloroplast enclose a semi-gel-like fluid
known as the stroma. The stroma makes up much of the volume of the chloroplast. The thylakoid
system floats in the stroma.
Structure of the Chloroplast
•
•
•
•
•
Outer membrane—This is a semi-porous membrane and is permeable to small molecules and ions
which diffuse easily. The outer membrane is not permeable to larger proteins.
Intermembrane Space—This is usually a thin intermembrane space about 10-20 nanometers and is
present between the outer and the inner membrane of the chloroplast.
Inner membrane—The inner membrane of the chloroplast forms a border to the stroma. It
regulates passage of materials in and out of the chloroplast. In addition to the regulation activity,
fatty acids, lipids and carotenoids are synthesized in the inner chloroplast membrane.
Stroma—This is an alkaline, aqueous fluid that is protein-rich and is present within the inner
membrane of the chloroplast. It is the space outside the thylakoid space. The chloroplast DNA,
chloroplast ribosomes, thylakoid system, starch granules, and other proteins are found floating
around the stroma.
Thylakoid System
The thylakoid system is suspended in the stroma. It is a collection of membranous sacks called
thylakoids. Thylakoids are small sacks that are interconnected. The membranes of these thylakoids are
the sites for the light reactions of the photosynthesis to take place. The chlorophyll is found in the
thylakoids. The thylakoids are arranged in stacks known as grana. Each granum contains around 10-20
thylakoids.
The word thylakoid is derived from the Greek word thylakos which means 'sack'.
Important protein complexes which carry out the light reaction of photosynthesis are embedded in the
membranes of the thylakoids.
The Photosystem I and the Photosystem II are
Teacher tip
If an LCD projector is not available, draw
the structure of the chloroplast on the
board.
Lecture on structure and functions of the
chloroplast can be accessed at (n.d.).
Retrieved from <http://
biology.tutorvista.com/animal-and-plantcells/chloroplasts.html>.
complexes that harvest light with chlorophyll and carotenoids. They
absorb the light energy and use it to energize the electrons.
The molecules present in the thylakoid membrane use the electrons
that are energized to pump hydrogen ions into the thylakoid space.
This decreases the pH and causes it to become acidic in nature. A
large protein complex known as the ATP synthase controls the
concentration gradient of the hydrogen ions in the thylakoid space
to generate ATP energy. The hydrogen ions flow back into the
stroma.
PRACTICE (10 MINS)
Thylakoids are of two types: granal thylakoids and stromal
thylakoids. Granal thylakoids are arranged in the grana. These
circular discs that are about 300-600 nanometers in diameter. The
stromal thylakoids are in contact with the stroma and are in the form
of helicoid sheets.
Group the learners into pairs. Ask one to draw the mitochondria and
label its parts while the other does the same for chloroplast. Once
done, the partners exchange tasks (i.e., the learner that drew the
mitochondria now does the same for the chloroplast).
The granal thylakoids contain only Photosystem II protein complex.
This allows them to stack tightly and form many granal layers with
granal membrane. This structure increases stability and surface area
for the capture of light.
Reproduce these diagrams without the labels and use these for the
class activity.
To demonstrate how folding increases surface area, ask the learners
to trace the edges of the outer membrane with a thread and
measure the length of the thread afterwards. Repeat the same for
the inner membrane. Compare the results and discuss how the
enfolding of the inner membrane increases surface area through
folding.
The Photosystem I and ATP synthase protein complexes are present
in the stroma. These protein complexes act as spacers between the
sheets of stromal thylakoids.
24
ENRICHMENT (30 MINS)
1. Using the figure below, ask learners to compute surface area vs. volume.
2. Draw the table on the board and instruct the learners to write their measurements.
Teacher tip
EVALUATION (60 MINS)
Ask the learners to answer practice questions on the following electronic resources:
•
•
•
•
•
Clarify to the learners the
misconception that the appearance of
organelles are static and rigid.
http://www.mcqbiology.com/2013/03/multiple-choice-questions-on_25.html#.Vl7Uq3YrLrc
http://www.uic.edu/classes/bios/bios100/summer2004/samples02.htm
http://www.tutorvista.com/content/science/science-i/fundamental-unit-life/question-answers-1.php
http://www.buzzfeed.com/kellyoakes/the-mitochondria-is-the-powerhouse-of-the-cell#.fajAl0b6o
http://global.oup.com/uk/orc/biosciences/cellbiology/wang/student/mcqs/ch10/
Possible responses to the homework (Source: Campbell et al, 10th Ed.):
They have double membranes and are not part of the endomembrane system.
Their shape is changeable.
They are autonomous (somewhat independent) organelles that grow and occasionally pinch in two,
thereby reproducing themselves.
• They are mobile and move around the cell along tracks of the cytoskeleton, a structural network of the
cell.
• They contain ribosomes, as well as multiple circular DNA molecules associated with their inner
membranes. The DNA in these organelles programs the synthesis of some organelle proteins on
ribosomes that have been synthesized and assembled there as well.
2. Give out the homework for next meeting.
•
•
•
What are the characteristics shared by these two energy transforming organelles?
Instruct the learners to write an essay on probable reasons for these the shared characteristics of the
mitochondria and the chloroplast. Learners shall submit a handwritten essay on the Endosymbiotic Theory
and how it explains the similarity between the mitochondria and chloroplast.
26
Teacher tip
Check the electronic resources on
Endosymbiotic Theory:
https://www.youtube.com/watch?
v=bBjD4A7R2xU (Endosymbiotic
Theory in plain English)
https://www.youtube.com/watch?v=FQmAnmLZtE
EVALUATION
Learning Competency
Assessment Tool
The learners shall be
able to describe the
following:
Learner
participation
(during lecture)
1. structure and
function of major and
subcellular organelles
(STEM_BIO11/12-Iac-2)
Assignment
Examination
Exemplary
Satisfactory
Developing
Learner was able to
answer all the question/
s without referring to
his/her notes
Learner was able to
answer the main question
without referring to his/
her notes but was not
able to answer follow-up
question/s
Learner was able to
answer the
questions but he/
she referred to his/
her notes
(1) Learner was not
able to answer the
question/s
Learner submitted an
assignment beyond the
requirements
Learner submitted a
comprehensive and wellwritten assignment
Learner submitted a
well written report
but some responses
lack details
(1) Learner did not
submit an
assignment
Learner obtained 70% to
89.99% correct answers
in the examination
Learner obtained
50% to 69.99%
correct answers in
the examination
Learner obtained
less that 50% correct
answers in the
examination
Learner submitted an
essay that was
comprehensive and wellwritten
Learner submitted a
well-written essay
some details are
lacking
(1) Learner did not
submit an essay
Learner obtained 90%
to 100% correct
answers in the
examination
Essay Assignment Learner submitted an
essay beyond the
requirements
Beginnning
(2) Learner read
notes of his/her
classmate
(2) Learner
submitted a
partially-finished
assignment
(2) Learner
submitted a
partially-finished
essay
General Biology 1
180 MINS
Structure and Functions of Animal Tissues
and Cell Modification
LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of animal tissues and cell
modification.
Introduction Communicating learning objectives to the
learners.
Performance Standard
Motivation
The learners shall be able to construct a three-dimensional model of the animal
tissue by using recyclable or indigenous materials.
Learning Competencies
The learners:
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
10
Instruction/ Review on the Hierarchy of Biological
Organisation and PTSF; Lesson on Animal
Delivery
95
Practice
Class Activity: Reporting on structure and
function of animal tissue or showing of
infomercial on diseases.
60
Evaluation
Class Quiz
10
Tissues and on Cell Modfication
• classify different cell types (plant/animal tissue) and specify the functions of
each (STEM_BIO11/12-Ia-c-4)
• describe some cell modifications that lead to adaptation to carry out
specialized functions (e.g., microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
•
Class Activity: Pinoy Henyo Classroom
Edition
5
Materials
present a five-minute report on how the structures of different animal
tissues define their function or show a two-minute infomercial about a
disease that is caused by animal tissue malfunction;
provide insights, offer constructive feedback, and note areas of
improvement on their classmates’ reports or infomercial
microscopes, LCD Projector (if available), laptop or computer
(if available), manila paper, cartolina, photos, images, or
illustrations of different types of tissues, drawing materials
(e.g. pens, pencils, paper, color pencils, etc.)
Resources (continued at the end of Teaching Guide)
(1) Reece JB, U. L., (2010). Campbell Biology 10th. San Francisco (CA).
28
INTRODUCTION (5 MINS)
Introduce the following learning objectives by flashing these on the board:
•
•
classify different cell types (plant/animal tissue) and specify the functions of each (STEM_BIO11/12Ia-c-4)
describe some cell modifications that lead to adaptation to carry out specialized functions (e.g.,
microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
Ask the learners to work in pairs and write the learning objectives using their own words.
MOTIVATION (10 MINS)
PINOY HENYO CLASSROOM EDITION
Divide the class into two groups.
Explain to the learners that instead of having the typical one-on-one Pinoy Henyo, only one
representative from each group shall be asked to go to the front and have the mystery word card on
his/her forehead. Only three words shall be allowed from the groups: “Oo”, “Hindi”, or “Pwede”.
Violation of the rules of the game (e.g., communicating the mystery word to the guesser) shall merit
corresponding penalties or disqualification. Assign three representatives per group to guess the
mystery words. Each guesser shall be given one minute and 30 seconds.
At the end of the activity, ask one or two learners what they think the learning objectives of the lesson
will be. Immediately proceed with the Introduction.
Teacher tip
For this particular lesson, start with the
Motivation first (i.e., class activity on Pinoy
Henyo Classroom Edition). After the game,
proceed to the Introduction by
communicating the learning objectives to
the learners.
For the part when the learners have to state
the learning objectives using their own
words, ask the learners to face their
seatmates and work in pairs. If the learners
are more comfortable in stating the learning
objectives in Tagalog or In their local
dialect, ask them to do so.
Teacher tip
Prior to this lesson, assign a reading
material or chapter for this topic. This shall
aid in the facilitation of the class activity.
In choosing the mystery words for the
game, do not limit yourself with the four
types of animal tissues. You may choose
terms that describe the tissue type or even
body parts wherein the tissues are located.
You may also include diseases that are
caused by certain malfunctions on the
tissues.
Make sure to mention the chosen mystery
words in the discussion. This shall help the
learners to understand the connection of
the game with the lesson.
Check how the class behaves during the
activity. If the learners get rowdy, you may
choose to stop the game. Make sure to
warn the learners of the consequences first
before the start of the activity.
INSTRUCTION/DELIVERY (95 MINS)
Teacher tip
Facilitate a five-minute review on the Hierarchy of Biological Organization and on the concept of “form
fits function”, the unifying theme in Biology.
Review on Hierarchy of Biological Organization
Do not use too much time for the review.
Just make sure to guide or lead the learners
in remembering past lessons. Provide clues
if necessary.
1. Discuss that new properties arise with each step upward the hierarchy of life. These are called
emergent properties.
2. Ask the class what the levels of biological organization are. The learners should be able to answer
this since this is just a review. In case the class does not respond to the question, you may facilitate
the discussion by mentioning the first level of the hierarchy.
3. Start with the cell since it is the most basic unit of life that shows all life properties.
cells
tissue organ
organ system
multicellular organism
Illustrate this by showing photos of the actual hierarchy using animals that are endemic in the
Philippines (e.g., pilandok, dugong, and cloud rat).
Review on the unifying theme in Biology: “form fits function”
1. Ask the class what the relation of form (structure) to function and vice versa is
2. Ask for examples of versaingit of life that shows all life properthe torpedo shape of the body of
dolphins (mammals with fishlike characteristics) and the bone structure and wing shape of birds in
relation to flying.
30
Teacher tip
For the review on “form fits function”, if the
class does not respond well, start giving
your own examples for the students to
figure out this unifying theme.
Make sure to relate structure to function.
Mention the role of fossils in determining
the habits of extinct animals. By doing this,
it shall establish a strong connection
between form and function and shall give
relevance on the study of this connection in
Biology. After this, you may now proceed to
the new topic on animal tissues.
Facilitate a class activity (i.e., observation of cells under a microscope) to illustrate that animals are
made up of cells. This shall be the foundation of the definition of and discussion on animal tissues. The
whole activity and discussion shall last for 90 minutes.
If microscopes are available for this activity, set up the equipment and the slides that were prepared
prior to the activity. Each slide should show one type of tissue (i.e., epithelial tissue, connective tissue,
muscle tissue, and nervous tissue). Make sure that the labels are covered because the learners will be
asked to name the tissues based on their observations during the discussion.
If there are no microscopes available for the activity, prepare cut-out images, photos, or illustrations
that show the different types of tissues (i.e., epithelial tissue, connective tissue, muscle tissue, and
nervous tissue). Make sure that the images, photos, or illustrations are not labeled because the learners
will be asked to name them.
Also, do not immediately identify the type of tissue based on the descriptions that you will be
presenting to the class. The learners will be asked to identify which among the slides under the
microscope or which image, photo, or illustration matches the description of the structure and function
that will be given during the discussion.
After the class activity, proceed with the actual lecture. If a computer, laptop, or projector is available,
show a PowerPoint presentation that shows the description and function of tissues. If there is no
available equipment, you may use flash cards or manila paper where description of structure and
function of the different tissue types are written down. Ask the learners which among the microscope
slides, image, photo, or illustration fits the given information on description and function. After the
learners’ responses, you can flash or show the next slide which shall reveal the image of the specimen
with the corresponding label or type of tissue.
Epithelial Tissue—This type of tissue is commonly seen outside the body as coverings or as linings of
organs and cavities. Epithelial tissues are characterized by closely-joined cells with tight junctions (i.e., a
type of cell modification). Being tightly packed, tight junctions serve as barriers for pathogens,
mechanical injuries, and fluid loss.
Teacher tip
If microscopes are available for this activity,
allot 20-30 minutes for the observation of
cells. If microscopes are not available, allot
only 10-15 minutes.
Prior to the activity, prepare the slides that
will be put under the microscopes. The
slides shall contain the different types of
tissue. Make sure to focus the slides so that
the learners can observe them clearly.
Give the learners enough time to observe
the specimens and then ask them to draw
on their notebooks what they were able to
observe under the microscopes. Encourage
the learners to write down the description
and function of the specific tissue type as
you go through the discussion.
If microscopes are not available and you
have shown photos, images, or illustrations
instead, ask the learners to draw them on
their notebooks and encourage them to
write down the description and function of
the specific tissue type as you go through
the discussion.
Teacher tip
Prepare the lecture in such a way that you
do not immediately reveal the label of the
images or the terms that are being
described. The learners should first be
asked to identify the images or slides that fit
the description of the structures and
functions. This will make the students more
engaged in the discussion. Always remind
the learners to take down notes while you
flash information for each tissue type.
Teacher tip
Cells that make up epithelial tissues can have distinct arrangements:
•
•
•
•
•
cuboidal—for secretion
simple columnar—brick-shaped cells; for secretion and active absorption
simple squamous—plate-like cells; for exchange of material through diffusion
stratified squamous—multilayered and regenerates quickly; for protection
pseudo-stratified columnar—single layer of cells; may just look stacked because of varying height;
for lining of respiratory tract; usually lined with cilia (i.e., a type of cell modification that sweeps the
mucus).
Figure 1: Epithelial Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.)
32
Take note that the part on cell modifications
is incorporated in the discussion on the
structure of the respective cells that make
up the tissue that is being discussed. Give
emphasis on the differences on the features
of the cells that make up the tissue type.
For examples or illustrations of the different
types of tissues, it is better to use an animal
that is endemic in the Philippines or in your
specific region so that the learners can
relate more in the discussion.
Connective Tissue—These tissues are composed of the
following:
BLOOD —made up of plasma (i.e., liquid extracellular matrix);
contains water, salts, and dissolved proteins; erythrocytes that
carry oxygen (RBC), leukocytes for defense (WBC), and platelets
for blood clotting.
CONNECTIVE TISSUE PROPER (CTP)—made up of loose
connective tissue that is found in the skin and fibrous connective
tissue that is made up of collagenous fibers found in tendons
and ligaments. Adipose tissues are also examples of loose
connective tissues that store fats which functions to insulate the
body and store energy.
CARTILAGE —characterized by collagenous fibers embedded
in chondroitin sulfate. Chondrocytes are the cells that secrete
collagen and chondroitin sulfate. Cartilage functions as cushion
between bones.
BONE —mineralized connective tissue made by bone-forming
cells called osteoblasts which deposit collagen. The matrix of
collagen is combined with calcium, magnesium, and phosphate
ions to make the bone hard. Blood vessesl and nerves are
found at a central canal surrounded by concentric circles of
osteons.
Figure 2: Connective Tissue (Source: Reece JB, U. L. (2010).
Campbell Biology 10th. San Francisco (CA):.)
Muscle Tissue—These tissues are composed of long cells called muscle
fibers that allow the body to move voluntary or involuntary. Movement
of muscles is a response to signals coming from nerve cells. In
vertebrates, these muscles can be categorized into the following:
• skeletal—striated; voluntary movements
• cardiac—striated with intercalated disk for synchronized heart
contraction; involuntary
• smooth—not striated; involuntary
Figure 3: Muscle Tissue (Source: Reece JB, U. L. (2010). Campbell
Biology 10th. San Francisco (CA):.)
Nervous Tissue—These tissues are composed of nerve cells called
neurons and glial cells that function as support cells. These neurons
sense stimuli and transmit electrical signals throughout the animal body.
Neurons connect to other neurons to send signals. The dendrite is the
part of the neuron that receives impulses from other neurons while the
axon is the part where the impulse is transmitted to other neurons.
Figure 4: Neurons and Glial Cells (Source: Reece JB, U. L. (2010). Campbell
Biology 10th. San Francisco (CA):.)
PRACTICE (60 MINS)
Divide the class into six groups. Four groups will be reporting on Animal Tissues while two groups will
be creating an infomercial on diseases caused by the malfunction of tissue types. Each infomercial
group shall cover two tissue types.
Each group will be given five minutes to report or show their infomercial. At the end of each
presentation, facilitate a five-minute critiquing of the presentation. Make sure to get feedbacks from
the learners and clarify misconceptions from the reports. The report or the infomercial on diseases shall
not be graded. These will be a kind of formative assessment.Group the learners into pairs. Ask one to
draw the mitochondria and label its parts while the other does the same for chloroplast. Once done,
the partners exchange tasks (i.e., the learner that drew the mitochondria now does the same for the
chloroplast).
EVALUATION (10 MINS)
Ask the learners to group themselves in pairs or in groups of threes. This will allow the learners to
discuss and decide among themselves. However, if a learner chooses to do this activity on his or her
own, he or she should be allowed to do so.
Ask the learners to briefly and clearly answer the following questions:
•
•
•
•
•
•
What is the importance of having a tissue level in the hierarchy of biological organization? (2 points)
What do the varying shapes and arrangement of epithelial tissue suggests? (2 points)
What is the general function of connective tissues? What function is common to all types of
connective tissues? (1 point)
Why are there voluntary and involuntary muscle tissue functions? (2 points)
What is the importance of glial cells in nervous tissues? (1 point)
Identify two cell modifications and describe their respective functions. (2 points)
Teacher tip
Group the learners before starting the
lesson. The reporting may be done the day
after finishing the discussion on Animal
Tissue Structure, Function, and Cell
Modification.
The reports may be presented using a table
which contains columns for tissue type, cell
structures that characterize the tissue, part
of the body where the tissue is located,
function, and importance.
Teacher tip
Assess if the learners are ready to answer
this individually. If they are not yet ready,
this activity can be done in pairs or in
groups of threes. Make sure that you
provide enough time for the group to
discuss their responses. Remind the learners
to answer briefly and clearly.
If you are not comfortable with this time of
exam, a multiple-choice type of evaluation
may also be prepared.
After getting the responses, you may get
feedback from the learners to see if all
members of each group helped or
participated in their small discussions to
answer the short quiz. You may ask learners
to rate the members of their group.
General Biology 1
90 MINS
Cell Cycle and Cell Division
Content Standard
The learners demonstrate an understanding of the cell cycle and cell division
(i.e., mitosis and meiosis).
LESSON OUTLINE
Introduction Presentation of a simplified life cycle of a
human being or plant
Motivation
Performance Standards
The learners shall be able to construct a three-dimensional model of the stages
or phases involved in the cell cycle using indigenous or recyclable materials.
Instruction/
The learners shall put emphasis on the identification of possible errors that may Delivery
happen during these stages.
Learning Competencies
The learners:
•
•
•
•
•
characterize the phases of the cell cycle and their control points (STEM_BIO11/12Id-f-6)
describe the stages of mitosis and meiosis given 2n=6 (STEM_BIO11/12-Id-f-7)
discuss crossing over and recombination in meiosis (STEM_BIO11/12-Id-f-8)
explain the significance or applications of mitosis/meiosis (STEM_BIO11/12-Id-f-9)
identify disorders and diseases that result from the malfunction of the cell during
the cell cycle (STEM_BIO11/12-Id-f-10)
Specific Learning Outcomes
• Identify and differentiate the phases of the cell cycle and their control
points
• describe and differentiate the stages of mitosis and meiosis given 2n=6
• discuss and demonstrate crossing over and recombination in meiosis
• explain the significance and applications of mitosis and meiosis
• construct a diagram of the various stages of mitosis and meiosis
• identify disorders and diseases that result from malfunctions in the cell
during the cell cycle
Practice
Video presentation of ‘Cell Cycle and Cell
Division’
60
Class activities or games such as Amazing
Race or Interphase, Mitosis, or Meiosis
Puzzle
10
and animal gametogenesis; Microscopic
examination of an onion root tip
Written or oral examination
5
5
Materials
photos of the life cycle or stages of eukaryotic organisms,
yarns of different thickness, cords, beads, coins, pens
Resources (continued at the end of Teaching Guide)
(1) Becker, W.M. (2000). The World of the Cell. Addison Wesley Longman
Inc., USA
(2) Mader, S.S. (2011).Biology 10th Ed. Mac Graw Hill Education, USA.
36
5
Lecture-discussion on the cell through the
use of a PowerPoint presentation, video, or
cell diagram on a Manila paper;
Demonstration of the processes inside the
cell using model materials (e.g., beads,
cords, yarn with different thickness, coins,
etc.); or, Summary of learners’ responses to
questions regarding the video on ‘Cell Cycle
and Cell Division’
Enrichment Video presentation or introduction on plant
Evaluation
5
INTRODUCTION (5 MINS)
Teacher tip
Introduce a simplified life cycle of a human being or plant. Let the learners identify the changes
throughout the different stages and how these organisms grow and develop.
Explain to the learners that these eukaryotic
organisms follow a complex sequence of
events by which their cells grow and divide.
This sequence of events is known as the Cell
Cycle.
You can show diagrams or illustrations that
demonstrate the growth or increase in the
number of organisms.
Figure 1: Life Cycle of Man and Higher Plants (Source: (n.d.). Retrieved from http://
www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/postmeio/)
MOTIVATION (5 MINS)
1. Play the video on ‘Cell Cycle and Cell Division’. This video can be accessed at http://
www.youtube.com/watch?v=Q6ucKWIIFmg.Divide the class into two groups.
2. Show diagrams of cell division in multicellular or eukaryotic organisms to the class.
38
Teacher tip
You can download the video prior to this
session or if internet connection is available
during class, you can just make use of the
hyperlink to play the video. To access the
video through the hyperlink, simply hold the
Control (Ctrl) Key on the keyboard and click
on the hyperlink.
You should ask the learners thoughtprovoking questions about the video and
relate it to the lesson.
INSTRUCTION/DELIVERY (30 MINS)
Teacher tip
Facilitate a lecture-discussion on the general concepts of cell division.
Cell Division—involves the distribution of identical genetic material or DNA to two daughter cells.
What is most remarkable is the fidelity with which the DNA is passed along, without dilution or error,
from one generation to the next. Cell Division functions in reproduction, growth, and repair.
Core Concepts:
•
•
•
•
•
•
•
•
•
•
All organisms consist of cells and arise from preexisting cells.
Mitosis is the process by which new cells are generated.
Meiosis is the process by which gametes are generated for reproduction.
The Cell Cycle represents all phases in the life of a cell.
DNA replication (S phase) must precede mitosis so that all daughter cells receive the same
complement of chromosomes as the parent cell.
The gap phases separate mitosis from S phase. This is the time when molecular signals mediate the
switch in cellular activity.
Mitosis involves the separation of copied chromosomes into separate cells.
Unregulated cell division can lead to cancer.
Cell cycle checkpoints normally ensure that DNA replication and mitosis occur only when conditions
are favorable and the process is working correctly.
Mutations in genes that encode cell cycle proteins can lead to unregulated growth, resulting in
tumor formation and ultimately invasion of cancerous cells to other organs.
The Cell Cycle control system is driven by a built-in clock that can be adjusted by external stimuli (i.e.,
chemical messages).
Checkpoint—a critical control point in the Cell Cycle where ‘stop’ and ‘go-ahead’ signals can regulate
the cell cycle.
•
•
Animal cells have built-in ‘stop’ signals that halt the cell cycles and checkpoints until
overridden by ‘go-ahead’ signals.
Three major checkpoints are found in the G1, G2, and M phases of the Cell Cycle.
38
Note the learners’ responses to questions
about the video compared to the expected
responses. The expected responses are the
concepts listed in the Instruction / Delivery
part.
The G1 Checkpoint—the Restriction Point
•
•
•
•
The G1 checkpoint ensures that the cell is large enough to divide and that enough nutrients are available to support the
resulting daughter cells.
If a cell receives a ‘go-ahead’ signal at the G1 checkpoint, it will usually continue with the Cell Cycle.
If the cell does not receive the ‘go-ahead’ signal, it will exit the Cell Cycle and switch to a non-dividing state called G0.
Most cells in the human body are in the G0 phase.
The G2 Checkpoint—ensures that DNA replication in S phase has been successfully completed.
The Metaphase Checkpoint—ensures that all of the chromosomes are attached to the mitotic spindle by a kinetochore.
Kinase—a protein which activates or deactivates another protein by phosphorylating them. Kinases give the ‘go-ahead’ signals at the
G1 and G2 checkpoints. The kinases that drive these checkpoints must themselves be activated.
•
•
•
•
•
•
The activating molecule is a cyclin, a protein that derives its name from its cyclically fluctuating concentration in the cell.
Because of this requirement, these kinases are called cyclin-dependent kinases or CDKs.
Cyclins accumulate during the G1, S, and G2 phases of the Cell Cycle.
By the G2 checkpoint, enough cyclin is available to form MPF complexes (aggregations of CDK and cyclin) which initiate
mitosis.
MPF functions by phosphorylating key proteins in the mitotic sequence.
Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of cyclin.
CDK, the non-cyclin part of MPF, persists in the cell as an inactive form until it associates with new cyclin molecules
synthesized during the interphase of the next round of the Cell Cycle.
Discuss the stages of mitosis and meiosis.
Mitosis (apparent division)—is nuclear division; the process by which the nucleus divides to produce two new nuclei. Mitosis results in two
daughter cells that are genetically identical to each other and to the parental cell from which they came.
Cytokinesis—is the division of the cytoplasm. Both mitosis and cytokinesis last for around one to two hours.
Prophase—is the preparatory stage, During prophase, centrioles move toward opposite sides of the nucleus.
•
The initially indistinct chromosomes begin to condense into visible threads.
• Chromosomes first become visible during early prophase as long, thin, and
intertwined filaments but by late prophase, chromosomes are more compacted and
can be clearly discerned as much shorter and rod-like structures.
• As the chromosomes become more distinct, the nucleoli also become more
distinct. By the end of prophase, the nucleoli become less distinct, often
disappearing altogether.
Metaphase—is when chromosomes become arranged so that their centromeres become aligned in
one place, halfway between the two spindle poles. The long axes of the chromosomes are 90 degrees
to the spindle axis. The plane of alignment is called the metaphase plate.
Anaphase—is initiated by the separation of sister chromatids at their junction point at the centromere.
The daughter chromosomes then move toward the poles.
Telophase—is when daughter chromosomes complete their migration to the poles. The two sets of
progeny chromosomes are assembled into two-groups at opposite ends of the cell. The chromosomes
uncoil and assume their extended form during interphase. A nuclear membrane then forms around
each chromosome group and the spindle microtubules disappear. Soon, the nucleolus reforms.
Meiosis—reduces the amount of genetic information. While mitosis in diploid cells produces
daughter cells with a full diploid complement, meiosis produces haploid gametes or spores with only
one set of chromosomes. During sexual reproduction, gametes combine in fertilization to reconstitute
the diploid complement found in parental cells. The process involves two successive divisions of a
diploid nucleus.
First Meiotic Division
The first meiotic division results in reducing the number of chromosomes (reduction division). In most
cases, the division is accompanied by cytokinesis.
40
Teacher tip
You may show diagrams or a video
demonstrating animal and plant mitosis. The
video can be accessed at http://
www.vcbio.science.ru.nl/en/virtuallessons/
mitostage/
Prophase I—has been subdivided into five substages: leptonema, zygonema, pachynema, diplonema, and diakinesis.
•
•
•
•
•
Leptonema—Replicated chromosomes have coiled and are already visible. The number of chromosomes present is the same
as the number in the diploid cell.
Zygonema—Homologue chromosomes begin to pair and twist around each other in a highly specific manner. The pairing is
called synapsis. And because the pair consists of four chromatids it is referred to as bivalent tetrad.
Pachynema—Chromosomes become much shorter and thicker. A form of physical exchange between homologues takes
place at specific regions. The process of physical exchange of a chromosome region is called crossing-over. Through the
mechanism of crossing-over, the parts of the homologous chromosomes are recombined (genetic recombination).
Diplonema—The two pairs of sister chromatids begin to separate from each other. It is at this point where crossing-over is
shown to have taken place. The area of contact between two non-sister chromatids, called chiasma, become evident.
Diakinesis—The four chromatids of each tetrad are even more condensed and the chiasma often terminalize or move down
the chromatids to the ends. This delays the separation of homologous chromosomes.
In addition, the nucleoli disappear, and the nuclear membrane begins to break down.
Metaphase I—The spindle apparatus is completely formed and the microtubules are attached to the centromere regions of the homologues.
The synapsed tetrads are found aligned at the metaphase plate (the equatorial plane of the cell) instead of only replicated chromosomes.
Anaphase I—Chromosomes in each tetrad separate and migrate toward the opposite poles. The sister chromatids (dyads) remain attached at
their respective centromere regions.
Telophase I—The dyads complete their migration to the poles. New nuclear membranes may form. In most species, cytokinesis follows,
producing two daughter cells. Each has a nucleus containing only one set of chromosomes (haploid level) in a replicated form.
Second Meiotic Division
The events in the second meiotic division are quite similar to mitotic division. The difference lies, however, in the number of chromosomes that
each daughter cell receives. While the original chromosome number is maintained in mitosis, the number is reduced to half in meiosis.
Prophase II—The dyads contract.
Metaphase II—The centromeres are directed to the equatorial plate and then divide.
Anaphase II—The sister chromatids (monads) move away from each other and migrate to the opposite poles of the spindle fiber.
Telophase II—The monads are at the poles, forming two groups of chromosomes. A nuclear membrane forms around each set of chromosomes
and cytokinesis follows. The chromosomes uncoil and extend.
Cytokinesis—The telophase stage of mitosis is accompanied by cytokinesis. The two nuclei are
compartmentalized into separate daughter cells and complete the mitotic cell division process. In
animal cells, cytokinesis occurs by the formation of a constriction in the middle of the cell until two
daughter cells are formed. The constriction is often called cleavage, or cell furrow. However, in most
plant cells this constriction is not evident. Instead, a new cell membrane and cell wall are assembled
between the two nuclei to form a cell plate. Each side of the cell plate is coated with a cell wall that
eventually forms the two progeny cells.
Meiosis
Teacher tip
You can show a tabular comparison
between mitosis and meiosis to point the
significance of the two types of division.
Divide the class into two groups and ask
them about their opinions on the
applications of mitosis and meiosis.
The following could be possible responses:
Mitosis
1. Requires two nuclear divisions
1. Requires one nuclear division
2. Chromosomes synapse and cross
over
2. Chromosomes do not synapse nor cross
over
3. Centromeres survive Anaphase I
3. Centromeres dissolve in mitotic anaphase
4. Halves chromosome number
4. Preserves chromosome number
5. Produces four daughter nuclei
5. Produces two daughter nuclei
6. Produces daughter cells genetically
different from parent and each other
6. Produces daughter cells genetically
identical to parent and to each other
7. Used only for sexual reproduction
7. Used for asexual reproduction and
growth
Table 1: Comparison of Mitosis and Meiosis (Source: http://courses.washington.edu/bot113/spring/
WebReadings/PdfReadings/TABLE_COMPARING_MITOSIS_AND.pdf)
42
Significance of mitosis for sexual
reproduction: Mitosis is important for
sexual reproduction indirectly. It allows the
sexually reproducing organism to grow and
develop from a single cell into a sexually
mature individual. This allows organisms to
continue to reproduce through the
generations.
Significance of Meiosis and Chromosome
Number: Chromosomes are the cell's way
of neatly arranging long strands of DNA.
Non-sex cells have two sets of
chromosomes, one set from each parent.
Meiosis makes sex cells with only one set of
chromosomes. For example, human cells
have 46 chromosomes, with the exception
of sperm and eggs, which contain only 23
chromosomes each. When a sperm cell
fertilizes an egg, the 23 chromosomes from
each sex cell combine to make a zygote, a
new cell with 46 chromosomes. The zygote
is the first cell in a new individual.
Meiosis I compared to Mitosis
Meiosis II compared to Mitosis
Meiosis I
Mitosis
Meiosis II
Mitosis
Prophase I
Prophase
Prophase II
Prophase
Pairing of homologous
chromosomes
No pairing of
chromosomes
No pairing of
chromosomes
No pairing of
chromosomes
Metaphase I
Metaphase
Metaphase II
Metaphase
Bivalents at metaphase
plate
Duplicated
chromosomes at
metaphase plate
Haploid number of
duplicated
chromosomes at
metaphase plate
Diploid number
of duplicated
chromosomes at
metaphase plate
Anaphase I
Anaphase
Anaphase II
Anaphase
Homologues of each
bivalent separate and
duplicated
chromosomes move to
poles
Sister chromatids
separate, becoming
daughter
chromosomes that
move to the poles
Sister chromatids
separate, becoming
daughter
chromosomes that
move to the poles
Sister chromatids
separate
becoming
daughter
chromosomes
that move to the
poles
Telophase I
Telophase
Telophase II
Telophase
Two haploid daughter
cells not identical to the
parent cell
Two diploid
daughter cells,
identical to the
parent cell
Four haploid
daughter cells not
genetically identical
Two diploid
daughter cells,
identical to the
parent cell
Table 2: Meiosis compared to Mitosis
Facilitate a discussion on disorders and diseases that result from the malfunction of the cell during the
cell cycle. Present some diagrams or illustrations on some errors in mitosis and allow the learners to
predict possible outcomes, diseases, or disorders that may happen:
•
•
incorrect DNA copy (e.g., cancer)
chromosomes are attached to string-like spindles and begin to move to the middle of the cell (e.g.,
Down Syndrome, Alzheimer’s, and Leukemia)
Teacher tip
Significance of Meiosis for Diversity:
One of the benefits of sexual reproduction
is the diversity it produces within a
population. That variety is a direct product
of meiosis. Every sex cell made from meiosis
has a unique combination of chromosomes.
This means that no two sperm or egg cells
are genetically identical. Every fertilization
event produces new combinations of traits.
This is why siblings share DNA with parents
and each other, but are not identical to one
another.
Teacher tip
You may show a video that demonstrates
how crossing over and recombination of
chromosomes occur. The video can be
accessed at http://
highered.mheducation.com/sites/
9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html.s
Other chromosome abnormalities:
•
•
•
•
arise from errors in meiosis, usually meiosis I;
occur more often during egg formation (90% of the time) than during sperm formation;
become more frequent as a woman ages.
Aneuploidy—is the gain or loss of whole chromosomes. It is the most common chromosome
abnormality. It is caused by non-disjunction, the failure of chromosomes to correctly separate:
• homologues during meiosis I or
• sister chromatids during meiosis II
PRACTICE (10 MINS)
Facilitate games like Amazing Race, Interphase/Mitosis/Meiosis Puzzle in the class.
1. The Amazing Race follows a series of stations or stages with challenges that the learners have to
accomplish. Divide the class into groups after the discussion. The number of groups will depend on the
number of stages or phases in the process (i.e., interphase, mitosis, or meiosis).
Teacher tip
2. The groups will race to accomplish the tasks in five stations. In each station, the learners will assemble
given materials to illustrate stages or phases of events in the specific process (i.e., interphase, mitosis,
or meiosis).
Encourage the learners to actively
participate in the challenge. You may
give extra points to those who will
finish first.
ENRICHMENT (5 MINS)
A number of good videos have the
stages or phases made into a rap or a
song. One such example is the video
entitled Cell Division Song Spongebob
that can be accessed at
http://www.youtube.com/watch?
v=9nsRufogdoI. Encourage each group
to brainstorm and point out their
perceptions of the videos.
1. Instruct the learners to watch additional videos on cell division.
2. Introduce animal and plant gametogenesis to the learners in order for them to appreciate the
significance of cell division.
3. Facilitate microscopic examination of onion root tip.
EVALUATION (5 MINS)
Facilitate the accomplishment of a self-assessment checklist.
A video on animal and plant
gametogenesis can be accessed at
http://csls-text.c.u-tokyo.ac.jp/active/
12_05.html.
44
ADDITIONAL RESOURCES:
Books:
1. Raven, P. a. (2001). Biology 6th Ed. The McGraw Hill Company, USA
2. Reece, J. B. (2013). Campbell Biology, 10th Ed. Pearson Education, Inc. United States of America.
Electronic Resources:
3. (n.d.). Retrieved from Bright Hub Education: http://www.brighthubeducation.com/middle-school-science-lessons/94267-three-activities-forteaching-cell-cycles/#
4. (n.d.). Retrieved from http://www.uic.edu/classes/bios/bios100/lecturesf04am/lect16.htm
5. (n.d.). Retrieved from MH Education: http://highered.mheducation.com/sites/9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html
6. (n.d.). Retrieved from http://www.vcbio.science.ru.nl/en/virtuallessons/meiostage/
7. (n.d.). Retrieved from http://csls-text.c.u-tokyo.ac.jp/active/12_05.html
8. (n.d.). Retrieved from http://education.seattlepi.com/biological-significance-mitosis-meiosis-sexual-reproduction-5259.htm
General Biology 1
480 MINS
Transport Mechanisms Pt.1
LESSON OUTLINE
Content Standards
The learners demonstrate an understanding of Transport Mechanisms:
Introduction Visualization of the plasma membrane and its
Simple Diffusion, Facilitated Transport, Active Transport, and Bulk/Vesicular
Transport
Motivation
Simple group activity and brief reporting
Performance Standards
The learners shall be able to construct a cell membrane model from indigenous Instruction/ Discussion and lecture proper
Delivery
or recyclable materials.
Learning Competencies
The learners:
•
•
•
•
Practice
describe the structural components of the cell membrane
(STEM_BIO11/12–Ig-h-11)
relate the structure and composition of the cell membrane to its function
(STEM_BIO11/12-Ig-h-12)
explain transport mechanisms in cells (diffusion, osmosis, facilitated
transport, active transport) (STEM_BIO11/12–Ig-h-13)
differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
30
functions
60
120
45
Answering practice/guide questions
Enrichment Essay and concept map writing
Evaluation
Designing a model of a plasma
membrane using recyclable or
indigenous materials
45
180
Materials
pen, paper, salt, water, recycled or indigenous materials
describe and compare diffusion, osmosis, facilitated transport and active
transport
explain factors that affect the rate of diffusion across a cell membrane
predict the effects of hypertonic, isotonic, and hypotonic environments on
osmosis in animal cells
differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis
46
Resources
(1) Campbell, N. J. (n.d.).
(2) Campbell, N. e. (2008). Biology 8th edition. Pearson International
Edition. Pearson/Benjamin.
(3) Freeman, S. (2011). Biological Science 4th edition International Edition.
Benjamin Cummings Publishing.
(4) Hickman, C. L. (2011). Integrated Principles of Zoology 15th edition.
McGraw Hill Co., Inc.
INTRODUCTION (30 MINS)
1. Before this lesson, ask the learners to read about the topic on transport of materials across
membranes.
2. Introduce the topic by providing the learners with background information.
In order for the cell to stay alive, it must meet the characteristics of life which include taking
nutrients in and eliminating wastes and other by-products of metabolism. Several mechanisms allow
cells to carry out these processes. All of the cell’s activities are in one way or another tied to the
membrane that separates its interior from the environment.
3. Ask the learners how they understand and visualize a plasma membrane and what characteristics
are essential for it to perform its function.
4. Ask the learners to identify the different mechanisms on how materials are transported in and out of
the cell.
MOTIVATION (60 MINS)
1. Divide the learners into groups and ask them the following question: “What comes to your mind
when you see a 20 year old man who is 7.5 ft. tall and 3.5 ft. tall man of the same age?” Among
their respective groups, let the learners discuss the similarities and differences between the two.
(Hint: Give students a clue by giving them the giant and pygmy as examples).
2. Ask a representative from each group to report the result of their discussion to the whole class.
3. Before the start of the lesson on diffusion, spray an air freshener in one corner of the room and ask
the learners to raise their hands if they have smelled the scent of the spray.
4. Ask the learners what they have observed. Who smelled the scent first? Who are the last ones to
smell the scent? How would you explain the phenomenon wherein learners in the same classroom
smelled the spray at different times?
INSTRUCTION/DELIVERY (120 MINS)
1. Show an illustration of a plasma membrane to the learners.
2. Ask the learners to describe the plasma membrane.
3. Discuss the importance of the plasma membrane and how indispensable it is to the life of the cell.
4. Explain how plasma membranes are arranged in the presence of water.
5. Let the learners enumerate the structures found in a plasma membrane.
Teacher tip
Different responses to the question will be
drawn from students. Their responses will
depend on what aspect they are looking
into.
Acknowledge the responses of the learners.
Point out and explain that the two men are
both abnormal. Their growths are abnormal
such that one is too big in size and the
other one is too small. Both men have
defective membranes. Insufficient amount
of growth hormones pass through a
pygmy’s body while an excessive amount of
growth hormones is released in a giant.
6. Explain to the learners the structure of a phospholipid bilayer.
Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a result of the interaction between the
nonpolar phospholipid tails, the polar phospholipid heads, and the surrounding water. The nonpolar tails face toward the water.
Transmembrane proteins float within the bilayer and serve as channels through which various molecules can pass.
7. Ask the learners to enumerate the different transport
mechanisms.
interior to accommodate the natural inward movement. Most
plants are hypertonic with respect to their immediate
environment. Osmotic pressure within the cell pushes the
cytoplasm against the cell wall and makes a plant cell rigid.
8. Differentiate between diffusion and osmosis.
9. Compare and contrast facilitated diffusion and active transport.
10. Present photos of plant and animal cells immersed in an
isotonic, hypotonic, and hypertonic solution.
To control the entrance and exit of particular molecules,
selective transport of materials is necessary. One simple process
is facilitated diffusion that utilizes protein transmembrane
channels that are specific to certain molecules. It is a passive
process driven by the concentration of molecules both inside
and the outside of the membrane. Certain molecules are
transported in and out of the cell, independent of concentration.
This process requires the expenditure of energy in the form of
ATP and is called active transport.
11. Describe solution and solute movement in and out of the cell
under hypertonic, hypotonic, and isotonic conditions.
12. Explain the effects of the different solutions to the cells. Ask
which among the three solutions is the best for plants? How
about for animals? Explain to the learners the water requirement
in plants.
Diffusion is the natural tendency for molecules to move
constantly. Their movement is random and is due to the energy
found in the individual molecules. Net diffusion occurs when the
materials on one side of the membrane have a different
concentration than the materials on the other side.
13. Differentiate among endocytosis, phagocytosis, pinocytosis,
receptor-mediated endocytosis, and exocytosis.
Large molecules enter the cell by generalized nonselective
process known as endocytosis. Phagocytosis is endocytosis of a
particulate material while endocytosis of liquid material is called
pinocytosis. Exocytosis is the reverse process. Receptormediated endocytosis is a complicated mechanism involving the
transport of materials via coated vesicles.
Osmosis is a special type of diffusion specifically associated with
the movement of water molecules. Many cells are isotonic to the
environment to avoid excessive inward and outward movement
of water. Other cells must constantly export water from their
48
PRACTICE (45 MINS)
Ask the learners to answer the following practice or guide
questions:
•
•
•
•
What is the difference between diffusion and facilitated
diffusion?
How do endocytosis and exocytosis allow movement of
materials in and out of the cell?
What solution is best for a plant cell? How about for an animal
cell?
Explain the orientation of the phospholipid molecules in the
presence of water.
ENRICHMENT (45 MINS)
Let the learners recognize the effect of a defective membrane in
normal body functioning. Ask them to write an essay about the
possible effects of a faulty plasma membrane aside from the
examples given earlier.
Ask the learners to individually submit a concept map about plasma
membrane and the different transport mechanisms.
EVALUATION (180 MINS)
Ask the learners to design and a model of a plasma membrane
using recyclable or indigenous materials.
Divide the learners into groups and assign different concentrations
of salt solution to be used in making salted eggs.
Ask the learners to answer the following questions:
•
•
Why does putting salt on meat preserve it from bacterial
spoilage?
Compare specific transport processes (i.e., diffusion, osmosis,
facilitated transport, active transport, endocytosis, and
exocytosis) in terms of the following:
• concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
General Biology 1
240 MINS
Transport Mechanisms Pt.2
LESSON OUTLINE
Content Standard
Introduction Presentation of objectives and important terms;
Discussion on the structure of the plasma
The learners shall be able to construct a cell membrane model from indigenous
membrane; Brief discussion on the different
or recyclable materials.
15
transport mechanisms
Performance Standard
The learners shall be able to construct a cell membrane model from indigenous Motivation
or recyclable materials.
Learning Competencies
The learners:
•
•
•
•
describe the structural components of the cell membrane
(STEM_BIO11/12–Ig-h-11)
relate the structure and composition of the cell membrane to its function
(STEM_BIO11/12-Ig-h-12)
explain transport mechanisms in cells (diffusion, osmosis, facilitated
transport, active transport) (STEM_BIO11/12–Ig-h-13)
differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
•
•
•
describe the plasma membrane
explain how plasma membranes are arranged in the presence of water
understand the structure of the phospholipid bilayer
describe and compare diffusion, osmosis, facilitated transport and active
transport
explain factors that affect the rate of diffusion across a cell membrane
predict the effects of hypertonic, isotonic, and hypotonic environments on
osmosis in animal cells
differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis
Class activity to illustrate the process of diffusion;
Discussion of similarities between a giant and
pygmy; Demonstration of the principle behind the
process of making salted eggs
15
Instruction/
Delivery
Discussions, as a class and among groups, on the
structure and importance of the plasma
membrane and on the different transport
mechanisms
60
Practice
Answering of practice or guide questions
30
Enrichment
Essay writing or concept mapping; Class activity
on salted egg making
60
Evaluation
Construction of a plasma membrane model from
indigenous or recyclable materials; Concept
mapping on the different transport mechanisms;
Answering of questions for assessment
60
Materials
projector, laptop (if available), visual aids, school supplies, recycled or
indigenous materials
Resources
(1) Campbell, N.A. et. al. (2008). Biology 8th Edition Pearson International.
Pearson/Benjamin Cummings Publishing.
(2) Campbell, N. J. (2010). Biology 9th edition Pearson International Edition.
Benjamin Cummings Publishing.
(3) Freeman, S. (2011). Biological Science. 4th edition. International Edition.
Benjamin Cummings Publishing.
(4) Hickman, C. L. (2011). Integrated Principles of Zoology. 15th edition. McGraw
Hill Co., Inc.
50
INTRODUCTION (15 MINS)
Prior to this lesson, instruct the learners to read up on the transport of materials across membranes. Ask
the learners to identify the different mechanisms on how materials are transported in and out of the
cell.
Introduce the topic by providing the learners with background information.
In order for the cell to stay alive, it must meet the characteristics of life which include taking nutrients in
and eliminating wastes and other by-products of metabolism. Several mechanisms allow cells to carry
out these processes. All of the cell’s activities are, in one way or another, tied to the membrane that
separates its interior from the environment.
Ask the learners how they visualize a plasma membrane and what characteristics do they think are
essential for it to perform its function.
MOTIVATION (15 MINS)
Before the start of the lesson on diffusion, conduct this simple class activity. Spray an air freshener in
one corner of the room and instruct the learners to raise their hands if they have smelled the scent of
the spray.
Ask the learners the following questions:
• Who among the class were able to smell the air freshener first?
• Who among the class were the last ones to smell the air freshener?
• How would you explain the phenomenon wherein people in the same classroom smelled the
scent of the air freshener at different times?
Divide the learners into groups and ask them the question: What comes to your mind when you see
two men who are of the same age but one is 7.5 feet tall and the other is 3.5 feet tall?
Allow the learners to discuss the similarities and differences between the two among their groups.
Ask a representative from each group to present the results of their discussions to the whole class.
Teacher tip
After the learners have enumerated the
different transport mechanisms, ask them
why they think there is a need to have
different kinds of processes that allow
materials to be transported in and out of
the cell.
Learners will describe the plasma
membrane in different ways. Ask them how
they think the structures found within the
membrane help in performing its function
and what might happen in the absence of
the these structures
Teacher tip
Allow some time for the learners to smell
the spray until everyone has already smelled
the scent. Remember to instruct the
learners to raise their hand once they smell
the scent.
The learners might give varying responses
to the question depending on what aspect
they are looking into. Give hints by
providing the giant and pygmy as examples.
Acknowledge the learners’ responses and
point out that the two men are similar in the
sense that they are both abnormal. Growth
in both men is abnormal such that one is
too big in size while the other one is too
small.
Explain that both men have abnormal
growth. Both have defective membranes.
Insufficient amount of growth hormones
pass through a pygmy’s body while an
excessive amount of growth hormones is
released in a giant.
INSTRUCTION/DELIVERY (60 MINS)
Teacher tip
Structure, function and importance of the plasma membrane
1. Present an illustration of the plasma membrane to the class
2. Ask the learners to describe the plasma membrane.
3. Discuss the importance of the plasma membrane and how indispensable it is to the life of the cell.
4. Explain how plasma membranes are arranged in the presence of water.
5. Let students enumerate structures found in a plasma membrane.
6. Make students understand the structure of a phospholipid bilayer.
Plasma membranes—are made up of a phospholipid bilayer in an aqueous environment.
Phospholipids are the foundation of all known
biological membranes. The lipid bilayer forms as a
result of the interaction between the non-polar (hydrophobic or water-fearing)
phospholipid
tails, the polar (hydrophilic or water-loving) phospholipid heads, and the surrounding water.
The nonpolar tails face toward the water. Transmembrane proteins float within the bilayer and serve as
channels through which various
molecules can pass. They function as ‘identification tags’ on cells
which enable the cell to determine if the other cells that it encounters
are like itself or not. It also
permits cells of the immune system to accept and reject foreign cells such as disease-causing bacteria.
Many membrane proteins function as enzymes that speed up reactions in cells. Others act like paste or
glue-forming cell junctions where
adjacent cells stick together. Membranes also contain cholesterol
which reduces the cell’s permeability to substances and make the bilayer stronger.
Transport Mechanisms
1. Ask the learners to enumerate the different transport mechanisms.
2. Differentiate between diffusion and osmosis.
52
You can ask the following questions before
starting the discussion:
Have you realized how crucial the task of a
plasma membrane is in maintaining the life
of a cell?
Have you thought about the ways on how
the materials needed by the cell and the
wastes it needs to dispose are able to move
in and out of the plasma membrane?
Molecules and substances move in several ways that fall within two categories: passive transport and active transport. In passive transport,
heat energy of the cellular environment provides all of the energy, hence, this is not energy-costly to the cell. Active transport, however, requires
the cell to do work, requiring the cell to expend its energy reserves.
Diffusion is a type of passive transport described as the natural tendency for molecules to move constantly. Their movement is random and is
due to the energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different
concentration than the materials on the other side. Osmosis is a special type of diffusion specifically associated with the movement of water
molecules.
A solution with a higher concentration of solutes is said to be hypertonic while a solution with a lower concentration of solutes is hypotonic.
Water crosses the membrane until the solute concentrations are equal on both sides. Solutions of equal solution concentration are said to be
isotonic. This only occurs when the solute concentration are the same on both sides of the membrane.
Compare and contrast facilitated diffusion and active transport. Then present photos of plant and animal cells immersed in an isotonic,
hypotonic, and hypertonic solution. In addition, describe a solution and solute movement into and out of the cell under hypertonic, hypotonic
and isotonic conditions.
Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? For animals? Let them
understand water requirement in plants.
Many cells are isotonic to the environment in order to avoid excessive inward and outward movement of water. Other cells must constantly
export water from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate
environment. Osmotic pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
Ask the learners the following questions:
•
•
•
How do cells behave in different solutions?
What do you notice about the effect of different solutions to animal and plant cells?
What solution is best for an animal cell? Does this hold true with plant cells?
When an animal cell such as red blood cell is immersed in an isotonic solution, the cell gains water at the same rate that it loses it. The cell’s
volume remains constant in this situation.
What will happen to the red blood cell when immersed in a hypotonic solution which has a lower solute concentration than the cell? The cell
gains water, swells, and may eventually burst due to excessive water intake. When placed in a hypertonic solution, an animal cell shrinks and
can die due to water loss.
Water requirement for plant cells is different due to their rigid cell walls. A plant cell placed in an isotonic solution is flaccid and a plant wilts in
this condition. In contrast with animal cells, a plant cell is turgid and healthy in a hypotonic solution. In a hypertonic solution, a plant cell loses
water, shrivels, and its plasma membrane detaches from the cell wall. This situation eventually causes death in plant cells.
Differentiate diffusion from facilitated diffusion.
To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated diffusion
that utilizes protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration of
molecules on the inside and the outside of the membrane. Certain molecules are transported in and out of the cell, independent of
concentration. This process requires the expenditure of energy in the form of ATP and is called active transport.
Differentiate endocytosis, phagocytosis, pinocytosis, receptor-mediated endocytosis, and exocytosis.
Large molecules enter the cell by generalized non-selective process known as endocytosis. Phagocytosis is endocytosis of a particulate
material while pinocytosis is endocytosis of liquid material. In this process, the plasma membrane engulfs the particle or fluid droplet and
pinches off a membranous sac or vesicle with a particular fluid inside into the cytoplasm.
Exocytosis is the reverse process where a membrane-bound vesicle filled with bulky materials moves to the plasma membrane and fuses with
it. In this process, the vehicle’s contents are released out of the cell.
Receptor-mediated endocytosis is a complicated mechanism involving the transport of materials through coated vesicles. Cells take up
molecules more efficiently in this process due to the receptor proteins on their surfaces. Each receptor protein bears a binding site for a
particular molecule. If the right molecule contacts a receptor protein, it attaches to the binding site, forming a pocket and eventually pinching
off into the cytoplasm.
PRACTICE (30 MINS)
Ask the learners to answer the following questions:
•
•
Explain the orientation of the phospholipid molecules in the presence of water.
Enumerate the structures found in a plasma membrane and give the function of each.
54
•
•
•
•
•
•
How do diffusion and facilitated diffusion differ?
How do endocytosis and exocytosis allow movement of materials in and out of the cell?
What solution is best for a plant cell? How about for an animal cell?
Give two ways by which one could determine whether active transport is going on.
Compare and contrast the effects of hypertonic and hypotonic solutions on plant and animal cells.
What role do vacuoles play in endocytosis and exocytosis?
ENRICHMENT (60 MINS)
Essay writing and concept mapping
1. Ask the learners to write an essay about the possible effects of a faulty plasma membrane aside
from the examples given in the lesson. Let the learners recognize the effects of a defective membrane
to normal bodily functions.
2. Ask the learners to individually submit a concept map about the plasma membrane. You can provide
them with sample words for their concept map:
•
•
•
•
•
•
•
plasma membrane
semipermeable
phospholipid bilayer
hydrophilic heads
hydrophobic tails
cholesterol
membrane proteins
Teacher tip
For the concept mapping, you can provide
the learners with key words or allow them to
come up with their own key words for their
concept map.
Creating own saturated salt solution for salted egg-making
1. Divide the class into groups and assign different concentrations of salt solutions to be used in
making salted eggs.
2. Instruct the learners to make their own salt solutions and take note of the concentration that they opt
to use.
Teacher tip
Diffusion and osmosis are two processes
involved in making salted eggs. The salt
solution should be supersaturated in order
to produce good and delicious salted eggs.
EVALUATION (60 MINS)
Building of plasma membrane model
1. Divide the class into groups.
2. Ask the groups to design and build a model of a plasma membrane using recyclable or indigenous
materials.
Concept mapping
Ask the learners to individually submit a concept map about the different transport mechanisms. You
can provide them with sample words for their concept map or allow them to come up with their own:
• plasma membrane
• phagocytosis
• transport mechanisms
• pinocytosis
• passive transport
• receptor-mediated
endocytosis
• active transport
• diffusion
• hypotonic
• facilitated diffusion
• hypertonic
• endocytosis
• isotonic
• exocytosis
Assessment questions:
Instruct the learners to answer the following questions to assess their knowledge and understanding of
the lesson:
•
•
Why does putting salt on meat preserve it from spoilage by bacteria?
Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport, active transport,
endocytosis, and exocytosis) in terms of the following:
• concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
56
Teacher tip
You can provide the learners with key words
or allow them to come up with their own
key words for their concept map.
General Biology 1
Carbohydrates and Lipids:
Structures and Functions
of Biological Molecules
Content Standard
The learners demonstrate an understanding of the structures and functions of
carbohydrates and lipids and their roles in specific metabolic processes.
Performance Standard
The learners shall be able to explain the role and significance of carbohydrates
and lipids in biological systems.
Learning Competencies
The learners:
•
•
•
categorize the biological molecule as a carbohydrate or lipid according to
their structure and function (STEM_BIO11/12-Ii-j-15)
explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12-Ii-j-16)
detect the presence of carbohydrates and lipids in food products using
simple tests
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
120 MINS
LESSON OUTLINE
Introduction Presentation of learning objectives and
important terms; Discussion on dehydration
reactions and hydrolysis
Motivation
10
Relating the lessons to real-life situations;
Discussion on food as sources of energy and
building blocks
10
Instruction/ Discussion, as a class and among groups, on
Delivery/
the structure and importance of
Practice
carbohydrates and lipids.
60
Enrichment Laboratory activity on testing the
20
Evaluation
20
presence of carbohydrates and lipids on
common food products
Group activity on making molecular
models of carbohydrates and lipids
Materials
projector, laptop (if available), sample food labels, common
food or drink products (e.g. flour, cornstarch, cooking oil,
present simple molecular models of carbohydrates and lipids and relate the
food or drink brought by the learners
structure to the roles that these molecules play in biological systems
perform tests for the presence of starch and reducing sugars and lipids on
Resources
common food products
(1) Reece, J.U. (2011). Campbell Biology, 9th ed. San Francisco, CA:
Pearson Benjamin Cummings
INTRODUCTION (10 MINS)
Teacher tip
Communicate learning objectives and important terms
Prominently display the learning objectives
and important terms on one side of the
classroom and frequently refer to them
during the discussion. You may place a
check-mark beside a term in the wordlist
after defining it so that the learners have an
idea of their progress.
Introduce the following learning objectives using any of the suggested protocols (i.e., verbatim, own
words, or read-aloud)
•
•
•
I can distinguish a carbohydrate from a lipid given its chemical structure and function.
I can explain the roles played by carbohydrates and lipids in biological systems.
I can detect the presence of carbohydrates and lipids in food products using simple chemical tests.
Introduce the list of important terms that learners will encounter in this lesson:
• macromolecule
• cellulose
• polymer
• chitin
• monomer
• lipids
• dehydration reaction
• fat
• hydrolysis
• fatty acid
• carbohydrates
• triacylglycerol
• monosaccharides
• saturated fatty acid
• disaccharides
• unsaturated fatty acid
• glycosidic linkage
• trans fat
• polysaccharide
• phospholipids
• starch
• steroids
• glycogen
• cholesterol
MOTIVATION (10 MINS)
1. Divide the class into groups of three.
2. Distribute sample food or nutrition labels to each group and ask them if they know how to interpret
the information written on the food labels.
58
Each learner can also illustrate or define the
term on a sheet of paper which can be
tacked beside the list of words.
Another way of incorporating lists of
important terms is to have the words placed
in a blank bingo card grid.
Learners can write a short definition or
description of the term under the entry in
the bingo card to block out a square. This
may serve as the learners’ reference guide
or method of formative assessment.
You may ask the following questions to facilitate the
discussion and call on several groups to present in front of
the class:
•How many servings are in this container?
•Would you agree that this is the reasonable amount of
food you would consume per serving? How many total
food calories (C) are in this container?
•How much fat is present in one serving? What kind of fat?
What is the importance of consuming fats in our diet?
•How much carbohydrates are present in one serving?
What kind of carbohydrates? What is the importance of
consuming carbohydrates in our diet?
•Decide on whether this food sample can be eaten often
or sparingly and justify.
3.Recall that human beings, like all animals, are
heterotrophs that need to take in energy and organic
molecules (carbohydrates, fats, and proteins) from plant
and animal matter.
4.Explain to the learners that this lesson will describe the
structure of carbohydrates and lipids and explain the role that these biomolecules play in important
biological processes.
Teacher tip
For the food labels, local products that are
familiar to the learners will make the best
samples. Make sure that the labels have
carbohydrates, fats, and fibers in them. If
there are no food labels available, you may
do an image search and print some sample
food labels from the internet.
Division into small groups of two or three
may facilitate sharing. Only call on two or
three groups to present if there is limited
time.
Expect the responses to vary depending on
how realistic the serving sizes are. You can
also discuss about how advertisers can
influence how people perceive food.
Take note that a food calorie is the same as
1 kcal or 1000 calories. A young adult would
often need to take 1800-2500C per day
depending on their size and level of activity.
Responses may include saturated,
unsaturated, and trans fats. Explain to the
learners that these fats will be discussed in
more detail during the lesson. Regarding its
importance, expect responses ranging from
energy source, insulation, for flavor, for aid
in cooking, for heart health, skin health, etc.
Possible responses include sugar, fibers, etc.
Regarding its importance, responses may
include energy source, for aid in regular
bowel movement, for provision of building
blocks for biosynthesis, etc.
INSTRUCTION/DELIVERY (60 MINS)
Present a diagram similar to the one below.
Table 1: Abundant elements in the human body (Source: http://www.personal.psu.edu/staff/m/b/
mbt102/bisci4online/chemistry/elementsorgnsm.jpg)
Point out that the bulk (i.e., more than 90%) of the human body weight is provided by only three
elements: oxygen, carbon, and hydrogen. We get these elements primarily from the food we eat, from
the water we drink, and from the air we inhale around us.
Explain to the learners that biogeochemical cycles such as the carbon-oxygen cycle and the water cycle
play important roles in ensuring that we have access to these important elements. All forms of life, not
only that of humans, are made up of four kinds of important large molecules: carbohydrates, lipids,
60
proteins, and nucleic acids. All of these have carbon atoms as their backbones since carbon is capable of forming up to four chemical bonds
with atoms of other elements.
Facilitate the lecture on carbohydrates and lipids.
What do humans get from food?
Heterotrophs, such as human beings, obtain energy and raw materials from food. These are important for cell growth, cell division, metabolism,
repair, and maintenance of the body. Nutrients can be classified as either organic nutrients (i.e., those that contain carbon such as
carbohydrates, fats, proteins, vitamins, and nucleic acids) or inorganic nutrients (i.e., those that do not contain carbon such as water and mineral
salts).
What are carbohydrates?
Carbohydrates are organic compounds made up of carbon, hydrogen, and oxygen. These compounds have a general formula of
CnH2mOm. This means that the hydrogen and oxygen atoms are present in a ratio of 2:1. For example, glucose has a formula of
C6H12O6 and sucrose has a formula of C12H22O11.
Carbohydrates are usually good sources of raw materials for other organic molecules and energy. One gram of carbohydrates provides
four food calories or 16 kJ of energy. In the human diet, carbohydrates mainly come from plants although they are found in all
organisms.
How are carbohydrates formed?
Carbohydrates are examples of macromolecules. These are chainlike molecules called polymers (mere means part) made from repeating units
like monomers. Polymers can be formed from covalently-bonded monomers much like a single structure can be made out of repeated building
blocks linked to each other.
These monomers, called monosaccharides, form covalent bonds when one monomer loses a hydroxyl group and the other loses a hydrogen
atom in dehydration or condensation reactions, forming disaccharides. This reaction requires energy to occur. The bond formed is called a
glycosidic linkage.
Teacher tip
Figure 2: Dehydration synthesis of disaccharides from monosaccharide components (Source: https://
bealbio.wikispaces.com/file/view/disaccharides.JPG/364413582/disaccharides.JPG)
Longer polysaccharide chains are formed by monomer addition through succeeding dehydration
reactions. These reactions can occur in the human liver as carbohydrates are stored as polysaccharides
called glycogen or in ground tissues of plants where these are stored as starch.
Polysaccharides are broken down into simpler components through the use of water to break covalent
bonds and release energy. The process, known as hydrolysis (hydro means water and lysis means split),
is the opposite of dehydration reactions and often occurs in the digestive tract during chemical and
mechanical digestion. Here, enzymes break bonds within polysaccharides. With the aid of water, one –
H group attaches to a monosaccharide while another –OH group attaches to the other.
Comprehension question: How many molecules of water are needed to completely hydrolyze a
polysaccharide that is one thousand monosaccharides long?
62
Use ball and stick models or plastic blocks
to demonstrate how dehydration and
hydrolysis reactions occur. Simple reusable
ones may be constructed from toothpicks or
clay or similar materials.
If a projector is available, you may also use
animations like the ones found at <http://
www.cengage.com/biology/
discipline_content/animations/
reaction_types.swfto> to help in
visualization.
Correct response: 999 water molecules
During the discussion, invite the learners to
find different kinds of carbohydrates in their
food labels.
How are carbohydrates classified?
Carbohydrates can be classified into three main categories, according to increasing complexity:
•
monosaccharides (monos means single and sacchar means sugar)
•
•
disaccharides (di means two)
polysaccharides (poly means many)
Some notes on their structures and functions are found in the following table:
Classification
Monosaccharide
Functions
•
•
major cellular
nutrient
often
incorporated
into more
complex
carbohydrates
Structure
•
•
•
contains a carbonyl group •
(C=O) and may be
classified as an aldose or
ketose depending on the
•
position
may have three to seven
carbons in the skeleton
may be arranged in a
linear form when solid
and is converted into a
•
ring form in aqueous
solution (α form when H is
on top of plane of ring
and β form when -OH is
on top of plane of ring)
Examples
Ribose—a 5C aldose that
forms part of the
backbone of nucleic
acids
Glucose—a 6C aldose
that is the product of
photosynthesis and the
substrate for respiration
that provides energy for
cellular activities
Fructose—a 6C ketose
that is found in many
plants and is often
bonded to glucose
Classification
Disaccharide
Functions
•
•
energy
source
sweetener
and dietary
component
Structure
•
forms when a
glycosidic linkage
forms between
two
monosaccharides
Examples
•
•
•
Polysaccharide
•
storage
material for
important
monosaccharides
•
structural
material for the
cell or the entire
organism
•
forms when
hundreds to thousands
of monosaccharides are
joined by glycosidic
linkages
•
•
Maltose (glucose + glucose)—malt sugar often
found in sprouting grains, malt-based energy
drinks, or beer
Lactose (glucose + galactose)—milk sugar that
is a source of energy for infants; an enzyme
called lactase is required to digest this. Many
adult Filipinos have low levels of this enzyme
leading to a condition called lactose
intolerance.
Sucrose (glucose + fructose)—found in table
sugar processed from sugar cane, sweet fruits,
and storage roots like carrots
Storage polysaccharides are large molecules
retained in the cell and are insoluble in water
(formed from α 1,4 linkage monomers; with a helical
structure)
o Starch—amylase is unbranched starch forming a
helical structure while amylopectin is branched
starch, these are present in plant parts like potato
tubers, corn, and rice and serve as major sources of
energy.
o
Glycogen—found in animals and fungi; often
found in liver cells and muscle cells
Structural polysaccharides (formed from β 1,4
linkage of monomers; strands associate to form a
sheet-like structure)
o
Cellulose—tough sheet-like structures that
make up plant and algal cell walls that may be
processed to form paper and paper-based products;
humans lack the enzymes to digest β 1,4 linkages so
is passed out of the digestive tract and aids in
regular bowel movement
o
Chitin—used for structural support in the walls
of fungi and in external skeletons of arthropods
o
Peptidoglycan—used for structural support in
bacterial cell walls
Teacher tip
Examples of alpha helices and beta
sheets may be created using wire for
the backbone and yarn for the Hbonds; invite learners to speculate on
why alpha helix structures are
associated with storage
polysaccharides and beta sheets with
structural polysaccharides.
Teacher tip
Invite learners to compare the rigidity
or structural integrity of plant matter
or paper, a shrimp’s shell, and a
mushroom. Explain that all these
structures are formed from β sheets.
What are lipids?
Teacher tip
Lipids are a class of large biomolecules that are not formed through polymerization. They have diverse
structures but are all non-polar and mix poorly, if at all, with water. They may have some oxygen atoms
in their structure but the bulk is composed of abundant nonpolar C-H bonds. They function for energy
storage, providing nine food calories or 37 kJ of energy per gram. They also function for the cushioning
of vital organs and for insulation. Furthermore, they play important roles in plasma membrane structure
and serve as precursors for important reproductive hormones.
Fats or triacylglycerol formation may be
explained better using a diagram such as
the one below or through models patterned
after a similar diagram. You may ask the
learners to explain, in their own words, what
they think is happening and compare the
formation of carbohydrates with that of
lipids.
How are lipids classified?
Lipids can be divided into three main classes according to differences in structure and function. Some
notes on their structures and functions are found in the following table:
Classification
Functions
Fats
(triacylglycerols
or triglycerides)
•
energy
storage
•
cushioning of
vital organs
(adipose
tissue)
•
insulation
Structure
•
•
formed from dehydration
reactions between glycerol (an
alcohol with three Cs, each with
an –OH group) forming three
ester linkages with three fatty
acids (16-18 Cs, with the last C as
part of a –COOH group) and
producing three molecules of
water
component fatty acids (FA) may
be either saturated or
unsaturated
o
Saturated FA (e.g., palmitic
acid) have the maximum number
of hydrogen atoms bonded to
each carbon (saturated with
hydrogen); there are no double
bonds between carbon atoms
o
Unsaturated FA (e.g., oleic
acid) have at least one double
bond, H atoms are arranged
around the double bond in a cis
configuration (same side)
resulting in a bend in the
structure
Teacher tip
Demonstrate the effects of the straight
chains of saturated FAs on packing by piling
together flat structures like books or
blackboard erasers and ask learners to
Examples
compare this with the stacking or packing of
•
Saturated fat—animal products such as irregularly shaped objects like partiallybutter and lard have a lot of saturated fatty acids. folded sheets of cardboard.
The linear structure allows for the close packing of
the fat molecules for ming solids at room
temperature, diets high in these fats may increase
the risk of developing atherosclerosis, a condition in
which fatty deposits develop within the walls of
blood vessels, increasing the incidence of
cardiovascular disease
•
Unsaturated fat—plant and fish oils have
unsaturated fatty acids. The bent structure prevents
close packing and results in oils or fats that are liquid
at room temperature. Homemade peanut butter has
oils that separate out of solution for this reason.
Industries have developed a process called
hydrogenation that converts unsaturated fats into
saturated fats to improve texture spreadability.
•
Trans fat—may be produced artificially
through the process of hydrogenation described
above. The cis double bonds are converted to trans
double bonds (H atoms on opposite sides) resulting
in fats that behave like saturated fats. Studies show
that trans fat are even more dangerous to health
than saturated fats to the extent that they have been
banned from restaurants in some countries.
During discussion, invite the learners to find
different kinds of fats in their food labels
and decide on whether a particular food is
healthier than another based on its fat
content.
Misconception
Clarify the misconception that consuming
fats is entirely dangerous for health. Fats are
an essential part of a healthy diet when
consumed in moderation.
Classification
Phospholipids
Functions
major component
of cell membranes
•
•
Structure
formed from dehydration
reactions between glycerol
(an alcohol with three Cs,
each with a –OH group),
forming two ester linkages
with two fatty acids (16-18
Cs, with the last C as part of
a –COOH group) and a last
linkage with a phosphate
group
Examples
Phospholipids self-assemble
into bilayers when
surrounded by water and
form the characteristic
structure of plasma
membranes
Steroid structure may be explained better
using a diagram such as the one below or
through models patterned after a similar
diagram. You may ask the learners to
describe the diagram in their own words
and compare the structure of cholesterol
with that of other lipids.
•
Steroids and
sterols
•
regulate
fluidity of cell
membranes
•
base of sex
hormones
•
emulsification of
fats during
digestion
•
functional group
attached to the rings vary (if –
OH is attached to the 4th C, then
it is called a cholesterol)
66
Phospholipid structure may be explained
better using a diagram such as the one
below or through models patterned after a
similar diagram. You may ask the learners to
describe the diagram in their own words
and compare the structure of fats with that
of phospholipids.
Teacher tip
phosphate group is
hydrophilic and is called
the ‘head’ of the molecule
fatty acids are hydrophobic
and form the ‘tails’ of the
molecule
•
characterized by a Cskeleton with four fused rings
Teacher tip
•
Cholesterol found in
cell membranes regulates
the rigidity of the cell
membrane and are the base
material for the production
of sex hormones like
estradiol and progesterone
ENRICHMENT (20 MINS)
Divide the class into groups. Instruct the learners to prepare the following materials that are needed for
the laboratory activity:
• eight glass droppers, medicine droppers, or caps
• ethanol solution
• 12 test tubes
• glucose solution
• test tube holders or tongs
• flour or cornstarch
• beaker
• cooking oil
• alcohol lamp
• sample of studentbrought food or drink
• Benedict’s solution
• iodine solution
• mortar and pestle
Explain the following processes to the learners.
Benedict’s solution, a blue solution with CuSO4(aq), can detect the presence of reducing sugars (i.e.,
any sugar with a free aldehyde or ketone group such as all monosaccharides and the disaccharides
lactose and maltose). When boiled, these sugars reduce Cu2+ in Benedict’s solution to produce a brickred precipitate of Cu2O(s).
Iodine test can be used to detect the presence of starch.
Teacher tip
This activity may be done as a class if time
does not permit for the activity to be done
in separate groups. If Benedict’s solution is
not available, you may only perform the last
two tests.
In the absence of laboratory grade
chemicals, you may improvise with storebought chemicals like iodine and 70% ethyl
alcohol for medical use. Make sure to test
the procedure before performing the
activity in the class.
Emulsion test can be used to identify fats.
Learners should perform all three tests on the following samples:
• glucose solution (available in the baking section of grocery
stores)
•
cooking oil
food or drink sample
that the learners
• flour or cornstarch solution
brought.
For solid samples, instruct the learners to mash a small portion of the sample in some water using the
mortar and pestle and then test the resulting solution. Ask the learners to prepare a table with
appropriate headings in which to record their results.
•
In discussing the results, ask the learners to conclude whether carbohydrates or lipids are present in
their samples. They may compare this with the list of ingredients for their food or drink sample. They
can also list possible sources of errors.
EVALUATION (20 MINS)
Divide the class into small groups. Provide the groups with different structures of lipids or
carbohydrates and ask them to create models using common or recyclable materials.
Ask the learners to explain or write a short description of their models. In grading the models, check to
see if the learners were able to create an accurate model of the assigned lipid or carbohydrate.
Ask the learners, still in their small groups, to create a short flowchart that will allow them to distinguish
between the different kinds of carbohydrates and lipids based on their structures. They may use this
flowchart in answering the comprehension questions that follow.
Provide different molecular structures of the following and ask the learners to identify whether these
are:
68
Teacher tip
Prior to this lesson, instruct the learners to
bring recyclable materials that they can use
for this activity.
•
•
monosaccharides
disaccharides
•
unsaturated fats
•
storage polysaccharides
•
phospholipids
•
structural polysaccharides
•
steroids.
• saturated fats
You may also ask the learners to give one of the associated functions or characteristics of the given
carbohydrate or lipid.
Teacher tip
The various carbohydrate structures were
obtained from the following electronic
resources:
•
•
•
commons.wikimedia.org
http://www.nature.com/pj/journal/v43/
n12/images/pj201196f3.jpg
http://chemwiki.ucdavis.edu/@api/deki/
files/522/260px-Cellulose_strand.jpg?
size=bestfit&width=352&height=310&r
evision=1
Images for the various lipid structures were
obtained from the following electronic
resources:
• https://upload.wikimedia.org,
• http://www.mikeblaber.org/oldwine/
BCH4053/Lecture13/triglyceride.jpg,
https://my.bpcc.edu/content/blgy225/
Biomolecules/phospholipid.gif
General Biology 1
180 MINS
Amino Acids and Proteins
Pt. 1 of 2
Content Standard
The learners demonstrate an understanding of the structure and function of
biomolecules (i.e., proteins).
LESSON OUTLINE
Introduction Review on the Genetic Code; Translation
20
Motivation
10
of codons to corresponding amino acids
Class activity on the Protein or Amino
Acid Alphabet
Performance Standard
Instruction/ Lecture-discussion on the different levels
The learners shall be able to construct a three-dimensional model of proteins
Delivery
of protein structure (i.e., primary,
using computers (i.e., computer generated models) or recyclable materials (i.e.,
secondary, tertiary, and quaternary
physical models).
Practice
Learning Competencies
The learners:
•
•
•
categorize the biological molecule (i.e., protein) according to their structure
and function (STEM_BIO11/12-Ii-j-15)
explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12-Ii-j-16)
determine how factors such as pH, temperature, and substrate affect
enzyme or protein activity (STEM_BIO11/12-Ii-j-19)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
Class activity on paper models of the
different protein helix types
15
Evaluation
60
generated protein models; Identification
of surface features of proteins (e.g.,
hydrophobic patches, positively or
negatively charged domains, etc.)
Examination and Model Accuracy
Evaluation
recyclable materials for construction of protein models,
software for molecular modelling (available for free
download)
Resources
(1) SwissPDB Viewer software (available for free download)
(2) Protein Data Bank (can be accessed at www.db.org
70
15
Enrichment Constructing of physical or computer-
Materials
discuss the different levels of protein structure (i.e., primary, secondary,
tertiary, and quaternary)
discuss how protein structural features may influence their interactions
discuss how protein structural features may influence their functions
60
INTRODUCTION (20 MINS)
Teacher tip
Communicate learning objectives and important terms
1. Review the Genetic Code. In particular, have the learners translate codons to their corresponding
amino acids.
2. Stress the importance of how mutations may alter the type of amino acid coded by a given
sequence.
3. Discuss how some mutations may be ‘silent’.
4. Discuss how some mutations may be considered ‘conservative’ (e.g., AA changed to another with a
similar functional group type) or ‘non-conservative’ (e.g., AA changed to another with a different
functional group type).
5. Discuss the importance of the translation reading frame. Stress how frameshift mutations may lead
to changes in the amino acid sequence translation as well as changes in the termination of the
protein.
Prepare a genetic code table. Teach the
learners how to use the genetic code table
to translate an mRNA sequence.
MOTIVATION (10 MINS)
1. Instruct the learners to spell out their names using the amino acid single letter codes (e.g., NEIL).
2. Next, instruct them to spell out their names using the amino acid triple letter codes (e.g., Asn-GluIle-Leu).
3. Then have the learners find codons that can correspond to these amino acid sequences.
INSTRUCTION/DELIVERY (60 MINS)
1. Discuss the basic amino acid structure. Discuss how these amino acids may be linked by peptide
bonds to form polypeptides sequences.
2. Group the amino acids in terms of their functional group properties. The amino acids may be polar
(i.e., acidic or basic) or non-polar.
3. Highlight amino acids with special properties (e.g., Cysteine for disulfide bond formation; Tyr, Trp,
and Phe for their aromatic rings and fluorescent character; Proline for its effect on the protein
backbone).
4. Discuss how the amino acid sequence is the primary structure of the protein.
5. Discuss how properties in the primary structure (e.g., placement of hydrophobic residues, charged
groups, and disulfide bridges) define the higher level structures of the protein. Show how
interactions between complementary sections of polypeptide chains may lead to the formation of
helices or sheets.
Clarify the misconception on mutations in
the mRNA sequence. Stress how not all
mutations in the mRNA sequence may lead
to changes in amino acid sequence.
Teacher tip
Prepare an Amino Acid Alphabet table.
In the table, provide respective columns for
one-letter and three-letter codes for each
amino acid.
Present the Genetic Code table with the
Amino Acid Alphabet table so that the
learners can use them in the translations.
6. Discuss the common secondary structures of proteins (i.e., helical and sheet-like structures).
7. Discuss the different helical types (3-10 helices, alpha helices, and pi helices). Show how these
different types are based on which residues are bound by hydrogen bonds or how many atoms are
included in the helices hydrogen bonding network.
8. Show how some proteins are composed of combinations of the secondary structures in differing
ratios.
9. Discuss how the arrangement of the secondary structures in these proteins may lead to the
formation of functional regions (e.g., active sites).
10. Discuss how protein functions may involve the interaction of several proteins in what is known as
quaternary associations (e.g., protein complexes for signal transduction).
PRACTICE (15 MINS)
Teacher tip
Note that signal transduction pathways
commonly involve quaternary protein
structures.
The maintenance of proper interactions in
these structures is necessary to produce the
desired functions.
Dysfunction in these associations is
commonly associated with disease. Some
current cancer diagnostic kits target
mutations that may disrupt the proper
association of proteins in these complexes.
Instruct the learners to construct paper models of helical structures.
Paper models may be made to represent structures such as the 3-10 helix and the alpha-helix. This
would require the drawing of polypeptide chains on paper, and the folding of the paper ensuring that
the peptide bonds are kept planar. The linkage of the appropriate amide protons (NH) with the
appropriate C=O group will create models of the proper dimensions (i.e., angle and width). This is
based on the classic experiment by Linus Pauling on the discovery of the alpha helix.
ENRICHMENT (15 MINS)
Prior to this lesson, the learners may generate computerized protein models and bring them to class.
Also, software on molecular viewers should be downloaded from the internet. These software, such as
the SwissPDB Viewer, can be downloaded for free. Sample protein structures may be downloaded from
the Protein Data Bank that can be accessed at www.pdb.org.
Determine the surface features of the observed protein (e.g., hydrophobic areas, charged areas). If a
protein with an active site and a bound ligand is chosen (eg., PDBID _____),then the location of the
active site and the nature of the protein-ligand interaction may be explored.
EVALUATION (60 MINS)
Conduct an examination to assess the learners’ knowledge and understanding of the discussions.
72
Teacher tip
A video on the discovery of the alpha helix
using paper models is available on the
internet. This video features Dr. Linus
Pauling himself describing the general steps
in creating an alpha helix paper model.
Teacher tip
Familiarize yourself with the features of the
molecular viewer. SwissPDB Viewer allows
you to select amino acids of certain types
(e.g., hydrophobic residues).
Teacher tip
These may be colored or labelled to show
their positions in the protein. The position
of hydrophobic patches and charged
surfaces in proteins can signify areas of
potential interaction.
General Biology 1
Amino Acids and Proteins
Pt. 2 of 2
Content Standard
The learners demonstrate an understanding of the structures and functions of
biological molecules (i.e., carbohydrates, lipids, nucleic acids, and proteins)
Performance Standard
The learners shall be able to identify key structural features of biological
molecules that are important for their functions (e.g., 5’ and 3’ OH of DNA, 2’
OH of RNA, complementary base pairing, N and C termini of proteins, R
groups of the different amino acids, etc.).
Learning Competencies
The learners:
•
•
•
•
categorize the biological molecules (e.g., DNA, RNA, proteins) according
to their structure and function (STEM_BIO11/12- II-j-15)
explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12 -II-j-16)
explain oxidation/reduction reactions (STEM_BIO11/12- II-j-18)
determine how factors such as pH, temperature, and substrate affect
enzyme or protein activity (STEM_BIO11/12 -II-j-19)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
discuss key structural features of DNA, RNA, and proteins
discuss structural and functional differences between DNA and RNA
discuss the different levels of protein structure (i.e., primary, secondary,
tertiary, and quaternary)
discuss how protein structural features may influence their functions
60 MINS
LESSON OUTLINE
Introduction Review on Cell and its organelles; Discussion
5
and illustrations of the Central Dogma of
Molecular Biology
Motivation
5
Class activity on the important functions of
biological molecules`
Instruction/ Lecture-discussion on the main functions and
Delivery
important physical properties of
30
biomolecules
Practice
5
Exercise on translating coding to non-coding
sequences
Enrichment Practice exercise on translating coding
5
sequences into mRNA transcripts and mRNA
transcripts into polypeptide sequences.
Evaluation
Practice exercises on identification of
biomolecules based on given chain
structures, identification of important
structural features in the chain structures,
and generating non-coding sequences
(DNA), transcripts (RNA) and polypeptides to
assess learners’ understanding of the topics
10
Materials
recyclable materials for construction of models of biological
molecules, software for molecular modelling (available for
free download)
Resources
(1) SwissPDB Viewer software (available for free download)
(2) Protein Data Bank (can be accessed at www.db.org
INTRODUCTION (5 MINS)
Teacher tip
1. Facilitate a review on the cell and its organelles. Emphasize that the specific functions for each
organelle type are compartmentalized and that the functions of each organelle are defined by its
physical properties.
2. Explain to the learners that the lesson will focus on understanding the important physical properties
of certain biomolecules (i.e., DNA, RNA and proteins) and how these properties allow the
biomolecules to serve specific functions within the cell.
RNA
Protein
3. Discuss the Central Dogma of Molecular Biology: DNA
Relate the Central Dogma of Molecular
Biology to real world situations.
For example, in cooking, the cook book
functions like the DNA (Genome). The
specific recipe functions like the mRNA
while the desired dish is the protein.
Provide two more examples of everyday life
activities that can illustrate the Central
Dogma of Molecular Biology.
Teacher tip
MOTIVATION (5 MINS)
1. Divide the class into groups and instruct them to identify or enumerate the most important
functions of DNA, RNA, and proteins.
2. Consolidate the learners’ responses on the board.
Elaborate on the main functions of the biomolecules:
•
DNA—is the repository of genetic information
RNA—serve as the transcripts and regulators of expressed genetic information
Proteins—are the functional products and executors of cellular functions
Biomolecule
DNA
Physical Property
•
•
INSTRUCTION/DELIVERY (30 MINS)
•
•
•
Note the following expected responses:
Functional Relevance
Complementary Base Pairs
Allows each strand to serve as a template for replication and
transcription
Phosphodiester bonds
Essential for polynucleotide chain elongation
Deoxyribose 5’OH
Start of the polynucleotide chain
Deoxyribose 3’OH
“End” of the polynucleotide chain
Connection point for extending the chain
74
DNA—repository of genetic
information
RNA—transcripts and
regulators of expressed
genetic information
protein—functional products
and executors of cellular
functions
Biomolecule
RNA
Protein
Physical Property
Functional Relevance
Teacher tip
Use computer modelling software like
Deoxyribose 2’H
Difference between the sugar residues of DNA (deoxyribose) SwissPDB Viewer to illustrate the basic
structures of DNA, RNA, and Proteins
and RNA (ribose)
Complementary Base
Pairing
Allows RNA to serve as transcripts (mRNA) and translators
(tRNA) of genetic information from DNA.
Uracil
Nitrogenous base equivalent to T in RNA.
Ribose 2’OH
Difference between the sugar residues of DNA (deoxyribose)
and RNA (ribose)
Focus on the important parts of the
structure that provide the necessary physical
Limits the compaction of RNA molecules.
properties of DNA, RNA, and Proteins.
Double stranded RNA molecules are similar in structure as
the A-form of DNA
N-Terminus
Start of the polypeptide chain
C-Terminus
End of the polypeptide chain
Addition point for new amino acids during polypeptide
growth
Peptide Bond
Links Amino Acids
Planar character
Phi Angle
Angle between:
Ci-1-Ni-Cαi-Ci
Ci-1 : Carbonyl C of
previous AA
Ni : Amide Nitrogen of current AA
Cαi: Alpha Carbon of current AA
Ci : Carbonyl C of
current AA
Angle is observed by looking down the bond between Ni
and Cαi; coming from the N-terminus of the polypeptide
(Polypeptides).
The basic structures for these biomolecules
are available as molecular structure files
(*.pdb) from the Protein Data Bank that can
be accessed at www.pdb.org.
Discuss the relevance of these physical
features for the functions of DNA, RNA, and
Proteins.
Biomolecule
Physical Property
Psi Angle
Functional Relevance
Angle between
Ni+1-Ci-Cαi-Ni
Ni+1 : Amide Nitrogen of succeeding AA
Ci : Carbonyl C of
current AA
Cαi: Alpha Carbon of current AA
Ni : Amide Nitrogen of current AA
Angle is observed by looking down the bond between Ci
and Cαi; coming from the C-terminus of the polypeptide
Defines Amino Acid Character
Amino Acid R-Groups
a. non-polar
i. aliphatic
(G,A,V, L, I, M)
ii. aromatic
(Y,W,F)
b. polar, uncharged
(S,T,C,P,Q)
Table 1: Important Physical Properties of Biomolecules
Teacher Tip:
PRACTICE (5 MINS)
Complementary Non-coding/ sequence:
3’ TACGTATCTAATCCTATAGGGTCTATC 5’
The correct response is:
Given the following coding sequence for DNA, provide the sequence of the complementary (template)
sequence.
Coding sequence:
5’ ATGCATAGATTAGGATATCCCAGATAG 3’
76
Be sure to note the antiparallel orientation
of the coding and non-coding strands of the
DNA. Note the relative positions of the 5’
and 3’ ends.
ENRICHMENT (5 MINS)
Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
2. Translate the given mRNA transcript into a polypeptide sequence:
Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
Teacher tip
The correct responses are the following:
For no. 1, the coding sequence ~ mRNA
transcript is
5’
AUGCAUAGAUUAGGAUAUCCCAGAUAG
3’
For no. 2, the polypeptide sequence is
N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
Note that the mRNA transcript has almost
the same sequence as the coding sequence
(DNA), but the Thymines are converted to
Uracil.
Teach the learners how to read the Codon
Table.
Teach the learners the single letter codes
for the amino acids (e.g., Tryptophan Trp
W).
EVALUATION (10 MINS)
Ask the learners to identify the type of biomolecule represented by a given chain structure:
•
DNA
•
RNA
•
Protein
You may ask the learners to identify the important structural features in these chain structures. The
features are listed in Table 1 in the Instruction/ Delivery section of this Teaching Guide.
A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and translated
polypeptides may be performed to test the learners’ understanding of the topic.
Instruct the learners to spell their names
using the amino acid codes (e.g., N-E-I-L
Asn – Glu – Ile – Lue).
Teacher tip
Worksheets with partially-completed
sequences may be used to help the learners
practice the generation of complementary
sequences.
For example:
Template sequence
3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’
5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
General Biology 1
150 MINS
Biological Molecules:
Enzymes
LESSON OUTLINE
Introduction Presentation of objectives and terms;
5
Content Standard
The learners demonstrate an understanding of enzymes and of the factors
affecting enzyme activity.
Motivation
5
Performance Standard
The learners shall be able to explain the role and significance of enzymes in
biological systems.
Instruction/ Small-group and class discussion on
Delivery/
definition of enzymes, its structure, and
Practice
function
60
Learning Competencies
The learners:
Enrichment Laboratory activity on the work of
60
Evaluation
20
•
•
describe the components of an enzyme (STEM_BIO11/12-Ii-j-17)
determine how factors such as pH, temperature, and substrate affect
enzyme activity (STEM_BIO11/12-Ii-j-19)
Brief discussion on thermodynamics or
protein structure
enzymes using raw liver as a source of
catalase and hydrogen peroxide as the
substrate
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
present a model demonstrating the components of a specific enzyme in a
biological system and the reaction it catalyzes
design a simple experiment that illustrates how pH, temperature, or
amount of substrate affect enzyme activity (i.e., includes problem
statement, hypothesis, materials and methods)
78
Illustration and explanation of enzymatic
browning in bananas
Group activities on creating models of
enzyme-catalyzed reactions and
designing of a simple experiment on
enzyme activity
Materials
projector, computer, recyclable materials for making models
of enzyme-catalyzed reactions.
Resources
(1) Reece, J.U. (2011). Csmpbell Biology, 9th ed. San Francisco, CA:
Pearson Benjamin Cummings.
INTRODUCTION (5 MINS)
Introduce the following learning objectives using any of the suggested protocols (e.g., verbatim, own
words, or read-aloud):
•
•
I can describe the components of an enzyme.
I can determine how factors such as pH, temperature, and substrate affect enzyme activity.
Introduce the list of important terms that the learners will encounter:
•
•
•
•
•
•
•
•
•
•
•
enzyme
catalyst
activation energy
substrate
enzyme-substrate complex
active site
induced fit
cofactor
coenzyme
competitive inhibitor
noncompetitive inhibitor
MOTIVATION (5 MINS)
Connect the lesson to a real-life problem or question.
While the learners are coming in and settling down in the classroom, show them that you are cutting a
banana into small pieces on a plate. After the introduction, you can show the learners the plate of
banana pieces. Instruct them to pass it around and share their observations.
The following could be expected answers:
•
•
•
•
•
The banana’s covering is brown.
The banana’s texture is mushy.
The banana looks spoiled.
The banana is smelly
The banana is soft.
Teacher Tip:
Prominently display the learning objectives
and important terms prominently on one
side of the classroom and frequently refer to
them during discussion. You may place a
check-mark beside a term in the wordlist
after defining it so that the learners have an
idea of their progress.
Another way of incorporating lists of
important terms is to have the words placed
in a blank bingo card grid. Learners can
write a short definition or description of the
term under the entry in the bingo card to
block out a square. This may serve as the
learners’ reference guide or method of
formative assessment.
Teacher Tip:
You may opt to divide the class into groups
of twos or threes to facilitate sharing of
observations and insights. You may call on
two to three groups to share their
observations if there is limited time for
presentations.
Ask the learners if they can explain why the bananas have turned brown and mushy. Challenge the
learners to think of ways to slow down the process of browning. Expected answers could be not to cut
the banana, keep the banana cold, or keep the banana in an airtight container.
Provide the learners with the following explanation:
•
•
•
Peeling, bruising, or cutting fruits cause them to release enzymes like polyphenol oxidase (PPO,
phenolase) that, with the presence of oxygen in the surrounding air, goes into chemical reactions of
plant compounds. These chemical reactions produce brown pigments through the process of
enzymatic browning.
Enzymes—are organic substances that accelerate the rate of chemical reaction. Enzymatic
browning can be a significant problem because it limits the shelf life of fruits and vegetables.
However, enzymatic browning is not always unwanted. The browning reaction contributes to the
desirable color and flavor of raisins, prunes, coffee, tea, and cocoa. Although enzymatic browning
causes changes in flavor and taste (i.e., bitter, astringent) and may reduce quality, the browning
agents formed are not toxic. Brown fruits are safe to eat up to a few hours after cutting.
Knowing the mechanism behind this, Arctic Apples, a Canadian company, produced geneticallyengineered apples that will not brown for 15-18 days.
INSTRUCTION/DELIVERY/PRACTICE (60 MINS)
Recall previous lessons on the laws of thermodynamics, spontaneity of reactions, and carbohydrate
structure through a scenario.
•
•
•
Scenario: Is the hydrolysis of starch to maltose a spontaneous reaction? What information do you
need to answer this question?
Expected response: Question may be answered with the given information since we are familiar
with hydrolysis and the structures of starch and maltose. The reactants have higher levels of free
energy compared to the products, making this a spontaneous reaction.
Follow-up questions: If this is so, why will a sterile starch solution sit for years at room temperature
without significantly hydrolyzing? Can you think of ways to hydrolyze starch more quickly?
80
Teacher Tip:
If pressed for time, No. 1 can be done as
part of the Motivation with soda crackers or
plain biscuits (that is mostly composed of
starch) as an example. Moisten the cracker
with water and place it in a visible area.
Compare the time it takes for a similarlysized piece of cracker to break down inside
a learner’s mouth. Remind the learner not to
chew the cracker.
If available, amylase and Benedict’s solution
may be used to test for the presence of
simple sugars.
Numerous chemical reactions support life.
The regulation of these reactions may take
place in two major ways:
• through the use of enzymes
• through the regulation of genetic
material (This which will be discussed
later.)
Proceed to the lecture proper.
• Can you imagine what would happen if it takes many years for our body to hydrolyze the starch in
the food that we eat? Starchy food comprises an important part of our diet and our bodies use
enzymes called amylase to quickly hydrolyze starch into simple sugars.
•
•
What are enzymes?
Enzymes are organic or biological catalysts. Catalysts are substances that speed up a reaction
without being used up, destroyed, or incorporated into the end product. They are vital to the
regulation of the metabolic processes of the cell. Many enzymes are proteins. We will focus on this
type of enzymes in this discussion. RNA enzymes called ribozymes will be discussed later.
•
What keeps spontaneous reactions from occurring more rapidly?
• All chemical reactions between molecules involve the breaking and forming of bonds.
Converting starch into glucose involves contorting starch into a highly unstable state before
the reaction can proceed. This unstable state is called the transition state that happens when
reactants absorb energy from their surroundings and. This initial investment of energy in
order to start a reaction is called the activation energy. It is often supplied as thermal energy
or heat absorbed by reactants from their surroundings. Reactant molecules absorb heat
which causes them to collide more frequently and more forcefully. This agitates the atoms
within the molecules that results in the likely breaking of bonds.
• When the new bonds of the products form, energy is released as heat and the molecules
return to stable shapes with lower energy. This results in an overall decrease of free energy.
Figure 1 (on the right): Energy profile for a spontaneous exergonic reaction: AB+CDAC+BD (Source: Reece, J. U (2011 ).
Campbell Biology, 9th ed. . San Francisco, CA: Pearson Benjamin Cummings)
Teacher Tip:
A visual aid may be used to show the
contortion. For example, a string of paper
clips or a bunch of keys on a key ring can
stand for starch. The contortions involved in
detaching one paper clip or removing one
key can serve as analogies for the process.
Teacher Tip:
To illustrate the concept of activation
energy, pushing a toy car or marble up a
makeshift ramp will also help concretize the
concepts of activation energy and transition
state.
•
The reaction shown in Figure 1 is spontaneous but the activation energy provides a barrier that
determines the rate of the reaction. Reactants have to absorb enough energy from their
environment to surmount this barrier before the reaction can proceed.
•
Knowing this, how can you cause reactants to absorb more energy from their environment?
How do enzymes affect reactions?
Heat speeds up reactions. This is inappropriate for biological systems because it denatures proteins,
kills cells, and speeds up all reactions, not just those that are needed. Enzymes catalyze specific
reactions by lowering the activation energy barrier and allowing the reactant molecules to absorb
enough energy at moderate temperatures. Enzymes cannot change the !G for a reaction and can only
hasten reactions that would eventually occur anyway.
View Part I of the animation at http://www.sumanasinc.com/webcontent/animations/content/enzymes/
enzymes.html. Click on ‘Show Narrative’ to reinforce the aforementioned concepts on spontaneous
reactions. Ask the learners to answer the following questions and call on a small group to explain their
responses using their own words:
•
•
What is the activation energy of a reaction?
How do enzymes affect the activation energy of a reaction?
Enzyme structure and function
View http://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/
animation__how_enzymes_work.html. Click on ‘Text’. Ask the learners to answer the following question
and call on a small group to explain their responses using their own words:
On a molecular level, how does the shape of an enzyme enable it to perform its function? Use
the following terms in your responses: ‘active site’, ‘substrate’, ‘enzyme-substrate complex’, and
‘product’.
The active site and functional groups of its amino acids may lower activation energy by:
•
•
•
•
acting as a template for substrate orientation
stressing the substrates and stabilizing the transition state
providing a favorable microenvironment
participating directly in the catalytic reaction
82
Teacher tip
Relate the discussion with the hypothetical
reactions in Figures 1 and 2.
View http://www.wiley.com/college/boyer/0470003790/animations/enzyme_binding/
enzyme_binding.htm. Click on ‘Binding Models’. Ask the learners to answer the following questions
and call on a small group to explain their responses using their own words:
•
•
How does the shape of an enzyme enable it to perform its function?
What is the difference between Emil Fisher’s lock-and-key model and Daniel Koshland’s induced-fit
model? Describe the current model.
Factors that affect enzyme action
Given what the learners know about enzyme action, ask them to predict how the following factors will
affect the action of an enzyme by completing the table below. This may be done by group or by the
class as a whole. If the entire class is involved, invite a small group to fill in each row.
Table 1: Factors that affect enzyme action.
Teacher tip
The video links provided here may be given
as a pre-lecture assignment to stimulate
prior knowledge and give the learners an
idea of the topics to be discussed.
If a computer is not available, you may ask
the learners to answer the questions based
on your discussion. Provide constructive
feedback and correct misconceptions. You
may use models or analogies to better
illustrate the concepts. Here are some
suggestions:
• a handshake to demonstrate induced fit
• two pieces of a jigsaw puzzle to
illustrate components of a substrate
• roleplay to show the interactions
between enzymes and substrates
Clarify the misconception that enzymes only
function in catabolic reactions or breaking
down of substances. This misconception
may be due to the learners’ first encounter
of enzymes in the context of digestion.
Enzymes also catalyze other types of
reactions. For example, DNA polymerase
facilitates the addition of nucleotides to a
polynucleotide chain.
View http://moleculesoflife2010.wikispaces.com/file/view/Enzyme+Model.swf and test the hypotheses
using controlled simulations. You may need to use a timer to assess reaction rates. Do your results
agree with your predictions? How were they similar? How were they different?
Provide constructive feedback and clarify the reasons for the observed changes to reaction rates and
enzyme function.
View http://web.biosci.utexas.edu/psaxena/MicrobiologyAnimations/Animations/Enzyme-Substrate/micro_enzyme-substrate.swf. Ask the
learners to answer the following question and call on a small group to explain their response in their own words:
What is the difference between a competitive and noncompetitive inhibitor?
The presence of non-protein helpers called co-factors and of organic molecules like co-enzymes may activate apoenzymes to produce
holoenzymes by binding to their active sites. Common examples may be found in popular supplements such as ions of iron, copper, zinc, or in
vitamins like vitamins A, C, and B-complex.
Enzyme regulation and metabolic control
View http://usmanscience.com/12bio/enzyme/enzyme_animations.htm. Click on ‘Allosteric Enzymes’ and ‘Feedback Inhibition’. Ask the learners
to answer the following questions and call on a small group to explain their responses in their own words:
What are allosteric enzymes?
Feedback inhibition regulates metabolic pathways that use more than one enzyme. How does feedback inhibition work?
ENRICHMENT (60 MINS)
Facilitate a laboratory activity on investigating the work of enzymes using raw liver as a source of
catalase and hydrogen peroxide as the substrate. Learners may be provided with the following:
•
•
•
•
temperature as a factor: ice water bath, water bath at room temperature, warm water bath
pH as a factor: acid solution, alkaline solution, and litmus paper
amount of substrate: droppers
small test tubes or medicine caps
Explain that many living tissues contain catalase or peroxidase that catalyzes the reaction conversion of
H2O2 → H2O + O2.
Cut the liver into equal-sized cubes and demonstrate the effect of placing the liver in a 2mL solution of
hydrogen peroxide. Evolution of gas (i.e., bubbling) will be observed. Groups of learners may prepare
solutions that they can test using the different factors.
Instruct the learners to rank the different solutions based on the rates of reactions.
84
Teacher tip
This activity may be done as a class if there
is not enough time to perform the
laboratory work individually or in groups.
You may perform the test on all three
factors or you may choose only one or two.
EVALUATION (20 MINS)
Making models of enzyme-catalyzed reactions
1. Divide the class into small groups.
2. Distribute different examples of important enzyme-catalyzed reactions to the groups.
3. Ask the groups to create models using common or recyclable materials and label the following
components: enzyme, substrate, product, and active site.
4. Ask the learners to demonstrate how this enzyme works.
Written Task
1. Divide the class into small groups.
2. List the materials for Enrichment (See previous section).
3. Ask the learners to design their own experiment in order to explore the effect of one factor on
enzyme activity. Explain that the experimental design should include:
•
•
•
•
•
•
a testable hypothesis
complete list of dependent and independent variables
complete list of controlled variables
logical procedure in a flowchart format
short and accurate explanation of what you expect to happen and why
sufficient replicates
Teacher tip
Before this session, inform the learners that
they will be making models of enzymecatalyzed reactions next meeting and ask
them bring recyclable materials that they
can use for this activity.
In grading the models, check to see if the
learners were able to label the parts
correctly. Demonstrate that the substrate
goes into the active site, gets contorted and
moves out as a product. Check if the
substrate and the products are consistent
with the reaction being modeled (e.g.,
anabolic, catabolic, or recombination)
General Biology 1
240 MINS
Photosynthesis and
Cellular Respiration
LESSON OUTLINE
Introduction Communicate to the class the oxidation-
5
Content Standard
The learners demonstrate an understanding of photosynthesis and cellular
respiration
Motivation
5
Learning Competency
The learners:
Instruction/ Show the overall equations of photosynthesis 145
and cellular respiration
Delivery
•
reduction and the flow of energy
Describe the major features and chemical events in photosynthesis and
cellular respiration (STEM_Bio11/12-IIa-j-1)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
functionally define photosynthesis and cellular respiration;
identify the reactants and products of photosynthesis and cellular
respiration;
differentiate the major chemical events of photosynthesis and cellular
respiration; and
summarize in a form of illustration or diagram the similarity in the
organization of chloroplast and mitochondrion in carrying out
photosynthesis and cellular respiration, respectively.
Post questions on the board and ask the
students to identify the processes involved in
energy transformation
Enrichment Similarity of photosynthesis and cellular
25
Evaluation
60
respiration and connecting the concepts with
the biological systems
Summary of the major events of
photosynthesis and cellular respiration
Resources
(1) Alumaga, Maria Jessica B. et al., (2014). Science and Technology 9. Quezon
City: Vibal Publishing House
(2) Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
(3) Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/
Cole
(4) www.biologycorner.com accessed July 19, 2015
Suggested Media Tools
•
•
•
www.mhhe.com/maderbiology11
www.masteringbiology.com
www.biologycorner.com
For animations, video, learning outcomes, chapter outline, image PowerPoint,
essay quiz, thinking critically, practice test and concept maps:
• http://highered.mheducation.com/sites/0073403466/student_view0/
chapter7/image_powerpoint.html
• http://highered.mheducation.com/sites/0073525502/student_view0/
chapter7/index.html
86
INTRODUCTION (5 MINS)
Review with the class that oxidation-reduction (redox) reactions involve electrons passing from one
molecule to another. Oxidation (also splitting) is the loss of electrons while reduction is the gain of
electrons. You can show this picture to your students and try to ask questions so that you can generate
critical-thinking skills from them. To help them visualize the concept, a diagram of redox reactions is
also shown below. Ask your students which organisms (in the picture below) photosynthesize and which
respire (take note that plants both photosynthesize ad respire at the same time). Then show the
equation of redox reactions after your students have given their responses. You may also ask examples
of oxidation reactions (e.g., browning of peeled potato, banana, and eggplant). For redox reactions
examples are rusting of iron, burning of combustible material (e.g., wood, coal, etc.)
NOTE: Energy transformation (e.g., photosynthesis and cellular respiration is one of the difficult topics
in biology. To capture the general picture of the topic, students have to be encouraged to read and reread the key concept, write and re-write, outline and re-outline, draw and re-draw, and to recite orally if
they want the ideas to sink in their system. Patience and steadfastness are important virtues that should
be included as you study this concept.
Teacher Tip:
Note: This lesson merely describes the
major features of (or an overview)
photosynthesis and cellular respiration. A
more detailed concept and deeper
explanation will be presented in another set
of learning competencies.
Emphasize that the flow of energy starts
with the sun. There are two organelles that
participate in the energy flow from the sun
through living things. You can now motivate
your students by posting two questions
relating to energy transformation. Redox
reactions is one type of chemical reaction.
Emphasize to students the importance of
understanding the processes rather than
memorizing all the various reactions.
Remember that plants both
photosynthesize and do on aerobic
respiration.
The following are some of the practical
examples of photosynthesis:
1. Photosynthesis helps create food chains
or food web (Note: Most modern scientists
prefer the latter because it portrays the
accurate interactions of several organisms in
the environment. The interactions make
possible the production and perpetuations
of the living creatures. Most life forms
directly or indirectly depend on plants for
their basic metabolism. Ultimately, materials
from producers, herbivores, omnivores and
carnivores will be consumed by
decomposers (e.g., bacteria). These bacteria
produce waste products that increase the
nutrient content of the soil.
Thus, plants are able to produce
macromolecules (e.g., carbohydrates,
proteins, fats and nucleic acids) and sustain
other cellular activities because of the
participation of the soil, nutrients, water,
carbon dioxide, chlorophyll and sunlight as
preparatory materials for the synthesis of
carbohydrates and oxygen.
Countless chemical reactions are occurring in cells to do essential life functions with the help of ATP as
the energy currency of the cells. Ask your students what are the tasks of ATP. The following are the
answers:
Photosynthesis and bioenergy. The plant
materials and animal wastes are used
especially as a source of fuel.
1. Chemical work: ATP is used for building macromolecules
2. Transport work: ATP is used for transporting ions membranes
3. Mechanical work: ATP is used for mechanical processes such as muscle contraction, cilia movement
For additional information, tell the class that ATP is also involved in rigor mortis—a temporary stiffness
of the body that happens soon after death of a person.
Teacher tip
MOTIVATION (5 MINS)
Post these two questions on the board. Ask them to identify the process involved in each question so
that food is manufactured and energy is released.
•
•
How do plants harness light energy to manufacture food?
How do living organisms harness energy from food?
Then show to them the overall equation for each process as follows:
•
•
A.
1. Components that are utilized: Carbon
dioxide, water, sunlight (and chlorophyll can
be mentioned)
2. Groups that come out: Carbohydrate
(glucose) and oxygen
B.
1. Groups that go in: Carbohydrate, oxygen
and 38 ADP molecules
2. Groups that are released: Carbon
dioxide, water and 38 ATP molecules
Chemical reactions for photosynthesis:
6 CO2 + 6 H20 + sunlight
Suggested answers:
1. Through photosynthesis
2. Through cellular respiration
C6H12O6 + 6 O2
Which groups participate in the reaction?
88
•
•
Which groups are released?
Chemical reactions for cellular respiration:
C6H12O6 + 6 O2 + about 38 molecules of ADP
•
Which groups participate in the reaction?
•
Which groups are released?
6 CO2 + 6 H20 + about 38 molecules of ATP
INSTRUCTION/DELIVERY (145 MINS)
1. You can draw pictures of photosynthesis and cellular respiration in Manila paper if LCD is not
available. You can also go to computer/printing shop and make these pictures into tarpaulin for
long use.
• Sample picture of Overview of Photosynthesis, Overview of the Stages of the Calvin
Cycle in Photosynthesis, Overview of Glucose Breakdown, and Overview of ATP Yield
per Glucose Molecule may be viewed at Biology 10th Edition by Mader, Sylvia S. (2010)
(Retrieved July 20, 2015)
2. Group your students into triad according to their learning skills. Give each member accountability
task to promote mutual cooperation.
3. Give them questions to answer for discussions. Tell them to prepare and bring out their Manila
paper and markers.
4. Have them report orally to the class.
5. Alternatively, if the class will not be able to report reliably, roleplaying, laboratory activities, or
simulations involving computer-aided activities such as the ones found in the following sites:
• http://www.reading.ac.uk/virtualexperiments/ves/preloader-photosynthesis-full.html
• http://www.pbs.org/wgbh/nova/nature/photosynthesis.html
Processing Questions:
What are the two kinds of reactions in photosynthesis?
What are the basic stages of the Calvin cycle?
What are the reactants and products of photosynthesis?
In which part of the cell glycolysis happens? What about the citric acid cycle and electron transport
chain?
5. How many metabolic pathways are there in cellular aerobic respiration? In anaerobic respiration?
6. What are the reactants and products of cellular respiration?
1.
2.
3.
4.
7. About how many ATP molecules does a cell obtain from the breakdown of one molecule of glucose
in cellular respiration?
8. Given the glucose, carbon dioxide and water, which one(s) is/are called high-energy molecule and
which one(s) is/are called low-energy molecule?
Suggested Answers:
1. Light-dependent reaction and light-independent reaction (also known as Calvin cycle reaction or
carbon fixation reaction).
2. The basic stages of Calvin cycle reaction are: carbon dioxide fixation, carbon dioxide reduction,
RuBP regeneration.
3. Reactants: carbon dioxide and water; products: carbohydrates and oxygen
4. Glycolysis happens in the cytoplasm of the cell; citric acid cycle (Krebs cycle) and ETC are in the
mitochondrion of the eukaryotic cell.
5. In cellular aerobic respiration: three; in anaerobic respiration: one
6. Reactants: carbohydrates, oxygen, and about 38 ADP molecules; products: carbon dioxide, water
and about 38 ATP molecules
7. About 36 to 38 ATP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ATP molecules produced depending on the shuttle used to transport the electrons
and on the kind of species.)
8. High-energy molecules: glucose; low-energy molecules: carbon dioxide and water
Directions:
Fill-in the two tables below for the major events and features of photosynthesis and cellular respiration,
respectively. The option tables are given for you to answer the needed materials and end products of
photosynthesis and cellular respiration.
90
Major Events and Features of Photosynthesis
Reaction Series
Needed Materials
End Products
1. Light-dependent reactions (take
place in the thylakoid membrane)
a. Photochemical reactions
b. Electron transport
c. Chemiosmosis
a.
a.
b.
b.
c.
c.
2. Carbon fixation reactions (take
place in stroma)
2
2
Available Choices
a. Electrons
b. NADPH, O2
e. Electrons, NADP
+, H O, electron
2
acceptors
f. Proton gradient,
ADP + P, ATP
synthase
c. Light energy;
pigments (chlorophyll)
g. Carbohydrates,
ADP + P, NADP+
d. ATP
h. Ribulose bisphosphate,
CO2, ATP, NADPH,
necessary enzymes
Major Events and Features of Cellular Respiration
Stage
Starting Materials
End Products
1. Glycolysis ( in cytosol)
2. Preparatory reaction
3. Citric acid cycle
4. Electron transport and
chemiosmosis
Available Choices
a. Pyruvate, ATP, NADH
e. Acetyl CoA, H2O,
NAD+, FAD, ADP Pi
b. NADH, FADH2,
O2, ADP Pi
f. Acetyl CoA, CO2,
NADH
c. Glucose, ATP, NAD
+, ADP P
i
g. CO2, NADH,
FADH2, ATP
d. Pyruvate, Coenzyme
A, NAD+
h. ATP, H2O, NAD+,
FAD
Suggested Answers:
Major Events and Features of Photosynthesis
Reaction Series
Needed Materials
End Products
Light-dependent reactions
(take place in the thylakoid
membrane)
a. Light-energy; pigments (chlorophyll)
a. Electrons
b. NADPH, O2
a. Photochemical reactions
b. Electron transport
Carbon fixation reactions
(take place in stroma)
b. Electrons, NADP+, H2O, electron acceptors
c. Proton gradient, ADP + P, ATP synthase
2. Ribulose bisphosphate, CO2, ATP, NADPH,
necessary enzymes
c. ATP
2.
Carbohydrates,
ADP + P, NADP+
Major Events and Features of Cellular Respiration
Stage
Starting Materials
End Products
1. Glycolysis (in cytosol)
Glucose, ATP, NAD+, ADP Pi
Pyruvate, ATP, NADH
2. Preparatory reaction
Pyruvate, Coenzyme A, NAD+
Acetyl CoA, CO2, NADH
3. Citric acid cycle
Acetyl CoA, H2O, NAD+, FAD,
ADP Pi
NADH, FADH2, O2, ADP Pi
CO2, NADH, FADH2, ATP
4. Electron transport and
chemiosmosis
ATP, H2O, NAD+, FAD
92
Activity: Gaseous Products of Photosynthesis
NOTE: If there is enough time and the materials are available, let the class do this activity.
Materials needed:
1000 mL beaker, 3 grams of sodium bicarbonate, Hydrilla or Elodea, funnel, test tube
Procedure:
1. Half-fill a 1000 mL beaker with tap water.
2. Add 3 grams of sodium bicarbonate.
3. Place Hydrilla or Elodea in the bottom of the beaker.
4. Put a funnel over the plant.
5. Fill the test tube with water up to the brim. Secure the mouth of the test tube with your thumb. Invert
the tube and place it on top of the funnel.
6. Place the beaker under direct sunlight. Count the bubbles that appear in the test tube after 30, 60,
90, 120, 150, 180, and 210 seconds.
7. After several minutes, slowly remove the test tube from the funnel. Place your thumb over its mouth.
Turn the tube right up and insert a glowing match to the test the presence of the oxygen in the tube.
Adapted from: Science and Technology II for the Modern World. (2003). Makati City: Diwa Scholastic
Press, Inc.
Note: An illustration of the set-up will help teachers and students to visualize how the experiment
should be performed.
ENRICHMENT (25 MINS)
Directions: Show the basic similarity and differences between photosynthesis and cellular respiration.
The options are provided for in the other table below.
PART I
Photosynthesis
Cellular Respiration
1.
Raw materials
2.
End products
3.
Electron transfer compound
4.
Location of electron transport chain
5.
Organelle involved
6.
ATP production
7.
Source of electron for ETC
8.
Type of metabolic reaction
9.
Terminal electron acceptor for
electron transport chain
Available Choices
a)
c)
e)
O2
Glucose, oxygen
NADP+ is turned to NADPH
g)
Phosphorylation and oxidative
phosphorylation
i)
Chloroplast
k)
Photophosphorylation
m)
In noncyclic electron
transport :H2O
o)
Glucose, oxygen
q)
In noncyclic electron transport:
NADP+
b)
d)
f)
Anabolism
Carbon dioxide, water
NAD+ is turned to NADH+
h)
Mitochondrial inner membrane
(cristae)
j)
Mitochondrion
l)
Thylakoid membrane
n)
Immediate source: NADH and
FADH2
p)
Catabolism
r)
Carbon dioxide, water
94
Suggested Answers
Photosynthesis
Cellular Respiration
1.Raw materials
Carbon dioxide, water
Glucose, oxygen
2.End products
Glucose, oxygen
Carbon dioxide, water
3.Electron transfer
compound
4.Location of electron
transport chain
5.Organelle involved
NADP+ is turned to NADPH
NAD+ is turned to NADH+
Thylakoid membrane
Mitochondrial inner membrane
(cristae)
Mitochondrion
6.ATP production
Photophosphorylation
7.Source of electron for ETC
In noncyclic electron
transport :H2O (undergoes
photolysis to yield electrons,
protons, and oxygen)
Anabolism
8.Type of metabolic reaction
9.Terminal electron acceptor
for electron transport chain
Chloroplast
In noncyclic electron transport:
NADP+ (becomes reduced to
form NADPH)
Phosphorylation and oxidative
phosphorylation
Immediate source: NADH and
FADH2, Ultimate source: glucose
Catabolism
O2 (becomes reduced to form
H2O)
Connecting the Concepts with the Biological Systems
•
•
•
Chloroplasts and mitochondria play a significant role in metabolism and their enzyme-requiring
pathways permit a flow of energy through all living things.
The energy transformations that take place in these organelles results in a loss of energy in the form
of heat. Therefore, all organisms are in need of a constant supply of energy, which they get from
their food.
Food is ultimately produced by plants, which have the ability to capture solar energy.
Photosynthesizing organisms form the basis of most food chains on Earth.
EVALUATION (60 MINS)
Suggested Answers:
Directions: Summarize the similarity of the two organelles as they carry out opposite processes.
PART II
SET A: Revisit of Energy Organelles
Structure
1.
Use of Membrane
2.
Electron Transport Chain
3.
Enzyme
Chloroplast
Mitochondrion
Electron Transport Chain
SET B: Photosynthesis versus cellular respiration
Directions: Using the following descriptions for photosynthesis and cellular respiration, bring out your
long bond paper or Oslo paper, pencil, ruler, ballpen and coloring materials. Show an illustration/
diagram comparing the structure and function of chloroplasts and mitochondria. Label the parts of the
organelles. The rubric for the drawing is given below.
In Photosynthesis:
•
•
•
•
Water is oxidized and oxygen is released
Has electron transport chain located within the grana of chloroplasts, where ATP is produced by
chemiosmosis
Has enzyme-catalyzed reactions within the semi-fluid interior
Carbon dioxide is reduced to a carbohydrate
In Cellular respiration:
•
•
•
•
Use of Membrane:
In chloroplast
• An inner membrane forms the thylakoid of
the grana.
In mitochondrion
• An inner membrane forms the cristae.
Oxygen is reduced to water
Has electron transport chain located within the cristae of the mitochondria, where ATP is produced
by chemiosmosis
Has enzyme-catalyzed reactions within the semi-fluid interior
A carbohydrate is oxidized to carbon dioxide
96
In chloroplast
•
An ETC is located on the thylakoid
membrane. Electrons passed down the ETC
have been energized by the sun; The ETC
establishes an electrochemical gradient of H
+ with subsequent ATP production by
chemiosmosis.
In mitochondrion
•
An ETC is located on the cristae of
mitochondrion. Energized electrons have
been removed from glucose and glucose
products. The ETC establishes an
electrochemical gradient of H+ with
subsequent ATP production by
chemiosmosis.
Enzymes
In chloroplast
•
The stroma contains the enzymes
of the Calvin cycle. In the Calvin cycle,
NADPH and ATP are used to reduce carbon
dioxide to carbohydrate.
In mitochondrion
•
The matrix contains the enzymes of
the citric acid cycle. In citric acid cycle, the
oxidation of glucose products occurs as
NADH and ATP are produced.
Rubrics for the Drawing
Standard
Contrast and
intensity of drawing
Blending of colors
Neatness
Excellent (7 points)
Good (5 points)
Fair (3 points)
Shows exceptional artistic and skillful
color contrast; and meaningful color
concentration
Color mix is exceptionally creative,
appropriate and meaningful
Completely free from mess
Shows generally acceptable artistic
and skillful color contrasts; and
meaningful color concentration
Color mix is generally creative,
appropriate and meaningful
Almost free from mess
Shows generally vague color contrasts;
and indiscernible sense of color
concentration
Color mix needs improvement
Too messy
PART III
Directions: Group the class into triad. Make each group construct a concept map to help them develop their understanding of photosynthesis
and cellular respiration. Prepare a rubric for easy scoring.
Standard
Content knowledge
Originality in
organization of ideas
Neatness
Excellent (10 points)
Good (7 points)
Fair (4 points)
Information is complete and
accurate
Exceptionally well organized and
understandable
Completely free from mess
Information is mostly complete and
accurate
Generally well-organized and
understandable
Almost free from mess
Information is mostly incomplete and
inaccurate
Fairly understandable
Too messy
PART IV
Directions: Arrange the following to get the right energy flow sequence in aerobic respiration.
NADH
Electron Transport Chain
Glucose
Suggested Answers:
1. Glucose 2. NADH 3. Electron Transport Chain 4. ATP
Directions: Identify the following statements as photosynthesis or cellular respiration.
_______________1. Energy-releasing pathways
_______________2. Energy-acquiring pathways
Suggested Answers:
1. Cellular respiration
2. Photosynthesis
98
ATP
General Biology 1
Forms of Energy, Laws of
Energy Transformation
and Role of ATP
120 MINS
LESSON OUTLINE
Introduction Communicate the learning objectives
Motivation
The “Nanay” Analogy
5
10
Content Standard
The learners demonstrate an understanding on the forms of energy, laws on
energy transformation, ATP Structure and Function and the ATP- ADP Cycle.
Instruction/ a. Review on the idea of organisms as OPEN
SYSTEMS
Delivery
60
Learning Competency
The learners:
Practice
10
•
Explain coupled reaction processes and describe the role of ATP in energy
coupling and transfer STEM-bio11/12-IIa-j-2
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
Identify different forms of energy in their surroundings.
Present and explain a real life analogy of the ATP=ADP cycle.
Relate the experiment done and the game to free energy and equilibrium;
and ATP cycle respectively.
Explain the topics discussed in their small groups (peer learning).
b. Lesson Proper
a. Hugot “Lines”
b. ATP in everyday life
Enrichment Small-group discussion (SGD)
15
Evaluation
Quiz
20
Reflection
End of topic question
Materials
Laboratory equipment needed, raw
materials, school supplies
Resources
•
Reece JB, Urry LA, Cain ML. 2010. Campbell Biology
10th. San Francisco(CA):Pearson Benjamin Cummings;
2010. pp. 141-151.
INTRODUCTION (5 MINS)
Teacher Tip:
A. Communicate Learning Objectives
(NOTE: PLEASE DO THE MOTIVATION BEFORE DOING THE INTRODUCTION)
1. Introduce the learning objective by writing it on the board, then give the students 5 minutes (to work
in pairs) to write down on a piece of paper what they already know or what they expect to learn under
the specified topics:
•
•
•
Through this introduction, you will have an
idea where to start or how you will
approach your discussion. You may also ask
your students which topic would interest
them the most and what would interest
them the least.
Forms of energy
Laws of energy transformation
Free energy and metabolism
MOTIVATION (10 MINS)
Teacher Tip:
Start the motivation by reviewing/introducing the terms Metabolism, Anabolism, Catabolism,
Bioenergetics, free energy, Entropy, Equilibrium, Digestion, Cellular Respiration, Photosynthesis and
ATP. After refreshing the students with the terms and processes, group your students into groups of 3’s
and allow them to think of how they can relate their mom (“NANAY”) to these processes. Have at least
3 groups of students share their analogy in front of the class.
“Nanay” analogy example:
Metabolism manages materials and energy resources of the cell. We can relate it to our mom/ Nanay
because our mom is responsible most of the time in budgeting the finances and cooks food for the
family.Entropy is the measure of disorder or randomness, Nanay makes sure that all the things inside
the house are well organized especially after the kids played. Nanay lessens the house’s entropy after
the increase in entropy done by the kids after playing by placing all the things in their proper places.
Another set of analogies may include putting together the ingredients of a dish to create a palatable
viand as an example of anabolism. Or removing one by one the parts of an engine to fix a broken car
as an example of catabolism.
100
The teacher can also encourage the
students to think of other analogies that will
help them relate the lesson to their
everyday lives. Please make sure that you
look for the meaning of the terms
mentioned and read about the topic to
facilitate and make the discussion more
interesting
As long as the analogy relates to the
concepts being discussed, give credits to
your students.
INSTRUCTION/DELIVERY (60 MINS)
Start the discussion by establishing that living organisms are open systems (energy and matter can be
transferred between the system and its surroundings). Remind the students that this was already
mentioned in one of the characteristics of living organisms. Obtain and use materials for Energy, and in
the unifying theme- interaction with the environment. This way students will clearly understand that
processes (Bioenergetics) that happen within a living organism is still influenced and affects the
surroundings. The teacher may directly involve students by pointing out that humans breath the carbon
dioxide needed by plants as raw materials to produce food via photosynthesis, the teacher may use the
figure below.
Emphasize as well the role of oxygen as final electron acceptor in cellular respiration. Students should
appreciate why they need to breathe in oxygen and not other form of gases.
Teacher tip
In the start of the lesson, since the terms
metabolism, catabolism, anabolism were
already used in the motivation, the teacher
can explain it further by the use of the
downhill and uphill metabolic avenues.
Downhill avenue (Catabolism)- releases
energy that will be used, enabling energy
be stored. While Uphill avenue (Anabolism)
uses energy to build complex materials.
Solicit other examples from your students.
Engage your students by giving examples
first.
If computers/laptops or lcd projectors are
not available, the teacher may adjust the
discussion by preparing materials written on
a manila paper. The teacher may pave the
discussion in such a way that the students
will be answering or completing tables or
having the students research (homework)
about the topic. This will ensure that the
students have something in line with the
topic that will be discussed. Instead of
pictures, the teacher can ask the students to
do actual processes that will depict the
different forms of energy
Teacher tip
Energy Flow and Chemical Recycling in Ecosystems
Energy flows into ecosystem as sunlight and ultimately leaves as heat, while the chemical elements
essential to life are recycled.
Make sure that for every form of energy,
you will be able to show a solid example in
living systems how energy forms exists and
transformed.
Forms of Energy
Teacher Tip
Energy is the capacity to cause change. It is also the ability to rearrange a collection of matter. In the
environment different forms of energy exist: Kinetic, Light and Potential energy.
This part of the topic will really be the least
of interest of the students. That’s why
exploring the trend in terms of the “hugotlines” may help you in engaging students.
Inform your students that at the end of the
discussion you will be having the “hugot
line” activity that will be based on the laws
of thermodynamics. So they can start
preparing for their “hugots” as you discuss
the laws of thermodynamics.
•
•
•
•
•
Kinetic- energy associated with relative motion of objects
Thermal energy-type of kinetic energy associated with random movement of atoms. When thermal
energy is transferred in the form of heat.
Light Energy- main energy source is the sun and powers photosynthesis (anabolic process).
Potential Energy- possessed energy of a matter at rest (non- moving form)
Chemical energy- potential energy released in a chemical reaction
Laws of Energy Transformation
Thermodynamics is the study of energy transformations that occurs in a
system (collection of matter). Living systems are considered as open
systems because energy and matter are transferred between systems and
the surroundings.
1st Law: The energy of the universe is constant: Energy can be
transferred and transformed but it cannot be created nor destroyed.
Plants do not produce energy, but transforms energy from the sun. Some
energy becomes unavailable to do work because most is lost as heat.
Transfer of energy and transformation makes the matter more
disordered. Disorder of matter is measured through entropy.
The teacher may also incorporate the concept on pyramid of energy,
where energy availability per trophic level decreases as one goes from
produces to the top consumer. Only the energy stored by herbivores as
biomass will be available to 1st order carnivores.
102
Laws of Energy Transformation
Teacher Tip
Thermodynamics is the study of energy transformations that occurs in a system (collection of matter).
Living systems are considered as open systems because energy and matter are transferred between
systems and the surroundings.
Use the figure used, but make sure to note
that an individuals’ contribution to the
disorder in surrounding is not obviously felt,
but as a group it is. Use the idea of having
lots of people inside the room compared to
an individual inside the room.
1st Law: The energy of the universe is constant: Energy can be transferred and transformed but it
cannot be created nor destroyed. Plants do not produce energy, but transforms energy from the sun.
Some energy becomes unavailable to do work because most is lost as heat. Transfer of energy and
transformation makes the matter more disordered. Disorder of matter is measured through entropy.
2nd Law: Every energy transfer or transformation increases the energy of the universe.
•
•
i.e In a room full of people, breathing increases entropy since all are exhaling carbon dioxide.
Organisms as open system increase order as long as the order in their surroundings decreases. This
shows that as living organism transfers/transforms energy to its surroundings, the disorder
increases, thus increases entropy.
Free Energy
•
•
•
•
•
•
•
•
Energy that can do work under cellular conditions
Gibbs free energy is the energy in the system that can perform work when temperature and
pressure are uniform throughout the system: ∆G = ∆H – T∆S
Also known as free energy change
Measure of system’s instability (trend: tendency to change to a more stable state)
Increase in G: UNSTABLE i.e. concentrated dye
Decrease in G: STABLE i.e. dye dispersed in water
In chemical reactions: as reaction precedes equilibrium, the free energy of reactants and products
decreases (decreases free energy). If products will be removed free energy will increase
When systems reach maximum stability, the system reaches the state of equilibrium. If equilibrium is
reached there is NO WORK. In chemical reactions proceeding equilibrium NO NET CHANGE in the
relative concentration of reactants and products.
The teacher must take note that there is
unstoppable trend towards randomization
of the universe as a whole.
∆G = ∆H – T∆S, where ∆H is enthalpy (total
energy), T is absolute temperature and ∆S is
the change in entropy.
If it is possible to show the concentrated
dye experiment (diffusion of dye in water), it
will be a big help. But before asking the
students to do it, make sure that you
prepare questions that will be answered to
lead the students in the discussion of free
energy.
NOTE: You may have the first two bullets
answered by the students before doing your
discussion. Then after the discussion have
the last 3 bullets answered.
•
•
•
•
•
Describe the free energy (G) of the
concentrated dye? Does it have high or low
free energy? Is it stable or unstable?
When do we say that the dye reached the
stable state?
Is there a way for the diffused dye system to
undergo spontaneous change? How will you
do it?
How will you relate the closed hydroelectric
system to the set up of the dye diffusion
experiment?
•
How will you relate the multistep
hydroelectric system to the dye diffusion
experiment?
Free Energy and Metabolism
Teacher Tip:
•
•
Exergonic reactions- energy is released (energy outward), more decrease in free energy= more work
done
Endergonic reactions- energy is absorbed (energy inward). Plants stores energy in the form of
glucose (from carbon dioxide and water
Equilibrium and Metabolism
•
•
•
Equilibrium = NO WORK. This usually happened in isolated systems that reach equilibrium.
A cell that reaches the state of equilibrium is DEAD
A normal cell is not in equilibrium, because its products are not accumulated within its system,
INSTEAD the products becomes a reactant in the next step.
104
It will be really helpful if you use the
example of an isolated/closed hydroelectric
system and an open hydroelectric system. A
closed hydroelectric dam will reach
equilibrium while the open hydroelectric
system will not since the overspill will be
used by another system. You may also think
of other examples that are parallel to the
hydroelectric system example.
You may also use the dye diffusion
experiment that you did in explaining the
isolated hydroelectric system as example.
Add a drop of concentrated dye to a glass
of water. Since it is a closed hydroelectric
system, the procedure stops there, where
the dye already reached the state of
equilibrium
Adenosine Triphosphate (ATP)
•
•
•
•
•
•
•
•
Structure composed of: sugar ribose, nitrogen base adenine and a chain of 3-phosphate groups
Mediates most energy coupling in cells
Powers cellular work
3 main kinds of work of a cell: chemical work, transport work and mechanical work. These are
possible through energy coupling, where the cells use and exergonic process to drive an
endergonic reactions.
chemical work: synthesis of polymers from monomers (pushing of endergonic reactions)
transport work: pumping of substances across membranes (against the direction of spontaneous
movement)
mechanical work: beating of cilia, contraction of muscles
also used to make RNA (since ATP is used as one of the nucleoside triphosphate)
ACTIVITY: Calamansi Relay ala ATP cycle
Materials: Calamansi, plastic spoons (30)
In an oval (if there is any in your area) or a lot where students can play the relay
divide the class into 3 groups (10 members per group) assuming that there are 30
students in a class. Define who’s going to be number 1-10 (refer to the figure
below). At your mark they will start the relay. Student 1 must be able to successfully
pass the calamansi (calamansi on a plastic spoon bitten by student 1) to the
students 2’s plastic spoon (must be bitten). The student’s hand must be at their back,
NO USING OF HANDS. If the calamansi falls from the spoon the student has to go
back to his/her starting point before proceeding in passing the calamansi to the next
player. The group that will finish first will be the winner. The winner will be awarded
with bonus points.
Do the game before discussing the ATP hydrolysis and ATP cycle. Make sure that you read the game
mechanics and do the adjustments to fit your classes. At the end of the activity discuss how it is related
to ATP hydrolysis and ATP cycle.
•
Calamansi: water (for hydrolysis)
•
Students: phosphates that is cleaved
Teacher Tip:
The multistep hydroelectric system can be
explained through the dye diffusion
experiment by using more than one glass or
water. You may show this by having the
concentrated dye dropped to the first glass.
Describe how the dye decreases free
energy and how it becomes more stable by
diffusing. But this doesn’t end with this set
up, get another dropper and obtain a
sample of the colored water from glass 1
then drop it into the clear water in glass 2.
This way you are showing that the dye that
had decreased its free energy and improved
to be more stable can still undergo
spontaneous change. Then repeat the
procedure from glass 1 to glass 2 for the
succeeding glasses. With this, you were able
to show that a multi-step open hydroelectric
system will not reach equilibrium because
the product becomes the reactant for the
next reaction.
Teacher tip:
The phosphate bonds of the ATP must not
be termed as high-energy phosphate
bonds. The bonds of the phosphate groups
of the ATP are not strong bonds but
instead, the reactants (ATP and water)
possess high energy compared to the
product.
•
Students exerting effort to reach the other end: energy releasing process to allow ADP + P to
produce ATP (phosphorylation)
•
Bonus/incentive for the winner: energy
•
2 groups: ATP and ADP
Teacher Tip
As for supplementary resource, you may
look for videos that clearly explains the
hydrolysis of ATP and the ATP Cycle. You
may ask your students to view it before the
class (HW) or have it shown in class as you
discuss it.
Hydrolysis of ATP
•
•
•
•
•
•
process of breaking down bonds between the phosphate groups
this happens when a water molecule breaks the terminal phosphate bond
HOPO32-, abbreviated P I leaves ATP
Forming Adenosine diphosphate (ADP)
Energy is released. This comes from the chemical change of the system state of lower free energy
and NOT from the phosphate bonds.
Hydrolysis relases so much energy because of the lnegative charges of the phosphate groups.
These charges are crowded together and their mutual repulsion contributes to the instability of that
region of the ATP. The energy equivalent of the triphosphate tail of ATP is compared to a
compressed spring.
106
Teacher Tip
Look for videos showing the 3 cellular work
powered by ATP. For the students to
appreciate these processes more and for
them to clearly see that its really happening
in living systems.
You may also use the lessons they had in
endomembrane system and transport
mechanisms to facilitate the discussion in
this part of the topic.
How the Hydrolysis of ATP Perform Work
•
•
Proof that ATP releases heat: in a test set up, the hydrolysis of ATP releases energy in the form of heat in the surrounding water.
Most of the time when an animal is exposed in a cold environment, the reaction of the body is through shivering. In this reaction of the
organism, shivering uses ATP during muscle contraction to warm the body. Since it will also be a disadvantage for organisms to generate
heat during ATP hydrolysis, in order to maintin the living conditions inside the cell, the energy released during ATP hydrolysis is used by
proteins to perform work: chemical, transport and mechanical
• Hydrolysis of ATP leads to change in the shape of protein and in its ability to bind to another molecule. Phosphorylation (ADP to
ATP) and dephosphorylation (ATP to ADP) promote crucial protein shape changes during important cellular process
The Regeneration of ATP
•
•
•
•
•
•
•
ATP is a renewable it can be regenerated by the addition of phosphate to ADP
Catabolism (exergonic) provides the free energy to phosphorylate ADP.
ATP formation is not spontaneous, so there is a need to use free energy for the process to work.
ATP cycle is the shuttling of inorganic phosphate and energy.
It couples the cell’s energy yielding processes (exergonic) to energy consuming process (endergonic)
ATP regeneration happens very fast (10M molecules of ATP used ad regenerated per second)
If ATP could not be regenerated by phosphorylation of ADP, HUMANS would use nearly their body weight in ATP each day.
108
PRACTICE (10 MINS)
A. “Hugot-lines”. Create “hugot-lines” based on the laws of transformation of energy. Ask your
students to create 3 “hugot-lines” per law under the transformation of energy. The student must give
justification for each “hugot-line” they’ll create. Make sure that the “hugot-lines” are in tune with the
scientific concepts of the law of thermodynamics.
B. ATP in everyday life. Ask your students to make an analogy relating the concepts under ATP (ATP
cycle, ATP hydrolysis, How ATP allows organisms to do work) or the relevance of ATP in our lives. After
listing the analogies or the relevance of ATP in our lives, ask the students to write their reflection/
realization regarding the topic.
ENRICHMENT (15 MINS)
Small Group Discussion. Allow your students to meet in groups (5 students per group) Assign each
students to a topic below:
• Forms of energy
• Transformation of energy
• Free energy and metabolism
• ATP- structure and function
This is to see how much the students understood the lesson. Encourage your students to explain the
concepts in their own words. You may allow you students to use their notes in this small discussion. If
they have an access to internet and can bring their gadgets, you may also encourage them to save
videos that will help them explain their topic.
EVALUATION (20 MINS)
The teacher can make his/her own list of questions that will allow students to practice critical thinking
skills. Having this short quiz done by group of 2s or 3s will allow students to discuss and decide among
themselves. If a student opts to answer individually, allow him/her. The teacher can prepare a multiplechoice type of evaluation if he/she is not comfortable with this type of exam
1. Explain metabolism through creating an appropriate analogy.
2. What is the difference between Catabolic and Anabolic reaction? How do each process compliment
one another?
3. What is the importance of having exergonic reactions in the body?
4. What is the disadvantage if there are not enough endergonic reactions in the body? Relate this to
the ATP cycle.
5. What happens when energy transforms to another form? Is the yield unchanging for every
transformation? Why or Why not?
6. Which law of thermodynamics states that energy transfer or transformation increases the state of
disorder of the universe?
7. Why do we consider living organisms as open systems?
8. If free energy is higher, does it mean that the system is more stable (Y/N) N? What does this imply
in the amount of work that can be done?
9. If free energy is lower,does it mean that there is greater work capacity? (Y/N) N What does this
imply about the systems stability?
10. How can you tell that a cell has reached equilibrium? What properties does it display?
11. (Y/N) Is the hydrolysis of ATP reversible? If Yes, explain your answer.
12. Describe how phosphorylation works (what drives it)?
13. How does the cell go about the continuous release of heat during ATP hydrolysis?
14. What will happen to the body if the regeneration of ATP is very slow?
15. How does the multi-step open hydroelectric system explain cellular respiration?
Teacher Tip
REFLECTION (HOMEWORK FOR THE NEXT MEETING)
•
•
•
•
Which of the topics interest you the most? Why?
Which of the topics interest you the least? Why?
Did the activities help you understand the topic (Y/N)? Explain your answer.
Did you see the significance/ connection of the topic in your life?
110
Encourage your students to answer this
section truthfully as it will also help you
improve the lesson and your approach.
General Biology 1
240 MINS
Energy Transformation Pt.1
Content Standard
The learners demonstrate an understanding of photosynthesis.
LESSON OUTLINE
Introduction Assess prior knowledge through a class
10
Learning Competency
The learners explain the importance of chlorophyll and other pigments
(STEM_BIO11/12 – IIa-j-3)
Motivation
Laboratory activity on separating plant
pigments through paper
chromatography
50
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
Instruction/ Discussion on chlorophyll,
Delivery
photoexcitation of chlorophyll, and the
120
•
•
•
•
separate and identify the different pigments present in plants through a
simple paper chromatography experiment
discuss the role of pigments in photosynthesis
illustrate how chlorophyll absorbs and transforms light energy
define and describe a photosystem
activity on word clustering
photosystem
Practice
Formative assessment through summary
reporting
20
Enrichment Answering of critical thinking questions
20
Evaluation
20
Short quiz on topics discussed in the
lesson
Materials
• laboratory materials and supplies for the chromatography
experiment (i.e., chromatography or filter paper,
glassware, acetone/solvent, spinach leaf, coleus leaf, coin,
pencil, aluminum foil, ruler, and coffee stirrer)
•
prism
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition. Pp.92
– 98. Belmont, California: Brooks/Cole-Tomson Learning.
INTRODUCTION (10 MINS)
Teacher Tip:
1. Assess the learners’ prior knowledge of the topic by facilitating a class activity on clustering or word
webbing. Write the word CHLOROPHYLL on the board. This will serve as the ‘nucleus word’.
2. Ask the learners to think of words or images associated with the ‘nucleus word’ and let them write
the words or sketch the images around the ‘nucleus word’.
3. Encircle each word or image and draw a line from each item to the ‘nucleus word’.
4. Ask the learners to write how each word or image is related to the ‘nucleus word’ CHLOROPHYLL
and have them write the relation above or below the line that you drew.
5. Ask the learners to summarize the word web formed by the class.
6. After the summary, present the following questions to the class:
• Why are chlorophyll and other plant pigments important?
• How do chlorophyll and other plant pigments help in carrying out photosynthesis?
By assessing the learners’ prior knowledge,
you will be able to gauge what they already
know and what they still need to learn from
the lesson. This will help you design and
determine the topics that you need to
include and those that you need to reiterate
and emphasize in your discussions.
Posing essential questions at the start of a
lesson helps stimulate thoughts, promotes
inquiry, and motivates the learners to find
and formulate ways to be able to come up
with the correct responses.
These essential questions shall help the learners focus in finding the correct responses.
Teacher Tip:
MOTIVATION (50 MINS)
To help the learners acquaint themselves with different plant pigments, instruct them to perform a
laboratory activity on chromatography of plant pigments. This activity will allow them to visually
demonstrate that leaves contain different colored pigments.
Before performing the experiment, provide a brief description of chromatography.
Chromatography—is a separation technique used to identify various components of mixtures based
on the differences in their structure and/or composition. It involves a stationary phase (e.g., paper or
any thin layer of an absorbent surface) and a mobile phase (i.e., solvent containing the dissolved
substances). The solvent will move up the paper through capillary action carrying with it the dissolved
substances. These substances will be carried along at different rates because they are not equally
soluble in the solvent and they will be attracted in different degrees to the paper.
Provide the learners with a copy of the instructions for the activity. Guide them as they perform the
experiment.
112
Use the following guidelines in performing
the laboratory activity:
• Make sure that the learners have
knowledge of safety practices in the
laboratory.
• Let the learners work in groups in order
to smoothly carry out the experiment.
• Prepare the materials a day before the
activity.
Extracting Plant Pigments through Chromatography
Objective: Perform chromatography to separate a mixture of pigments from plants
Materials per group:
•
Chromatography paper strips or filter paper about 1cm x 15cm in size
•
Acetone (solvent)
•
150 ml beaker or a tall glass jar
•
aluminum foil to serve as cover for the beaker
•
fresh spinach leaf
•
Coleus leaf or other leaf that is red in color
•
coin
•
pencil
•
ruler
•
coffee stirrer or plastic stick
Procedure (Adapted with modifications from
<http://www.dal.ca/content/dam/dalhousie/pdf/faculty/science/imhotep/9.2-Discovering-PlantPigments.pdf>):
1. Using a pencil, draw a base line that is 2cm from the bottom of the paper strip. Be careful in
handling the chromatography paper as oil from the human skin can alter the results. Lift the paper
only by its sides and be careful not to touch its front.
2. Place the spinach leaf over the paper. Pressing hard, roll the edge of the coin, and rub the leaf onto
the paper, following the path of the line. Repeat until the line turns very dark.
3. Repeat the same process for the Coleus leaf using a second strip of chromatography paper.
4. Add enough acetone to cover the bottom of the beaker or glass jar (no more than 1cm high).
5. Attach the top of the paper strips to a pencil or a coffee stir stick. This can be done by making a
loop with the top of the paper and fastening it with a paper clip or tape.
6. Lay the pencil or stick across the top of the beaker so that it suspends the paper above the liquid.
The bottom of the paper strip must be dipped in the solvent but the solvent should not surpass the
2cm baseline that is the point of origin.
7. Cover the beaker and allow 15–30 minutes for the solvent to rise through the strips.
8. Remove the paper strips just before the solvent reaches the top.
9. Lay the paper strip face up. Using the pencil, immediately mark the line where the solvent stopped
before it evaporates. This is called the solvent front.
10. Allow the strips to dry.
11. Before the pigments fade, mark the top of each color that you can identify.
12. Measure the distance (in mm) travelled by each pigment from the point of origin.
13. Tabulate your data. Show the following information in your table: color observed, distance
travelled, and probable pigment.
INSTRUCTION/DELIVERY/PRACTICE (120 MINS)
Teacher Tip:
Using the learners’ observations from the experiment and the data they have gathered, have them
discuss their analysis and conclusion among their groups with the help of these guide questions:
•
•
•
•
•
The learners’ discussion of the experiment’s
result, analysis, and conclusion will
jumpstart the lecture and discussion on
pigments and their role in photosynthesis.
Which pigments were you able to observe in your chromatogram?
Why do the pigments move at different rates through the chromatogram?
How do the spinach leaf and Coleus leaf differ from each other in terms of their pigments?
Which of the two leaves can carry out photosynthesis better? Why?
Why is it an advantage for plants to have different colored pigments?
Let the groups share their analysis and conclusion in class.
Discuss the following concepts:
Teacher Tip:
Pigments
Pigments are substances that absorb visible light. Different pigments absorb light of different
wavelengths.
114
If a prism is available, you may use it to
demonstrate the various colors of visible
light.
Light, as it encounters an object, is either reflected, transmitted, or absorbed. Visible light, with a
wavelength of 380–750nm, is the segment in the entire range of electromagnetic spectrum that is most
important to life on earth. It is detected as various colors by the human eye. The color that is not
absorbed by pigments of objects is transmitted or reflected and that is the color of the object that we
see.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Figure'1:!The!Electromagnetic!Spectrum!
Pigments are the means by which plants capture sun’s energy to be used in photosynthesis. However,
since each pigment absorbs only a narrow range of wavelength, there is usually a need to produce
several kinds of pigments of different colors to capture more of sun’s energy.
Chlorophyll
Chlorophyll is the greenish pigment found in the thylakoid membrane inside the chloroplast of a plant
cell. The figure below shows the location and structure of a chloroplast.
Teacher Tip:
Encourage participation from the students
while discussing these concepts.
Chlorophyll absorbs blue and red light while it transmits and reflects green light. This is why leaves
appear green.
There are several kinds of chlorophyll. Among these, chlorophyll a plays the most important role in
photosynthesis. It directly participates in converting solar energy to chemical energy.
Other pigments in the chloroplast play the part of accessory pigments. These pigments can absorb
light and transfer the energy to chlorophyll a. One of these accessory pigments is chlorophyll b. Some
carotenoids also contribute energy to chlorophyll a. Other carotenoids, however, serve as protection for
chlorophyll by dissipating excessive energy that will otherwise be destructive to chlorophyll.
Structure of chlorophyll
• Head—a flat hydrophilic head called porphyrin ring. It has a magnesium atom at its center. Different
chlorophylls differ on the side groups attached to the porphyrin.
•
Tail—a lipid-soluble hydrocarbon tail.
How does photoexcitation of chlorophyll happen?
1. A chlorophyll molecule absorbs photon or light energy.
2. An electron of the molecule in its normal orbital, said to be in its ground state, will be elevated to
an orbital of a higher energy. The molecule is now in an excited state. The molecule only absorbs
photon that has the energy that is equal to the energy needed for it to be able to elevate from the
ground state to the excited state.
3. The excited state is unstable. Hence, excited electrons drop back down to the ground state
immediately after, releasing energy in the form of heat and photon. This happens in isolated
chlorophyll molecules. However, chlorophyll molecule that is found in its natural environment in the
thylakoid membrane forms a photosystem together with proteins and other organic molecules to
prevent the loss of energy from the electrons.
116
Teacher tip
For this part, you may ask some learners to
volunteer to show the location of
chlorophyll in a leaf of a plant. They may do
this through drawings or sketches in the
board.
Teacher tip
Reiterate the importance of the formation
of photosystem. The formation of the
photosystem prevents the excited electrons
from going back to the ground state, thus
preventing the loss of energy which is
essential for photosynthesis to occur.
Figure 4: Photoexcitation of Chlorophyll
Photosystem
A photosystem is an aggregate of pigments and proteins in the thylakoid membrane responsible for
the absorption of photons and the transfer of energy and electrons. It is composed of:
•
Light-harvesting complex— is also called the ‘antenna’ complex and is consisted of several different
pigments (chlorophyll a, chlorophyll b, and carotenoids) bounded with proteins. When a pigment
molecule absorbs a photon, energy is passed on from one pigment molecule to another pigment
molecule until the energy reaches the reaction center.
•
Reaction-center complex—is composed of a pair of chlorophyll a and a primary electron acceptor.
The primary electron acceptor is a specialized molecule that is able to accept electrons from the
pair of chlorophyll a. The pair of chlorophyll a in the reaction-center is also specialized because they
are capable of transferring an electron to the primary electron acceptor and not just boosting the
electron to a higher energy level.
There are two types of photosystem:
•
•
Photosystem II—was discovered later after the discovery of Photosystem I, but functions first in the
light reaction of photosynthesis. The chlorophyll a in the reaction-center of Photosystem II
effectively absorbs light with a wavelength of 680nm and thus called P680.
Photosystem I—was discovered first. Its reaction-center has a chlorophyll a called P700 because it is
effective in absorbing light with a wavelength of 700nm.
PRACTICE (20 MINS)
Teacher tip
1. Divide the class into three groups. Assign each topic you discussed to each group: chlorophyll and
other pigments, photoexcitation of chlorophyll, and photosystem.
2. Instruct each group to perform a Summary Report of the topic assigned to them. Each member of
the group will have to say something about the topic without consulting their notes.
3. Give the groups enough time to organize and consolidate their report before asking them to
present in class.
ENRICHMENT (20 MINS)
Ask the learners to answer the following questions:
•
•
In places where there are four seasons (i.e., winter, spring, summer, and fall), how do plants
cope with the change in season? Give a detailed description and explanation.
Chlorophyll-enriched products and supplements are now being sold in the market. Find out
what benefits these products claim. With your knowledge about chlorophyll, do you think
these claims are valid? Support your answer.
Ask the learners to share their answers in class.
118
This activity will serve as a formative
assessment to evaluate the learners’
understanding of the lesson. This will also
provide you an opportunity to reinforce
concepts that are not clearly understood
and to rectify misconceptions, if there are
any.
EVALUATION (20 MINS)
Give the students a short quiz to assess their understanding of the topics discussed in the lesson.
You may formulate other questions that can gauge their learning.
What happens to light when it hits an object.
What wavelength of light is most important to life on earth?
How do plants capture the sun’s energy?
In what cell organelle can we find chlorophyll? In what structure
of this organelle is chlorophyll located?
5. What color/s of light does chlorophyll absorb? What color does
it reflect?
6. What might be the advantage of accessory pigments?
7. What happens to a chlorophyll molecule when it absorbs
photons?
8. How do chlorophyll molecules prevent the loss of energy when
electrons go back to the ground state?
9. What composes a photosystem?
10. In what part of the photosystem does the first step of light
reaction takes place?
11. Differentiate the two types of photosystem.
1.
2.
3.
4.
General Biology 1
180 MINS
Energy Transformation Pt.2
Content Standard
The learners demonstrate an understanding of photosynthesis.
LESSON OUTLINE
Learning Competency
The learners describe the patterns of electron flow through light reaction
events (STEM_BIO11/12–IIa-j-4)
Introduction Communicating learning competencies
20
Motivation
10
and outcomes; Familiarization with key
terms
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
differentiate the two stages of photosynthesis
identify the important molecules involved in the light reactions
describe the events and processes happening during light reactions
Establishing the importance of
photosynthesis to all organisms by using
plant samples
Instruction/ Discussion on the events of light
Delivery
reactions.
60
Practice
60
Role-playing activity
Enrichment Think-pair-share class activity
10
Evaluation
20
Quiz on the light reactions events
diagram
Materials
• samples and photos of plant products (e.g. fruits and
vegetables)
•
materials for the role-playing activity (e.g. tennis balls or
soft balls, lids, and labels)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003 ). Biology: Concepts and Applications 5th edition. Pp.98
- 100. Belmont, California: Brooks/Cole-Tomson Learning.
120
INTRODUCTION (20 MINS)
1. Communicate the learning competencies and learning outcomes of this lesson to the class.
2. Give the learners enough time to research on the definition and description of the following
keywords:
• light reactions
• noncyclic electron flow
• cyclic electron flow
• plastoquinone (Pq)
• plastocyanin (Pc)
• ATP
• photophosphorylation
• ferredoxin
• NADP+
• NADPH
• chemiosmosis
MOTIVATION (10 MINS)
1. Establish to the learners that photosynthesis is important not only to plants but also to other living
organisms such as humans.
2. Show pictures of food with vegetables or fruits to the class. You may also bring real fruits and
vegetables to the class. Let the learners identify them.
3. Ask the learners what percentage of their diet consisted of fruits and vegetables.
Ask learners to make conclusions on the role played by plants in converting the sun’s energy to a
form of energy that the human body can use.Using a pencil, draw a base line that is 2cm from the
bottom of the paper strip. Be careful in handling the chromatography paper as oil from the human
skin can alter the results. Lift the paper only by its sides and be careful not to touch its front.
Teacher Tip:
Communicating the learning competencies
and learning outcomes shall give the
learners an idea on what they can expect to
learn from the lesson.
You may also opt to establish prior
understanding of the topic or lesson. You
can ask the learners to show specific hand
signals depending on how familiar they are
on the topics to be discussed. For example,
they can do a ‘thumbs up’ to indicate
extensive understanding of the specific
topic, a ‘thumb to the side’ to signify
enough understanding of the topic, and a
‘thumbs down’ to show little or no
understanding at all.
INSTRUCTION/DELIVERY (60 MINS)
Teacher Tip:
You may the students to write on the board
the chemical reaction for photosynthesis.
Review the chemical reaction for photosynthesis:
6 CO2 + 6 H20 + sunlight
C6H12O6 + 6 O2
Ask the learners to identify which among the reactants is/are used in the light reactions and the Calvin
cycle.
Give an overview and further differentiate the two stages of photosynthesis.
•
•
Light reactions—use sunlight to initiate electron transfer, thereby reducing NADP+ to NADPH and
splitting water to give off oxygen as a by-product.
•
form ATP through phosphorylation
•
take place in the thylakoids of the chloroplast
Calvin Cycle—sometimes referred to as ‘dark reactions’ because it does not require light energy for
its processes to take place
•
incorporates CO2 into organic molecules through carbon fixation
•
uses NADPH and ATP to produce carbohydrate from the fixed carbon
•
takes place in the stroma of chloroplast
•
returns ADP, inorganic phosphate, and NADP+ to the light reactions
Show an image of the light reactions similar to the one shown in Figure 2 below:
122
Using a diagram showing an overview of
photosynthesis, have the students figure out
differences between the two stages
involved.
Teacher Tip:
While discussing the events in the light
reaction, make sure to engage the learners
and encourage them to participate by
asking questions before proceeding with
the discussion on each step or event.
The following could be sample questions:
• What happens to electrons when they
encounter light energy?
• How is oxygen formed in the first phase
of light reaction?
• What happens to the hydrogen ions
formed from the splitting of water
molecules?
Teacher Tip:
Figure 2: The Light Reactions
From the image or diagram of the light reactions, ask the learners to identify the key players involved in
the process.
You may review the concept of redox
reaction in this part.
In an oxidation reaction, a molecule loses
one or more electrons and becomes more
positively charged.
In a reduction reaction, a molecule gains
one or more electrons and becomes more
negatively charged.
Oxidation and reduction reactions are most
often paired, resulting to a redox reaction.
As a molecule is oxidized, the molecule that
accepts the electrons is reduced.
Teacher Tip:
Proceed to an in-depth discussion of the steps or events in light reactions.
Light Reactions Events
1. Light energy or photon is absorbed by a pigment molecule of the light-harvesting complex of
Photosystem II and is passed on to other pigment molecules nearby until the energy makes it to the
reaction center. In the reaction center, it is absorbed by the P680 pair of chlorophyll a.
Integrate the First Law of Thermodynamics
which states that energy can be transferred
or transformed from one form into another
but cannot be created nor destroyed. Ask
the students how the First Law of
Thermodynamics is applied in
Photosynthesis. Ask the learners to cite
specific events in the process that illustrates
the law.
2. The electron in this pair of chlorophyll a is raised to an excited state and is transferred to the
primary electron acceptor. P680 loses its electron and becomes positively charged (P680+).
3. The positively charged molecule attracts electrons from a water molecule, resulting to the splitting
up of H20 into two electrons, two hydrogen ions (H+), and an oxygen atom with the provision of
light energy. The oxygen atom immediately combines with another oxygen atom to form an oxygen
molecule (O2) which is then released outside the leaf through the stomata.
4. The excited electrons are then passed on from the primary electron acceptor to the electron carrier
molecules through the electron transport chain until they reach Photosystem I. The electron carrier
molecules involved here are plastoquinone (Pq), a cytochrome complex, and plastocyanin (Pc).
5. At each transfer, the electrons release small amounts of energy. This energy is used to pump
hydrogen ions across the membrane. The splitting up of water molecules results to an uneven
distribution of hydrogen ions in the stroma and the lumen. The H+ ions tries to equalize their
distribution by moving from the lumen to the stroma through the aid of a membrane protein called
ATP synthase. This is referred to as chemiosmosis. The movement of hydrogen ions through the
ATP synthase channel triggers the synthesis of ATP from ADP. The ATP contains high-energy
phosphate bonds.
6. Meanwhile, photon is also absorbed and energy is passed on from one pigment molecule to
another until the energy reaches the reaction center complex of Photosystem I. The energy excites
the electron present in the pair of P700 chlorophyll a located here. The excited electron is then
transferred to a primary electron acceptor, making the P700 positively charged and now seeking
electrons to fill up the missing ones. This is filled up by the electrons from Photosystem II that are
passed on through the electron transport chain.
7. The photo-excited electron from the primary electron acceptor of Photosystem I enters another
electron transfer chain, passing the electron to an iron-containing protein called ferredoxin (Fd).
8. An enzyme, the NADP+ reductase, then transfers the electron to NADP+ and stabilizes it by adding
a proton (H+) to form NADPH. NADPH is then released to the stroma and becomes part of the
Calvin Cycle.
Cyclic Electron Flow
Aside from the usual route of electron flow as described in the events of the light reactions (i.e.,
noncyclic or linear electron flow), photo-excited electrons may take a short-circuited route which utilizes
Photosystem I but not Photosystem II. The ferrodoxin goes back to the cycle and passes the electron
124
to the cytochrome complex and to the Pc until it reaches P700 chlorophyll instead of transferring the
electron to NADP+reductase. Due to this event, no NADPH is produced but ATP is still synthesized.
Figure 3: Cyclic Electron Flow
PRACTICE (20 MINS)
Teacher tip
LIGHTS, Camera, ReACTIONS!
1. Take the class outside the classroom and look for a wide area that will allow the learners to move
around.
2. Ask the learners to pick a role as players in light reaction events (e.g., hydrogen ions, oxygen atoms,
etc.).
3. Let the learners plan how they are going to act out the process.
4. You may provide the following information and materials to assist them in planning and performing
the roleplaying activity.
Materials:
•
balls (tennis balls or soft balls) that will serve as electrons
•
lids or any material that will serve as light energy or photon
•
labeled cards for the following roles:
sun
•
pigment molecules (several learners)
•
water molecule (i.e., oxygen atom and hydrogen ions)
•
P680
•
primary electron acceptors
•
electron carriers (i.e., Pq, cytochrome complex, Pc, and Fd)
•
ADP
•
P700
•
NADP+ reductase
•
NADP+
Ask the class present their simulation of the light reactions.
6.
After the presentation, provide feedback, if there is any.
This activity shall help the learners process
the information that they acquired. This
shall ensure that the learners acquire a
deeper understanding of the concepts.
Through this activity, you shall have an idea
of how well the learners understood the
topics you discussed. It shall give you the
chance to correct any misunderstandings
and misconceptions they might have
regarding the lesson.
•
5.
For this part of the lesson, the learners shall
take on roles and act out the events that
happen during light reactions. This shall be
a class effort and shall need each learner’s
cooperation to be able to accurately act out
the events. Learners who are not directly
involved in the performance shall serve as
director and scriptwriters to ensure the
smooth flow of the ‘play’.
126
ENRICHMENT (60 MINS)
Think-Pair-Share
1. First, instruct the learners to determine what event/s in the light reactions they consider to be the
most significant to humans.
Teacher tip
You may also opt to formulate questions to
be answered as a quiz. The quiz may be
done individually or in pairs.
2. Next, ask the learners to look for a partner and share their response.
3. Then, ask the pairs to share their responses to the whole class. Pair: Look for a partner and discuss
your answers.
EVALUATION (20 MINS)
Assess the learners’ understanding of the lesson by having them accomplish the diagram below. They need to fill in the empty shapes with the
names of the molecules involved in the processes. This activity may serve as a quiz.
Assign a homework to the class. Ask the learners to conduct a research and answer this question: What do you think is the importance of the
Cyclic Electron Flow to the process of photosynthesis and to the cell?
General Biology 1
240 MINS
Energy Transformation Pt.3
Content Standards
The learners demonstrate an understanding of photosynthesis.
LESSON OUTLINE
Learning Competency
The learners describe the significant events of the Calvin Cycle
(STEM_BIO11/12-IIa-j5)
Introduction Communicating learning competency
10
Motivation
20
and learning outcomes; Description of
the stages of the Calvin Cycle
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
describe the phases of the Calvin cycle
identify the important molecules needed in the Calvin cycle
identify the molecules produced in the cycle
Familiarization with key words and
researching for their meanings or
definitions
Instruction/ Discussion on the three phases of Calvin
Delivery
cycle
60
Practice
60
Building of a three-dimensional model of
the Calvin Cycle
Enrichment Researching and reporting on the
60
Evaluation
30
photosynthetic adaptations of C3, C4,
and CAM plants
Class quiz
Materials
• materials for making three-dimensional models of the
Calvin Cycle (e.g., clay, Styrofoam balls, beads, and art
materials)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco(CA):
Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition.
Belmont, California: Brooks/Cole-Tomson Learning.
128
INTRODUCTION (10 MINS)
Teacher tip
1. Present the learning competency and learning outcomes for this lesson.
2. Describe the significant events of the Calvin cycle.
3. Review the basic features of the Calvin cycle.
Let the learners provide the overview or
description of the Calvin cycle.
You may refer to the equation of
photosynthesis in introducing the topic.
The Calvin Cycle
•
also referred to as light-independent reactions or “dark reactions”
•
takes place in the stroma of the chloroplast
•
second stage of photosynthesis that is involved in the formation of sugar from CO2 using chemical
energy stored in ATP and NADPH, the products of light reactions
MOTIVATION (20 MINS)
1. Write the following terms on the board: CO2
• RuBP
•
ATP
•
Rubisco
•
NADPH
•
3-phosphoglycerate (PGA)
•
G3P
•
1,3-biphosphoglycerate
2.
Explain to the learners that these terms are the key players in the Calvin cycle that they need to
familiarize themselves with.
3. Instruct the learners to research the meaning and description of the molecules involved in Calvin
cycle.
INSTRUCTION/DELIVERY (60 MINS)
Give a lecture-discussion on Calvin cycle.
The Calvin Cycle
Important points to know:
•
The sugar that is produced in the Calvin Cycle is not the six-carbon glucose that we are
familiar with. This is formed later on. What is produced in the Calvin Cycle is a three-carbon
sugar known as G3P or glyceraldehyde-3-phosphate.
•
The Calvin Cycle needs to ‘spin’ three times to make one molecule of G3P from three
molecules of CO2.
Three Phases of Calvin Cycle:
Carbon Fixation
•
•
•
Carbon fixation is a process of incorporating an inorganic carbon molecule, CO2, into an
organic material.
In this phase, the CO2 molecule is attached to a five-carbon sugar molecule named ribulose
biphosphate (RuBP) aided by an enzyme named rubisco or RuBP carboxylase. Rubisco is
believed to be the most abundant protein in the chloroplast and maybe on Earth.
The resulting product, a six-carbon sugar, is extremely unstable and immediately splits in
half. The split forms two molecules of a 3-phosphoglycerate (3-carbon).
Reduction
•
•
•
•
•
A phosphate group (from ATP) is then attached to each 3-phosphoglycerate by an enzyme,
forming 1,3-phosphoglycerate.
NADPH swoops in and reduces 1,3-biphosphogycerate to G3P.
For every six G3Ps produced by the Calvin Cycle, five are recycled to regenerate three
molecules of RuBP. Only one G3P leaves the cycle to be packaged for use by the cell.
It will take two molecules of G3P to make one molecule of glucose.
The ADP and NADP+ that is formed during the Calvin Cycle will be transported back to the
thylakoid membrane and will enter the light reactions. Here, they will be ‘recharged’ with
energy and become ATP and NADPH.
130
Teacher Tip:
You may also opt to have the learners make
a graphic organizer that shows the three
phases of the Calvin Cycle.
Regeneration of RuBP
•
Five molecules of G3P undergo a series of complex enzymatic reactions to form three molecules of RuBP. This costs the cell another
three molecules of AT, but also provides another set of RuBP to continue the cycle.
What happens to G3P after its release from the cycle?
•
Two G3Ps can combine together to form either glucose or fructose which are both are six-carbon sugar.
•
Glucose and fructose can be combined to form sucrose.
•
Glucose can be connected in chains to form starch.
•
G3Ps can also be used in lipid and protein synthesis.
The cost of making carbohydrate:
To make one molecule of G3P, the chloroplast needs:
•
3 molecules of CO2
•
9 molecules of ATP
•
6 molecules of NADPH
PRACTICE (60 MINS)
Divide the learners into five or six groups. Orient the class on the nature of the activity, as described below:
Calvin Cycle 3-D Model Building
For this activity, each group has to gather materials that will help them build a three-dimensional model that represents the events or phases of
the Calvin Cycle. You may use clay, Styrofoam balls, beads, or recyclable materials. The outputs will be presented in class.
ENRICHMENT (60 MINS)
•
•
•
•
Ask the learners to work in groups for this activity.
Instruct them to research on photosynthetic adaptations of plants found in desert environments.
Assign the following topics for their research outputs: C3 plants, C4 plants, and CAM plants.
The groups may choose any method of presenting their outputs. They can opt for oral
presentations, role-playing, poem or song making, or using visual arts and media.
EVALUATION (30 MINS)
Ask the learners to answer the following questions:
•
Temperature and light intensity are two of the factors that may affect the rate of photosynthesis.
Explain how the said factors affect photosynthesis. Which of the two would you expect to have
more effect on the rate at which the Calvin Cycle proceeds? Why?
•
Many urban areas in our country are becoming less eco-friendly in exchange for new buildings and
commercialization. What do you think is the implication of this in relation to photosynthesis?
•
With your knowledge on photosynthesis, correlate the process in helping curb the effects of climate
change.
132
General Biology 1
360 MINS
Energy Transformation - Cellular
Respiration (Part 1 of 3)
Content Standard
The learners demonstrate an understanding of cellular respiration.
Learning Competencies
The learners:
•
•
Differentiate aerobic from anaerobic respiration (STEM_BIO11/12-IIa-j-6)
Describe the role of oxygen in cellular respiration and describe pathways of
electron flow in the absence of oxygen (STEM_BIO11/12-IIa-j-10)
Specific Learning Outcomes
At the end of this lesson, the students must be able to;
1. determine the functional definition of cellular respiration;
2. compare fermentation with anaerobic and aerobic respiration;
3. explain how cells can produce ATP in the presence or absence of oxygen;
4. identify the metabolic pathways where aerobic respiration specifically
occurs; and
5. explain how the lack of oxygen in the body results in eventual death of an
organism.
LESSON OUTLINE
Introduction As part of understanding by design, engage
5
the students in learning exploring and
firming up.
Motivation
To extend and refine your students’
understanding on energy transformation,
you may ask them regarding the function
and structure of the mitochondrion
Instruction/ A series of activities with directions are
Delivery
indicated below.
Practice
Post guide questions
Enrichment Answer the modified true or false, make a
graphic organizer on aerobic and aerobic
respiration and accomplish the Venn diagram
Evaluation
Answer the multiple-choice questions and a
diagram that shows a comparison among
fermentation, aerobic and anaerobic
respiration
10
15
240
60
30
Resources
•
Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA:
McGraw-Hill
•
Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
•
Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill
•
Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San
Francisco USA: Pearson Education, Inc.
•
Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
INTRODUCTION (5 MINS)
As part of learning exploration, let your students define cellular respiration. You may also ask students to describe process happening when
they respire using their respiratory system then connect this process of respiration to what is happening inside the cell (cellular respiration).
Cellular respiration by technical definition includes both aerobic and anaerobic respiration processes. But today cellular respiration is often used
to refer to aerobic processes.
MOTIVATION (10 MINS)
To help your students analyze and identify attributes and components of the mitochondrion, ask them the following questions:
1. What are the major parts of the mitochondrion?
2. What is the function of each part?
3. What would happen if each part were missing?
4. What is your conclusion?
Give examples of answers from students and what conclusion you expect to give a good motivation to students
INSTRUCTION/DELIVERY (15 MINS)
Procedure
1. Determine and list the molecules that enter and the molecules that leave the metabolic pathways of aerobic cellular respiration.
2. The pictures below can be redrawn or printed so that the students can visualize the metabolic pathways of the glucose molecule.
3. Post the redrawn visual learning materials on the board. Tell the students to work this out individually.
Metabolic Pathways
Glycosis
Reactants and Products
Molecules that enter:
Molecules that leave:
Krebs cycle
Molecules that enter:
Molecules that leave:
Electron Transport
Chain
Molecules that enter:
Molecules that leave:
Provide expected answers to the table
134
Teacher tip
Teacher Tip:
To fill-out the table above, you may opt to
give hint to your students:
Glycolysis: three molecules
Krebs cycle: three molecules those that
enter and four those that leave
ETC: three molecules
ergy forms exists and transformed.
Courtesy: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill
(Retrieved August 13, 2015.)
PROCEDURE
1. To extend and refine your students’ knowledge on cellular respiration, tell them to do the sample
graphic organizer below.
2. Fill-out the table and distinguish how the two types of respiration are alike and different. Then tell
them to write their conclusion based on the similarities and differences they have listed.
3. You may form three groups for this activity. Each group has to present the output(s) to the class
using any kind of visual learning materials.
Comparing Graphic Organizer
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How alike?
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How different?
Summary and Conclusion
136
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How alike?
Both undergo glycolysis in the cytoplasm of the cell
Both undergo substrate-level phosphorylation and oxidative phosphorylation and chemiosmosis in producing ATP molecules
Both split the 6-carbon glucose into two molecules of pyruvate, the three-carbon molecule
Both involve a series of enzyme-controlled reactions that take place in the cytoplasm
Both use NAD+ (nicotinamide adenine dinucleotide), a redox coenzyme that accepts two electrons plus a hydrogen (H+) that becomes NADH
Both performed by eukaryotic and prokaryotic cells
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How different?
Maximum yield of 36 to 38 ATP molecules per glucose
Complete breakdown of glucose to carbon dioxide and water with the use of
oxygen
Multiple metabolic pathways
Pyruvate proceeds to acetyl formation in the mitochondrion
The presence of enough oxygen in the cell makes the cell perform its job
smoothly without burning sensation
More efficient in harvesting energy from glucose with estimated 39% energy
efficiency (36-38 ATP) in eukaryotic organisms but much higher ATP
production (38 to 40 ATP) in prokaryotic organisms
Outputs are carbon dioxide, water and ATP
Products produce are for biochemical cycling and for the cellular processes
that require energy
Slow glucose breakdown
Electrons in NADH are transferred to electron transport chain
Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis
Maximum yield of 2 ATP molecules per glucose for obligate anaerobes
Partial degradation of glucose without the use of oxygen (obligate
anaerobes)
Single metabolic pathway (in fermentation)
Pyruvate is broken down to ethanol and carbon dioxide or lactate (in
fermentation)
Cause burning sensation in the muscle during strenuous exercise
(in fermentation)
Less efficient in harvesting energy from glucose with 2% energy efficiency
(for obligate anaerobes)
Outputs are lactate, alcohol and carbon dioxide (in fermentation); but
reduced inorganic compound in anaerobic respiration
Produce numerous products with economic and industrial importance
through fermentation
Rapid breakdown of glucose
Electrons in NADH are transferred to electron transport chain; but in
fermentation electrons in NADH are transferred to organic molecule
Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis; but in fermentation substrate-level
phosphorylation only during glycolysis
O2 is the final electron acceptor of the electron transport system
Brain cells in the human body can only live aerobically. They die if
molecular oxygen is absent.
In anaerobic respiration, inorganic substances like NO3- or SO42- are
the final acceptor of the electron transport system; but in
fermentation, there is no electron acceptor because it has no
electron transport system.
Some organisms like yeasts (eukaryotic), many bacteria (prokaryotic)
and the human muscle cells (eukaryotic) can make enough ATP to
survive in facultative anaerobes (can live in the absence or presence
of oxygen). But under anaerobic conditions lactic acid fermentation
occurs. A facultative anaerobe needs to consume the nutrient at a
much faster rate when doing the fermentation or anaerobic process.
Summary and/or Conclusion
Aerobic respiration requires molecular oxygen to happen in the cells of most eukaryotes and prokaryotes. Here, nutrients are split into a series
of enzyme-controlled reactions producing an estimated 36 to 38 ATP per glucose complete breakdown. Molecular oxygen is the final
acceptor of the low-energy level electron at the end of the electron transport system that results in the production of water. In anaerobic
respiration on the other hand does not require oxygen in splitting nutrients. Some prokaryotes that live in oxygen-free environments such as
water logged soil, in ponds where water does not flow, and in the intestines of animals transfer glucose to NADH and then pass the electrons
down the electron transport chain that is joined to ATP synthesis by chemiosmosis. Nitrate and sulfate are the final acceptors of electrons. The
end products are carbon dioxide, reduced inorganic substances and ATP. In fermentation (as type of anaerobic respiration) there is no
electron acceptor because it has no electron transport chain. Its products are either alcohol (and carbon dioxide) or lactate.
Note: Clarify how many minutes should be allotted for this activity
ETC: A Metaphor
PROCEDURE
1. To describe how the electron transport system performs its function along the cristae (folds) of the mitochondrion, the students will prepare
the following materials: coloring materials, Manila paper(s), color papers, markers, pencil, and ruler.
2. The learners will make an analogy or a metaphor on how the electrons are being passed on to electron transport chain that result in the
release of water.
3. In their drawing, they have to illustrate the participation of NADH, FADH2, hydrogen proton ion, electrons and oxygen along the electron
transport system. Review your students that the simultaneous cooperation of these carrier molecules and hydrogen atoms are being used to
run ATP production by chemiosmosis. They have to show that ATP and water are two of the products of ETC.
138
4. To facilitate their understanding, you can give them metaphoric examples such as bucket relay for ETC and a stair. A sample illustration is
given below for your reference.
5. Form four groups for this activity. You may form rubric for this part focusing on appropriateness of illustration with all key ideas and elements
are put together correctly.
Stair image courtesy of: Mader, Sylvia S. (2013). Biology 10th Edition. USA: McGraw-Hill (Retrieved August 15, 2015.)
Directions: The pictures below describe the pathways of electron in the absence of oxygen. Analyze it by arranging the seven metabolic
pathways from numbers 1 to 7 provided for you in the opposite table. The same procedure is followed in another table for fermentation with
numbers 1 to 6.
Images courtesy of: Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill (Retrieved August 17, 2015.)
140
Metabolic Pathways Outside the Mitochondria: Glycolysis
(Note: This is not sequenced.)
Metabolic Pathways Outside the Mitochondria: Glycolysis
(Note: Arrange the pathways in order from 1 to 7.)
1 Water is released as 3PG is oxidized.
1
+
2 G3P is oxidized as NAD receives high energy-electrons
2
coming from the hydrogen atoms of C6H12O6.
3 Substrate-level ATP synthesis occurs.
4 Two Pyruvate molecules (3-carbon) are produced as the
end products of glycolysis.
5 Splitting of the 6-carbon sugar produces 3-carbon
molecules.
6 Substrate-level ATP synthesis occurs (also called as
substrate-level phosphorylation).
7 Two ATP molecules are used to start glycolysis.
Metabolic Pathways Outside the mitochondria:
Fermentation (Note: This is not sequenced.)
G3P is oxidized as NAD+ receives high energy-electrons
coming from the hydrogen atoms of C6H12O6.
NAD+ is “freed” to return to the glycolytic pathway to
pick up more electrons.
Two ATP molecules are used to start glycolysis.
Two molecules of pyruvate are converted to ethanol (with
CO2 as by-product) and lactate.
Splitting of BPG into two molecules of pyruvate is couple
to substrate-level ATP synthesis.
Splitting of the 6-carbon sugar produces 3-carbon
molecules.
3
4
5
6
7
Metabolic Pathways Outside the Mitochondria:
Fermentation (Note: Arrange the pathways in order from
1 to 6.)
PRACTICE (240 MINS)
1. Explain how NAD+, pyruvate, oxygen and ATP are involved in aerobic cellular respiration.
2. What is the role of oxygen in cellular respiration.
3. What are the members of the chain in the electron transport system?
4. What do the cristae (or folds) in the mitochondrion contain?
5. What happens to the hydrogen ions (H+) carried by NADH and FADH2?
6. Contrast the energy-investment step with the energy-payoff step of glycolysis.
7. How is aerobic cellular respiration different between prokaryotic and eukaryotic organisms?
8. What happens during electron transport and what it has to do with a proton pump?
9. Using arrows show in simple diagram the metabolic for glycolysis.
10. Explain how ATP can continue to be produced in the absence of oxygen.
Suggested Answers:
1. NAD+ accepts electrons and delivers them to the ETS. Pyruvate is the product of glycolysis. It is converted to acetyl-CoA and transferred to
the Krebs cycle. Oxygen is the final electron acceptor of the ETS and combines with hydrogen to form water. ATP is used in glycolysis to get
the process going but ultimately it is the most valuable molecule produced by aerobic respiration. All parts of aerobic respiration result in a
net yield of ATP.
2. Oxygen molecule is the final acceptor of electrons from ETC. It receives the low energy electron from the last of the carriers (that is,
cytochrome oxidase). After receiving electrons, the oxygen molecule combines with hydrogen ions, and water is formed.
3. The members of the chain in sequence are the following: NADH-Q reductase, coenzyme Q, cytochrome reductase, cytochrome c,
cytochrome oxidase. These are the members of the chain which accept high-energy level electrons which they pass from one molecule to
another.
4. The cristae contain the chain members (carrier molecules and protein complexes, ATP synthase complex and ATP channel protein (bulk of
ATP is produced by chemiosmosis).
5. The complexes of the ETC use the released energy to pump these hydrogen ions from the matrix into the intermembrane space of
mitochondria.
6. If you want to earn, you really need to invest, and therefore you need a capital of some amount. During the energy-investment step, 2 ATPs
are used to split glucose into 2 pyruvate molecules. The split of glucose produces a gross of 4 ATPs and 2 NADH. 4 ATP- 2 ATP = 2 ATP net
in the glycolysis.
7. Prokaryotic organisms do not have mitochondria. These organisms use a slightly different way to perform the Krebs cycle and ETC that
results in slightly more ATP than is produced by eukaryotic organisms.
142
8. The electron transport chain consists of a series of molecules which accept electrons and transfer them from one molecule to another. As
electron is passed on along the series, energy is released to run ATP production. As this happens, protons are pumped from one location to
another in the mitochondrion. Protons begin to build up in their new location. This creates a chemical gradient producing a bulk of ATP by
chemiosmosis. These ATP molecules can be used by the cell to do work.
9. Glucose
G3P
BPG
3PG
PEP
pyruvate
10. ATP can still be produced without oxygen. This can be done through anaerobic fermentation. A net of 2 ATP molecules are produced
during glycolysis. Glucose proceeds through the glycolysis pathway, producing pyruvate. This process “frees” NAD+ and it returns to the
glycolytic pathway to up more electrons to become NADH again.
ENRICHMENT (60 MINS)
Directions: This is a modified true or false activity. Write the word TRUE if the underlined word/phrase being referred to is correct. If it is false,
change the word/phrase to make the whole statement correct based on the concept of cellular respiration. Write your answer on the space
provided before each number.
_________1. Fermentation and anaerobic respiration enable the cells to produce ATP without the use of oxygen.
_________2. The term cellular respiration includes both aerobic and anaerobic processes.
_________3. Fermentation is a complete degradation of sugars or other fuel that occurs without the use of
oxygen.
_________4. An electron transport system consists of a number of molecules, majority are proteins, located in the
matrix of the mitochondria of eukaryotic cells and the plasma membrane of aerobic prokaryotes.
_________5. Pyruvate oxidation and the citric acid cycle, oxidative phosphorylation: electron transport chain and
chemiosmosis are the metabolic stages reserved for cellular respiration.
_________6. The breakdown of glucose to carbon dioxide is completed in the electron transport chain.
_________7. ATP synthase is the enzyme that makes the bulk of the ATP from ADP and Pi by chemiosmosis
_________8. ATP synthase uses the energy of an existing hydrogen ion gradient to power ATP synthesis.
_________9. Phosphorylation of ADP to form ATP stores at least 14.6 kcal per molecule of ATP.
________10. Citric acid cycle generates 2 ATP whether oxygen is present or not, whether the conditions are
aerobic or anaerobic.
Suggested Answers:
1) True 2) True 3) Partial or incomplete 4) Cristae or folds 5) True 6) Krebs cycle 7) True 8) True 9) 7.3 kcal 10) glycolysis
Directions: Accomplish the table below by comparing aerobic and anaerobic respiration
Factors
Aerobic Respiration
Anaerobic Respiration
Factors
Aerobic Respiration
Anaerobic Respiration
Main function
Production of ATP without the use of oxygen
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Production of ATP from food such as
carbohydrate, lipid and protein
Cytoplasm and mitochondrion
36 to 38 ATP per glucose molecule
Long-term
Does not produce
Yes
Through the electron transport system
Participating cells
Most cells
Main function
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Participating cells
Suggested Answers:
144
Cytoplasm
2 ATP per glucose molecule
Short-term
Produces
No
In lactic acid fermentation (i.e., muscle cells;
in alcohol fermentation (pyruvate is
converted to carbon dioxide and ethanol)
Yeast, other fungi, prokaryotes, muscle cells
Directions: Compare aerobic and anaerobic respiration by accomplishing the Venn diagram below.
Venn Diagram of Aerobic and Anaerobic Respiration
EVALUATION (30 MINS)
Directions: Compare fermentation with anaerobic and aerobic respiration by analyzing the diagram below.
Diagram courtesy of: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill (Retrieved August 13, 2015)
1. What are the three kinds of enzyme-controlled reactions so that the chemical-bond energy from a certain nutrient is released to the cell in
the form of ATP?
2. What are the hydrogen electron acceptors for aerobic and anaerobic respiration as well as in fermentation?
3. These are the by-products of aerobic respiration that are considered low-energy molecules.
4. What are the outputs produced by anaerobic respiration? What about in fermentation?
5. What are two general metabolic mechanisms by which certain cells can oxidize organic fuel and generate ATP without the use of oxygen?
146
Suggested Answers:
1. Aerobic respiration, anaerobic respiration, and fermentation
2. aerobic respiration — molecular oxygen, anaerobic respiration — nitrate or sulfate, fermentation – pyruvate
3. Water and carbon dioxide
4. Anaerobic respiration—ATP, water reduced acceptor (nitrate or sulfate), fermentation, ATP, carbon dioxide, alcohol or lactate
5. Anaerobic respiration and fermentation
Directions: This is a multiple-choice task. Encircle the letter of the correct answer.
1. Majority of the CO2 is released during
a.
Glycolysis
b.
Citric acid cycle
c.
Electron transport chain
d.
Oxidative phosphorylation
2. Cellular respiration processes that do not use O2 are called
a.
heterotrophic organism.
b.
anaerobic organism.
c.
aerobic organism.
d.
anabolic
3. The positively charged hydrogen ions that are released from the glucose during cellular respiration eventually
combine with _________ ion to form ______
a.
another hydrogen, a gas
b.
a carbon, carbon dioxide
c.
an oxygen, water
d.
a pyruvic acid, lactic acid
4. The Krebs cycle (also known as citric acid cycle or tricarboxylic acid) and ETC are biochemical pathways
performed in which eukaryotic organelle?
a.
nucleus
b.
ribosome
c.
chloroplast
d.
mitochondrion
5. Anaerobic pathways that oxidize glucose to generate ATP energy by using an organic molecule as the ultimate
hydrogen acceptor are called
a.
fermentation.
b.
reduction.
c.
Krebs cycle.
d.
Electron pumps
6. When skeletal muscle cells function anaerobically, they accumulate the compound________, which causes
muscle soreness.
a.
pyruvic acid
b.
malic acid
c.
carbon dioxide
d.
lactic acid
7. Each molecule of fat can release ______ of ATP, compared with a molecule of glucose.
a.
smaller amounts
b.
the same amount
c.
larger amount
d.
only twice the amount.
148
8. In complete accounting of all ATPs produced in aerobic respiration, there a total of ________ATPs: ______
from the ETC, _____ from glycolysis, and _______ from the Krebs cycle.
a.
36, 32, 2, 2
b.
38, 34, 2, 2
c.
36, 30, 2, 4
d.
38, 30, 4, 4
9. The chemical activities that remove electrons from glucose result in the glucose being
a.
reduced.
b.
oxidized.
c.
phosphorylated.
d.
hydrolyzed.
10. Which of the following is NOT true of the citric acid cycle? The citric acid cycle
a.
includes the preparatory reaction
b.
produces ATP by substrate-level ATP synthesis
c.
occurs in the mitochondria
d.
is a metabolic pathway, as is glycolysis
Suggested Answers:
1. b 2.b
3.c
4.d 5.a
6.d
7.c
8.a
9.b
10. a
General Biology 1
420 MINS
Energy Transformation Cellular Respiration (Part 2
of 3)
Content Standard
The learners demonstrate an understanding of cellular respiration.
•
Introduction Communicate to the class the learning
Explain the features and sequence the chemical events of cellular
respiration (STEM_Bio11/12-IIa-j-7)
Distinguish major features of glycolysis, Krebs cycle, electron transport
system, and chemiosmosis (STEM_Bio11/12-IIa-j-8)
Specific Learning Outcomes
At the end of this lesson, the students must be able to:
1. Identify the major stages of cellular respiration;
2. Identify the organelles involved for each stage of cellular respiration.
3. Describe the following for each stage of cellular respiration: process,
starting materials, and end products of aerobic respiration.
Motivation
Show a picture of students eating at the
school canteen, then show questions
15
250
Enrichment Do the jigsaw activity and people
90
Evaluation
60
hunting and applying knowledge of
biochemical pathways
Fill-in the necessary information for
cellular respiration and the 3-2-1 Closing
Resources
•
•
•
Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San
Francisco USA: Pearson Education, Inc.
Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
Suggested Media Tools:
• www.mhhe.com/maderbiology11
• www.masteringbiology.com
• www.biologycorner.com
For animations, video, learning outcomes, chapter outline, image
PowerPoint, essay quiz, thinking critically, practice test and concept maps
http://highered.mheducation.com/sites/0073403466/student_view0/
chapter7/image_powerpoint.html
http://highered.mheducation.com/sites/0073525502/student_view0/
chapter7/index.html
150
5
competencies. Review the reactants and
products of cellular respiration
Instruction/ A 3-D model of a mitochondrion made
Delivery
from re-usable materials
Learning Competencies
The learners:
•
LESSON OUTLINE
INTRODUCTION (5 MINS)
Teacher tip
You may ask them the following questions:
Emphasize that both prokaryotic and
eukaryotic organisms need food in order to
get the energy needed to adapt to many
things in the environment and to perform
bodily processes such as growth, repair,
reproduction, maintenance of homeostasis,
etc.
Communicate to the class the learning competencies. Then go over the reactants and products of
cellular respiration.
1. How many molecules of ADP as reactant are needed to produce about 38 molecules of ATP for
eukaryotic organisms?
2. Which groups in the cellular respiration equation go in?
3. Which groups are released?
Suggested Answers:
1. About 36 to 38 ADP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ADP (or ATP) molecules depending on the shuttle used to transport the electrons
and on the kind of species.)
2. Groups that go in: carbohydrate and molecular oxygen
3. Groups that are released: carbon dioxide, water and energy (ATP)
NOTE: Cellular respiration is one of the more difficult topics in biology. To capture the general picture
of the topic, students have to be encouraged to read and re-read the key concept, write and re-write,
outline and re-outline, draw and re-draw, and to recite orally if they want the ideas to sink in their
system. Patience and steadfastness are important virtues that should be included as you study this
concept.
MOTIVATION (15 MINS)
Post a color picture of a group of students eating at the school canteen. To establish healthy academic
atmosphere and camaraderie, ask them if they know one who is a friend of them. Then ask the
following questions:
1. If one of the students who ate would pay to the cashier a bill in US dollar, would the cashier accept
the money as a form of payment for the food ordered?
Suggested Answers:
1. No
2. Encash the 1000-peso cheque first at the
bank.
3. Convert the US dollar bill to Philippine
Peso and encash the 1000-peso bill cheque
at the bank.
4. ATP or Adenosine Triphosphate, a form
of nucleic acid
2. If one of the students ate combo meal and the amount of the food eaten is P49.00 and he gave out
1000-peso money cheque to the cashier, what do you think the cashier would ask to the student?
(Assuming that the student is the first customer of the day).
3. What should the students do (one with a US dollar bill and one with a 1000-peso money cheque) to
make their money more functional?
4. Just like the US dollar bill and the 1000-peso money cheque, the glucose (carbohydrate) in the food
that we eat is a principal high-energy molecule that has to be digested into smaller molecules in
order to release the high energy molecule that is highly recognized by the cell. What do you call
this molecule that serves as the “energy currency of the cell”?
5. After this group of students ate the food at their school canteen, how do they obtain energy from
these food (protein, carbohydrate, fat) molecules?
Process the answers of the students related to the US dollar bill. Give the relationship of this analogy
to the current topic.
INSTRUCTION/DELIVERY (250 MINS)
Activity 1: 3-D Mitochondrion Model
1. Let your class form triad. Give a model color picture of a mitochondrion that will serve as their
guide for the 3-D mitochondrion. Print color pictures of a mitochondrion and give one to each
group.
2. To make a 3-D model of a mitochondrion, prepare the following materials: Old newspapers, metal
wires, starch (serves as paste), vinegar, acrylic paint, and paintbrush.
3. The sizes of the 3-D model mitochondrion are: Length — 24 inches, width — 14 inches, height — 8
inches.
4. From the metal wire, mold a mitochondrion based on the sizes given. The cristae of the
mitochondrion can be formed through the metal wire.
5. Prepare a mixture for the starch (this will serve as your paste) as follows: 2 cups water, 2 cups starch,
1 cup vinegar. Mix the materials together under normal fire for 3-5 minutes.
6. With the old newspapers collected from the students’ neighbors, tell your students to wet the
newspapers with paste and glue them on to the metal wire.
7. Let the model dry up before they paint the 3-D model mitochondrionProvide expected answers to
the table
152
5. The complex food molecules are broken
down by digestion into simpler substances
that are absorbed by the body through the
bloodstream. These food molecules will
then be transported to all their cells.
Breaking down of food is a catabolic
process that converts the energy in the
chemical bonds of nutrients to chemical
energy stored in ATP that occur inside the
cells of these students. This process in
known as cellular respiration.
NOTE: The US dollar currency is not directly
used in everyday transaction. It has to be
converted into usable form such as the
Philippine money.
Cellular respiration is different from
organismic respiration. The latter refers to
the exchange of gases such as oxygen and
carbon dioxide with the environment by
living organisms, particularly animals with
special organs such as lungs and gills, for
gas exchange.)
Teacher Tip
Inform the groups of students one week
prior to this topic to give way to the
preparation and designing of a 3-D model
of a mitochondrion. You may form three
groups. Give each group a model color
picture of a mitochondrion that will serve as
their template for the 3-D.
Activity 2: Drawing, Coloring and Labeling
1. Inform your students to bring the following materials: Oslo paper (or long bond paper), coloring
materials, pencil and a ballpen.
2. Let them draw and color, and label the model picture of a mitochondrion below.
3. The rubric for the drawing and coloring is given to help in the objective scoring of the output
coming from your students.
4. The students will proceed to labeling. There are 10 blanks to be filled-in.
5. Then proceed to discussion by giving them processing questions.
Rubrics for Drawing and Coloring
Standard
Contrast and intensity
of drawing
Blending of colors
Neatness
Excellent (7 points)
Good (5 points)
Fair (3 points)
Shows exceptional artistic
and skillful color contrast;
and meaningful color
concentration
Color mix is exceptionally
creative, appropriate and
meaningful
Completely free from
mess
Shows generally acceptable
artistic and skillful color
contrasts; and meaningful
color concentration
Color mix is generally
creative, appropriate and
meaningful
Almost free from mess
Shows generally vague
color contrasts; and
indiscernible sense of
color concentration
Color mix needs
improvement
Too messy
Teacher tip
̌For the drawing, coloring and labeling of
the parts of a mitochondrion, you may print
the picture in color and post it on the board
for everyone to see.
Model Picture of a Mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole
(Retrieved July 20, 2015)
Activity 3: Sequencing Cellular Respiration
Teacher tip
Procedure:
1. Group the class into three. Fill-in the missing information to make the graphic organizer complete.
Few examples are given.
2. Report the output to the class. You will be graded according to the following rubric.
NOTE: Students might find this difficult to accomplish. To facilitate better understanding for this
154
Insight:
The reason why we humans breathe is to
get the oxygen into our cells. Recall that at
the end of the electron transport chain,
hydrogen ions are being welcomed by the
oxygen molecules to produce a by-product
called water.
activity, tell them to research on the major events of cellular respiration (e.g. how glucose gets into the cell and how it becomes converted into
ATP). Your students should be able to see the major events (though the events are happening simultaneously). You may also prepare a set of
reading materials (including diagrams and/or pictures) given to each group and let every member of the group analyze the text and be able to
sequence and narrate the major events of cellular respiration.
Suggested Rubrics
Standard
Excellent (10 points)
Good (7 points)
Fair (4 points)
Content knowledge
Information is complete
and accurate
Information is mostly
complete and accurate
Originality in
organization of ideas
Exceptionally well
organized and
understandable
Generally well-organized
and understandable
Information is mostly
incomplete and
inaccurate
Fairly understandable
STAGE 1: Glycolysis
This is what happens:
During this stage, glucose (the six-carbon molecule) is split into two
molecules of pyruvate (which contains three carbons). A net of two ATP
molecules is produced by substrate-level phosphorylation during glycolysis.
In addition, there are four hydrogen atoms are removed and are used to
produce two NADH (an electron-carrier molecule that enters mitochondrion
Note: You can say more at this stage.
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole (Retrieved August 2, 2015)
STAGE 2: ____________________
This is what happens:
STAGE 3: ____________________
This is what happens:
156
STAGE 4: ______________________
This is what happens:
Activity 4: Watch Summary Video for Aerobic Respiration (If materials are available)
Cellular Respiration Video\www.youtube.comwatchv=00jbG_cfGuQ.mp4 (Retrieved August 3, 2015)
Cellular Respiration Video\www.youtube.comwatchv=-Gb2EzF_XqA.mp4 (Retrieved August 3, 2015)
Directions: With the help of your instructional materials (e.g. in tarpaulin form, PowerPoint Presentation or even simple pictures that are visually
attractive and accurate) ask the following processing questions. Allow the pictures and the boardwalk to speak to your students.
Processing Questions:
1. How many metabolic pathways are present in aerobic respiration?
2. Where in the cell part does glycolysis take place? What about the formation of Acetyl CoA, Krebs cycle and the electron transport chain and
chemiosmosis?
3. How many reduced NADH molecules are produced after the glucose has been completely broken down to ATP? And what stage of the
aerobic respiration is glucose completely broken down to carbon dioxide?
4. As glucose is split in the cytosol of the cell, is there a release of carbon dioxide as by-product of the reaction?
5. What molecule accepts the hydrogen atoms at the end of electron transport chain?
6. What is the major goal of NADH and FADH2 in aerobic respiration?
7. Why do you think the cell needs to digest glucose or any other nutrients such as protein and fats?
8. Among the metabolic pathways of cellular respiration, which phase is the major contributor of ATP?
9. What happens to pyruvate if oxygen is not available in the cell?
10. How many acetyl-CoAs are produced from each glucose molecule?
Suggested Answers:
1. Three metabolic pathways
2. Glycolysis takes place in the cytoplasm or cytosol; formation of acetyl CoA, Krebs cycle, ETC and chemiosmosis all take place in the
mitochondrion
3. 10 NADH molecules; glucose is completely broken down carbon dioxide at the Krebs cycle
4. No
5. Oxygen molecule
6. The goal of NADH and FADH2 is to transport the electrons coming from the hydrogen atoms (in glucose) to the electron transport chain
7. The cell has to digest glucose, fat, and protein in order to convert them into usable form of energy molecule called adenosine triphosphate.
This ATP is the only molecule that is recognized by the cell for all of its cellular activities.
8. Among the metabolic pathways in aerobic respiration, the electron transport chain (or oxidative phosphorylation) makes about 90 per cent
of ATP per glucose molecule.
9. The pyruvate will not proceed to the formation of acetyl CoA. The pyruvate will become lactic acid in animal and alcohol in plant.
10. Two
158
ENRICHMENT (90 MINS)
Directions: Read the procedures below on how the jigsaw and expert groups are formed.
PART I: Jigsaw Activity
Procedure:
1. Form a group having four members. Each student-member in the group will be assigned to a
certain phase of cellular respiration (1. glycolysis, 2. preparatory reaction, 3. citric acid cycle,
4.electron transport chain). Each group will be called “jigsaw group”.
2. Each group will be given handouts (with texts and pictures/diagrams—samples of these pictures are
shown below) with the help of its leader and distribute them to his/her group mates. The handouts
contain information about cellular respiration. Other helpful tools such as biology textbook, Internet
can be used to facilitate their learning of the topic.
3. All the members in each group will be given enough time to read over their assigned topic for them
to become familiar with it.
4. From the “jigsaw group” previously formed, the so-called “expert group” will then be formed.
Those assigned in glycolysis from each group will be grouped as “expert group” in glycolysis. The
same procedure will be done to preparatory reaction, citric acid cycle and electron transport chain
— “expert groups” will be formed from these remaining topics.
5. These “expert groups” will be given enough time to discuss the main points of their assigned topic
and to rehearse for the presentation.
6. After a certain amount of time, each student from the “expert group” will go back to his/her
“jigsaw group”.
7. Each member from the “jigsaw group” will this time begin to present his/her topic to the whole
class.
Teacher tip
•
•
•
•
Encourage each member to ask
question(s) for clarifications.
Provide cellular respiration handouts/
diagrams for each group to discuss.
For this part, provide a rubric for the
presentation that each group has to
make.
Writing the definitions of the terms can
help your students better understand
the concept.
•
Glycolysis – means “sugarsplitting” that occurs in the
cytosol of the cell. It does not
require oxygen to breakdown
glucose into pyruvate.
•
Krebs cycle – completes the
metabolic breakdown of glucose
to carbon dioxide and produces
2 ATP.
•
Oxidative phosphorylation – a
process occurring in
mitochondria and accounts for
majority of the ATP production.
•
Electron Transport Chain –
contains the chain members
(carrier and protein complexes,
ATP synthase complex and ATP
channel protein. These
membrane proteins shuttle
electrons during the redox
reactions. The electrons will be
used to produce ATP by
chemiosmosis.
•
•
NADH and FADH2 – these are
electron acceptor molecules
that contain high-energy
electrons. They transport the
electrons to ETC to produce
many more ATPs by oxidative
phosphorylations.
ATP synthase – is an enzyme
that is responsible for the great
production of ATPs. This
happens when it uses the
energy coming from H+ ions to
bind ADP and phosphate group
together to produce ATP.
Teacher Tip
The diagram on the left shows the total
energy produced from the complete
breakdown of glucose by aerobic
respiration.
Rubric for the Report
Standard
Excellent (10 points)
Good (7 points)
Fair (4 points)
Content
knowledge
Information is
complete and accurate
Originality in
organization of
ideas
Exceptionally well
organized and
understandable
Information is mostly
complete and
accurate
Generally wellorganized and
understandable
Information is mostly
incomplete and
inaccurate
Fairly understandable
160
PART II
People Hunt
1. Prepare four sets of paper strips. Set A contains the four stages of cellular respiration. Set B contains the summary for each stage. Set C
contains starting materials for each stage. Set D contains end products for each stage.
2. Twelve students will be asked to volunteer. Randomly, each of these volunteers will be given strips of paper
(NOTE: tell them not to read yet the information written on the strip of paper).
3.Student-volunteers will be asked to scatter around the room. After this, instruct them that there are four stages of cellular respiration (please
refer back to the procedure number 1). The student-volunteers will be given time to find their group mates correctly for each specific stage
based on the paper strip(s) they are holding.
4.
Tell each group for each stage to line up at the four corners of the room (north, south, east, west side of the room) and check if each
member has found their group mates correctly.
Summary of Cellular Respiration
Stage
Summary
Some Starting Materials
Some End Products
1. Glycolysis (in cytosol)
Series of reactions in which glucose is degraded to pyruvate; net
profit of 2 ATPs; hydrogen atoms are transferred to carriers; can
proceed anaerobically
Glucose, ATP, NAD+, Pi
Pyruvate, ATP, NADH
2. Formation of acetyl CoA Pyruvate is degraded and combined with coenzyme A to form
(in mitochondria)
acetyl CoA; hydrogen atoms are transferred to carriers; CO2 is
released
Pyruvate, coenzyme A,
NAD+
Acetyl CoA, CO2,
NADH
3. Citric acid cycle (in
mitochondria)
Series of reactions in which the acetyl portion of acetyl CoA is
degraded to CO2; hydrogen atoms are transferred to carriers; ATP
is synthesized
Acetyl CoA, H2O, NAD+,
FAD, ADP, Pi
CO2, NADH, FADH2,
ATP
4. Electron transport and
chemiosmosis (in
mitochondria)
Chain of several electron transport molecules; electrons are passed NADH, FADH2, O2, ADP, Pi
along chain; released energy is used to form a proton gradient; ATP
is synthesized as protons diffuse down the gradient; oxygen is final
electron acceptor
ATP, H2O, NAD+, FAD
Applying Knowledge of Biochemical Pathways
As scientists have developed a better understanding of the processes of aerobic cellular respiration and anaerobic cellular respiration, several
practical applications of this knowledge have developed:
•
Although for centuries people have fermented beverages such as beer and wine, they have often plagued by sour products that were
undrinkable. Once people understood that there were yeasts that produce alcohol under anaerobic conditions and bacteria that converted
alcohol to acetic acid under aerobic conditions, it was a simple task to prevent acetic acid production by preventing oxygen from getting to
the fermenting mixture.
•
When it was discovered that the bacterium that causes gas gangrene uses anaerobic respiration and is, in fact, poisoned by the presence of
oxygen, various oxygen therapies were developed to help cure patients with gangrene. Some persons with gangrene are placed in
hyperbaric chambers, with high oxygen levels under high pressure. In other patients, only the affected part of the body is enclosed. Under
such conditions, the gangrene-causing bacteria die or are inhibited.
•
Spoilage, or putrefaction, is the anaerobic respiration of proteins with the release of nitrogen and sulfur-containing organic compounds as
products. Protein fermentation by the bacterium Clostridium produces foul-smelling chemicals such as putrescine, cadavarine, hydrogen
sulfide, and methyl mercaptan. Clostridium perfringens and C. sporogenes are the two anaerobic bacteria associated with the disease gas
gangrene. A gangrenous wound is a foul-smelling infection resulting from the fermentation activities of those two bacteria.
•
Because many disease-causing organisms are prokaryotic and have somewhat different pathways and enzymes than do eukaryotic
organisms, it is possible to develop molecules, antibiotics that selectively interfere with the enzymes of prokaryotes without affecting
eukaryotes, such as us humans.
•
When physicians recognized that the breakdown of fats releases ketone bodies, they were able to diagnose diseases such as diabetes and
anorexia more easily, because people with these illnesses have bad breath.
•
In starvation and severe diabetes mellitus, the body does not metabolize sugars properly, and it shifts to using fats as its main source of
energy. When this occurs, the Krebs cycle is unable to perform as efficiently and the acetyl CoA does not move into the mitochondria. It
accumulates in the blood. To handle this problem, the liver converts acetyl CoA to ketone bodies (e.g., acetoacetic acid). As ketone bodies
accumulate in the blood, the pH decreases and the person experiences ketosis, or ketoacidosis, with symptoms such as an increased
breathing rate; in untreated cases, it can lead to depression of the central nervous system, coma, and death.
Adapted from: Enger, Eldon D. et al., Concepts in Biology 14th edition. USA: McGraw-Hill
162
EVALUATION (60 MINS)
Teacher tip
Directions: Complete the tables below by filling-in the necessary information for aerobic respiration.
Table 1: Inputs and Outputs of Glycosis
Glycosis
Inputs
Table 1 Suggested Answers:
Glycolysis outputs:
• 2 pyruvate
• 2 NADH
• 2 ADP
• 4 ATP total
• 2 ATP net gain
Outputs
Table 2 Suggested Answers:
Citric Acid Cycle inputs:
• 2 acetyl groups
• 6 NAD+
• 2 FAD
• 2 ADP + 2 P
1.
Glucose
1
2.
2 NAD+
2
3.
2 ATP
3
4.
4 ADP + 4 P
4
Table 3 Suggested Answers:
Total:
First Column
Glycolysis-ATP-SLP= 2 ATP net
Krebs-ATP-SLP= 2 ATP
Total-ATP-SLP= 4 ATP
Table 2: Inputs and Outputs of Citric Acid Cycle
Citric Acid Cycle
Inputs
Outputs
1
1. 4 CO2
2
2. 6 NADH
3
3. 2 FADH2
4
4. 2 ATP
Second Column
Glycolysis-HEA= 2 NADH
Prep-HEA= 2 NADH
Krebs-HEA= 6 NADH and 2 FADH2
Third Column
Glycolysis-ATP-OP= 4-6 ATP
Prep-OP= 6 ATP
Krebs-ATP-OP= 18 ATP and 4 ATP
Table 3: ATP Harvest from Aerobic Respiration
Teacher tip
Total-ATP-OP=32-34
Phases in
Aerobic
Respiration
Glycolysis
Preparatory
Reaction
Krebs cycle
ATP produced by
Substrate-Level
Phosphorylation
High-energy
Electron
Acceptors
ATP produced
by Oxidative
Phosphorylation
Sub-total
Fourth Column
Glycolysis-S= 6-8 ATP
Prep-S= 6 ATP
Krebs-S= 24 ATP
Total-S= 36-38 ATP
-Table 4 Suggested Answers:
Total
Starting materials
G: Glucose, ATP, NAD+, ADP, P
F: Pyruvate, CoA, NAD+
K: Acetyl CoA, H2O, NAD+, FAD, ADP, P
E: NADH, FADH2, O2, ADP, P
--
Table 4: Starting Materials and End Products of Aerobic Respiration
Stage
Glycolysis (in cytosol)
Formation of Acetyl CoA (in
mitochondria)
Krebs cycle (in mitochondria)
Starting Materials
End Products
--
Electron Transport Chain and
Chemiosmosis (in mitochondria
--
Directions: As part of performance assessment, let the students do the 3-2-1 Closing. On their ½
crosswise
paper, they write
3 things/concepts/key ideas they have learned in the lesson(s);
2 things/concepts/key ideas they have questions about the lesson(s); and
1 thing/concept/key idea they want the teacher to know about in connection to the lesson(s) discussed.
164
End Products
G: Pyruvate, ATP, NADH
F: Acetyl CoA, CO2, NADH
K: CO2, NADH, FADH2, ATP
E: ATP, H2O, NAD+, FAD
General Biology 1
Energy Transformation Cellular Respiration (Part 3
of 3)
Content Standard
The learners demonstrate an understanding of cellular respiration.
Performance Standard
The leaners prepare simple fermentation setups using common fruits to
produce wine or vinegar via microorganisms
240 MINS
LESSON OUTLINE
Introduction Discuss the nature of science with regard
to cellular respiration. Raise several
questions for the students to think about
Motivation
Instruction/ Let the students do activities on
Delivery
advantages and disadvantages of
1. Explain the advantages and disadvantages of fermentation and aerobic
respiration (STEM_Bio11/12-IIa-j-12)
Practice
Answer the guide questions
Enrichment Prepare materials for vinegar making
Specific Learning Outcomes
At the end of this lesson, the students must be able to:
1. Tabulate and explain the advantages and disadvantages of fermentation,
anaerobic respiration and aerobic respiration;
2. Show the similarities and differences of fermentation, anaerobic respiration
and aerobic respiration;
3. Compare the pathways of carbohydrate, fat, and protein catabolism.
5
15
aerobic and anaerobic respiration and
fermentation together with their
similarities and differences; prepare
homemade virgin coconut oil and
fermentation
Learning Competency
The learners:
•
Show a diagram of metabolic pool
concept and ask few questions
15
Evaluation
Compare and explain aerobic
respiration, anaerobic respiration and
fermentation, their advantage and
disadvantage
160
5
40
Resources
•
•
•
•
•
Alumaga, Maria Jessica B. et al., (2014). Science and Technology 9.
Quezon City: Vibal Publishing House
Bawalan, Divina D. and Chapman, Keith R. (2006). Virgin Coconut Oil:
Production Manual for Micro- and Village-scale Processing. Thailand:
FAO Regional Office for Asia and the Pacific
Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
Rabago, Lilia M. et al., (2014). Science and Technology Laboratory
Manual and Workbook for Grade 9 Quezon City: Vibal Group, Inc.
Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
INTRODUCTION (15 MINS)
Communicate the learning competencies for this topic. You can enumerate some products (or show
pictures) of fermentation. You may opt to insert and discuss the nature of science with regard to cellular
respiration. For instance, athletes and trainers today are constantly finding ways to improve their
performance in a particular event such as in triathlon by boosting cellular respiration. Why is meant by
carbo-loading?
Or as you go to the supermarket, you will see several kinds of energy drinks, are they safe to drink?
What are the health implications if a person drinks them excessively? What about energy-boosting
vitamins, are they really beneficial for the body? Or is it safe to drink an energy-boosting fluid rich in
vitamin B-complex and other related substances when your stomach is empty? If you want to jump-start
your mitochondria, would you rely on alternative medicine? These are interesting issues to discuss and
bring to the whole class to think about.
MOTIVATION (5 MINS)
Show a metabolic pool concept to the class and ask the following questions:
1. What are the three kinds of food that provide the building blocks for the cells, and that all can
provide energy?
2. What are the basic metabolic pathways organisms use to extract energy from carbohydrates in
aerobic respiration? What about for proteins and fats? Are the pathways the same or not?
3. To which pathway do glycerol and fatty acids of fat enter?
Suggested Answers:
1. Carbohydrates, proteins, and fats.
2. Glycolysis, Krebs cycle, electron transport chain—for carbohydrates, proteins and fats. The
metabolic pathways for these three kinds of food are the same except that for proteins and fats,
there are additional steps to get fats and proteins ready to enter the specific pathway as shown in
the diagram.
3. Glycerol enters glycolysis; fatty acids enter preparatory reaction.
166
INSTRUCTION/DELIVERY (15 MINS)
Directions: Tabulate and explain the advantages and disadvantages of fermentation, anaerobic respiration and aerobic respiration. Show their
similarities and differences.
Procedure:
1. Form five groups. Each group has an assigned topic to work on. The following groups are as follows:
•
GROUP 1: To work on the differences among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
•
GROUP 2: To work on the similarities among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
•
GROUP 3: To work on and explain the advantages and disadvantages of aerobic respiration.
•
GROUP 4: To work on and explain the advantages and disadvantages of anaerobic respiration.
•
GROUP 5: To work on and explain the advantages and disadvantages of fermentation.
2. Show to the class a sample table on how you want them to display, outline and report the information to the whole class.
3. Tell them to prepare Manila papers, marker, or any visual materials.
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Differences
Aerobic Organisms
Similarity
Anaerobic Organisms
Fermenting Organisms
Aerobic, Anaerobic and
Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Advantages of Aerobic Respiration
Advantages of Anaerobic Respiration
Advantages of Fermentation
Disadvantages of Aerobic Organisms
Disadvantages of Anaerobic Organisms
Disadvantages of Fermenting Organisms
Suggested Answers:
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Differences
Aerobic Organisms
Similarity
Anaerobic Organisms
•
Use oxygen.
•
Do not use oxygen.
•
H2O is the by-product.
•
•
Electron acceptor is O2
and is reduced to
water.
H2O and potassium
nitrite are the byproducts.
•
•
With electron transport
chain.
With electron transport
chain.
•
•
Occur in prokaryotes
and eukaryotes.
Electron acceptor is
nitrate or sulfate.
•
Occur in prokaryotes.
•
Requires no special
organelles
Fermenting Organisms
•
•
•
•
•
•
•
•
Do not use oxygen.
Lactate (lactate fermentation) or ethyl
alcohol (alcoholic fermentation) is the byproduct.
Final acceptors of electrons are pyruvate
reduced to lactate, and acetaldehyde
reduced to ethyl alcohol.
No electron transport chain.
Occur in prokaryotes and eukaryotes.
Simple and faster alternative to cellular
respiration
Requires no special organelles
Glycolysis and waste product formation
are two sets of reactions that occur.
168
Aerobic, Anaerobic and
Fermenting Organisms
•
ATP is produced.
•
CO2 is the waste product.
•
Electrons are transferred from
glucose to NADH.
Advantages of Aerobic Respiration
•
All available energy extracted from
glucose is 36 to 38 ATP.
•
39% energy transferred from glucose to
ATP.
Advantages of Anaerobic
Respiration
• All available energy extracted from
glucose is 40 ATP (because
prokaryotes have no
mitochondria).
•
Slow breakdown of glucose into ATP.
•
•
Organisms can do more work for a
longer time with the slow and efficient
breakdown of ATP.
43% energy transferred from
glucose to ATP.
•
Complete breakdown of glucose.
•
Animals and the human muscle cells can
adapt and perform lactic acid
fermentation for a rapid burst of energy.
•
Can breathe heavily to refill the cells
with oxygen so that lactate is removed
from the muscle cells.
•
Lactate is returned to the liver to
become pyruvate or glucose again.
•
Complete breakdown of glucose.
Advantages of Fermentation
•
All available energy extracted from glucose is 2
ATP.
•
Certain bacteria produce chemicals of industrial
importance such as isopropanol, butyric acid,
acetic acid when bacteria ferment—breakdown of
sugars in the absence of oxygen.
•
Foods that are fermented last longer because
these fermenting organisms have removed many
of the nutrients that would attract other
microorganisms.
•
Yeasts ferment fruits and wine is produced. Grain
is also fermented to produce beer. They also
cause the bread to rise due to CO2, a by-product,
and alcohol is lost in the bread.
•
Yeasts and lactobacillus together produce sour
taste in wheat beer.
•
Yeasts and Acetobacter aceti spoil wine to
become vinegar.
•
Bacterial fermentation produces yogurt (due to
Streptococcus thermophilus and Lactobacillus
bulgaricus), sour cream, cheese, brine cucumber
pickles, sauerkraut, and kimchi.
•
Clostridium bacteria can produce nail polish
remover and rubbing alcohol from the acetone
and isopropanol they make
•
Soy sauce is produced by adding mold
(Aspergillus), yeasts and fermenting bacteria.
Disadvantages of Aerobic Organisms
Disadvantages of Anaerobic Organisms
Disadvantages of Fermenting Organisms
•
•
•
Consumption of 2 ATP is fast.
•
Ethanol and lactate, the by-products of
fermentation, have a lot of energy
reserves—prokaryotes and eukaryotes
cannot extract the energy in lactate and
ethanol using anaerobic method.
•
Needs a large supply of glucose to
perform the same work as in aerobic
respiration.
•
Glucose is partially oxidized.
61% of glucose metabolism becomes
heat and enters the environment.
•
Human brain cells cannot perform lactic
acid fermentation.
•
Human muscle cells feel the burning
sensations and pain when lactate
accumulates in the cell and experience
oxygen debt.
57% of glucose metabolism becomes heat
and enters the environment.
Directions: Compare aerobic respiration, anaerobic respiration and fermentation in terms of the following factors
listed in the first column.
Activity Title: Comparison of Aerobic and Anaerobic Respiration and Fermentation
Factors
Aerobic Respiration
Anaerobic Respiration
Immediate fate of electrons in
NADH
Terminal electron acceptor of
electron transport chain
Reduced Product(s) formed
Mechanism of ATP synthesis
170
Fermentation
Suggested Answers:
Factors
Aerobic Respiration
Anaerobic Respiration
Fermentation
Immediate fate of
electrons in NADH
Transferred to
electron transport
chain
O2
Transferred to electron
transport chain
Transferred to organic
molecule
Inorganic substances
such as NO3-- or SO4 2-
No electron transport
chain
Water
Relatively reduced
inorganic substances
Relatively reduced
organic compounds
(e.g., alcohol or lactate)
Oxidative
phosphorylation/
chemiosmosis; also
substrate-level
phosphorylation
Oxidative
phosphorylation/
chemiosmosis; also
substrate-level
phosphorylation
Substrate-level
phosphorylation only
(during glycolysis)
Terminal electron
acceptor of electron
transport chain
Reduced Product(s)
formed
Mechanism of ATP
synthesis
Teacher Tip:
Activity Title: Homemade Virgin Coconut Oil and Fermentation
Materials needed:
Fermentation containers (food-grade transparent plastics), basin or stainless stock pots, ladle (long
spoon with deep bowl), cheesecloth (katsa), five fully matured nuts and coconut water, funnel, hand
soap, water, cotton wool, glass bottle or PET bottle
Procedures:
•
•
1.
The natural fermentation method has two parts: (1) extraction and preparation of coconut milk and
(2) processing of VCO from the milk
The process for extracting, preparing and processing of VCO from the coconut milk are as follows:
Fermentation refers to the addition of yeast
or a specific microorganism or enzyme to a
raw material to produce a desired product.
But for the so-called natural fermentation
method, we will produce VCO that does not
require any addition of microorganisms or
substance. When the coconut milk mixture
is allowed to stand for at least 10 hours, the
VCO will naturally separate from water and
protein. Several theories say that the
separation of these substances is due to the
presence of airborne acetic acid bacteria
(Acetobacter aceti). A. aceti breaks the
protein bonds in the coconut milk causing
the mixture to separate distinctively.
1. a. Selecting nuts — select fully five matured nuts (12 to 13 months) and de-husk; the husk should
be turning brown.
2. Splitting and grating — split the de-husked nut into two manually and grate. Place the
3. First milk extraction — extract the milk from the grated coconut meat by hand using cheesecloth
(katsa). Mix the grated coconut milk and the coconut water. Materials to be used such as
fermentation containers, basin, ladle, and cheese cloth should be prepared neat and clean to avoid
contamination. Wash your hands vigorously with water and soap.to kill and remove the presence of
microorganisms that may alter the quality of VCO. Press the coconut meat thoroughly using your
cheese cloth. Set aside the milk obtained using your clean fermentation container(s). Prepare the
coconut residue (sapal) for the second round of milk extraction.
4. Second milk extraction — the ratio of mixing is 2 cups of milk residue (sapal) is to 1 cup of water
coming from the first milk extraction.
5. Mixing of first and second milk extracts — mix well the first and second coconut milk extracts for 10
minutes.
6. Preparing for the fermentation containers — place the coconut milk extract in clean fermentation
container(s). Cover the container(s) loosely as shown below. Place the container(s) in a place where
temperature is 35 to 40oC. Allow the coconut milk mixture to settle for 16 to 24 hours for natural
fermentation of the coconut milk extract to occur.
7. Separating the oil and fermented curd layers — separate the oil from the fermented curd by using
ladle to scoop the oil off the top. Note: dispose of the water phase and gummy portion by diluting
with water before draining into a grease trap. The fermented curd can be heated to remove the
residual class B oil that can be used for making skin care and herbal soap products. The toasted
curd can also be mixed with other compost material and use as organic fertilizer.
8. Filtering the oil — filter the VCO to remove adhering particles of fermented curd.
9. Packaging and storage — the recommended packaging material for VCO is glass. PET bottles can
be used in cases where the VCO is immediately consumed. Note: Class A VCO is always waterclear. Class B VCO is yellow. The latter happens when the process of coconut milk extraction is
invaded by unwanted microorganisms or sanitary protocols are not followed strictly such as washing
the hands with antibacterial soap or washing the materials with antibacterial detergent soap.
10. Tell them to report their output to the class.
172
Another theory says that the enzyme
present in the coconut makes the
separation of substances to occur. The socalled ‘fermentation method’ happens when
after 16 to 24 hours of settling, the water
smells and tastes sour. The so-called
‘natural’ explains that there is no addition of
any other substance or microorganism in
fermenting the virgin coconut oil.
Also the ‘virgin’ in the virgin coconut oil
implies that there is no substance added to
make the oil.
Modified Natural Fermentation Method
ENRICHMENT (90 MINS)
Directions: Read the procedures below on how the jigsaw and expert
PRACTICE (160 MINS)
Procedure:
Directions:
1. Explain why cells of most multicellular organisms cannot live long without oxygen.
2. How does poison like cyanide interfere with activity of electron transport chain in the mitochondrion?
3. Why is it beneficial for pyruvate to be reduced when oxygen in not available during the fermentation process?
4. If fermentation is a fast easy way to get ATP without oxygen and without requiring complex organelles, then why is there a slow more
complex process involving oxygen?
Suggested Answers:
1. The ATP produced during glycolysis is insufficient to sustain life processes. As a result, molecular oxygen has to appear to supply a bulk of
ATP (almost 90%) to the body cells. And hence, most cells of multicellular organisms cannot live long without oxygen, especially the human
brain cells which cannot undergo glycolysis.
2. Lack of oxygen is not the only factor that interferes with the electron transport system. Some
poisons like cyanide inhibit the normal activity of the cytochrome found in the ETC. Cyanide binds
tightly to the iron in the last cytochrome, making it unable to transport electrons to oxygen. This
cyanide also blocks the passage of electron through the ETC. As this happens the production of
ATP stops — and death ensues.
3. The reduction of pyruvate into lactate and alcohol ensures that NAD+ is regenerated, which is
required for the first step in the energy-harvesting step of glycolysis. As NAD+ returns to the earlier
reaction, it becomes reduced to NADH. In this way, glycolysis and substrate-level ATP synthesis
continue to occur even without the presence of oxygen.
4. In aerobic respiration, the molecules are broken down slowly to get much more of that energy out
and the left over products have useful energy left in them. Imagine a racing car were to get instantly
all the energy from fuel. If this happened, the racing car could not run longer mileage.
ENRICHMENT (5 MINS)
Teacher Tip:
This can be done at home as group
assignment. Just give your students
precautionary measures. Instructions can be
given for five minutes. Tell them to
document their output and submit it via
YouTube or Facebook.
Activity Title: Vinegar Making
Materials needed:
9 cups of coconut water, 2 cups of brown sugar, ½ teaspoon yeast, 2 clean cheesecloth, transparent
bottles for transferring the mixture, gas stove, rubber bands, cooking pan, funnel, 2 cups of mother
vinegar, jar(s) spoon for mixing
Procedure:
SET A: Preparation and alcoholic fermentation
1. Using cheesecloth, filter the coconut water and place it a clean cooking pan. Then add 2 cups of
brown sugar. Mix thoroughly using a spoon until the sugar crystals are dissolved completely.
2. Heat the mixture at low fire for 20 minutes. As you do this, do not cover the cooking pan and do
not boil the mixture. After 20 minutes, let the mixture cool for 30 minutes to 1 hour.
3. Add ½ teaspoon of yeast. Mix very well. Afterwards, transfer the mixture to clean transparent
174
Vinegar is a sour-tasting condiment and
preservative. It can be prepared by two
successive microbial processes. The first
phase is done through alcoholic
fermentation by a eukaryotic organism
called yeast. The second phase is by
oxidation of alcohol by a prokaryotic
organism called Acetobacter aceti. This
bacterium is responsible for converting the
alcohol in wine to acetic acid or vinegar.
Since coconut is abundant in our country,
use this example to show the principle of
fermentation process involving
microorganisms and the series of reactions
that take place as coconut water is
converted into vinegar.
4. bottle(s). Cover the bottle(s) with cheesecloth. The small pores in the cheesecloth will allow the gas from inside the bottle to exit.
5. Place the mixture in a safe place to allow the process of fermentation.
Note: From the day you added yeasts to the mixture you will observe alcoholic fermentation that is characterized by the release of bubbles.
The bubbles indicate the presence of carbon dioxide. When bubbles no longer appear in the mixture, then alcoholic fermentation has ceased
already. The formation of bubbles will be observed for approximately one week. To ferment means to break the sugar in the absence of oxygen.
SET B: Acetous Fermentation
After one week, transfer the mixture to a jar. Then add 2 cups of mother vinegar to a jar. Cover the jar with cheesecloth to allow oxygen to enter
into the jar. Place the jar in a safe place. Wait for one month to allow acetous fermentation.
EVALUATION (40 MINS)
Directions: Compare and explain aerobic respiration, anaerobic respiration and fermentation in terms of the following:
1. Immediate fate of electron transfer
2. Terminal electron acceptor of electron transport chain
3. Reduced product(s) formed
4. Mechanism of ATP synthesis
Tabulate your answers. Then give at least three advantages and at one disadvantage for aerobic respiration, anaerobic respiration and
fermentation.
General Biology 1
120 MINS
ATP in Cellular Metabolism and
Photosynthesis
LESSON OUTLINE
Content Standards
The learners demonstrate an understanding of:
Introduction Review of prerequisite and related topics
1. ATP-ADP Cycle
2. Photosynthesis
Motivation
3. Respiration
Performance Standard
The learners shall be able to prepare simple fermentation setup using common
fruits to produce wine or vinegar via microorganisms.
Learning Competencies
• The learners describe reactions that produce and consume ATP
(STEM_BIO11/12-IIa-j-9)
•
The learners compute the number of ATPs needed or gained in
photosynthesis and respiration (STEM_BIO11/12_IIa-j-11)
Specific Learning Outcome
At the end of the lesson, the learners shall be able to compute the number of
ATPs needed or gained in photosynthesis and respiration
176
Engage students with questions of
purpose
30
5
Instruction/ Lecture on Photosynthesis, ATP
Delivery/
Production, and Cellular Metabolism
Practice
60
Practice
Group Activity
15
Evaluation
Quiz
10
Resources
Shown/presented on the different parts of the Teaching
Guide
INTRODUCTION (30 MINS)
Clearly communicate learning competencies and objectives. At the end of the session, the learners shall be able to compute the number of
ATPs needed or gained in photosynthesis and respiration. Also, allow the readers to connect and/or review prerequisite knowledge. Review
structure of ATP (Adenosine Triphosphate) and how it is used as the energy currency of the cell.
During PHOTOSYNTHESIS:
•
Energy from sunlight is harvested and used to drive the synthesis of glucose from CO2 and H2O. By converting the energy of sunlight to a
usable form of potential chemical energy, photosynthesis is the ultimate source of metabolic energy for all biological systems.
•
Photosynthesis takes place in two distinct stages.
(A) In the light reactions, energy from sunlight drives the synthesis of ATP and NADPH, coupled to the formation of O2 from H2O.
(B) In the dark reactions (named because they do not require sunlight), the ATP and NADPH produced by the light reactions drive
glucose synthesis.
•
In eukaryotic cells, both the light and dark reactions of photosynthesis occur within chloroplasts—the light reactions in the thylakoid
membrane and the dark reactions within the stroma.
Stages of Cellular Metabolism:
1. Glycosis
2. Pyruvate grooming (between Glycolysis and Citric acid cycle
3. Kreb’s Cycle/Citric Acid Cycle/Acid Cycle
4. Electron Transport Chain and Oxidality
Compare and Contrast Cellular Respiration and Photosynthesis
Cellular Respiration
Photosynthesis
Production of ATP
Yes; theoretical yield is 38 ATP molecules per
glucose but actual yield is only about 30-32.
Yes
Reactants
C6H12O6 and 6O2
6O2 and 12H2O and light energy
Requirement of sunlight
Sunlight not required; cellular respiration occurs at
all times.
Can occur only in presence of sunlight
Chemical Equation (formula)
6O2 + C6H12O6 --> 6CO2 +6H2O + ATP (energy)
6CO2 + 12H2O + light --> C6H12O6 + 6O2 + 6H20
Process
Production of ATP via oxidation of organic sugar
compounds. [1] glycolosis: breaking down of
sugars; occurs in cytoplasm [2] Krebs Cycle: occurs
in mitochondria; requires energy [3] Electron
Transport Chain-- in mitochondria; converts O2 to
water.
The production of organic carbon (glucose and
starch) from inorganic carbon (carbon dioxide) with
the use of ATP and NADPH produced in the light
dependent reaction
Fate of oxygen and carbon dioxide
Oxygen is absorbed and carbon dioxide is
released.
Carbon dioxide is absorbed and oxygen is
released.
Energy required or released?
Releases energy in a step wise manner as ATP
molecules
Requires energy
Main function
Breakdown of food. Energy release.
Production of food. Energy Capture.
Chemical reaction
Glucose is broken down into water and carbon
dioxide (and energy).
Carbon dioxide and water combine in presence of
sunlight to produce glucose and oxygen.
Stages
4 stages: Glycolysis, Linking Reaction (pyruvate
oxidation), Krebs cycle, Electron Transport Chain
(oxidative phosphorylation).
2 stages: The light dependent reaction, light
independent reaction. (AKA light cycle & calvin
cycle)
What powers ATP synthase
H+ proton gradient across the inner mitochondria
membrane into matrix. High H+ concentration in
the intermembrane space.
H+ gradient across thylakoid membrane into
stroma. High H+ concentration in the thylakoid
lumen
Products
6CO2 and 6H20 and energy(ATP)
C6H12O6 (or G3P) and 6O2 and 6H2O
Cellular Respiration
Photosynthesis
What pumps protons across the membrane
Electron transport chain. Electrochemical gradient
creates energy that the protons use to flow
passively synthesizing ATP.
Electron transport chain
Occurs in which organelle?
Mitochondria Glycolysis (cytoplasm)
Chloroplasts
Final electron receptor
O2 (Oxygen gas)
NADP+ (forms NADPH )
Occurs in which organisms?
Occurs in all living organisms (plants and animals).
Occurs in plants, protista (algae), and some
bacteria.
Electron source
Glucose, NADH + , FADH2
Oxidation H2O at PSII
Catalyst - A substance that increases the rate of No catalyst is required for respiration reaction.
a chemical reaction
Reaction takes places in presence of chlorophyll.
High electron potential energy
From light photons.
From breaking bonds
Photosynthesis (source: http://www.diffen.com/difference/Cellular_Respiration_vs_Photosynthesis)
MOTIVATION (5 MINS)
Teacher asks students “Why study photosynthesis and cellular respiration?”
Photosynthesis - Lead discussion into the importance of
1. Photosynthesis in selection of plants/trees for reforestation, agriculture and biodiversity conservation. (http://bioenergy.asu.edu/photosyn/
study.html)
2. Cellular Respiration in food production (pretzels, beer, soy sauce, pickles, vinegar, yeast-risen bread, or any other product that requires
fermentation or microbial breakdown of compounds in food), athletics (sports nutrition and event-specific training) and others.
INSTRUCTION/DELIVERY/PRACTICE (60 MINS)
Lecture on Photosynthesis and ATP Production
ATP is formed by the addition of a phosphate group to a molecule of adenosine diphosphate (ADP); or to state it in chemical terms, by the
phosphorylation of ADP. This reaction requires a substantial input of energy, much of which is captured in the bond that links the added
phosphate group to ADP. Because light energy powers this reaction in the chloroplasts, the production of ATP during photosynthesis is referred
to as photophosphorylation.
The light reaction uses the energy from photons to create ATP and NADPH, which are both forms of chemical energy used in the dark reaction
(=Calvin Cycle). Calvin Cycle, through a series of chemical reactions, takes the carbon from carbon dioxide and turns it into glucose, which is a
sugar that cells use as energy.
Carbon dioxide is a fully oxidized molecule. What that means is basically it does not have a lot of chemical energy. The Calvin Cycle turns
carbon dioxide into the much more reduced molecule, glucose, which has much more energy.
Where ATP comes into play is that it functions as a reduced molecule that provides the chemical energy that transforms the carbons in the
carbon dioxide molecules into progressively more reduced molecules until you get glucose. Thus, ATP is used to power the change from 3phosphoglycerate to 1,3-bisphosphoglycerate, which is then turned into 2 glyceraldehyde 3-phosphate (G3P) molecules with NADPH (an
energy source similar to ATP). One of these G3P molecules gets turned into glucose. The other one is transformed by ATP into ribulose
bisphosphate (RuBP), which then picks up carbon dioxide and the cycle begins again.
Lecture on Cellular Metabolism and ATP Production
What is the difference between substrate-level phosphorylation and oxidative phosphorylation?
Substrate-level phosphorylation – is the formation of ATP by the direct transfer of a PO3 group to ADP.
(Source: https://quizlet.com/11951424/metabolism-final-exam-flash-cards/)
Oxidative phosphorylation – is the process that explains how molecules of FADH2 and NADH are used to make ATP. The term “oxidative” is
used because oxygen accepts an electron while the gradient made by the movement of electrons powers the creation ATP.
(Source: http://www.dbriers.com/tutorials/2012/04/substrate-level-vs-oxidative-phosphorylation/)
Other references that can be used: https://online.science.psu.edu/biol110_sandbox_8862/node/8924
http://www.neshaminy.k12.pa.us/Page/20741
180
Review Stages of Cellular Metabolism and the products produced at each stage (ATP by substrate level phosphorylation, CO2, NADH and
FADH2)
Four Major Reaction Pathways
1. Glycolysis
2. Conversion of Pyruvate to Acetyl CoA (also called Oxidation of Pyruvate, Pyruvate Processing, Pyruvate Grooming)
3. Kreb’s Cycle (Citric Acid Cycle, Tricarboxylic Acid Cycle)
4. Electron Transport Chain (Chemiosmosis)
Other references that can be used:
•
•
•
•
•
•
•
•
•
•
•
https://courses.candelalearning.com/ap2x1/chapter/carbohydrate-metabolism/
http://www.uic.edu/classes/bios/bios100/lectures/respiration.htm
http://www.neshaminy.k12.pa.us/Page/20741
http://sp.uconn.edu/~bi102vc/1102fall11/ATP.html
http://biology.tutorvista.com/cell/cellular-respiration.html
https://en.wikibooks.org/wiki/Biology,_Answering_the_Big_Questions_of_Life/Metabolism/Metabolism3
http://people.ucalgary.ca/~rosenber/CellularRespirationSummary.html
http://antranik.org/intro-to-cellular-respiration-the-production-of-atp/
http://sandwalk.blogspot.com/2007/12/how-cells-make-atp-substrate-level.html
http://study.com/academy/lesson/substrate-level-phosphorylation-and-oxidative-phosphorylation.html
http://www.diffen.com/difference/Cellular_Respiration_vs_Photosynthesis
Stage of Cellular Metabolism
Substrate-Level Phosphorylation
Oxidative Phosphorylation through ETC
NADH
Subtotal1
Glycolysis
2
2
4-6 2
Pyruvate Grooming
(Decarboxylation of Pyruvate)(x2)3
0
2
6
Citric acid cycle ( x 2)3
2
6
18
Subtotal
4
28-30
FADH2
Subtotal1
2
4
4
Total
36-38
SUMMARY TABLE – Number of ATP molecules formed from 1 molecule of glucose
The amount of ATP produced is estimated from the number of protons than passes through the inner mitochondrial membrane (via the electron
acceptors of the electron transport chain (ETC) and the number of ATP produced by ATP Synthase.
1.
Assumption = Each NADH will generate 3 ATPs while FADHs will generate 2 ATPs.
2. The number of ATP produced depends on the acceptor that receives the hydrogen ions and electrons from the NADH formed during
glycolysis in the cytoplasm.
3. Glycolysis results in formation of 2 molecules of pyruvic acid/pyruvate thus values are multiplied by 2.
STAGE
LOCATION
WHAT
REACTANT (What PRODUCTS (What ATP PRODUCED BY
HAPPENS? goes in)
comes out)
Substrate Level
Phosphorylation
Oxidative Phosphorylation
NADH
FADH2
Glycolysis
Pyruvate Processing/
Grooming
Citric Acid Cycle
Oxidative
Phosphorylation
PRACTICE (15 MINS)
Using previous lessons and this lecture, students grouped into 2-3 are asked to answer the table below. Teacher provides the initial number of
glucose molecules that will undergo cellular metabolism.
Practice Questions
(Available at the following sites: Students are asked to watch a video and answer questions after watching the video).
Photosynthetic Electron Transport and ATP Synthesis
•
https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/photosynthetic_electron_transport_and_atp_synthesis.html
182
Calvin Cycle
•
https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/calvin_cycle.html
EVALUATION (10 MINS)
Questions for Exam/Quiz
•
https://quizlet.com/11951424/metabolism-final-exam-flash-cards/
•
https://quizlet.com/17507853/biochemistry-ii-practice-questions-oxidative-phosphorylation-flash-cards/
•
http://faculty.une.edu/com/courses/bionut/distbio/obj-512/Chap21-practice%20questions.htm
•
http://web.mnstate.edu/provost/Chem410ETSOxPhosQuest.pdf
•
https://www.khanacademy.org/test-prep/mcat/biomolecules/krebs-citric-acid-cycle-and-oxidative-phosphorylation/e/oxidativephosphorylation-questions
•
https://mcb.berkeley.edu/labs/krantz/mcb102/MCB102-SPRING2008-EXAM-KEY_v3.pdf
RUBRICS/ASSESSMENT GUIDE
LEARNING
COMPETENCY
ASSESSMENT TOOL
Exemplary
(8-10)
Satisfactory
(5-7)
Developing
(3-4)
The learners shall be
able to describe the
following:
Student participation
(During lecture)
Student was able to
answer the question
without referring to his/her
notes plus the follow-up
question.
Student was able to
answer the question
without referring to his/
her notes; Was not able
to answer follow up
question.
Student was able to
(1) Student was not able
answer the question but to answer the question.
read from his/her notes. (2) Student read from
notes of his/her
classmate..
Students in the team
equally contributed to the
discussion and the
answering of the table
provided
Student listened to the
discussion but
contribution to the team
was lesser than the
other members
Student was a passive
participant and
contribution was
minimal.
Student was interested
in other matters not
related to the exercise.
Obtained 50-69.99%
correct answers in the
exam
Obtained percentile
<50% correct answers in
the exam
Compute the number
of ATPs needed or
gained in
Student participation
photosynthesis and
(During Practice)
respiration
Examination
Obtained 90-100% correct Obtained 70-80.99%
answers in the exam
correct answers in the
exam
Beginning
(1-2)
Biographical Notes
FLORENCIA G. CLAVERIA, Ph.D.
Team Leader
DAWN T. CRISOLOGO
Team Leader
Dr. Florencia G. Claveria is the current Chair of the CHED
Technical Panel for Biology and Molecular Biology. She is also
member of the Commission’s Technical Panel for Math and
Science. She is currently Vice Chancellor for Academics,
Research, and Operations at the De La Salle Araneta University.
She is a full professor at the De La Salle University-Manila
where she served as Dean of the College of Science for 6
academic years. Dr Claveria finished her doctorate in Biological
Sciences at the University of Cincinnati, through a Fulbright-Hays
grant. She completed her master’s in Zoology at the Ghen State
University, through a grant from the Government of Belgium. She
earned her bachelor’s degree in Biology at St. Louis University.
Her written scholarly works include contributions to academic
publications such as the Philippine Textbook of Medical
Parasitology, Journal of Protozoology Research, and The Journal
of Veterinary Medical Science.
184
Ms. Dawn Crisologo is a Special Science Teacher at the
Philippine Science High School-Main Campus in Diliman, Quezon
City and specializes in advanced topics in Ecology, Evolution and
Biodiversity, Anatomy, Physiology, and Methods in Science and
Technology Research. She is a member of the Asian Association
of Biology Educators, Wildlife Conservation Society of the
Philippines, and Biology Teachers Association of the Philippines.
Her works are included in The Philippine BIOTA Journal and
three editions of the Science Blast textbook. Ms. Crisologo is
currently finishing her master’s in Environmental Science at the
University of the Philippines Diliman. She completed her
bachelor’s degree in Biology at the same university.
CHUCKIE FER CALSADO
Writer
Mr. Chuckie Fer Calsado is Special Science Teacher IV at
the Philippine Science High School Main Campus where he has
been teaching for 8 years. He is a member of biological
organisations like the Biology Teachers Association of the
Philippines, the Asian Association for Biology Education, and
Concerned Artists of the Philippines among many others. He has
published academic papers such as Implication of Students’
Cognitive Style, Personal Demographics, Values and Decision
Making in Environmental Education and the Role of Education in
the Prevention of Child Trafficking in Nepal. Mr. Calsado finished
his Master’s in Bioethics at the Monash University and his
bachelor’s degree in Biology at the University of the Philippines
DIliman.
AILEEN C. DELA CRUZ
Writer
JANET S. ESTACION, Ph.D.
Writer
Ms. Aileen Dela Cruz has been serving as the Science
Research Analyst at the Philippine Science High School - Main
Campus since 2004. Her academic interests range from
microbiology, food safety and nutrition, and laboratory safety and
she has been involved in trainings and conferences on the same
fields of study. Her published scholarly works include series of
textbooks on 21st Century Learning. Ms. Dela Cruz earned her
bachelor’s degree in Biology at the University of the Philippines
Baguio.
Dr. Janet Estacion is current Officer-in-Charge at the
Institute of Marine and Environmental Science in Silliman Unive
DOREEN D. DOMINGO, PH.D.
Writer
Dr. Doreen D. Domingo is a Professor at the Mariano
Marcos State University where she teaches both in the graduate
and undergraduate levels. She is currently the Chief of Alumni
Relations for the university. Dr. Domingo finished her doctorate in
Biology (magna cum laude) at St. Louis University through a
research grant from CHED and the Microbial Forensics and
Biodefense Laboratory, Indiana University. She completed her
Doctor of Education on Educational Management, her master’s
degree in Education major in Biology, and her bachelor’s degree
in Biology at the Mariano Marcos State University. Dr. Domingo’s
scholarly works were published on the International Referred
Journal and the National Referred Journal.
rsity where she has been teaching for 30 years now. She headed
researches on marine conservation and the recovery of reefs. Her
scholarly works appeared on different publications such as the
Philippine Science Letters and the Silliman Journal. Dr. Estacion
earned her doctorate degree in Zoology at the James Cook
University of North Queensland. She completed her master’s
degree in Marine Biology at the University of the Philippines
Diliman and her bachelor’s degree in Biology at the Silliman
University.
MARY JANE C. FLORES, Ph.D.
Writer
Dr. Mary Jane C. Flores is Assistant Professor 3 at the
College of Science in the De La Salle University where she has
been teaching for 20 years now. Her published works include
researches on parasitology, climatology, and community
nutrition. Dr Flores has conducted and attended seminars on
Biology in the country and abroad, including the Training on
Biological Control at the US Department of AgricultureAgricultural Research Service and Congress meetings on
Parasitology. She is a two-time recipient of the Don Ramon J.
Araneta Chair in Ecology among other citations. Dr. Flores
earned her Doctorate, Master’s, and Bachelor’s degrees in
Biology at the De La Salle University.
JOHN DONNIE RAMOS, Ph.D.
Technical Editor
JUSTIN RAY M. GUCE
Writer
Mr. Justin Ray Guce is a Special Science Teacher I at the
Philippine Science High School Main Campus in DIliman, Quezon
City where he teaches for 9 years. He has served as a Trainer of
student representatives for Science Olympiad competitions and
has delivered presentations in a number of Biology workshops
and conventions. Mr Guce is a member of the Wildlife
Conservation Society of the Philippines and the Biology Teachers
Association of the Philippines. Mr Guce is currently finishing his
master’s in Biology Education at the University of the Philippines
Diliman where he also graduated his bachelor’s degree in
Biology.
NOLASCO H. SABLAN
Writer
Mr. Nolasco Sablan is Teacher III at the Parada National
High School and is a DepEd teacher for 11 years now. He has
worked as resource speaker, trainer, and writer for different
institutions in the education sector, including the Ateneo de
Manila University, Metrobank Foundation Inc., and the
Department of Education. Mr. Nolasco Sablan earned his
master’s degree in Biology Education at the Ateneo de Manila
University and completed his bachelor’s degree in Education
major in General Science at the Philippine Normal University.
186
Dr. John Donnie Ramos is a Member of CHED’s Technical
Panel for Biology and Microbiology and Board Member of the
Philippine Society for Biochemistry and Molecular Biology. He is
currently the Dean of the College of Science at the University of
Santo Tomas where he teaches molecular biology, immunology
and genetics, and allergology. Dr. Ramos completed his
doctorate in Molecular Biology at the National University of
Singapore. He finished his master’s degree in Biological Sciences
at the University of Santo Tomas and his bachelor’s degree in
Biology at the Philippine Normal University. Dr. Ramos is
recipient of the NAST-TWAS Prize for Young Scientist in the
Philippines in 2010, and Outstanding Young Scientist by the
National Academy of Science and Technology in 2005.
JOY R. JIMENA
Copyreader
Ms. Joy Jimena is currently Planning Officer II at the
Information Management Bureau of the Department of Social
Welfare and Development. She also previously worked with other
government agencies such as the Department of National
Defense and Philippine Commission on Women, and Social
Security System. Ms. Jimena graduated at the University of the
Philippines Diliman with a degree in Public Administration.
RENAN U. ORTIZ
Illustrator
Mr. Renan Ortiz is a teacher and visual artist who has
collaborated in local and international art exhibitions such as the
SENSORIUM at the Ayala Museum, Populus in Singapore,
Censorship_2013 Move On Asia in South Korea, and the Triumph
of Philippine Art in New Jersey, USA. Mr. Ortiz’s solo exhibitions
include versereverse at the Republikha Art Gallery. He first
completed his bachelor’s degree in Political Science at the
University of the Philippines Manila before finishing his bachelor’s
degree in Fine Arts major in Painting at the University of the
Philippines Diliman. Mr. Ortiz is an awardee of the Cultural
Center of the Philippines’ CCP Thirteen Artists Awards in 2012.
DANIELA LOUISE B. GO
Illustrator
Ms Daniela Louise Go is a freelance illustrator and graphic
designer, specializing on graphic design, brand and campaign
design, and copywriting. She has worked as illustrator for Stache
Magazine, Philippine Daily Inquirer, and Summit Media Digital.
Ms Go is a member of organisations such as the UP Graphic and
UP Grail in which she also served as designer and illustrator. Her
works have been part of art exhibitions including Freshly Brewed,
Wanton Hypermaterialism, and Syntheses 2014: Graduate
Exhibit. Ms. Go graduated her bachelor’s degree in Fine Arts
Major in Visual Communication at the University of the Philippine
Diliman.