The Commission on Higher Education in
collaboration with the Philippine Normal University
Teaching Guide for Senior High School
GENERAL
BIOLOGY 1
SPECIALIZED SUBJECT | ACADEMIC-STEM
This Teaching Guide was collaboratively developed and reviewed by
educators from public and private schools, colleges, and universities.
We encourage teachers and other education stakeholders to email
their feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School Support
Team at k12@ched.gov.ph. We value your feedback and recommendations.
Development Team
Team Leaders: Florencia G. Claveria, Ph.D.,
Crisologo
Dawn T.
Writers: Doreen D. Domingo, Ph.D., Aileen C. dela Cruz,
Chuckie Fer A. Calsado, Doreen D.
Domingo, Janet S. Estacion, Justin Ray M. Guce, Mary
Jane C. Flores, Nolasco H. Sablan Technical Editors:
Annalee S. Hadsall, Ph.D.
Published by the Commission on Higher Education, 2016
Chairperson: Patricia B. Licuanan, Ph.D.
Copy Reader: Caroline H. Pajaron
Commission on Higher Education
K to 12 Transition Program Management Unit
Office Address: 4th Floor, Commission on Higher Education,
C.P. Garcia Ave., Diliman, Quezon City
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz
Illustrator: Ma. Daniella Louise F. Borrero
Senior High School Support Team
CHED K to 12 Transition Program Management Unit
Program Director: Karol Mark R. Yee
Consultants
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY. University
President: Ester B. Ogena, Ph.D.
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
VP for University Relations & Advancement: Rosemarievic V. Diaz,
Ph.D.
Ma. Cynthia Rose B. Bautista, Ph.D., CHED
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University
Carmela C. Oracion, Ph.D., Ateneo de Manila University
Minella C. Alarcon, Ph.D., CHED Gareth
Price, Sheffield Hallam University
Stuart Bevins, Ph.D., Sheffield Hallam University
Table of Contents
Lead for Senior High School Support: Gerson M.
Abesamis
Lead for Policy Advocacy and Communications:
Averill M. Pizarro Course Development Officers:
John Carlo P. Fernando, Danie Son D. Gonzalvo
Teacher Training Officers: Ma. Theresa C.
Carlos, Mylene E. Dones
Monitoring and Evaluation Officer: Robert
Adrian N. Daulat
Administrative Officers:
Ma. Leana Paula B. Bato, Kevin Ross D. Nera, Allison A.
Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC
Commercial, No. 32 St. Louis Compound 7,
Baesa, Quezon City, ectec_com@yahoo.com
This Teaching Guide by the Commission
on Higher Education is licensed under a
Creative Commons
AttributionNonCommercial-ShareAlike
4.0 International License. This means
you are free to: Share — copy and
redistribute the material in any
medium or format Adapt — remix,
transform, and build upon the material.
The licensor, CHED, cannot revoke
these freedoms as long as you follow
the license terms. However, under the
following terms:
Attribution — You must give appropriate
credit, provide a link to the license, and
indicate if changes were made. You may
do so in any reasonable manner, but not
in any way that suggests the licensor
endorses you or your use.
NonCommercial — You may not use the
material for commercial purposes.
ShareAlike — If you remix, transform, or
build upon the material, you must
distribute your contributions under the
same license as the original.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1
DepEd General Biology 1 Curriculum Guide . . . . . . . . . . . . .
5
Chapter 3: Energy Transformation
Chapter 1: Cell
Lesson 11: Photosynthesis and Cellular Respiration . . . . . . . . . . .
Lesson 1: The Cell: Endomembrane System, Mitochondria,
Lesson 12: Forms of Energy, Laws of Energy Transformation
86
Chloroplasts, Cytoskeleton, and Extracellular Components . . . 9
and Role of ATP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Lesson 2: Mitochondria and Chloroplasts . . . . . . . . . . . . . . . . . 15
Lesson 13: Energy Transformation Part 1 . . . . . . . . . . . . . . . . . . . . 111
Lesson 3: Structure and Functions of Animal Tissues and Cell
Lesson 14: Energy Transformation Part 2 . . . . . . . . . . . . . . . . . . . . 120
Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
28
Lesson 4: Cell Cycle and Cell Division . . . . . . . . . . . . . . . . . . . . 36
Lesson 5: Transport Mechanisms Part 1 . . . . . . . . . . . . . . . . . . .
99
Lesson 15: Energy Transformation Part 3 . . . . . . . . . . . . . . . . . . . . 128
Lesson 16: Cellular Respiration Part 1 . . . . . . . . . . . . . . . . . . . . . . 133
46
Lesson 17: Cellular Respiration Part 2 . . . . . . . . . . . . . . . . . . . . . . 150
Lesson 6: Transport Mechanisms Part 2 . . . . . . . . . . . . . . . . . . . 50
Lesson 18: Cellular Respiration Part 3 . . . . . . . . . . . . . . . . . . . . . . 165
Chapter 2: Biological Molecules
Lesson 19: ATP in Cellular Metabolism and Photosynthesis . . . . . 176
Lesson 7: Carbohydrates and Lipids . . . . . . . . . . . . . . . . . . . . .
57
Lesson 8: Amino Acids and Proteins Part 1 . . . . . . . . . . . . . . . . 70
Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
Lesson 9: Amino Acids and Proteins Part 2 . . . . . . . . . . . . . . . . 73
Lesson 10: Biological Molecules: Enzymes . . . . . . . . . . . . . . . .
78
Introduction
As the Commission supports DepEd’s implementation of Senior High School (SHS), it upholds the vision and
mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic Education Act of
2013, that “every graduate of basic education be an empowered individual, through a program rooted on...the
competence to engage in work and be productive, the ability to coexist in fruitful harmony with local and global
communities, the capability to engage in creative and critical thinking, and the capacity and willingness to
transform others and oneself.”
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this Teaching
Guide was studied and reviewed by education and pedagogy experts, and was enhanced with appropriate
methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this goal.
Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and assessment tools,
support them in facilitating activities and questions, and assist them towards deeper content areas and
competencies. Thus, the introduction of the SHS for SHS Framework.
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at the core of this
book. The lessons, which combine high-quality content with flexible elements to accommodate diversity of
teachers and environments, promote these three fundamental concepts:
SAYSAY:
MEANIN
G
SHS for SHS
Framework
Why is
this
important
?
Through
this
Teaching
Guide,
teachers
will be
able to
facilitate
an
understan
ding of
the value
of the
lessons,
for each
learner to
fully
engage in
the
content
on both
the
cogniti
ve and
affecti
ve
levels.
HUSAY: MASTERY
How will I deeply understand this? Given
that developing mastery goes beyond
memorization, teachers should also aim for
deep understanding of the subject matter
where they lead learners to analyze and
synthesize knowledge.
SARILI: OWNERSHIP
What can I do with this?
About this Teaching
Guide
When
teachers
empower learners to take ownership of their
learning, they develop independence and
selfdirection, learning about both the
subject matter and themselves.
Biology I is a Science, Technology, Engineering and Mathematics (STEM) Specialized Subject taken in
the first half of Grades 11/12. Learners go on a journey geared toward the deeper understanding and
appreciation of life processes at the cellular and molecular levels previously introduced in Grades 710. They will also apply basic chemistry and physics principles as they examine the transformation of
energy in organisms.
Implementing this course at the senior high school level is subject to numerous challenges with
mastery of content among educators tapped to facilitate learning and a lack of resources to deliver
the necessary content and develop skills and attitudes in the learners, being foremost among these.
In support of the SHS for SHS framework developed by CHED, these teaching guides were crafted and
refined by biologists and biology educators in partnership with educators from focus groups all over
the Philippines to provide opportunities to develop the following:
1.
Saysay through meaningful, updated, and context-specific content that highlights important
points and common misconceptions so that learners can connect to their realworld experiences and
future careers;
2.
Husay through diverse learning experiences that can be implemented in a resourcepoor
classroom or makeshift laboratory that tap cognitive, affective, and psychomotor domains are
accompanied by field-tested teaching tips that aid in facilitating discovery and development of higherorder thinking skills; and
3.
Sarili through flexible and relevant content and performance standards allow learners the
freedom to innovate, make their own decisions, and initiate activities to fully develop their academic
and personal potential.
These ready-to-use guides are helpful to educators new to either the content or biologists new to the
experience of teaching Senior High School due to their enriched content presented as lesson plans or
guides. Veteran educators may also add ideas from these guides to their repertoire. The Biology Team
hopes that this resource may aid in easing the transition of the different stakeholders into the new
curriculum as we move towards the constant improvement of Philippine education.
Parts of the Teaching
Guide
2
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly usable for
teachers. It contains classroom activities and pedagogical notes, and is integrated with innovative pedagogies.
All of these elements are presented in the following parts:
1. Introduction
• Highlight key concepts and identify the essential questions
• Show the big picture
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands-on/laboratory activity
• Connect to a real-life problem
3. Instruction/Delivery
• Give a demonstration/lecture/simulation/hands-on activity
• Show step-by-step solutions to sample problems
• Give applications of the theory
• Connect to a real-life problem if applicable
4. Practice
• Discuss worked-out examples
• Provide easy-medium-hard questions
• Give time for hands-on unguided classroom work and discovery
• Use formative assessment to give feedback
5. Enrichment
• Provide additional examples and applications
• Introduce extensions or generalisations of concepts
• Engage in reflection questions
• Encourage analysis through higher order thinking prompts
6. Evaluation
• Supply a diverse question bank for written work and exercises
• Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of the
Senior High School program, it is of paramount importance to align
Functional Skills set by DepEd with the College Readiness Standards stated
by CHED.
The DepEd articulated a set of 21st century skills that should be embedded
in the SHS curriculum across various subjects and tracks. These skills are
desired outcomes that K to 12 graduates should possess in order to
proceed to either higher education, employment, entrepreneurship, or
middle-level skills development.
College Readiness Standards Foundational Skills
On the other hand, the Commission declared the College Readiness
Standards that consist of the combination of knowledge, skills, and
reflective thinking necessary to participate and succeed - without
remediation - in entry-level undergraduate courses in college.
The alignment of both standards, shown below, is also presented in this
Teaching Guide - prepares Senior High School graduates to the revised
college curriculum which will initially be implemented by AY 2018-2019.
DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1.
2.
3.
4.
5.
Solid grounding on Philippine experience and culture;
An understanding of the self, community, and nation;
Application of critical and creative thinking and doing processes;
Competency in formulating ideas/arguments logically, scientifically, and creatively; and
Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and a diverse
world;
Systematically apply knowledge, understanding, theory, and skills for the development of the self,
local, and global communities using prior learning, inquiry, and experimentation
Visual and information literacies, media literacy, critical thinking and
problem solving skills, creativity, initiative and self-direction
Global awareness, scientific and economic literacy, curiosity, critical
thinking and problem solving skills, risk taking, flexibility and
adaptability, initiative and self-direction
Work comfortably with relevant technologies and develop adaptations and innovations for significant Global awareness, media literacy, technological literacy, creativity,
flexibility and adaptability, productivity and accountability
use in local and global communities
Communicate with local and global communities with proficiency, orally, in writing, and through new
technologies of communication
Global awareness, multicultural literacy, collaboration and
interpersonal skills, social and cross-cultural skills, leadership and
responsibility
Interact meaningfully in a social setting and contribute to the fulfilment of individual and
shared goals, respecting the fundamental humanity of all persons and the diversity of
responsibility, ethical, moral, and spiritual groups and communities
values
4
Media literacy, multicultural literacy, global awareness,
collaboration and interpersonal skills, social and cross-cultural skills, leadership and
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12
Subject Title: Biology I
Quarters: 1st to 2nd Quarter
No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly life processes at the cellular
and molecular levels. It also covers the transformation of energy in organisms.
Content
Cell
Content Standard
The learners demonstrate an
understanding of:
1. Cell Theory
2. Cell Structure and Functions
3. Prokaryotic vs Eukaryotic
Cells
4. Cell Types
5. Cell Modifications
Performance Standard
The learners shall be able
to:
1. construct a 3D model of
a plant/animal/ bacterial
cell using
recyclable materials
2. construct a cell
membrane model from
indigenous or recyclable
materials
6. Cell Cycle
a. Mitosis
b. Meiosis
K to 12 Senior High School STEM Specialized Subject – General December 2013
Learning Competencies
Code
The learners...
explain the postulates of the cell theory
1.
2. describe the structure and function of major and
subcellular organelles
STEM_BIO11/12
-Ia-c-1
STEM_BIO11/12
-Ia-c-2
3. distinguish prokaryotic and eukaryotic cells according to
their distinguishing features
STEM_BIO11/12
-Ia-c-3
4. classify different cell types (plant/animal tissues) and
specify the function(s) of each
STEM_BIO11/12
-Ia-c-4
5. describe some cell modifications that lead to adaptation
to carry out specialized functions (e.g., microvilli, root
hair)
STEM_BIO11/12
-Ia-c-5
1. characterize the phases of the cell cycle and their control
points
STEM_BIO11/12
-Id-f-6
2. describe the stages of mitosis/meiosis given 2n=6
STEM_BIO11/12
-Id-f-7
3. discuss crossing over and recombination in meiosis
STEM_BIO11/12
-Id-f-8
4. explain the significance or applications of mitosis/meiosis STEM_BIO11/12 Id-f-9
Page 1 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
7. Transport Mechanisms
a. Simple Diffusion
5. identify disorders and diseases that result from the
malfunction of the cell during the cell cycle
STEM_BIO11/12
-Id-f-10
1. describe the structural components of the cell
STEM_BIO11/12
-Ig-h-11
Biology 1
Content
Content Standard
Performance Standard
b. Facilitated Transport
c. Active Transport
d. Bulk/Vesicular
Transport
Biological
Molecules
Learning Competencies
membrane
Structures and Functions of
Biological Molecules
- Carbohydrates
- Lipids
- Proteins
- Enzymes
- Nucleic Acids
2. relate the structure and composition of the cell
membrane to its function
STEM_BIO11/12
-Ig-h-12
3. explain transport mechanisms in cells (diffusion osmosis,
facilitated transport, active transport)
STEM_BIO11/12
-Ig-h-13
4. differentiate exocytosis and endocytosis
STEM_BIO11/12
-Ig-h-14
1. categorize the biological molecules(lipids, carbohydrates,
proteins, and nucleic acids) according to their structure
and function
STEM_BIO11/12
-Ii-j-15
2. explain the role of each biological molecule in specific
metabolic processes
STEM_BIO11/12
-Ii-j-16
3. describe the components of an enzyme
5. determine how factors such as pH, temperature, and
substrate affect enzyme activity
STEM_BIO11/12
-Ii-j-17
STEM_BIO11/12
-Ii-j-18
STEM_BIO11/12
-Ii-j-19
1. explain coupled reaction processes and describe the role
of ATP in energy coupling and transfer
STEM_BIO11/12
-IIa-j-1
2. describe the major features and chemical events in
photosynthesis and respiration
STEM_BIO11/12
-IIa-j-2
4. explain oxidation/reduction reactions
Energy
Transformation
1. ATP- ADP Cycle
2. Photosynthesis
3. Respiration
Code
prepare simple fermentation
setup using common fruits
to produce wine or vinegar
via microorganisms
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
Page 2 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Content
Content Standard
3. explain the importance of chlorophyll and other
pigments
STEM_BIO11/12
-IIa-j-3
4. describe the patterns of electron flow through light
reaction events
STEM_BIO11/12
-IIa-j-4
5. describe the significant events of the Calvin cycle
STEM_BIO11/12
-IIa-j-5
Performance Standard
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
Learning Competencies
Code
6. differentiate aerobic from anaerobic respiration
STEM_BIO11/12
-IIa-j-6
7. explain the major features and sequence the chemical
events of cellular respiration
STEM_BIO11/12
-IIa-j-7
8. distinguish major features of glycolysis, Krebs cycle,
electron transport system, and chemiosmosis
STEM_BIO11/12
-IIa-j-8
9. describe reactions that produce and consume ATP
STEM_BIO11/12
-IIa-j-9
10. describe the role of oxygen in respiration and describe
pathways of electron flow in the absence of oxygen
STEM_BIO11/12
-IIa-j-10
11. compute the number of ATPs needed or gained in
photosynthesis and respiration
STEM_BIO11/12
-IIa-j-11
12. explain the advantages and disadvantages of fermentation
and aerobic respiration
STEM_BIO11/12
-IIa-j-12
Page 3 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Code Book Legend
Sample: STEM_BIO11/12-IIa-j-12
LEGEND
SAMPLE
Learning Area and Strand/ Subject or
Specialization
Science, Technology, Engineering and
Mathematics
Grade Level
Grade 11 or 12
Domain/Content/
Component/ Topic
General Biology
First Entry
Uppercase Letter/s
STEM_BIO11/12
-
Roman Numeral
Quarter
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
Second Quarter
Page 4 of 4
II
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate
more than a specific week
Week
Weeks one to ten
a-j
-
Arabic Number
Competency
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013
explain the advantages and disadvantages
of fermentation and aerobic respiration
Page 5 of 4
12
General Biology 1
60 MINS
The Cell: Endomembrane System, Mitochondria,
Chloroplasts, Cytoskeleton, and Extracellular Components
Content Standards
The learners demonstrate an understanding of (1) Composition of the endomembrane
system; (2) Structure and function of organelles involved in energy transformation; (3)
Structure and functions of the cytoskeleton; and, (4) Composition and functions of the
extracellular components or matrix.
Performance Standards
The learners shall be able to construct three-dimensional models of whole cells using
indigenous or recyclable materials. The models shall show the following cell parts: (1)
Endomembrane System, (2) Mitochondria, and (3) Chloroplast
•
understand how the extracellular components or matrix
determine the appearance and function of the tissues
LESSON OUTLINE
Introduction
Review on the differences between prokaryotic
and eukaryotic cells; submission and discussion of
responses to the pre-topic homework assigned
before the lecture.
5
Motivation
Brief class activity on prokaryotic and eukaryotic
cells.
5
Lecture. Board work on cell parts, structure, and
function. Examination of cheek cells and Hydrilla
cells under a microscope. Class activity on
identifying the parts and functions of the
endomembrane system.
40
Learning Competencies
The learners: (1) explain the postulates of the cell theory (STEM_BIO11/12-1a- c-1); (2)
Instruction/
describe the structure and function of major and subcellular organelles
Practice
(STEM_BIO11/12-Ia-c-2); (3) describe the structural components of the cell membrane
(STEM_BIO11/12-Ig-h-11); and (4) relate the structure and composition of the cell
membrane to its function (STEM_BIO11/12-Ig-h-12)
Specific Learning Outcomes
At the end of the unit lesson, the learners shall be able to:
•
•
•
•
illustrate the structure of the endomembrane system, label its parts, and
understand how the system works
illustrate the structure of the mitochondria, label its parts, and understand the
importance of the enfolding of the inner mitochondrial membrane
illustrate the structure of the chloroplast, label its parts, and relate these parts to
photosynthesis
understand the connection of the endomembrane system to other cell parts such
as the lysosomes, peroxisomes, endosomes, and cell membrane
Enrichment
Class discussion on cell size and relationship of
surface area and volume
5
Evaluation
Assessment of learners’ knowledge; assignment of
homework for next lecture
5
Materials
microscope (slide, cover slip), hand-held lens,
work books, methylene blue, plastic
spoon/popsicle stick, Hydrilla plansts, colored
chalk/white board marker
Resources (continued at the end of Teaching Guide)
(1) (n.d.). Retrieved from <http://www.phschool.com/science/
biology_place/biocoach/cells/common.html>
(2) (n.d.). Retrieved from <http://biology.tutorvista.com/animal-and-plant(3) (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-thecell-as-a-system/>
5. Explain that in eukaryotic cells, the machinery of the cell is
compartmentalized into organelles. The compartmentalization
of the cell into membrane-bound organelles:
• allows conflicting functions (i.e., synthesis vs. breakdown)
and several cellular activities to occur simultaneously
without interference from each other
• separates the DNA material of the nucleus, mitochondria,
and chloroplast
• increases the surface area-volume ratio of the cell
6. Encourage the learners to look at the cell as both a system and
subsystem. They should develop an understanding of how the
parts of a cell interact with one another and how these parts
1. Ask the learners to make a recap of the differences between prokaryotic and
help to do the ‘work’ of the cell (Source: (n.d.). Retrieved from
eukaryotic cells.
<http://sciencenetlinks.com/lessons/cells-2-the-cell-asa2. Discuss the learners’ responses to the pre-topic assignment on the functions of the
system/>)
following cell parts:
INTRODUCTION (5 MINS)
• Nucleus
• Smooth Endoplasmic Reticulum
• Rough Endoplasmic Reticulum
10
Teacher Tip
• Golgi Apparatus
• Ribosomes
• Lysosomes
• Mitochondria
• Chloroplast
3. Present an overview of the cell membrane, its structure, and functions.
4. Define what an ‘organelle’ is and differentiate membrane-bound organelles from
non-membranebound organelles.
The review on the differences between prokaryotic and eukaryotic cells is needed
to connect prerequisite knowledge to the present lesson. Remind the learners
that the cell parts are found in eukaryotic cells.
Remind the learners of the pre-topic assignment that shall be submitted before
the lecture. This is to ensure the learners read on the topic before the lecture.
Briefly discuss the structure of the cell membrane in order to provide basic
knowledge on said structure to the learners. Do not fully elaborate on this topic
since the structure and function of the cell membrane shall further be discussed in
the succeeding parts of the lesson.
The cell’s parts should be discussed as a system, emphasizing on the
interconnectedness of each part to the others.
To clarify common misconceptions, emphasize the following to the learners:
• Not all organelles are surrounded by a membrane.
• The plasma or cell membrane is different from the cell wall.
• Not all cell parts are present in all kinds of cells.
MOTIVATION (5 MINS)
Briefly review the differences between prokaryotic and eukaryotic cells by asking
questions to the learners.
Sample question: What cell parts can be found in both prokaryotic and
eukaryotic cells? Discuss the function/s of each part.
Sample Responses:
•
DNA
•
Cell membrane
•
Protoplasm (nucleoloid region and cytosol)
•
Ribosomes
of water to the scrapings. Tease the scrapings into a thin layer and
cover with a slip. Examine under HPO. Instruct the learners to draw
the cells on their workbooks and to label the cell parts that they
were able to observe under the microscope.
For the plant cells, instruct the learners to obtain a Hydrilla leaf and
place it on a microscope slide. Examine under LPO. Ask the learners
to draw the cells on their workbooks and to label the cell parts that
they were able to observe under the microscope.
Teacher tip
If the number of available microscopes is limited, ask the learners to group
themselves according to the number of microscopes available or set-up a
demonstration scope for the whole class and facilitate the examination of cells so
that all the learners will get a chance to observe the cells under the microscope.
Orient the learners on the proper use and care of the microscopes, particularly on
focusing first on LPO before shifting to HPO.
Cheek cells are very transparent. Adjust the iris diaphragm or add a small amount
of dye (i.e., methylene blue) to the scrapings.
Compare the cell to a big city. Ask the learners what the requirements of the city
would be in order for it to function. Relate these requirements to the parts of the cell.
Relate the learners’ responses to the functions of the different parts of a cell.
The learners will only see the cell membrane and the nucleus. Remind the learners
to draw what they observe. Students may observe cytoplasmic streaming in the
plant cell.
Sample responses:
•
The city will need power. What generates power for the city? Relate this to
the function of the mitochondria and the chloroplast.
•
The city generates waste. How does it minimize its waste? How does the
city handle its garbage? Relate this to the function of the lysosome.
•
The city requires raw materials to process into food, clothing, and housing
materials. Where are these raw materials processed? Relate this to the
functions of the Golgi Apparatus.
INSTRUCTION/PRACTICE (30 MINS)
1. Draw the cell membrane on one end of the board.
2. Draw the double membrane of the nucleus (nuclear
membrane) on the other end of the board.
3. From the nuclear membrane, draw the reticulated structure of
the endoplasmic reticulum. Ask the learners what the two
types of endoplasmic reticulum are and their corresponding
functions.
Compare animal cells from plant cells. For the animal cells, scrape cheek cells using a
toothpick. Ask the learners to place the scrapings on a microscope slide and add a drop 4. Draw the ribosomes as separate units.
5. Draw a DNA and an mRNA. Explain that the mRNA is a copy of the DNA that will be
sent to the cytoplasm for protein synthesis.
6. Explain to the learners that the mRNA leaves the nucleus and goes to where the
ribosomes are located (i.e., mRNA + functional ribosome)
7. Explain the possible ‘pathways’ for protein synthesis (e.g., within the cytosol or the
endoplasmic reticulum)
8. Draw the mRNA + functional ribosome on the endoplasmic reticulum. With a lot of
these, the endoplasmic reticulum becomes a rough endoplasmic reticulum.
9. Draw the formed polypeptide inside the rough endoplasmic reticulum. Discuss the
formation of a cisternae and pinching off as a vesicle.
10. Draw the Golgi Apparatus and then a vesicle from the rough endoplasmic
reticulum that travels to the Golgi Apparatus and attaches to the part which is
nearest the rough endoplasmic reticulum.
11. Ask the learners what the function of the Golgi Apparatus is. Synthesize their
answers and compare the Golgi Apparatus to a factory with an assembly
manufacturing line.
12. Draw the polypeptide travelling along the Golgi Apparatus stack; pinching off as a
vesicle to travel to the next stack. Repeat the process while increasing the
complexity of the polypeptide drawing.
13. On the last stack, explain the ‘pathways’ that the vesicle may follow: become a
lysosome through fusion with an endosome (i.e., formed by endocytosis), or travel
to the cell membrane, fuse with it, and empty its contents.
14. Present the composition of the endomembrane system and discuss how these
parts are connected to each other by structure and by function.
15. Draw the mitochondria and label its parts. Explain the importance of the enfolding
(cristae) in increasing the surface area of the inner mitochondrial membrane.
Further explain to the class that Teacher tip
Use chalk or white board markers with different colors. Explain the structure and function of each cell part
as you draw them.
Explain to the learners that a more detailed discussion of the structure and
functions of the cell membrane, mitochondria, and chloroplast will be given in
succeeding lessons.
enfolding is a common structural strategy to increase surface area. As an example,
you may draw a cross-sectional structure of the small intestine.
16. Draw the chloroplast and label its parts. Explain the function that each part
performs in the process of photosynthesis.
17. Discuss the similarities of the mitochondria and chloroplast (e.g., both are involved
in energy transformation, both have DNA, high surface area, and double
membranes).income accounts and lastly, expenses accounts.
Group the learners into pairs. Ask one to draw the endomembrane system as
he/she explains it to his/her partner. Reshuffle the groupings and repeat until all
learners have performed the exercise.
ENRICHMENT (30 MINS)
Facilitate a class discussion on why cells are generally small in size. Explain the
relationship between surface area and volume.
EVALUATION (60 MINS
Ask questions to the learners. Sample questions can be found in the following
electronic resources:
•
(n.d.). Retrieved from< http://www.proprofs.com/quiz-school/story.php?title=cellstructure-test >
• (n.d.). Retrieved from< http://study.com/academy/exam/topic/cell-biology.html>
Assign a research assignment on this question: How do environmental toxins like lead
and mercury affect the functions of the cell? The assignment shall be submitted one
week after this lesson.
RESOURCES (CONTINUED):
(4) (n.d.). Retrieved from
<http://www.schools.manatee.k12.fl.us/072JOCONNOR/celllessonplans/
lesson_plan__cell_structure_and_function.html>
(5) (n.d.). Retrieved from
<http://www.phschool.com/science/biology_place/biocoach/cells/end
o.html>
(6) (n.d.). Retrieved from <http://study.com/academy/lesson/theendomembrane-system-functionscomponents.html>
(7) (n.d.). Retrieved from
<http://www.ncbi.nlm.nih.gov/books/NBK26907/>
(8) (n.d.). Retrieved from
<http://staff.um.edu.mt/acus1/01Compart.pdf>
Teacher tip
Assignments should be handwritten.
This strategy is aimed at ensuring that the learners have read the topic rather than
just copying and printing from a source.
ASSESSMENT
Learning Competency
Assessment Tool
Exemplary
Satisfactory
The learners shall be able to:
Learner
participation (during
lecture)
Learner was able to answer
all the question/s without
referring to his/ her notes
Learner was able to answer the
main question without
referring to his/her notes but
was not able to answer followup question/s
1. describe the structure and
function of major and
subcellular organelles
(STEM_BIO11/12-Ia-c-2)
Assignment
The learners shall be able to:
2. describe the structural
components of the cell
membrane
(STEM_BIO11/12-Ig-h-11)
The learners shall be able to:
3. relate the structure and
composition of the cell
Learner
participation (during
practice)
Learner submitted an
assignment beyond the
requirements
Developing
Learner was able to
answer the questions
but he/she referred to
his/her notes
Learner submitted a
Learner submitted a
comprehensive and wellwritten well written report but
assignment
some responses
lack details
Beginnning
(1)
Learner was not
able to answer the
question/s
(2)
Learner read
notes of his/her
classmate
(1)
Learner did not
submit an assignment
(2)
Learner
submitted
a partially-finished
assignment
(1)
Learner was not
able to answer the
question/s
Learner was able to concisely Learner was able to answer the
answer all the questions
main question without
referring to his/her notes but
was not able to answer followup question/s
Learner was able to
answer the questions
but he/she referred to
his/her notes
Laboratory
(Examination of
Animal and Plant
Cells)
Learner submitted drawings
that were beyond the
requirements
Learner submitted drawings
that fulfilled the requirements
(complete and detailed)
Learner submitted
drawings that were
incomplete
(1)
Learner was not
able to submit drawings
Examination
Learner obtained 90% to
100% correct answers in the
examination
Learner obtained 70% to
89.99% correct answers in the
examination
Learner obtained 50%
to 69.99% correct
answers in the
examination
Learner obtained less
that 50% correct answers
in the examination
14
(2)
Learner read
notes of his/her
classmate
(2)
Learner’s
drawings
were haphazardly
done
60 MINS
membrane to its function
(STEM_BIO11/12-Ig-h12)
Research Assignment
Learner submitted a research Learner submitted a
Learner submitted a
assignment beyond the
comprehensive and wellwritten well written report but
requirements
research assignment
some responses
lack details
Mitochondria and
Chloroplasts
General Biology 1
Content Standards
The learners demonstrate an understanding of the structure and function of the
mitochondria and chloroplasts, the organelles involved in energy transformation.
Performance Standards
The learners shall be able to construct three-dimensional models of whole cells using
indigenous or recyclable materials. These models should show the mitochondria and
chloroplasts.
Learning Competencies
The learners describe the structure and function of major and subcellular organelles
(STEM_BIO11/12-Ia-c-2) and distinguish prokaryotic and eukaryotic cells according to
their distinguishing features (STEM_BIO11/12 -Ia-c-3)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
illustrate the structure of the mitochondria, label its parts, and understand the
importance of the enfolding of the inner mitochondrial membrane
illustrate the structure of the chloroplast, label its parts, and relate these parts to
photosynthesis
(1)
Learner did not
submit an assignment
(2)
Learner
submitted
a partially-finished
assignment
LESSON OUTLINE
Review of relevant terminologies and definitions
5
Motivation
Understanding of key concepts using real-life
situations
(5) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
Resources
5 (continued at the (6) http://biology.tutorvista.com/animal-and-plant-cells/chloroplasts.html
(7) ttp://www.nature.com/scitable/topicpage/mitochondria-14053590
end of Teaching
Instruction/
Delivery
Discussion and lecture proper
30 Guide)
Practice
Drawing (with label) activity
10
Enrichment
Computation of surface area vs volume
5
Evaluation
Answering practice questions and homework
5
Introduction
(1) http://scienceaid.co.uk/biology/biochemistry/atp.html
(2) http://www.britannica.com/list/6-cell-organelles)
(3) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
(4) http://www.britannica.com/list/6-cell-organelles
INTRODUCTION (5 MINS)
Facilitate a review of the following concepts:
•
•
•
•
•
Differences between prokaryotic and eukaryotic cells
Definition of an ‘organelle’
Differences between membrane-bound organelles and non-membrane-bound organelles
Functions of the different parts of a cell
The endomembrane system
MEMBRANE-BOUND ORGANELLES
NON-MEMBRANE-BOUND ORGANELLES
Nucleus
Ribosomes
Smooth ER
Centrioles
Rough ER
Cytoskeleton
Golgi Apparatus
16
Vacuoles and Vesicles
Mitochondria
Chloroplast and other plastids
Lysosomes
Peroxisomes
Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The compartmentalization of the cell into membranebound organelles:
•
allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur simultaneously without interference from each
other
• separates the DNA material of the nucleus, mitochondria, and chloroplast
• increases the surface area-volume ratio of the cell
Encourage the learners to look at the cell as both a system and subsystem. They should develop an understanding A possible response is that
of how the parts of a cell interact with one another and how these parts help to do the ‘work’ of the cell (Source:
partitioning of the house into
(n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-asa-system/>)
different parts facilitates the
simultaneous occurrence of several
Emphasize to the learners that energy transformation is one of the characteristics of life. This refers to the ability
activities without interfering with one
to obtain and use energy. This characterizes the main function of the mitochondria and the chloroplasts.
another. Also, materials needed for
each activity can be stored at their
specific areas. For example, pots and
MOTIVATION (5 MINS)
pans are being stored in the kitchen
Ask the learners how they understand the concept of compartmentalization. Relate the concept to how the cell is and not in the bedroom. Beds and
compartmentalized into organelles.
pillows are found in the bedroom and
not in the toilet/bath.
Compare compartmentalization to the division of a house into a receiving room or sala, kitchen, dining room,
comfort rooms, bedrooms, etc.
Ask the learners why they think a house is divided into several rooms.
Explain to the learners that the
mitochondria and chloroplasts have a
small amount of DNA. Although most
of the proteins of these organelles are imported from the cytosol and are thus programmed by the nuclear DNA,
their DNA programs the synthesis of the proteins made on the organelles’ ribosomes (Source: Campbell et al).
Compartmentalization separates the DNA material of the nucleus, mitochondria, and chloroplast.
Ask the learners if they have experienced going to a city/municipal hall and if they have observed that the Mayor,
Vice-Mayor, and the City/Municipal Administrator have separate offices. You can use other examples such as the
University President, VP for Academic Affairs, VP for Finance; Philippine President, Vice President, Senators, etc.
Compare the nuclear DNA to the Mayor and the mitochondrial DNA and chloroplast DNA to the Vice Teacher tip
Explain to the learner that this is how the cell is able to allow conflicting functions (e.g., synthesis vs breakdown) and several cellular
activities to occur simultaneously without interference from each other.
ATP + H2O → ADP + Pi where ADP is
adenosine diphosphate and Pi is
inorganic phosphate Group the
learners into pairs. Ask one to draw
the endomembrane system as
he/she explains it to his/ her
partner. Reshuffle the groupings
and repeat until all learners have
performed the exercise.
Mayor. The Mayor runs the city/municipality but the Vice Mayor also performs functions that are specific to their
positions. They need different offices (or compartments) to avoid conflict in their functions.
Introduce the concept of surface area-volume ratio/relationship to the learners. Show a fruit to the learners and
explain that the outer surface of the fruit is the surface area. Peel the fruit and show them what’s inside,
explaining that the inside of the fruit is the volume.
Explain to the learners that surface area (SA) and volume (V) do not increase in the same manner. As an object
increases in size, its volume increases as the cube of its linear dimensions while surface area increases as the
square of its linear dimensions.
Teacher tip
Select a fruit that can be easily peeled like
calamansi or dalandan
Example: If the initial starting point is the same: SA = 2; Volume = 2 (Ratio = 1:1) A onestep increase will result to: SA = 22 = 4 while V = 23 = 8 (Ratio = 1:2)
INSTRUCTION/DELIVERY (30 MINS)
Explain and discuss the nature and functions of the Adenosine Triphosphate (ATP) to the learners.
Adenosine Triphosphate (ATP)—It is the major energy currency of the cell that provides the energy for most of
the energy-consuming activities of the cell. The ATP regulates many biochemical pathways.
Mechanism: When the third phosphate group of ATP is removed by hydrolysis, a substantial amount of free
energy is released.
18
Teacher tip Ask questions to the learners
while giving the lecture.
If an LCD projector is not available, draw the structure of the mitochondria and chloroplast on the board.
Illustration 1: Energy release in Hydrolysis (Source: (n.d.). Retrieved from http://scienceaid.co.uk/biology/biochemistry/atp.html)
Illustration 2: Chemical Energy and ATP (Source: (n.d.). Retrieved from http://winklebiology.weebly.com/chemical-energyatp.html)
Synthesis of ATP
• ADP + Pi → ATP + H2O
• requires energy: 7.3 kcal/mole
• occurs in the cytosol by glycolysis
• occurs in mitochondria by cellular respiration
• occurs in chloroplasts by photosynthesis
Consumption of ATP
ATP powers most energy-consuming activities of cells, such as:
•
•
anabolic (synthesis) reactions, such as:
joining transfer RNAs to amino acids for assembly into proteins
20
•
•
•
•
•
•
•
•
•
•
synthesis of nucleoside triphosphates for assembly into DNA and RNA
synthesis of polysaccharides
synthesis of fats
active transport of molecules and ions
conduction of nerve impulses
maintenance of cell volume by osmosis
addition of phosphate groups (phosphorylation) to different proteins (e.g., to alter their activity in cell signaling)
muscle contraction
beating of cilia and flagella (including sperm)
bioluminescence
Extracellular ATP
In mammals, ATP also functions outside of cells. ATP is released in the following examples:
•
•
•
•
from damaged cells to elicit inflammation and pain
from the carotid body to signal a shortage of oxygen in the blood
from taste receptor cells to trigger action potentials in the sensory nerves leading back to the brain
from the stretched wall of the urinary bladder to signal when the bladder needs emptying
In eukaryotic cells, the mitochondria and chloroplasts are the organelles that convert energy to other forms which
cells can use for their functions.
Discuss the function and structure of the mitochondria.
Mitochondria (singular, mitochondrion)—Mitochondria are the sites of cellular respiration, the metabolic process
that uses oxygen to drive the generation of ATP by extracting energy from sugars, fats, and other fuels.
The mitochondria are oval-shaped organelles found in most eukaryotic cells. They are considered to be the
‘powerhouses’ of the cell. As the site of cellular respiration, mitochondria serve to transform molecules such as
glucose into an energy molecule known as adenosine triphosphate (ATP). ATP fuels cellular processes by breaking
its high-energy chemical bonds. Mitochondria are most plentiful in cells that require significant amounts of energy
to function, such as liver and muscle cells.
Figure 1: Structure of the Mitochonsdria (Source: (n.d.). Retrieved from http://www.britannica.com/list/ 6-cell-organelles)
The mitochondria has two membranes that are similar in composition to the cell membrane:
•
•
•
•
Outer membrane—is a selectively permeable membrane that surrounds the mitochondria. It is the site of attachment for the
respiratory assembly of the electron transport chain and ATP Synthase. It has integral proteins and pores for transporting molecules
just like the cell membrane
Inner membrane—folds inward (called cristae) to increase surfaces for cellular metabolism. It contains ribosomes and the DNA of the
mitochondria. The inner membrane creates two enclosed spaces within the mitochondria:
intermembrane space between the outer membrane and the inner membrane; and
matrix that is enclosed within the inner membrane.
Ask questions to the learners on the structure of the mitochondria. A sample question could be: What is the
importance of the enfolding of the mitochondria? The response would be to increase the surface area that can be
‘packed’ into such a small space.
Discuss the purpose of the mitochondrial membranes.
22
As mentioned, the mitochondria has two membranes: the outer and inner mitochondrial membranes.
•
•
•
•
•
•
•
Outer Membrane
fully surrounds the inner membrane, with a small intermembrane space in between
has many protein-based pores that are big enough to allow the passage of ions and molecules as large as a
small protein
Inner membrane
has restricted permeability like the plasma membrane
is loaded with proteins involved in electron transport and ATP synthesis
surrounds the mitochondrial matrix, where the citric acid cycle produces the electrons that travel from one
protein complex to the next in the inner membrane. At the end of this electron transport chain, the final
22
electron acceptor is oxygen,
and this ultimately forms
water (H20). At the same
time, the electron transport
chain produces ATP in a
process called oxidative
phosphorylation
During electron transport, the
participating protein complexes push
protons from the matrix out to the
intermembrane space. This creates a concentration gradient of protons that another protein complex, called ATP
synthase, uses to power synthesis of the energy carrier molecule ATP.
Figure 4: The Electrochemical Proton Gradient and the ATP Synthase (Source: (n.d.). Retrieved from
http://www.nature.com/scitable/topicpage/mitochondria-14053590)
Explain and discuss the structure and functions of the Chloroplasts.
Chloroplasts—Chloroplasts, which are found in plants and algae, are the sites of photosynthesis. This process
converts solar energy to chemical energy by absorbing sunlight and using it to drive the synthesis of organic
compounds such as sugars from carbon dioxide and water.
The word chloroplast is derived from the Greek word chloros which means ‘green’ and plastes which means ‘the
one who forms’. The chloroplasts are cellular organelles of green plants and some eukaryotic organisms. These
organelles conduct photosynthesis. They absorb sunlight and convert it into sugar molecules. They also produce
free energy stored in the form of ATP and NADPH through photosynthesis.
Chloroplasts are double membrane-bound organelles and are the sites of photosynthesis. The
Teacher tip
Lecture on mitochondrial membranes can be accessed at (n.d.). Retrieved from <http://www.nature.com/scitable/ topicpage/mitochondria14053590>.
chloroplast has a system of three membranes: the outer membrane, the inner membrane, and the thylakoid
system. The outer and the inner membranes of the chloroplast enclose a semi-gel-like fluid known as the stroma.
The stroma makes up much of the volume of the chloroplast. The thylakoid system floats in the stroma.
Structure of the Chloroplast
•
•
•
•
Outer membrane—This is a semi-porous membrane and is permeable to small molecules and ions which diffuse
easily. The outer membrane is not permeable to larger proteins.
Intermembrane Space—This is usually a thin intermembrane space about 10-20 nanometers and is present
between the outer and the inner membrane of the chloroplast.
Inner membrane—The inner membrane of the chloroplast forms a border to the stroma. It regulates passage of
materials in and out of the chloroplast. In addition to the regulation activity, fatty acids, lipids and carotenoids
are synthesized in the inner chloroplast membrane.
Stroma—This is an alkaline, aqueous fluid that is protein-rich and is present within the inner membrane of the
chloroplast. It is the space outside the thylakoid space. The chloroplast DNA, chloroplast ribosomes, thylakoid
system, starch granules, and other proteins are found floating around the stroma. • Thylakoid System
The thylakoid system is suspended in the stroma. It is a collection of membranous sacks called thylakoids.
Thylakoids are small sacks that are interconnected. The membranes of these thylakoids are the sites for the light
reactions of the photosynthesis to take place. The chlorophyll is found in the thylakoids. The thylakoids are arranged
in stacks known as grana. Each granum contains around 10-20 thylakoids.
The word thylakoid is derived from the Greek word thylakos which means 'sack'.
Important protein complexes which carry out the light reaction of photosynthesis are embedded in the membranes
of the thylakoids.
The Photosystem I and the Photosystem II are
Teacher tip
If an LCD projector is not available, draw the structure of the chloroplast on the board.
24
Lecture on structure and functions of the
chloroplast can be accessed at (n.d.).
Retrieved from <http://
biology.tutorvista.com/animal-andplantcells/chloroplasts.html>.
complexes that harvest light with chlorophyll and carotenoids. They absorb the light energy and use it to energize
the electrons.
The molecules present in the thylakoid membrane use the electrons that are energized to pump hydrogen ions into
the thylakoid space. This decreases the pH and causes it to become acidic in nature. A
large protein complex known as the ATP synthase controls the concentration gradient of the hydrogen ions in the
thylakoid space to generate ATP energy. The hydrogen ions flow back into the stroma.
Thylakoids are of two types: granal thylakoids and stromal thylakoids. Granal thylakoids are arranged in the grana.
These circular discs that are about 300-600 nanometers in diameter. The stromal thylakoids are in contact with the
stroma and are in the form of helicoid sheets.
The granal thylakoids contain only Photosystem II protein complex. This allows them to stack tightly and form many
granal layers with granal membrane. This structure increases stability and surface area for the capture of light.
The Photosystem I and ATP synthase protein complexes are present in the stroma. These protein complexes act as
spacers between the sheets of stromal thylakoids.
PRACTICE (10 MINS)
Group the learners into pairs. Ask one
to draw the mitochondria and label its
parts while the other does the same
for chloroplast. Once done, the
partners exchange tasks (i.e., the
learner that drew the mitochondria
now does the same for the
chloroplast).
Reproduce these diagrams without the
labels and use these for the class
activity.
To demonstrate how folding increases
surface area, ask the learners to trace
the edges of the outer membrane with
a thread and measure the length of
the thread afterwards. Repeat the
same for the inner membrane.
Compare the results and discuss how
the enfolding of the inner membrane
increases surface area through folding.
ENRICHMENT (30 MINS)
1. Using the figure below, ask learners to compute surface area vs. volume.
2. Draw the table on the board and instruct the learners to write their measurements.
26
EVALUATION (60 MINS)
Ask the learners to answer practice questions on the following electronic resources:
•
http://www.mcqbiology.com/
2013/03/multiple-choice-
•
•
•
•
questions-on_25.html#.Vl7Uq3YrLrc
http://www.uic.edu/classes/bios/bios100/summer2004/samples02.htm
http://www.tutorvista.com/content/science/science-i/fundamental-unit-life/question-answers-1.php
http://www.buzzfeed.com/kellyoakes/the-mitochondria-is-the-powerhouse-of-the-cell#.fajAl0b6o
http://global.oup.com/uk/orc/biosciences/cellbiology/wang/student/mcqs/ch10/ Possible responses to the
Teacher tip
Clarify to the learners the misconception
that the appearance of organelles are
static and rigid.
homework (Source: Campbell et al, 10th Ed.):
•
•
•
They have double membranes and are not part of the endomembrane system.
Their shape is changeable.
They are autonomous (somewhat independent) organelles that grow and occasionally pinch in two, thereby
reproducing themselves.
• They are mobile and move around the cell along tracks of the cytoskeleton, a structural network of the cell.
• They contain ribosomes, as well as multiple circular DNA molecules associated with their inner membranes. The
DNA in these organelles programs the synthesis of some organelle proteins on ribosomes that have been
synthesized and assembled there as well.
2. Give out the homework for next meeting.
Teacher tip Check the electronic
resources on Endosymbiotic Theory:
https://www.youtube.com/watch?
v=bBjD4A7R2xU (Endosymbiotic Theory in
plain English)
https://www.youtube.com/watch?v=FQmAnmLZtE
What are the characteristics shared by these two energy transforming organelles?
Instruct the learners to write an essay on probable reasons for these the shared characteristics of the mitochondria
and the chloroplast. Learners shall submit a handwritten essay on the Endosymbiotic Theory and how it explains the
similarity between the mitochondria and chloroplast.
EVALUATION
Learning Competency
Assessment Tool
Exemplary
Satisfactory
28
Developing
Beginnning
The learners shall be able Learner
to describe the following: participation
Learner was able to
answer all the question/ s
without referring to
his/her notes
Learner was able to answer
the main question without
referring to his/ her notes
but was not able to answer
follow-up question/s
Learner was able to
answer the questions
but he/ she referred
to his/ her notes
(1)
Learner was
not able to answer the
question/s
Learner submitted an
assignment beyond the
requirements
Learner submitted a
comprehensive and
wellwritten assignment
Learner submitted a
well written report
but some responses
lack details
(1)
Learner did not
submit an assignment
Examination
Learner obtained 90% to
100% correct answers in
the examination
Learner obtained 70% to
89.99% correct answers in
the examination
Learner obtained 50%
to 69.99% correct
answers in the
examination
Learner obtained less
that 50% correct
answers in the
examination
Essay Assignment
Learner submitted an
essay beyond the
requirements
Learner submitted an essay Learner submitted a
that was comprehensive and well-written essay
wellwritten
some details are
lacking
(during lecture)
1. structure and function
of major and subcellular
organelles
(STEM_BIO11/12-Iac-2)
General Biology 1
Assignment
(2)
Learner read
notes of his/her
classmate
(2)
Learner
submitted a partiallyfinished assignment
(1)
Learner did not
submit an essay
(2)
Learner
submitted a
partially-finished essay
Structure and Functions of Animal Tissues
180 MINS
and Cell Modification
Content Standard
The learners demonstrate an understanding of animal tissues and cell modification.
Performance Standard
The learners shall be able to construct a three-dimensional model of the animal tissue
by using recyclable or indigenous materials.
Learning Competencies The
learners:
•
•
•
classify different cell types (plant/animal tissue) and specify the functions of each
(STEM_BIO11/12-Ia-c-4)
describe some cell modifications that lead to adaptation to carry out specialized
functions (e.g., microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
Motivation
Class Activity: Pinoy Henyo Classroom Edition
Practice
Class Activity: Reporting on structure and function
of animal tissue or showing of infomercial on
diseases.
60
Evaluation
Class Quiz
10
computer (if available), manila paper, cartolina, photos, images, or
illustrations of different types of tissues, drawing materials (e.g.
pens, pencils, paper, color pencils, etc.)
(1)
5
10
Reece JB, U. L., (2010). Campbell Biology 10th. San Francisco (CA).
INTRODUCTION (5 MINS)
Introduce the following learning objectives by flashing these on the
board:
•
•
LESSON OUTLINE
Communicating learning objectives to the learners.
95
Resources (continued at the end of Teaching Guide)
present a five-minute report on how the structures of different animal tissues
define their function or show a two-minute infomercial about a disease that is
caused by animal tissue malfunction;
provide insights, offer constructive feedback, and note areas of improvement on
their classmates’ reports or infomercial
Introduction
Review on the Hierarchy of Biological
Organisation and PTSF; Lesson on Animal Tissues
and on Cell Modfication
Materials microscopes, LCD Projector (if available), laptop or
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
Instruction/
Delivery
classify different cell types (plant/animal tissue) and specify the
functions of each (STEM_BIO11/12Ia-c-4)
describe some cell modifications that lead to adaptation to
carry out specialized functions (e.g., microvilli, root hair)
(STEM_BIO11/12-Ia-c-5)
Ask the learners to work in pairs and write the learning objectives
using their own words.
30
MOTIVATION (10 MINS)
PINOY HENYO CLASSROOM EDITION
Divide the class into two groups.
Make sure to mention the chosen mystery words in the discussion. This shall help
the learners to understand the connection of the game with the lesson.
Check how the class behaves during the activity. If the learners get rowdy, you
may choose to stop the game. Make sure to warn the learners of the
consequences first before the start of the activity.
Explain to the learners that instead of having the typical one-on-one Pinoy Henyo, only INSTRUCTION/DELIVERY (95 MINS)
one representative from each group shall be asked to go to the front and have the
Facilitate a five-minute review on the Hierarchy of Biological
mystery word card on his/her forehead. Only three words shall be allowed from the
Organization and on the concept of “form fits function”, the
groups: “Oo”, “Hindi”, or “Pwede”. Violation of the rules of the game (e.g.,
unifying theme in Biology.
communicating the mystery word to the guesser) shall merit corresponding penalties
or disqualification. Assign three representatives per group to guess the mystery words.
Each guesser shall be given one minute and 30 seconds.
Review on Hierarchy of Biological Organization
At the end of the activity, ask one or two learners what they think the learning
objectives of the lesson will be. Immediately proceed with the Introduction.
Teacher tip
For this particular lesson, start with the
Motivation first (i.e., class activity on Pinoy Henyo Classroom Edition). After the game, proceed to the
Introduction by communicating the learning objectives to the learners.
For the part when the learners have to state the learning objectives using their own words, ask the
learners to face their seatmates and work in pairs. If the learners are more comfortable in stating the
learning objectives in Tagalog or In their local dialect, ask them to do so.
1. Discuss that new properties arise with each step upward the
hierarchy of life. These are called emergent properties.
2. Ask the class what the levels of biological organization are. The
learners should be able to answer this since this is just a
review. In case the class does not respond to the question, you
may facilitate the discussion by mentioning the first level of the
hierarchy.
3. Start with the cell since it is the most basic unit of life that
shows all life properties.
cells
tissue organ
organ system
multicellular organism
Teacher tip
Prior to this lesson, assign a reading material or chapter for this topic. This shall aid in the facilitation of the
class activity.
Illustrate this by showing photos of the actual hierarchy using
animals that are endemic in the Philippines (e.g., pilandok, dugong,
In choosing the mystery words for the game, do not limit yourself with the four types of animal tissues. You and cloud rat).
may choose terms that describe the tissue type or even body parts wherein the tissues are located. You
may also include diseases that are caused by certain malfunctions on the tissues.
Review on the unifying theme in Biology: “form fits function”
1. Ask the class what the relation of form (structure) to function and vice versa is
If microscopes are available for this activity, set up the equipment
2. Ask for examples of versaingit of life that shows all life properthe torpedo shape of and the slides that were prepared prior to the activity. Each slide
the body of dolphins (mammals with fishlike characteristics) and the bone structure should show one type of tissue (i.e., epithelial tissue, connective
tissue, muscle tissue, and nervous tissue). Make sure that the
and wing shape of birds in relation to flying.
labels are covered because the learners will be asked to name the
tissues based on their observations during the discussion.
Teacher tip
Do not use too much time for the review. Just make sure to guide or lead the learners in remembering past
lessons. Provide clues if necessary.
If there are no microscopes available for the activity, prepare cutout images, photos, or illustrations that show the different types of
tissues (i.e., epithelial tissue, connective tissue, muscle tissue, and
nervous tissue). Make sure that the images, photos, or illustrations
are not labeled because the learners will be asked to name them.
Also, do not immediately identify the type of tissue based on the
descriptions that you will be presenting to the class. The learners
will be asked to identify which among the slides under the
microscope or which image, photo, or illustration matches the
description of the structure and function that will be given during
the discussion.
Teacher tip
For the review on “form fits function”, if the class does not respond well, start giving your own examples
for the students to figure out this unifying theme.
Make sure to relate structure to function. Mention the role of fossils in determining the habits of extinct
animals. By doing this, it shall establish a strong connection between form and function and shall give
relevance on the study of this connection in Biology. After this, you may now proceed to the new topic on
animal tissues.
Facilitate a class activity (i.e., observation of cells under a microscope) to illustrate that
animals are made up of cells. This shall be the foundation of the definition of and
discussion on animal tissues. The whole activity and discussion shall last for 90
minutes.
32
After the class activity, proceed with the actual lecture. If a
computer, laptop, or projector is available, show a PowerPoint
presentation that shows the description and function of tissues. If
there is no available equipment, you may use flash cards or manila
paper where description of structure and function of the different
tissue types are written down. Ask the learners which among the
microscope slides, image, photo, or illustration fits the given
information on description and function. After the learners’
responses, you can flash or show the next slide which shall reveal
the image of the specimen with the corresponding label or type of
tissue.
Epithelial Tissue—This type of tissue is commonly seen outside the body as coverings
•
or as linings of organs and cavities. Epithelial tissues are characterized by closely-joined
cells with tight junctions (i.e., a type of cell modification). Being tightly packed, tight
junctions serve as barriers for pathogens, mechanical injuries, and fluid loss.
pseudo-stratified columnar—single layer of cells; may just look
stacked because of varying height; for lining of respiratory tract;
usually lined with cilia (i.e., a type of cell modification that
sweeps the mucus).
Teacher tip
If microscopes are available for this activity, allot 20-30 minutes for the observation of cells. If microscopes
are not available, allot only 10-15 minutes.
Prior to the activity, prepare the slides that will be put under the microscopes. The slides shall contain the
different types of tissue. Make sure to focus the slides so that the learners can observe them clearly.
Give the learners enough time to observe the specimens and then ask them to draw on their notebooks
what they were able to observe under the microscopes. Encourage the learners to write down the
description and function of the specific tissue type as you go through the discussion.
If microscopes are not available and you have shown photos, images, or illustrations instead, ask the
learners to draw them on their notebooks and encourage them to write down the description and function
of the specific tissue type as you go through the discussion.
Teacher tip
Prepare the lecture in such a way that you do not immediately reveal the label of the images or the terms
that are being described. The learners should first be asked to identify the images or slides that fit the
description of the structures and functions. This will make the students more engaged in the discussion.
Always remind the learners to take down notes while you flash information for each tissue type.
Cells that make up epithelial tissues can have distinct arrangements:
•
•
•
•
cuboidal—for secretion
simple columnar—brick-shaped cells; for secretion and active absorption
simple squamous—plate-like cells; for exchange of material through diffusion
stratified squamous—multilayered and regenerates quickly; for protection
Figure 1: Epithelial Tissue (Source: Reece JB, U. L. (2010). Campbell
Biology 10th. San Francisco (CA):.) Teacher tip
Take note that the part on cell modifications is incorporated in the discussion on
the structure of the respective cells that make up the tissue that is being
discussed. Give emphasis on the differences on the features of the cells that make
up the tissue type.
For examples or illustrations of the different types of tissues, it is better to use an animal that is endemic in
the Philippines or in your specific region so that the learners can relate more in the discussion.
Connective Tissue—These tissues are composed of the following:
BLOOD —made up of plasma (i.e., liquid extracellular matrix); contains
water, salts, and dissolved proteins; erythrocytes that carry oxygen
(RBC), leukocytes for defense (WBC), and platelets for blood clotting.
CONNECTIVE TISSUE PROPER (CTP)—made up of loose
connective tissue that is found in the skin and fibrous connective tissue
that is made up of collagenous fibers found in tendons and ligaments.
Adipose tissues are also examples of loose connective tissues that
store fats which functions to insulate the body and store energy.
CARTILAGE —characterized by collagenous fibers embedded in
chondroitin sulfate. Chondrocytes are the cells that secrete collagen
and chondroitin sulfate. Cartilage functions as cushion between bones.
BONE —mineralized connective tissue made by bone-forming cells
called osteoblasts which deposit collagen. The matrix of collagen is
combined with calcium, magnesium, and phosphate ions to make the
bone hard. Blood vessesl and nerves are found at a central canal
surrounded by concentric circles of osteons.
Figure 2: Connective Tissue (Source: Reece JB, U. L. (2010).
Campbell Biology 10th. San Francisco (CA):.)
14
Muscle Tissue—These tissues are composed of long cells called muscle fibers
that allow the body to move voluntary or involuntary. Movement of muscles is
a response to signals coming from nerve cells. In vertebrates, these muscles
can be categorized into the following:
•
skeletal—striated; voluntary movements
•
cardiac—striated with intercalated disk for synchronized heart
contraction; involuntary • smooth—not striated; involuntary
Figure 3: Muscle Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th.
San Francisco (CA):.)
Nervous Tissue—These tissues are composed of nerve cells called neurons and
glial cells that function as support cells. These neurons sense stimuli and
transmit electrical signals throughout the animal body. Neurons connect to
other neurons to send signals. The dendrite is the part of the neuron that
receives impulses from other neurons while the axon is the part where the
impulse is transmitted to other neurons.
Figure 4: Neurons and Glial Cells (Source: Reece JB, U. L. (2010). Campbell
Biology 10th. San Francisco (CA):.)
Ask the learners to briefly and clearly
answer the following questions:
PRACTICE (60 MINS)
Divide the class into six groups. Four groups will be reporting on Animal Tissues while two groups will be creating
an infomercial on diseases caused by the malfunction of tissue types. Each infomercial group shall cover two
tissue types.
•
•
Each group will be given five minutes to report or show their infomercial. At the end of each presentation,
facilitate a five-minute critiquing of the presentation. Make sure to get feedbacks from the learners and clarify
misconceptions from the reports. The report or the infomercial on diseases shall not be graded. These will be a
kind of formative assessment.Group the learners into pairs. Ask one to draw the mitochondria and label its parts
while the other does the same for chloroplast. Once done, the partners exchange tasks (i.e., the learner that
drew the mitochondria now does the same for the chloroplast).
•
•
EVALUATION (10 MINS)
Ask the learners to group themselves in pairs or in groups of threes. This will allow the learners to discuss and
decide among themselves. However, if a learner chooses to do this activity on his or her own, he or she should
be allowed to do so.
16
•
What is the importance of having a
tissue level in the hierarchy of
biological organization? (2 points)
What do the varying shapes and
arrangement of epithelial tissue
suggests? (2 points)
What is the general function of
connective tissues? What function
is common to all types of
connective tissues? (1 point)
Why are there voluntary and
involuntary muscle tissue
functions? (2 points)
What is the importance of glial cells
in nervous tissues? (1 point)
• Identify two cell modifications and describe their respective functions. (2 points)
Teacher tip
Group the learners before starting the lesson. The reporting may be done the day after finishing the discussion on Animal Tissue Structure,
Function, and Cell Modification.
The reports may be presented using a table which contains columns for tissue type, cell structures that characterize the tissue, part of the
body where the tissue is located, function, and importance.
•
•
•
•
•
Teacher tip
Assess if the learners are ready to answer this individually. If they are not yet ready, this activity can be done in pairs or in groups of
threes. Make sure that you provide enough time for the group to discuss their responses. Remind the learners to answer briefly and
clearly.
If you are not comfortable with this time of exam, a multiple-choice type of evaluation may also be prepared.
After getting the responses, you may get feedback from the learners to see if all members of each group helped or participated in their
small discussions to answer the short quiz. You may ask learners to rate the members of their group.
General Biology 1
Cell Cycle and Cell Division
Content Standard
The learners demonstrate an understanding of the cell cycle and cell division (i.e., mitosis and meiosis).
Performance Standards
The learners shall be able to construct a three-dimensional model of the stages or phases involved in the cell
cycle using indigenous or recyclable materials. The learners shall put emphasis on the identification of possible
errors that may happen during these stages.
Learning Competencies The learners:
characterize the phases of the cell cycle
and their control points
(STEM_BIO11/12Id-f-6)
describe the stages of mitosis and
meiosis given 2n=6 (STEM_BIO11/12Id-f-7)
discuss crossing over and
recombination in meiosis
(STEM_BIO11/12-Id-f-8)
explain the significance or applications
of mitosis/meiosis (STEM_BIO11/12-Idf-9)
identify disorders and diseases that
result from the malfunction of the cell
during the cell cycle (STEM_BIO11/12Id-f-10)
Specific Learning Outcomes
• Identify and differentiate the
phases of the cell cycle and their
control points
• describe and differentiate the
stages of mitosis and meiosis given
2n=6
• discuss and demonstrate crossing
over and recombination in meiosis
• explain the significance and
applications of mitosis and meiosis
• construct a diagram of the various
stages of mitosis and meiosis
• identify disorders and diseases that
result from malfunctions in the cell
during the cell cycle
90 MINS
LESSON OUTLINE
Introduction
Presentation of a simplified life cycle of a human
being or plant
Practice
Class activities or games such as Amaz
Race or Interphase, Mitosis, or Meiosi
Enrichment
Video presentation or introduction on
animal gametogenesis; Microscopic
examination of an onion root tip
Evaluation
Written or oral examination
5
Motivation
Video presentation of ‘Cell Cycle and Cell Division’
5
Instruction/
Delivery
Lecture-discussion on the cell through the use of a
PowerPoint presentation, video, or cell diagram
on a Manila paper;
Demonstration of the processes inside the cell
using model materials (e.g., beads, cords, yarn
with different thickness, coins, etc.); or, Summary
of learners’ responses to questions regarding the
video on ‘Cell Cycle and Cell Division’
60
Materials
photos of the life cycle or stages of eukaryotic organ
of different thickness, cords, beads, coins, pens
Resources (continued at the end of
Teaching Guide)
(1) Becker, W.M. (2000). The World of the Cell.
Addison Wesley Longman Inc., USA
(2) Mader, S.S. (2011).Biology 10th Ed. Mac
Graw Hill Education, USA.
INTRODUCTION (5 MINS)
Teacher tip
Introduce a simplified life cycle of a human being or plant. Let the learners identify the changes
throughout the different stages and how these organisms grow and develop.
18
Explain to the learners that these eukaryotic
organisms follow a complex sequence of events by which their cells grow and divide. This sequence of events is known as the Cell Cycle.
You can show diagrams or illustrations that
demonstrate the growth or increase in the
number of organisms.
Figure 1: Life Cycle of Man and Higher
Plants (Source: (n.d.). Retrieved from http://
www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/postmeio/)
Teacher tip
You can download the video prior to this session
or if internet connection is available
MOTIVATION (5 MINS)
during class, you can just make use of the
hyperlink to play the video. To access the video
through the hyperlink, simply hold the
1. Play the video on ‘Cell Cycle and Cell Division’. This video can be accessed at http:// Control (Ctrl) Key on the keyboard and click
www.youtube.com/watch?v=Q6ucKWIIFmg.Divide the class into two groups.
on the hyperlink.
2. Show diagrams of cell division in multicellular or eukaryotic organisms to the class. You should ask the learners thought-provoking questions about the video and relate
it to the lesson.
38
•
INSTRUCTION/DELIVERY (30 MINS)
Facilitate a lecture-discussion on the general concepts of cell division.
Cell Division—involves the distribution of identical genetic material or DNA to two daughter cells. What is most
remarkable is the fidelity with which the DNA is passed along, without dilution or error, from one generation to
the next. Cell Division functions in reproduction, growth, and repair.
Core Concepts:
•
•
•
•
•
•
•
•
•
•
All organisms consist of cells and arise from preexisting cells.
Mitosis is the process by which new cells are generated.
Meiosis is the process by which gametes are generated for reproduction.
The Cell Cycle represents all phases in the life of a cell.
DNA replication (S phase) must precede mitosis so that all daughter cells receive the same complement of
chromosomes as the parent cell.
The gap phases separate mitosis from S phase. This is the time when molecular signals mediate the switch in
cellular activity.
Mitosis involves the separation of copied chromosomes into separate cells.
Unregulated cell division can lead to cancer.
Cell cycle checkpoints normally ensure that DNA replication and mitosis occur only when conditions are
favorable and the process is working correctly.
Mutations in genes that encode cell cycle proteins can lead to unregulated growth, resulting in tumor
formation and ultimately invasion of cancerous cells to other organs.
The Cell Cycle control system is driven by a built-in clock that can be adjusted by external stimuli (i.e., chemical
messages).
Checkpoint—a critical control point in the Cell Cycle where ‘stop’ and ‘go-ahead’ signals can regulate the cell
cycle.
20
Animal cells have built-in ‘stop’
signals that halt the cell cycles and
checkpoints until overridden by
‘go-ahead’ signals.
• Three major checkpoints are found
in the G1, G2, and M phases of the
Cell Cycle.
Teacher tip
Note the learners’ responses to questions about
the video compared to the expected responses.
The expected responses are the concepts listed
in the Instruction / Delivery part.
The G1 Checkpoint—the Restriction Point
•
•
•
•
The G1 checkpoint ensures that the cell is large enough to divide and that enough nutrients are available to support the resulting
daughter cells.
If a cell receives a ‘go-ahead’ signal at the G1 checkpoint, it will usually continue with the Cell Cycle.
If the cell does not receive the ‘go-ahead’ signal, it will exit the Cell Cycle and switch to a non-dividing state called G0.
Most cells in the human body are in the G0 phase.
The G2 Checkpoint—ensures that DNA replication in S phase has been successfully completed.
The Metaphase Checkpoint—ensures that all of the chromosomes are attached to the mitotic spindle by a kinetochore.
Kinase—a protein which activates or deactivates another protein by phosphorylating them. Kinases give the ‘go-ahead’ signals at the
checkpoints. The kinases that drive these checkpoints must themselves be activated.
•
•
•
•
•
•
G1 and G2
The activating molecule is a cyclin, a protein that derives its name from its cyclically fluctuating concentration in the cell.
Because of this requirement, these kinases are called cyclin-dependent kinases or CDKs.
Cyclins accumulate during the G1, S, and G2 phases of the Cell Cycle.
By the G2 checkpoint, enough cyclin is available to form MPF complexes (aggregations of CDK and cyclin) which initiate mitosis.
MPF functions by phosphorylating key proteins in the mitotic sequence.
Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of cyclin.
CDK, the non-cyclin part of MPF, persists in the cell as an inactive form until it associates with new cyclin molecules synthesized during
the interphase of the next round of the Cell Cycle.
Discuss the stages of mitosis and meiosis.
Mitosis (apparent division)—is nuclear division; the process by which the nucleus divides to produce two new nuclei. Mitosis results in two daughter cells
that are genetically identical to each other and to the parental cell from which they came.
Cytokinesis—is the division of the cytoplasm. Both mitosis and cytokinesis last for around one to two hours.
Prophase—is the preparatory stage, During prophase, centrioles move toward opposite sides of the nucleus.
•
The initially indistinct chromosomes begin to condense into visible threads. Teacher tip • Chromosomes first become visible during
early prophase as long, thin, and intertwined filaments but by late prophase, chromosomes are more compacted and
You may show
diagrams or a video can be clearly discerned as much shorter and rod-like structures.
•
demonstrating animal and plant mitosis. The
As the chromosomes become more distinct, the nucleoli also become more video can be accessed awww.vcbio.science.ru.nl/en/virtuallessont http://
s/ distinct. By the end of prophase, the nucleoli become less distinct, often
mitostage/ disappearing altogether.
Metaphase—is when chromosomes become arranged so that their centromeres become aligned in one place,
halfway between the two spindle poles. The long axes of the chromosomes are 90 degrees to the spindle axis.
The plane of alignment is called the metaphase plate.
Anaphase—is initiated by the separation of sister chromatids at their junction point at the centromere. The
daughter chromosomes then move toward the poles.
Telophase—is when daughter chromosomes complete their migration to the poles. The two sets of progeny
chromosomes are assembled into two-groups at opposite ends of the cell. The chromosomes uncoil and assume
their extended form during interphase. A nuclear membrane then forms around each chromosome group and
the spindle microtubules disappear. Soon, the nucleolus reforms.
Meiosis—reduces the amount of genetic information. While mitosis in diploid cells produces daughter cells with
a full diploid complement, meiosis produces haploid gametes or spores with only one set of chromosomes.
During sexual reproduction, gametes combine in fertilization to reconstitute the diploid complement found in
parental cells. The process involves two successive divisions of a diploid nucleus.
First Meiotic Division
The first meiotic division results in reducing the number of chromosomes (reduction division). In most cases, the
division is accompanied by cytokinesis.
Prophase I—has been subdivided into five substages: leptonema, zygonema, pachynema, diplonema, and diakinesis.
22
•
•
•
•
•
Leptonema—Replicated chromosomes have coiled and are already visible. The number of chromosomes present is the same as the
number in the diploid cell.
Zygonema—Homologue chromosomes begin to pair and twist around each other in a highly specific manner. The pairing is called
synapsis. And because the pair consists of four chromatids it is referred to as bivalent tetrad.
Pachynema—Chromosomes become much shorter and thicker. A form of physical exchange between homologues takes place at specific
regions. The process of physical exchange of a chromosome region is called crossing-over. Through the mechanism of crossing-over, the
parts of the homologous chromosomes are recombined (genetic recombination).
Diplonema—The two pairs of sister chromatids begin to separate from each other. It is at this point where crossing-over is shown to have
taken place. The area of contact between two non-sister chromatids, called chiasma, become evident.
Diakinesis—The four chromatids of each tetrad are even more condensed and the chiasma often terminalize or move down the
chromatids to the ends. This delays the separation of homologous chromosomes.
In addition, the nucleoli disappear, and the nuclear membrane begins to break down.
Metaphase I—The spindle apparatus is completely formed and the microtubules are attached to the centromere regions of the homologues. The synapsed
tetrads are found aligned at the metaphase plate (the equatorial plane of the cell) instead of only replicated chromosomes. Anaphase I—Chromosomes in
each tetrad separate and migrate toward the opposite poles. The sister chromatids (dyads) remain attached at their respective centromere regions.
Telophase I—The dyads complete their migration to the poles. New nuclear membranes may form. In most species, cytokinesis follows, producing two
daughter cells. Each has a nucleus containing only one set of chromosomes (haploid level) in a replicated form.
Second Meiotic Division
The events in the second meiotic division are quite similar to mitotic division. The difference lies, however, in the number of chromosomes that each
daughter cell receives. While the original chromosome number is maintained in mitosis, the number is reduced to half in meiosis.
Prophase II—The dyads contract.
Metaphase II—The centromeres are directed to the equatorial plate and then divide.
Anaphase II—The sister chromatids (monads) move away from each other and migrate to the opposite poles of the spindle fiber.
Telophase II—The monads are at the poles, forming two groups of chromosomes. A nuclear membrane forms around each set of chromosomes and
cytokinesis follows. The chromosomes uncoil and extend.
Cytokinesis—The telophase stage of mitosis is accompanied by cytokinesis. The two nuclei are
compartmentalized into separate daughter cells and complete the mitotic cell division process. In animal
cells, cytokinesis occurs by the
formation of a constriction in the
middle of the cell until two daughter cells are formed. The constriction is often called cleavage, or cell furrow.
However, in most plant cells this constriction is not evident. Instead, a new cell membrane and cell wall are
assembled between the two nuclei to form a cell plate. Each side of the cell plate is coated with a cell wall
that eventually forms the two progeny cells.
Meiosis
Mitosis
1. Requires two nuclear divisions
1. Requires one nuclear division
2. Chromosomes synapse and cross over
2. Chromosomes do not synapse nor cross over
WebReadings/PdfReadings/TABLE_CO
MPARING_MITOSIS_AND.pdf)
Teacher tip
You can show a tabular comparison between
mitosis and meiosis to point the significance of
the two types of division. Divide the class into
two groups and ask them about their opinions
on the applications of mitosis and meiosis.
The following could be possible responses:
3. Centromeres survive Anaphase I
3. Centromeres dissolve in mitotic anaphase
4. Halves chromosome number
4. Preserves chromosome number
5. Produces four daughter nuclei
5. Produces two daughter nuclei
6. Produces daughter cells genetically
different from parent and each other
6. Produces daughter cells genetically identical
to parent and to each other
7. Used only for sexual reproduction
7. Used for asexual reproduction and growth
Table 1: Comparison of Mitosis and Meiosis (Source: http://courses.washington.edu/bot113/spring/
24
Significance of mitosis for sexual reproduction:
Mitosis is important for sexual reproduction
indirectly. It allows the sexually reproducing
organism to grow and develop from a single cell
into a sexually mature individual. This allows
organisms to continue to reproduce through the
generations.
Significance of Meiosis and Chromosome
Number: Chromosomes are the cell's way of
neatly arranging long strands of DNA. Non-sex
cells have two sets of chromosomes, one set
from each parent. Meiosis makes sex cells with
only one set of chromosomes. For example,
human cells have 46 chromosomes, with the
exception of sperm and eggs, which contain only
23 chromosomes each. When a sperm cell
fertilizes an egg, the 23 chromosomes from each
sex cell combine to make a zygote, a new cell
with 46 chromosomes. The zygote is the first cell
in a new individual.
Meiosis I compared to Mitosis
Meiosis II compared to Mitosis
Meiosis I
Mitosis
Meiosis II
Mitosis
Prophase I
Prophase
Prophase II
Prophase
Pairing of homologous
chromosomes
No pairing of
chromosomes
No pairing of
chromosomes
No pairing of
chromosomes
Metaphase I
Metaphase
Metaphase II
Metaphase
Bivalents at metaphase
plate
Duplicated
chromosomes at
metaphase plate
Haploid number of
duplicated
chromosomes at
metaphase plate
Diploid number of
duplicated
chromosomes at
metaphase plate
Anaphase I
Anaphase
Anaphase II
Anaphase
Homologues of each
bivalent separate and
duplicated chromosomes
move to poles
Sister chromatids
separate, becoming
daughter
chromosomes that
move to the poles
Sister chromatids
separate, becoming
daughter
chromosomes that
move to the poles
Sister chromatids
separate becoming
daughter
chromosomes that
move to the
poles
Telophase I
Telophase
Two haploid daughter cells Two diploid daughter
not identical to the parent cells, identical to the
cell
parent cell
Telophase II
Telophase
Four haploid daughter
cells not genetically
identical
Two diploid
daughter cells,
identical to the
parent cell
Teacher tip
Significance of Meiosis for Diversity: One of the benefits of sexual
reproduction is the diversity it produces within a population. That variety is a
direct product of meiosis. Every sex cell made from meiosis has a unique
combination of chromosomes. This means that no two sperm or egg cells are
genetically identical. Every fertilization event produces new combinations of
traits. This is why siblings share DNA with parents and each other, but are not
identical to one another.
Teacher tip
You may show a video that demonstrates how crossing over and
recombination of chromosomes occur. The video can be accessed at http://
highered.mheducation.com/sites/ 9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html.s
Table 2: Meiosis
compared to Mitosis
Facilitate a discussion
on disorders and
diseases that result
from the malfunction
of the cell during the cell cycle. Present some diagrams or illustrations on some errors in mitosis and allow the
learners to predict possible outcomes, diseases, or disorders that may happen:
• incorrect DNA copy (e.g., cancer)
• chromosomes are attached to string-like spindles and begin to move to the middle of the cell (e.g., Down Syndrome, Alzheimer’s, and Leukemia)
Other chromosome abnormalities:
•
•
•
•
•
•
arise from errors in meiosis, usually meiosis I;
occur more often during egg formation (90% of the time) than during sperm formation;
become more frequent as a woman ages.
Aneuploidy—is the gain or loss of whole chromosomes. It is the most common chromosome abnormality. It is
caused by non-disjunction, the failure of chromosomes to correctly separate:
homologues during meiosis I or
sister chromatids during meiosis II
PRACTICE (10 MINS)
Facilitate games like Amazing Race, Interphase/Mitosis/Meiosis Puzzle in the class.
1. The Amazing Race follows a series of stations or stages with challenges that the learners have to accomplish.
Divide the class into groups after the discussion. The number of groups will depend on the number of stages or
phases in the process (i.e., interphase, mitosis, or meiosis).
2. The groups will race to accomplish the tasks in five stations. In each station, the learners will assemble given
materials to illustrate stages or phases of events in the specific process (i.e., interphase, mitosis, or meiosis).
ENRICHMENT (5 MINS)
1. Instruct the learners to watch additional videos on cell division.
2. Introduce animal and plant gametogenesis to the learners in order for them to appreciate the significance of cell
division.
ADDITIONAL RESOURCES:
Books:
1. Raven, P. a. (2001). Biology 6th Ed. The McGraw Hill Company, USA
2. Reece, J. B. (2013). Campbell Biology, 10th Ed. Pearson Education, Inc. United States of America.
Electronic Resources:
26
3. Facilitate microscopic
examination of onion root tip.
EVALUATION (5 MINS)
Facilitate the accomplishment of a
self-assessment checklist.
Teacher tip
Encourage the learners to actively
participate in the challenge. You may give
extra points to those who will finish first.
A number of good videos have the stages or
phases made into a rap or a song. One such
example is the video entitled Cell Division
Song Spongebob that can be accessed at
http://www.youtube.com/watch?
v=9nsRufogdoI. Encourage each group to
brainstorm and point out their perceptions
of the videos.
A video on animal and plant gametogenesis
can be accessed at http://csls-text.c.utokyo.ac.jp/active/ 12_05.html.
3. (n.d.). Retrieved from Bright Hub Education: http://www.brighthubeducation.com/middle-school-science-lessons/94267-three-activities-forteachingcell-cycles/#
4. (n.d.). Retrieved from http://www.uic.edu/classes/bios/bios100/lecturesf04am/lect16.htm
5. (n.d.). Retrieved from MH Education: http://highered.mheducation.com/sites/9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html
6. (n.d.). Retrieved from http://www.vcbio.science.ru.nl/en/virtuallessons/meiostage/
7. (n.d.). Retrieved from http://csls-text.c.u-tokyo.ac.jp/active/12_05.html
8. (n.d.). Retrieved from http://education.seattlepi.com/biological-significance-mitosis-meiosis-sexual-reproduction-5259.htm
General Biology 1
Introduction
Visualization of the plasma membrane and its
functions
30
Transport Mechanisms Pt.1
Motivation
Simple group activity and brief reporting
60
Instruction/
Delivery
Discussion and lecture proper
Performance Standards
The learners shall be able to construct a cell membrane model from indigenous or
recyclable materials.
Practice
Answering practice/guide questions
45
Learning Competencies The learners:
Enrichment
Essay and concept map writing
45
Evaluation
Designing a model of a plasma membrane
using recyclable or indigenous materials
Content Standards
The learners demonstrate an understanding of Transport Mechanisms:
Simple Diffusion, Facilitated Transport, Active Transport, and Bulk/Vesicular Transport
•
•
•
•
describe the structural components of the cell membrane
(STEM_BIO11/12–Ig-h-11)
relate the structure and composition of the cell membrane to its function
(STEM_BIO11/12-Ig-h-12)
explain transport mechanisms in cells (diffusion, osmosis, facilitated transport,
active transport) (STEM_BIO11/12–Ig-h-13)
differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
120
180
Materials pen, paper, salt, water, recycled or indigenous
materials
Resources
(1) Campbell, N. J. (n.d.).
describe and compare diffusion, osmosis, facilitated transport and active transport (2) Campbell, N. e. (2008). Biology 8th edition. Pearson International Edition.
Pearson/Benjamin.
explain factors that affect the rate of diffusion across a cell membrane
predict the effects of hypertonic, isotonic, and hypotonic environments on osmosis (3) Freeman, S. (2011). Biological Science 4th edition International Edition.
Benjamin Cummings Publishing.
in animal cells
(4) Hickman, C. L. (2011). Integrated Principles of Zoology 15th edition.
differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis
McGraw Hill Co., Inc.
480 MINS
LESSON OUTLINE
INTRODUCTION (30 MINS)
1. Before this lesson, ask the learners to read about the topic on
transport of materials across membranes.
2. Introduce the topic by providing the learners with background information.
In order for the cell to stay alive, it must meet the characteristics of life which
include taking nutrients in and eliminating wastes and other by-products of
metabolism. Several mechanisms allow cells to carry out these processes. All of the
cell’s activities are in one way or another tied to the membrane that separates its
interior from the environment.
3. Ask the learners how they understand and visualize a plasma membrane and what
characteristics are essential for it to perform its function.
4. Ask the learners to identify the different mechanisms on how materials are
transported in and out of the cell.
MOTIVATION (60 MINS)
1. Divide the learners into groups and ask them the following question: “What comes
INSTRUCTION/DELIVERY (120 MINS)
1. Show an illustration of a plasma membrane to the learners.
2. Ask the learners to describe the plasma membrane.
3. Discuss the importance of the plasma membrane and how
indispensable it is to the life of the cell.
4. Explain how plasma membranes are arranged in the presence of
water.
5. Let the learners enumerate the structures found in a plasma
membrane.
Teacher tip
Different responses to the question will be drawn from students. Their responses
will depend on what aspect they are looking into.
Acknowledge the responses of the learners. Point out and explain that the two
6. Explain to the learners the structure of a phospholipid bilayer.
Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a result of the interaction between the nonpolar
phospholipid tails, the polar phospholipid heads, and the surrounding water. The nonpolar tails face toward the water.
Transmembrane proteins float within the bilayer and serve as channels through which various molecules can pass.
to your mind when you see a 20 year old man who is 7.5 ft. tall and 3.5 ft. tall man
of the same age?” Among their respective groups, let the learners discuss the
similarities and differences between the two. (Hint: Give students a clue by giving
them the giant and pygmy as examples).
2. Ask a representative from each group to report the result of their discussion to the
whole class.
3. Before the start of the lesson on diffusion, spray an air freshener in one corner of
the room and ask the learners to raise their hands if they have smelled the scent of
the spray.
4. Ask the learners what they have observed. Who smelled the scent first? Who are
the last ones to smell the scent? How would you explain the phenomenon wherein
learners in the same classroom smelled the spray at different times?
men are both abnormal. Their growths are abnormal such that one is too big in
size and the other one is too small. Both men have defective membranes.
Insufficient amount of growth hormones pass through a pygmy’s body while an
excessive amount of growth hormones is released in a giant.
7. Ask the learners to enumerate the different transport
mechanisms.
8. Differentiate between diffusion and osmosis.
9. Compare and contrast facilitated diffusion and active transport.
10. Present photos of plant and animal cells immersed in an
isotonic, hypotonic, and hypertonic solution.
11. Describe solution and solute movement in and out of the cell
under hypertonic, hypotonic, and isotonic conditions.
12. Explain the effects of the different solutions to the cells. Ask which among the three PRACTICE (45 MINS)
solutions is the best for plants? How
about for animals? Explain to the learners the water requirement in plants.
Ask the learners to answer the following practice or guide
questions:
Diffusion is the natural tendency for molecules to move constantly. Their
• What is the difference between diffusion and facilitated
movement is random and is due to the energy found in the individual molecules.
diffusion?
Net diffusion occurs when the materials on one side of the membrane have a
• How do endocytosis and exocytosis allow movement of
different concentration than the materials on the other side.
materials in and out of the cell?
•
Osmosis is a special type of diffusion specifically associated with the movement of
water molecules. Many cells are isotonic to the environment to avoid excessive
•
inward and outward movement of water. Other cells must constantly export water
from their interior to accommodate the natural inward movement. Most plants are
hypertonic with respect to their immediate environment. Osmotic pressure within
the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
What solution is best for a plant cell? How about for an animal
cell?
Explain the orientation of the phospholipid molecules in the
presence of water.
ENRICHMENT (45 MINS)
To control the entrance and exit of particular molecules, selective transport of
Let the learners recognize the effect of a defective membrane in
materials is necessary. One simple process is facilitated diffusion that utilizes
normal body functioning. Ask them to write an essay about the
protein transmembrane channels that are specific to certain molecules. It is a
possible effects of a faulty plasma membrane aside from the
passive process driven by the concentration of molecules both inside and the
outside of the membrane. Certain molecules are transported in and out of the cell, examples given earlier.
independent of concentration. This process requires the expenditure of energy in
Ask the learners to individually submit a concept map about plasma
the form of ATP and is called active transport.
membrane and the different transport mechanisms.
13. Differentiate among endocytosis, phagocytosis, pinocytosis, receptor-mediated
endocytosis, and exocytosis.
Large molecules enter the cell by generalized nonselective process known as
endocytosis. Phagocytosis is endocytosis of a particulate material while endocytosis
of liquid material is called pinocytosis. Exocytosis is the reverse process.
Receptormediated endocytosis is a complicated mechanism involving the transport
of materials via coated vesicles.
30
EVALUATION (180 MINS)
Ask the learners to design and a model of a plasma membrane using
recyclable or indigenous materials.
Divide the learners into groups and assign different
concentrations of salt solution to be used in making salted eggs.
Ask the learners to answer the following questions:
•
Why does putting salt on meat preserve it from bacterial
spoilage?
•
•
•
•
•
Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport,
active transport, endocytosis, and exocytosis) in terms of the following:
concentration gradient
use of channel or carrier protein
use of energy
types or sizes of molecules transported
General Biology 1
240 MINS
Transport Mechanisms Pt.2
Content Standard
The learners shall be able to construct a cell membrane model from indigenous or
recyclable materials.
Performance Standard
The learners shall be able to construct a cell membrane model from indigenous
or recyclable materials.
Introduction
Presentation of objectives and important terms;
Discussion on the structure of the plasma membrane;
Brief discussion on the different transport mechanisms
15
Motivation
Class activity to illustrate the process of diffusion;
Discussion of similarities between a giant and pygmy;
Demonstration of the principle behind the process of
making salted eggs
15
Instruction/
Delivery
Discussions, as a class and among groups, on the
structure and importance of the plasma
membrane and on the different transport mechanisms
60
Learning Competencies The learners:
•
•
•
•
describe the structural components of the cell membrane
(STEM_BIO11/12–Ig-h-11)
relate the structure and composition of the cell membrane to its function
(STEM_BIO11/12-Ig-h-12)
explain transport mechanisms in cells (diffusion, osmosis, facilitated transport,
active transport) (STEM_BIO11/12–Ig-h-13)
differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
•
•
•
Practice
describe the plasma membrane
explain how plasma membranes are arranged in the presence of water
Enrichment
understand the structure of the phospholipid bilayer
describe and compare diffusion, osmosis, facilitated transport and active transport
explain factors that affect the rate of diffusion across a cell membrane
Evaluation
predict the effects of hypertonic, isotonic, and hypotonic environments on osmosis
in animal cells
differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis
LESSON OUTLINE
Materials
32
Answering of practice or guide questions
Essay writing or concept mapping; Class activity on
salted egg making
Construction of a plasma membrane model from
indigenous or recyclable materials; Concept mapping on
the different transport mechanisms; Answering of
questions for assessment
60
projector, laptop (if available), visual aids, school supplies, recycled or indigenous materials
Resources
(1) Campbell, N.A. et. al. (2008). Biology 8th Edition Pearson International. Pearson/Benjamin Cummings Publishing.
(2) Campbell, N. J. (2010). Biology 9th edition Pearson International Edition. Benjamin Cummings Publishing.
(3) Freeman, S. (2011). Biological Science. 4th edition. International Edition. Benjamin Cummings Publishing.
(4) Hickman, C. L. (2011). Integrated Principles of Zoology. 15th edition. McGraw Hill Co., Inc.
Divide the learners into groups and ask them the question: What
comes to your mind when you see two men who are of the same
age but one is 7.5 feet tall and the other is 3.5 feet tall?
Allow the learners to discuss the similarities and differences
between the two among their groups. Ask a representative from
INTRODUCTION (15 MINS)
each group to present the results of their discussions to the whole
Prior to this lesson, instruct the learners to read up on the transport of materials across
membranes. Ask the learners to identify the different mechanisms on how materials
class.
are transported in and out of the cell.
Introduce the topic by providing the learners with background information.
In order for the cell to stay alive, it must meet the characteristics of life which include
taking nutrients in and eliminating wastes and other by-products of metabolism.
Several mechanisms allow cells to carry out these processes. All of the cell’s activities
are, in one way or another, tied to the membrane that separates its interior from the
environment.
Ask the learners how they visualize a plasma membrane and what characteristics do
they think are essential for it to perform its function.
Teacher tip
After the learners have enumerated the different transport mechanisms, ask them
why they think there is a need to have different kinds of processes that allow
materials to be transported in and out of the cell.
Learners will describe the plasma membrane in different ways. Ask them how they
think the structures found within the membrane help in performing its function
and what might happen in the absence of the these structures
Teacher tip
MOTIVATION (15 MINS)
Before the start of the lesson on diffusion, conduct this simple class activity. Spray an
air freshener in one corner of the room and instruct the learners to raise their hands if
they have smelled the scent of the spray.
Ask the learners the following questions:
•
•
•
Who among the class were able to smell the air freshener first?
Who among the class were the last ones to smell the air freshener?
How would you explain the phenomenon wherein people in the same
classroom smelled the scent of the air freshener at different times?
Allow some time for the learners to smell the spray until everyone has already
smelled the scent. Remember to instruct the learners to raise their hand once
they smell the scent.
The learners might give varying responses to the question depending on what
aspect they are looking into. Give hints by providing the giant and pygmy as
examples.
Acknowledge the learners’ responses and point out that the two men are similar
in the sense that they are both abnormal. Growth in both men is abnormal such
that one is too big in size while the other one is too small.
Explain that both men have abnormal growth. Both have defective membranes. Insufficient amount of
growth hormones pass through a pygmy’s body while an excessive amount of growth hormones is
released in a giant.
INSTRUCTION/DELIVERY (60 MINS)
Structure, function and importance of the
plasma membrane 1. Present an
illustration of the plasma membrane to the
class
2. Ask the learners to describe the plasma membrane.
3. Discuss the importance of the plasma membrane and how indispensable it is to the
life of the cell.
4. Explain how plasma membranes are arranged in the presence of water.
5. Let students enumerate structures found in a plasma membrane.
6. Make students understand the structure of a phospholipid bilayer.
Plasma membranes—are made up of a phospholipid bilayer in an aqueous
environment.
Phospholipids are the foundation of all known biological membranes. The lipid bilayer
forms as a result of the interaction between the non-polar (hydrophobic or waterfearing)
phospholipid tails, the polar (hydrophilic or water-loving)
phospholipid heads, and the surrounding water.
The nonpolar tails face toward the water. Transmembrane proteins float within the
bilayer and serve as channels through which various
molecules can pass. They
function as ‘identification tags’ on cells which enable the cell to determine if the other
cells that it encounters are like itself or not. It also permits cells of the immune system
to accept and reject foreign cells such as disease-causing bacteria.
Many membrane proteins function as enzymes that speed up reactions in cells. Others
act like paste or glue-forming cell junctions where
adjacent cells stick together.
Membranes also contain cholesterol which reduces the cell’s permeability to
substances and make the bilayer stronger.
34
Transport Mechanisms
1. Ask the learners to enumerate the different transport
mechanisms.
2. Differentiate between diffusion and osmosis.
Teacher tip You can ask the following questions before starting the discussion:
Have you realized how crucial the task of a plasma membrane is in maintaining the
life of a cell?
Have you thought about the ways on how the materials needed by the cell and the
wastes it needs to dispose are able to move in and out of the plasma membrane?
Molecules and substances move in several ways that fall within two categories: passive transport and active transport. In passive transport, heat energy of
the cellular environment provides all of the energy, hence, this is not energy-costly to the cell. Active transport, however, requires the cell to do work,
requiring the cell to expend its energy reserves.
Diffusion is a type of passive transport described as the natural tendency for molecules to move constantly. Their movement is random and is due to the
energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different concentration than the
materials on the other side. Osmosis is a special type of diffusion specifically associated with the movement of water molecules.
A solution with a higher concentration of solutes is said to be hypertonic while a solution with a lower concentration of solutes is hypotonic. Water crosses
the membrane until the solute concentrations are equal on both sides. Solutions of equal solution concentration are said to be isotonic. This only occurs
when the solute concentration are the same on both sides of the membrane.
Compare and contrast facilitated diffusion and active transport. Then present photos of plant and animal cells immersed in an isotonic, hypotonic, and
hypertonic solution. In addition, describe a solution and solute movement into and out of the cell under hypertonic, hypotonic and isotonic conditions.
Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? For animals? Let them understand water
requirement in plants.
Many cells are isotonic to the environment in order to avoid excessive inward and outward movement of water. Other cells must constantly export water
from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate environment. Osmotic
pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
Ask the learners the following questions:
•
•
•
How do cells behave in different solutions?
What do you notice about the effect of different solutions to animal and plant cells?
What solution is best for an animal cell? Does this hold true with plant cells?
When an animal cell such as red blood cell is immersed in an isotonic solution, the cell gains water at the same rate that it loses it. The cell’s volume remains
constant in this situation.
What will happen to the red blood cell when immersed in a hypotonic solution which has a lower solute concentration than the cell? The cell gains water,
swells, and may eventually burst due to excessive water intake. When placed in a hypertonic solution, an animal cell shrinks and can die due to water loss.
Water requirement for plant cells is different due to their rigid cell walls. A plant cell placed in an isotonic solution is flaccid and a plant wilts in this condition.
In contrast with animal cells, a plant cell is turgid and healthy in a hypotonic solution. In a hypertonic solution, a plant cell loses water, shrivels, and its plasma
membrane detaches from the cell wall. This situation eventually causes death in plant cells.
Differentiate diffusion from facilitated diffusion.
To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated diffusion that utilizes
protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration of molecules on the inside and the
outside of the membrane. Certain molecules are transported in and out of the cell, independent of concentration. This process requires the expenditure of
energy in the form of ATP and is called active transport.
Differentiate endocytosis, phagocytosis, pinocytosis, receptor-mediated endocytosis, and exocytosis.
Large molecules enter the cell by generalized non-selective process known as endocytosis. Phagocytosis is endocytosis of a particulate material while
pinocytosis is endocytosis of liquid material. In this process, the plasma membrane engulfs the particle or fluid droplet and pinches off a membranous sac or
vesicle with a particular fluid inside into the cytoplasm.
Exocytosis is the reverse process where a membrane-bound vesicle filled with bulky materials moves to the plasma membrane and fuses with it. In this
process, the vehicle’s contents are released out of the cell.
Receptor-mediated endocytosis is a complicated mechanism involving the transport of materials through coated vesicles. Cells take up molecules more
efficiently in this process due to the receptor proteins on their surfaces. Each receptor protein bears a binding site for a particular molecule. If the right
molecule contacts a receptor protein, it attaches to the binding site, forming a pocket and eventually pinching off into the cytoplasm.
PRACTICE (30 MINS)
Ask the learners to answer the following questions:
•
•
Explain the orientation of the phospholipid molecules in the presence of water.
Enumerate the structures found in a plasma membrane and give the function of each.
36
•
•
•
•
•
•
How do diffusion and facilitated diffusion differ?
How do endocytosis and exocytosis allow movement of materials in and out of the cell?
What solution is best for a plant cell? How about for an animal cell?
Give two ways by which one could determine whether active transport is going on.
Compare and contrast the effects of hypertonic and hypotonic solutions on plant and animal cells.
What role do vacuoles play in endocytosis and exocytosis?
ENRICHMENT (60 MINS)
Essay writing and concept mapping
1.
Ask the learners to write an essay about the possible effects of a faulty plasma membrane aside from the
examples given in the lesson. Let the learners recognize the effects of a defective membrane to normal bodily
functions.
1.
Divide the class into groups and
assign different concentrations of salt
solutions to be used in making salted
eggs.
2.
Instruct the learners to make
their own salt solutions and take note
of the concentration that they opt to
use.
Teacher tip
For the concept mapping, you can provide the
learners with key words or allow them to come
up with their own key words for their concept
map.
2.
Ask the learners to individually submit a concept map about the plasma membrane. You can provide
them with sample words for their concept map:
•
•
•
•
•
•
•
plasma membrane
semipermeable
phospholipid bilayer
hydrophilic heads
hydrophobic tails
cholesterol
membrane proteins
Creating own saturated salt solution for salted egg-making
Teacher tip
Diffusion and osmosis are two processes involved
in making salted eggs. The salt solution should be
supersaturated in order to produce good and
delicious salted eggs.
EVALUATION (60 MINS)
Building of plasma membrane model 1.
Divide the class into groups.
2. Ask the groups to design and build a model of a plasma membrane using recyclable or indigenous materials.
Concept mapping
Ask the learners to individually submit a concept map about the different transport mechanisms. You
them with sample words for their concept map or allow them to come up with their own:
•
•
•
•
•
•
•
•
plasma membrane •
phagocytosis key words for their concept map.
transport mechanisms
•
pinocytosis
passive transport •
receptor-mediated
active transport
endocytosis
diffusion •
hypotonic
facilitated diffusion •
hypertonic
endocytosis
•
isotonic
exocytosis
Assessment questions:
Instruct the learners to answer the following questions to assess their knowledge and understanding of the
lesson:
•
•
•
•
•
Why does putting salt on meat preserve it from spoilage by bacteria?
Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport, active transport,
endocytosis, and exocytosis) in terms of the following:
concentration gradient
use of channel or carrier protein
use of energy
38
Teacher tip
You can provide the learners with key words can provide
or allow them to come up with their own
•
types or sizes of molecules transported
General Biology 1
Carbohydrates and Lipids:
Structures and Functions of
Biological Molecules
Content Standard
The learners demonstrate an understanding of the structures and functions of
carbohydrates and lipids and their roles in specific metabolic processes.
•
perform tests for the presence of starch and reducing sugars
and lipids on common food products
120 MINS
LESSON OUTLINE
Introduction
Presentation of learning objectives and important
terms; Discussion on dehydration reactions and
hydrolysis
10
Motivation
Relating the lessons to real-life situations;
Discussion on food as sources of energy and
building blocks
10
Instruction/
Delivery/
Practice
Discussion, as a class and among groups, on the
structure and importance of carbohydrates and
lipids.
60
Enrichment
Laboratory activity on testing the presence of
carbohydrates and lipids on common food
products
20
Evaluation
Group activity on making molecular models of 20
carbohydrates and lipids
Performance Standard
The learners shall be able to explain the role and significance of carbohydrates and
lipids in biological systems.
Learning Competencies The learners:
•
•
•
categorize the biological molecule as a carbohydrate or lipid according to their
structure and function (STEM_BIO11/12-Ii-j-15)
explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12-Ii-j-16)
detect the presence of carbohydrates and lipids in food products using simple tests
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
present simple molecular models of carbohydrates and lipids and relate the
structure to the roles that these molecules play in biological systems
Materials
projector, laptop (if available), sample food labels, common food or drink products (e.g.
flour, cornstarch, cooking oil, food or drink brought by the learners
Resources
(1)
Reece, J.U. (2011). Campbell Biology, 9th ed. San Francisco, CA:
Pearson Benjamin Cummings
INTRODUCTION (10 MINS)
Communicate learning objectives and important terms
Introduce the following learning objectives using any of the suggested protocols (i.e.,
verbatim, own words, or read-aloud)
•
•
•
I can distinguish a carbohydrate from a lipid given its chemical structure and
function.
I can explain the roles played by carbohydrates and lipids in biological systems.
I can detect the presence of carbohydrates and lipids in food products using simple
chemical tests.
Introduce the list of important terms that learners will encounter in this lesson:
•
•
•
•
•
•
•
•
•
•
•
•
macromolecule
polymer
monomer
dehydration reaction
hydrolysis
carbohydrates
monosaccharides
disaccharides
glycosidic linkage
polysaccharide starch
glycogen
MOTIVATION (10 MINS)
1. Divide the class into groups of three.
Teacher tip
Prominently display the learning objectives and important terms on one side of
the classroom and frequently refer to them during the discussion. You may place
a check-mark beside a term in the wordlist after defining it so that the learners
have an idea of their progress.
Each learner can also illustrate or define the term on a sheet of paper which can
be tacked beside the list of words.
Another way of incorporating lists of important terms is to have the words placed
in a blank bingo card grid.
Learners can write a short definition or description of the term under the entry in
the bingo card to block out a square. This may serve as the learners’ reference
guide or method of formative assessment.
40
2. Distribute sample food or nutrition labels to each group and ask them if they know how to interpret the
information written on the food labels.
You may ask the following questions to
facilitate the discussion and call on
several groups to present in front of
the class:
•How many servings are in this
container?
•Would you agree that this is the
reasonable amount of food you would
consume per serving? How many total
food calories (C) are in this container?
•How much fat is present in one
serving? What kind of fat? What is the
importance of consuming fats in our
diet?
4.Explain to the
learners that this
lesson will
describe the
structure of carbohydrates and lipids and explain the role that
these biomolecules play in important biological processes.
Teacher tip
For the food labels, local products that are familiar to the learners will make the
best samples. Make sure that the labels have carbohydrates, fats, and fibers in
them. If there are no food labels available, you may do an image search and print
some sample food labels from the internet.
Division into small groups of two or three may facilitate sharing. Only call on two
or three groups to present if there is limited time.
Expect the responses to vary depending on how realistic the serving sizes are. You
can also discuss about how advertisers can influence how people perceive food.
Take note that a food calorie is the same as 1 kcal or 1000 calories. A young adult
would often need to take 1800-2500C per day depending on their size and level
of activity.
•How much carbohydrates are present
in one serving? What kind of
carbohydrates? What is the
importance of consuming
Responses may include saturated, unsaturated, and trans fats. Explain to the
carbohydrates in our diet?
learners that these fats will be discussed in more detail during the lesson.
•Decide on whether this food sample
can be eaten often or sparingly and
justify.
3.Recall that human beings, like all animals, are heterotrophs that need to take in
energy and organic molecules (carbohydrates, fats, and proteins) from plant and
animal matter.
Regarding its importance, expect responses ranging from energy source,
insulation, for flavor, for aid in cooking, for heart health, skin health, etc.
Possible responses include sugar, fibers, etc. Regarding its importance, responses
may include energy source, for aid in regular bowel movement, for provision of
building blocks for biosynthesis, etc.
INSTRUCTION/DELIVERY (60 MINS)
Present a diagram similar to the one below.
Table 1: Abundant elements in the human body (Source:
http://www.personal.psu.edu/staff/m/b/
mbt102/bisci4online/chemistry/elementsorgnsm.jpg)
Point out that the bulk (i.e., more than 90%) of the human body
weight is provided by only three elements: oxygen, carbon, and
hydrogen. We get these elements primarily from the food we eat,
from the water we drink, and from the air we inhale around us.
Explain to the learners that biogeochemical cycles such as the
carbon-oxygen cycle and the water cycle play important roles in
ensuring that we have access to these important elements. All
forms of life, not only that of humans, are made up of four kinds of
important large molecules: carbohydrates, lipids,
proteins, and nucleic acids. All of these have carbon atoms as their backbones since carbon is capable of forming up to four chemical bonds with atoms of
other elements.
Facilitate the lecture on carbohydrates and lipids.
What do humans get from food?
Heterotrophs, such as human beings, obtain energy and raw materials from food. These are important for cell growth, cell division, metabolism, repair, and
maintenance of the body. Nutrients can be classified as either organic nutrients (i.e., those that contain carbon such as
carbohydrates, fats, proteins, vitamins, and nucleic acids) or inorganic nutrients (i.e., those that do not contain carbon such as water and mineral salts).
42
What are carbohydrates?
Carbohydrates are organic compounds made up of carbon, hydrogen, and oxygen. These compounds have a general formula of CnH2mOm. This
means that the hydrogen and oxygen atoms are present in a ratio of 2:1. For example, glucose has a formula of C6H12O6 and sucrose has a formula of
C12H22O11.
Carbohydrates are usually good sources of raw materials for other organic molecules and energy. One gram of carbohydrates provides
calories or 16 kJ of energy. In the human diet, carbohydrates mainly come from plants although they are found in all
organisms.
four food
How are carbohydrates formed?
Carbohydrates are examples of macromolecules. These are chainlike molecules called polymers (mere means part) made from repeating units like
monomers. Polymers can be formed from covalently-bonded monomers much like a single structure can be made out of repeated building blocks linked to
each other.
These monomers, called monosaccharides, form covalent bonds when one monomer loses a hydroxyl group and the other loses a hydrogen atom in
dehydration or condensation reactions, forming disaccharides. This reaction requires energy to occur. The bond formed is called a glycosidic linkage.
Comprehension question: How many
molecules of water are needed to
completely hydrolyze a polysaccharide
that is one thousand monosaccharides
long?
Teacher tip
Use ball and stick models or plastic blocks to
demonstrate how dehydration and hydrolysis
reactions occur. Simple reusable ones may be
constructed from toothpicks or clay or similar
materials.
If a projector is available, you may also use
animations like the ones found at <http://
www.cengage.com/biology/
discipline_content/animations/
reaction_types.swfto> to help in visualization.
Figure 2: Dehydration synthesis of disaccharides from monosaccharide components (Source: https://
bealbio.wikispaces.com/file/view/disaccharides.JPG/364413582/disaccharides.JPG)
Longer polysaccharide chains are formed by monomer addition through succeeding dehydration reactions.
These reactions can occur in the human liver as carbohydrates are stored as polysaccharides called glycogen or
in ground tissues of plants where these are stored as starch.
Polysaccharides are broken down into simpler components through the use of water to break covalent bonds
and release energy. The process, known as hydrolysis (hydro means water and lysis means split), is the opposite
of dehydration reactions and often occurs in the digestive tract during chemical and mechanical digestion. Here,
enzymes break bonds within polysaccharides. With the aid of water, one – H group attaches to a
monosaccharide while another –OH group attaches to the other.
44
Correct response: 999 water molecules
During the discussion, invite the learners to find
different kinds of carbohydrates in their food
labels.
How are carbohydrates classified?
Carbohydrates can be classified into
three main categories, according to
increasing complexity:
•
monosaccharides (monos means
single and sacchar means sugar)
•
•
disaccharides (di means two)
polysaccharides (poly means many)
Some notes on their structures and functions are found in the following table:
Classification
Monosaccharide
Functions
•
•
major cellular
nutrient often
incorporated
into more
complex
carbohydrates
Structure
•
•
•
contains a carbonyl group
(C=O) and may be classified
as an aldose or ketose
depending on the position
may have three to seven
carbons in the skeleton may
be arranged in a linear form
when solid and is converted
into a ring form in aqueous
solution (α form when H is
on top of plane of ring and β
form when -OH is on top of
plane of ring)
Examples
•
•
•
Ribose—a 5C aldose that
forms part of the backbone
of nucleic acids
Glucose—a 6C aldose that is
the product of
photosynthesis and the
substrate for respiration that
provides energy for cellular
activities
Fructose—a 6C ketose that is
found in many plants and is
often bonded to glucose
Classification
Disaccharide
Polysaccharide
Functions
•
•
Structure
energy source •
sweetener
and dietary
component
•
storage
material for
important
monosaccharides
•
structural
material for the
cell or the entire
organism
Examples
•
forms when a
glycosidic linkage
forms between two
•
monosaccharides
Maltose (glucose + glucose)—malt sugar often found
in sprouting grains, malt-based energy drinks, or
beer
Lactose (glucose + galactose)—milk sugar that is a
source of energy for infants; an enzyme called
lactase is required to digest this. Many adult Filipinos
have low levels of this enzyme leading to a condition
called lactose intolerance.
•
Sucrose (glucose + fructose)—found in table sugar
processed from sugar cane, sweet fruits, and storage
roots like carrots
•
Storage polysaccharides are large molecules retained in
the cell and are insoluble in water (formed from α 1,4
linkage monomers; with a helical structure)
o
Starch—amylase is unbranched starch forming a
helical structure while amylopectin is branched starch,
these are present in plant parts like potato tubers, corn,
and rice and serve as major sources of energy.
o
Glycogen—found in animals and fungi; often
found in liver cells and muscle cells
•
forms when
hundreds to thousands of
monosaccharides are
joined by glycosidic
linkages
•
Teacher tip
Teacher tip
Structural polysaccharides (formed from β 1,4 linkage of
monomers; strands associate to form a sheet-like
structure)
o
Cellulose—tough sheet-like structures that
make up plant and algal cell walls that may be processed
to form paper and paper-based products; humans lack
the enzymes to digest β 1,4 linkages so is passed out of
the digestive tract and aids in regular bowel movement
o
Chitin—used for structural support in the walls
of fungi and in external skeletons of arthropods o
Peptidoglycan—used for structural support in bacterial
cell walls
Examples of alpha helices and beta sheets
may be created using wire for the backbone
and yarn for the Hbonds; invite learners to
speculate on why alpha helix structures are
associated with storage polysaccharides
and beta sheets with structural
polysaccharides.
Teacher tip
Invite learners to compare the rigidity or structural integrity of plant matter or paper, a shrimp’s shell, and a mushroom. Explain that all these structures are formed from β sheets.
What are lipids?
How are lipids classified?
Lipids are a class of large biomolecules that are not formed through polymerization. They have diverse structures
but are all non-polar and mix poorly, if at all, with water. They may have some oxygen atoms in their structure
but the bulk is composed of abundant nonpolar C-H bonds. They function for energy storage, providing nine food
calories or 37 kJ of energy per gram. They also function for the cushioning of vital organs and for insulation.
Furthermore, they play important roles in plasma membrane structure and serve as precursors for important
reproductive hormones.
Lipids can be divided into three main
classes according to differences in
structure and function. Some notes on
their structures and functions are found
in the following table:
Classification
Functions
Str
Teacher tip
Fats
(triacylglycerols
or triglycerides)
•
energy
storage •
cushioning of
vital organs
(adipose
tissue) •
insulation
•
•
formed from dehydration reactions
between glycerol (an alcohol with
three Cs, each with an –OH group)
forming three ester linkages with
three fatty acids (16-18 Cs, with the
last C as part of a –COOH group) and
producing three molecules of water
component fatty acids (FA) may b e e
ithersaturatedor
unsaturated
o Saturated FA (e.g., palmitic acid)
have the maximum number of
hydrogen atoms bonded to each
carbon (saturated with hydrogen);
there are no double bonds between
carbon atoms o Unsaturated FA
(e.g., oleic acid) have at least one
double bond, H atoms are arranged
around the double bond in a cis
configuration (same side) resulting in
a bend in the structure
•
Saturated fat—animal products such as butter
and lard have a lot of saturated fatty acids. The linear
structure allows for the close packing of the fat molecules
forming solids at room temperature, diets high in these fats
may increase the risk of developing atherosclerosis, a
condition in which fatty deposits develop within the walls
of blood vessels, increasing the incidence of cardiovascular
disease
Fats or triacylglycerol formation may be
explained better using a diagram such as the one
below or through models patterned after a
similar diagram. You may ask the learners to
explain, in their own words, what they think is
happening and compare the formation of
carbohydrates with that of lipids.
•
Unsaturated fat—plant and fish oils have
unsaturated fatty acids. The bent structure prevents close
packing and results in oils or fats that are liquid at room
temperature. Homemade peanut butter has oils that
separate out of solution for this reason. Industries have Teacher tip
developed a process called hydrogenation that converts Demonstrate the effects of the straight chains of
unsaturated fats into saturated fats to improve texture saturated FAs on packing by piling together flat
spreadability.
structures like books or
•
Trans fat—may be produced artificially through
the process of hydrogenation described above. The cis
double bonds are converted to trans double bonds (H
atoms on opposite sides) resulting in fats that behave like
saturated fats. Studies show that trans fat are even more
dangerous to health than saturated fats to the extent that
they have been banned from restaurants in some
countries.
blackboard erasers and ask learners to compare this with the stacking or packing of irregularly shaped objects like partiallyfolded sheets of cardboard.
During discussion, invite the learners to find different kinds of fats in their food labels and decide on whether a particular food is healthier than another based on its fat content.
Misconception
Clarify the misconception that consuming fats is entirely dangerous for health. Fats are an essential part of a healthy diet when consumed in moderation.
48
Classification
Phospholipids
Steroids and
sterols
Functions
major component of
cell membranes
•
regulate
fluidity of cell
membranes
•
base of sex
hormones
•
emulsification of fats
during digestion
•
Structure
formed from dehydration
reactions between glycerol (an
alcohol with three Cs, each
with a –OH group), forming
two ester linkages with two
fatty acids (16-18 Cs, with the
last C as part of a –COOH
group) and a last linkage with a
phosphate group
•
phosphate group is
hydrophilic and is called the
‘head’ of the molecule
•
fatty acids are hydrophobic
and form the ‘tails’ of the
molecule
Examples
Phospholipids self-assemble
into bilayers when surrounded
by water and form the
characteristic
structure of plasma membranes
•
Cholesterol found in
cell membranes regulates the
rigidity of the cell
•
functional group
attached to the rings vary (if – OH is membrane and are the base
attached to the 4th C, then it is
material for the production of
called a cholesterol)
sex hormones like estradiol and
progesterone
•
characterized by a Cskeleton with four fused rings
Teacher tip
Phospholipid structure may be explained better
using a diagram such as the one below or through
models patterned after a similar diagram. You
may ask the learners to describe the diagram in
their own words and compare the structure of
fats with that of phospholipids.
Teacher tip
Steroid structure may be explained better using a
diagram such as the one below or through models
patterned after a similar diagram. You may ask
the learners to describe the diagram in their own
words and compare the structure of cholesterol
with that of other lipids.
ENRICHMENT (20 MINS)
Divide the class into groups. Instruct the learners to prepare the following materials that are needed for the
laboratory activity:
• eight glass droppers, medicine droppers, or caps
• ethanol solution
• 12 test tubes
• glucose solution flour
• test tube holders or tongs
• or cornstarch cooking
beaker
alcohol
lamp
• oil sample of
•
• Benedict’s solution iodine
• studentbrought food or
drink mortar and
• solution
pestle
•
•
Explain the following processes to the learners.
Benedict’s solution, a blue solution with CuSO4(aq), can detect the presence of reducing sugars (i.e., any sugar
with a free aldehyde or ketone group such as all monosaccharides and the disaccharides lactose and maltose).
When boiled, these sugars reduce Cu2+ in Benedict’s solution to produce a brickred precipitate of Cu2O(s).
Iodine test can be used to detect the presence of starch.
This activity may be done as a class if time does not permit for the activity to be done in separate groups. If Benedict’s solution is not
available, you may only perform the last two tests.
In the absence of laboratory grade chemicals,
you may improvise with storebought chemicals
like iodine and 70% ethyl alcohol for medical
use. Make sure to test the procedure before
performing the activity in the class.
Emulsion test can be used to identify fats.
Teacher tip
Prior to this lesson, instruct the learners to bring
recyclable materials that they can use for this
activity.
Learners should perform all three tests on the following samples:
• glucose solution (available in the baking section of grocery •
stores)
•
cooking oil
•
food or drink sample
flour or cornstarch solution that the learners
brought.
For solid samples, instruct the learners to mash a small portion of the sample in some water using the mortar
and pestle and then test the resulting solution. Ask the learners to prepare a table with appropriate headings in
which to record their results.
In discussing the results, ask the learners to conclude whether carbohydrates or lipids are present in their
samples. They may compare this with the list of ingredients for their food or drink sample. They can also list
possible sources of errors.
EVALUATION (20 MINS)
Divide the class into small groups. Provide the groups with different structures of lipids or carbohydrates and ask
them to create models using common or recyclable materials.
Ask the learners to explain or write a short description of their models. In grading the models, check to see if the
learners were able to create an accurate model of the assigned lipid or carbohydrate. Ask the learners, still in
their small groups, to create a short flowchart that will allow them to distinguish between the different kinds of
carbohydrates and lipids based on their structures. They may use this flowchart in answering the comprehension
questions that follow.
Provide different molecular structures of the following and ask the learners to identify whether these are:
•
•
monosaccharides
disaccharides
•
storage polysaccharides
• structural polysaccharides
• saturated fats
You may also ask the learners to give
one of the associated functions or
characteristics of the given
carbohydrate or lipid.
Teacher tip
The various carbohydrate structures were
obtained from the following electronic
resources:
•
•
•
commons.wikimedia.org
http://www.nature.com/pj/journal/v43/
n12/images/pj201196f3.jpg
http://chemwiki.ucdavis.edu/@api/deki/
files/522/260px-Cellulose_strand.jpg?
size=bestfit&width=352&height=310&r
evision=1
Images for the various lipid structures were
obtained from the following electronic
resources:
• https://upload.wikimedia.org,
• http://www.mikeblaber.org/oldwine/
BCH4053/Lecture13/triglyceride.jpg,
https://my.bpcc.edu/content/blgy225/
Biomolecules/phospholipid.gif
General Biology 1
LESSON OUTLINE
52
180 MINS
Amino Acids and Proteins
Pt. 1 of 2
Introduction
Review on the Genetic Code; Translation of
codons to corresponding amino acids
20
Motivation
Class activity on the Protein or Amino Acid
Alphabet
10
Content Standard
The learners demonstrate an understanding of the structure and function of
biomolecules (i.e., proteins).
Instruction/
Delivery
Lecture-discussion on the different levels of
protein structure (i.e., primary, secondary,
tertiary, and quaternary
60
Performance Standard
The learners shall be able to construct a three-dimensional model of proteins using
computers (i.e., computer generated models) or recyclable materials (i.e., physical
models).
Practice
Class activity on paper models of the different 15
protein helix types
Enrichment
Constructing of physical or computergenerated 15
protein models; Identification of surface
features of proteins (e.g., hydrophobic
patches, positively or negatively charged
domains, etc.)
Evaluation
Examination and Model Accuracy Evaluation
Learning Competencies The learners:
•
•
•
categorize the biological molecule (i.e., protein) according to their structure and
function (STEM_BIO11/12-Ii-j-15)
explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12-Ii-j-16)
determine how factors such as pH, temperature, and substrate affect enzyme or
protein activity (STEM_BIO11/12-Ii-j-19)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
discuss the different levels of protein structure (i.e., primary, secondary, tertiary,
and quaternary)
discuss how protein structural features may influence their interactions
discuss how protein structural features may influence their functions
INTRODUCTION (20 MINS)
Materials
recyclable materials for construction of protein models,
software for molecular modelling (available for free download)
Resources
(1) SwissPDB Viewer software (available for free download)
(2) Protein Data Bank (can be accessed at www.db.org
Communicate learning objectives and important terms
1. Review the Genetic Code. In particular, have the learners translate codons to their corresponding amino
acids.
2. Stress the importance of how
mutations may alter the type of
60
amino acid coded by a given sequence.
3. Discuss how some mutations may be ‘silent’.
4. Discuss how some mutations may be considered ‘conservative’ (e.g., AA changed to another with a similar
functional group type) or ‘non-conservative’ (e.g., AA changed to another with a different functional group
type).
5. Discuss the importance of the translation reading frame. Stress how frameshift mutations may lead to
changes in the amino acid sequence translation as well as changes in the termination of the protein.
MOTIVATION (10 MINS)
1. Instruct the learners to spell out their names using the amino acid single letter codes (e.g., NEIL).
2. Next, instruct them to spell out their names using the amino acid triple letter codes (e.g., Asn-GluIle-Leu).
3. Then have the learners find codons that can correspond to these amino acid sequences.
INSTRUCTION/DELIVERY (60 MINS)
1. Discuss the basic amino acid structure. Discuss how these amino acids may be linked by peptide bonds to
form polypeptides sequences.
2. Group the amino acids in terms of their functional group properties. The amino acids may be polar (i.e.,
acidic or basic) or non-polar.
3. Highlight amino acids with special properties (e.g., Cysteine for disulfide bond formation; Tyr, Trp, and Phe
for their aromatic rings and fluorescent character; Proline for its effect on the protein backbone).
4. Discuss how the amino acid sequence is the primary structure of the protein.
5. Discuss how properties in the primary structure (e.g., placement of hydrophobic residues, charged groups,
and disulfide bridges) define the higher level structures of the protein. Show how interactions between
complementary sections of polypeptide chains may lead to the formation of helices or sheets.
Teacher tip
Prepare a genetic code table. Teach the learners how to use the genetic code table to translate an mRNA sequence.
Clarify the misconception on mutations in the mRNA sequence. Stress how not all mutations in the mRNA sequence may lead to changes
in amino acid sequence.
54
Teacher tip
Prepare an Amino Acid Alphabet table. In the
table, provide respective columns for one-letter
and three-letter codes for each amino acid.
Present the Genetic Code table with the Amino
Acid Alphabet table so that the learners can use
them in the translations.
6. Discuss the common secondary
structures of proteins (i.e., helical
and sheet-like structures).
7. Discuss the different helical types
(3-10 helices, alpha helices, and pi
helices). Show how these different
types are based on which residues
are bound by hydrogen bonds or
how many atoms are included in
the helices hydrogen bonding
network.
8. Show how some proteins are
composed of combinations of the
secondary structures in differing
ratios.
9. Discuss how the arrangement of
the secondary structures in these
proteins may lead to the formation
of functional regions (e.g., active
sites).
10. Discuss how protein functions may
involve the interaction of several
proteins in what is known as
quaternary associations (e.g.,
protein complexes for signal transduction).
PRACTICE (15 MINS)
Instruct the learners to construct paper models of helical structures.
Paper models may be made to represent structures such as the 3-10 helix and the alpha-helix. This would
require the drawing of polypeptide chains on paper, and the folding of the paper ensuring that the peptide bonds
are kept planar. The linkage of the appropriate amide protons (NH) with the appropriate C=O group will create
models of the proper dimensions (i.e., angle and width). This is based on the classic experiment by Linus Pauling
on the discovery of the alpha helix.
Teacher tip
A video on the discovery of the alpha helix using
paper models is available on the internet. This
video features Dr. Linus Pauling himself
describing the general steps in creating an alpha
helix paper model.
Teacher tip
Familiarize yourself with the features of the
molecular viewer. SwissPDB Viewer allows you
to select amino acids of certain types (e.g.,
hydrophobic residues).
ENRICHMENT (15 MINS)
Prior to this lesson, the learners may generate computerized protein models and bring them to class. Also,
software on molecular viewers should be downloaded from the internet. These software, such as the SwissPDB
Viewer, can be downloaded for free. Sample protein structures may be downloaded from the Protein Data Bank
that can be accessed at www.pdb.org.
Determine the surface features of the observed protein (e.g., hydrophobic areas, charged areas). If a protein with
an active site and a bound ligand is chosen (eg., PDBID _____),then the location of the active site and the nature
of the protein-ligand interaction may be explored.
EVALUATION (60 MINS)
Conduct an examination to assess the learners’ knowledge and understanding of the discussions.
Teacher tip
Note that signal transduction pathways commonly involve quaternary protein structures.
The maintenance of proper interactions in these structures is necessary to produce the desired functions.
Dysfunction in these associations is commonly associated with disease. Some current cancer diagnostic kits target mutations that may
disrupt the proper association of proteins in these complexes.
Teacher tip
These may be colored or labelled to show their
positions in the protein. The position of
hydrophobic patches and charged surfaces in
proteins can signify areas of potential
interaction.
General Biology 1
Amino Acids
and Proteins
Pt. 2 of 2
Content Standard
The learners demonstrate an
understanding of the structures and
functions of biological molecules (i.e.,
carbohydrates, lipids, nucleic acids, and proteins)
Performance Standard
The learners shall be able to identify key structural features of biological molecules that are important for their
functions (e.g., 5’ and 3’ OH of DNA, 2’ OH of RNA, complementary base pairing, N and C termini of proteins, R
groups of the different amino acids, etc.).
Learning Competencies The learners:
•
•
•
•
categorize the biological molecules (e.g., DNA, RNA, proteins) according to their structure and function
(STEM_BIO11/12- II-j-15)
explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12 -II-j-16)
explain oxidation/reduction reactions (STEM_BIO11/12- II-j-18)
determine how factors such as pH, temperature, and substrate affect enzyme or protein activity
(STEM_BIO11/12 -II-j-19)
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
Instruction/
Delivery
Lecture-discussion on the main functi
important physical properties of biom
Practice
Exercise on translating coding to non
sequences
Enrichment
Practice exercise on translating codin
into mRNA transcripts and mRNA tran
polypeptide sequences.
Evaluation
Practice exercises on
identif
biomolecules based on given chain
identification of important structura
the chain structures, and generating
sequences
(DNA), transcripts (RNA) and polypep
learners’ understanding of the topics
Materials
recyclable materials for construction of
models of biological molecules,
software for molecular modelling
(available for free download)
discuss key structural features of DNA, RNA, and proteins
discuss structural and functional differences between DNA and RNA
discuss the different levels of protein structure (i.e., primary, secondary, tertiary, and quaternary)
discuss how protein structural features may influence their functions
60 MINS
LESSON OUTLINE
Introduction
Motivation
Resources
Review on Cell and its organelles; Discussion and
illustrations of the Central Dogma of Molecular
Biology
5
Class activity on the important functions of
biological molecules`
5
(1) SwissPDB Viewer software (available for
free download)
(2) Protein Data Bank (can be accessed at
www.db.org
56
Teacher tip
INTRODUCTION (5 MINS)
1. Facilitate a review on the cell and its organelles. Emphasize that the specific functions for each organelle type
are compartmentalized and that the functions of each organelle are defined by its physical properties.
2. Explain to the learners that the lesson will focus on understanding the important physical properties of
certain biomolecules (i.e., DNA, RNA and proteins) and how these properties allow the biomolecules to serve
specific functions within the cell.
3. Discuss the Central Dogma of Molecular Biology: DNA
RNA
Protein
Relate the Central Dogma of Molecular Biology
to real world situations.
For example, in cooking, the cook book functions
like the DNA (Genome). The specific recipe
functions like the mRNA while the desired dish is
the protein.
Provide two more examples of everyday life
activities that can illustrate the Central Dogma
of Molecular Biology.
MOTIVATION (5 MINS)
Teacher tip Note the following expected
1. Divide the class into groups and instruct them to identify or enumerate the most important functions of DNA,
RNA, and proteins.
responses:
2. Consolidate the learners’ responses on the board.
•
•
INSTRUCTION/DELIVERY (30 MINS)
Elaborate on the main functions of the biomolecules:
•
•
•
•
DNA—is the repository of genetic information
RNA—serve as the transcripts and regulators of expressed genetic information
Proteins—are the functional products and executors of cellular functions
Biomolecule
DNA
Physical Property
Functional Relevance
Complementary Base Pairs
Allows each strand to serve as a template for replication and
transcription
Phosphodiester bonds
Essential for polynucleotide chain elongation
Deoxyribose 5’OH
Start of the polynucleotide chain
DNA—repository of genetic
information
RNA—transcripts and
regulators of expressed genetic
information
protein—functional products and
executors of cellular functions
Deoxyribose 3’OH
“End” of the polynucleotide chain
Connection point for extending the chain
74
58
Biomolecule
RNA
Protein
Physical Property
Functional Relevance
Deoxyribose 2’H
Difference between the sugar residues of DNA (deoxyribose) and
RNA (ribose)
Complementary Base Pairing
Allows RNA to serve as transcripts (mRNA) and translators (tRNA)
of genetic information from DNA.
Uracil
Nitrogenous base equivalent to T in RNA.
Ribose 2’OH
Difference between the sugar residues of DNA (deoxyribose) and
RNA (ribose)
Limits the compaction of RNA molecules.
Double stranded RNA molecules are similar in structure as the Aform of DNA
N-Terminus
Start of the polypeptide chain
C-Terminus
End of the polypeptide chain
Addition point for new amino acids during polypeptide growth
Peptide Bond
Links Amino Acids Planar
character
Phi Angle
Angle between: Ci-1-Ni-Cαi-Ci
Ci-1 : Carbonyl C of previous AA
Ni : Amide Nitrogen of current AA
Cαi: Alpha Carbon of current AA
Ci : Carbonyl C of current
AA
Angle is observed by looking down the bond between Ni and Cαi;
coming from the N-terminus of the polypeptide
Teacher tip
Use computer modelling software like SwissPDB
Viewer to illustrate the basic structures of DNA,
RNA, and Proteins (Polypeptides).
The basic structures for these biomolecules are
available as molecular structure files (*.pdb) from
the Protein Data Bank that can be accessed at
www.pdb.org.
Focus on the important parts of the structure
that provide the necessary physical properties of
DNA, RNA, and Proteins.
Discuss the relevance of these physical features
for the functions of DNA, RNA, and Proteins.
60
Biomolecule
Physical Property
Functional Relevance
Teacher Tip:
The correct response is:
Psi Angle
Angle between Ni+1-Ci-Cαi-Ni
Ni+1 : Amide Nitrogen of succeeding AA
Ci : Carbonyl C of current
AA
Cαi: Alpha Carbon of current AA
Ni : Amide Nitrogen of current AA
Complementary Non-coding/ sequence:
3’ TACGTATCTAATCCTATAGGGTCTATC 5’
Be sure to note the antiparallel orientation of the
coding and non-coding strands of the DNA. Note
the relative positions of the 5’ and 3’ ends.
ENRICHMENT (5 MINS)
Angle is observed by looking down the bond between Ci and Cαi;
coming from the C-terminus of the polypeptide
Amino Acid R-Groups
Defines Amino Acid Character
i. aliphatic
Coding sequence ~ mRNA transcript: 5’
AUGCAUAGAUUAGGAUAUCCCAGAUAG
3’
ii.
aromatic
(Y,W,F)
b. polar, uncharged
(S,T,C,P,Q)
Table 1: Important Physical Properties of Biomolecules
PRACTICE (5 MINS)
Given the following coding sequence for DNA, provide the sequence of the complementary (template) sequence.
Coding sequence:
Complementary Non-coding / Template
sequence: 3’
TACGTATCTAATCCTATAGGGTCTATC 5’
2. Translate the given mRNA transcript
into a polypeptide sequence:
a. non-polar
(G,A,V, L, I, M)
Convert the given coding sequence into
an mRNA transcript:
5’ ATGCATAGATTAGGATATCCCAGATAG 3’
EVALUATION (10 MINS)
Ask the learners to identify the type of biomolecule represented by a given chain structure:
•
DNA
•
RNA
•
Protein
General Biology 1
You may ask the learners to identify the important structural features in these chain structures. The features are
listed in Table 1 in the Instruction/ Delivery section of this Teaching Guide.
A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and translated polypeptides may
be performed to test the learners’ understanding of the topic.
Teacher tip
The correct responses are the following:
For no. 1, the coding sequence ~ mRNA
transcript is
5’
AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
For no. 2, the polypeptide sequence is
3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’
5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
Biological
Molecules:
Enzymes
Content Standard
The learners demonstrate an
understanding of enzymes and of the
factors affecting enzyme activity.
Performance Standard
The learners shall be able to explain the
role and significance of enzymes in
biological systems.
N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
Note that the mRNA transcript has almost the same sequence as the coding sequence (DNA), but the Thymines are converted to Uracil.
Learning Competencies The learners:
•
Teach the learners how to read the Codon Table.
•
Teach the learners the single letter codes for the amino acids (e.g., Tryptophan Trp W).
Instruct the learners to spell their names using the amino acid codes (e.g., N-E-I-L Asn – Glu – Ile – Lue).
Teacher tip
describe the components of an
enzyme (STEM_BIO11/12-Ii-j-17)
determine how factors such as pH,
temperature, and substrate affect
enzyme activity (STEM_BIO11/12-Iij-19)
For example:
Specific Learning Outcomes
At the end of the lesson, the learners
shall be able to:
Template sequence
•
Worksheets with partially-completed sequences may be used to help the learners practice the generation of complementary sequences.
62
present a model demonstrating the
components of a specific enzyme in
•
a biological system and the reaction it catalyzes
design a simple experiment that illustrates how pH, temperature, or amount of substrate affect enzyme
activity (i.e., includes problem statement, hypothesis, materials and methods)
150 MINS
LESSON OUTLINE
INTRODUCTION (5 MINS)
Introduce the following learning
objectives using any of the suggested
protocols (e.g., verbatim, own words, or
read-aloud):
•
Introduction
Motivation
Presentation of objectives and terms; Brief
discussion on thermodynamics or protein
structure
5
Illustration and explanation of enzymatic
browning in bananas
5
•
Instruction/
Delivery/
Practice
Small-group and class discussion on definition 60
of enzymes, its structure, and function
Enrichment
Laboratory activity on the work of enzymes
using raw liver as a source of catalase and
hydrogen peroxide as the substrate
60
Evaluation
Group activities on creating models of
enzyme-catalyzed reactions and designing of
a simple experiment on enzyme activity
20
Materials
projector, computer, recyclable materials for making models of enzyme-catalyzed reactions.
Resources
(1)
Reece, J.U. (2011). Csmpbell Biology, 9th ed. San Francisco, CA:
Pearson Benjamin Cummings.
I can describe the components of an
enzyme.
I can determine how factors such as
pH, temperature, and substrate
affect enzyme activity.
Introduce the list of important terms
that the learners will encounter:
•
•
•
•
•
•
•
•
•
•
•
enzyme
catalyst
activation energy
substrate
enzyme-substrate complex
active site
induced fit
cofactor
coenzyme
competitive inhibitor
noncompetitive inhibitor
MOTIVATION (5 MINS)
Connect the lesson to a real-life
problem or question.
While the learners are coming in and
settling down in the classroom, show
them that you are cutting a banana into
small pieces on a plate. After the introduction, you can show the learners the plate of banana pieces. Instruct
them to pass it around and share their observations.
The following could be expected answers:
• The banana’s covering is brown.
• The banana’s texture is mushy.
• The banana looks spoiled. • The banana is smelly
• The banana is soft.
Teacher Tip:
Prominently display the learning objectives and important terms prominently on one side of the classroom and frequently refer to them
during discussion. You may place a check-mark beside a term in the wordlist after defining it so that the learners have an idea of their
progress.
•
Another way of incorporating lists of important terms is to have the words placed in a blank bingo card grid. Learners can write a short
definition or description of the term under the entry in the bingo card to block out a square. This may serve as the learners’ reference
guide or method of formative assessment.
not always unwanted. The browning
reaction contributes to the
desirable color and flavor of raisins,
prunes, coffee, tea, and cocoa.
Although enzymatic browning
causes changes in flavor and taste
(i.e., bitter, astringent) and may
reduce quality, the browning agents
formed are not toxic. Brown fruits
are safe to eat up to a few hours
after cutting.
Knowing the mechanism behind
this, Arctic Apples, a Canadian
company, produced
geneticallyengineered apples that
will not brown for 15-18 days.
INSTRUCTION/DELIVERY/PRACT
ICE (60 MINS)
Teacher Tip:
You may opt to divide the class into groups of twos or threes to facilitate sharing of observations and insights. You may call on two to
three groups to share their observations if there is limited time for presentations.
Ask the learners if they can explain why the bananas have turned brown and mushy. Challenge the learners to
think of ways to slow down the process of browning. Expected answers could be not to cut the banana, keep the
banana cold, or keep the banana in an airtight container.
Provide the learners with the following explanation:
•
•
Peeling, bruising, or cutting fruits cause them to release enzymes like polyphenol oxidase (PPO, phenolase)
that, with the presence of oxygen in the surrounding air, goes into chemical reactions of plant compounds.
These chemical reactions produce brown pigments through the process of enzymatic browning.
Enzymes—are organic substances that accelerate the rate of chemical reaction. Enzymatic browning can be
a significant problem because it limits the shelf life of fruits and vegetables. However, enzymatic browning is
64
Recall previous lessons on the laws of
thermodynamics, spontaneity of
reactions, and carbohydrate structure
through a scenario.
•
•
Scenario: Is the hydrolysis of starch
to maltose a spontaneous reaction?
What information do you need to
answer this question?
Expected response: Question may
be answered with the given
information since we are familiar
with hydrolysis and the structures
of starch and maltose. The
reactants have higher levels of free
energy compared to the products, making this a spontaneous reaction.
• Follow-up questions: If this is so, why will a sterile starch solution sit for years at room temperature without
significantly hydrolyzing? Can you think of ways to hydrolyze starch more quickly?
Teacher Tip:
Figure 1 (on the right): Energy profile for a
spontaneous exergonic reaction: AB+CDAC+BD
(Source: Reece, J. U (2011 ).
Campbell Biology, 9th ed. . San Francisco, CA:
Pearson Benjamin Cummings)
If pressed for time, No. 1 can be done as part of the Motivation with soda crackers or plain biscuits (that is mostly composed of starch) as
an example. Moisten the cracker with water and place it in a visible area. Compare the time it takes for a similarlysized piece of cracker to
break down inside a learner’s mouth. Remind the learner not to chew the cracker.
Teacher Tip:
If available, amylase and Benedict’s solution may be used to test for the presence of simple sugars.
A visual aid may be used to show the contortion.
For example, a string of paper clips or a bunch of
keys on a key ring can stand for starch. The
contortions involved in detaching one paper clip
or removing one key can serve as analogies for
the process.
Numerous chemical reactions support life. The regulation of these reactions may take place in two major ways:
• through the use of enzymes
• through the regulation of genetic material (This which will be discussed later.)
Proceed to the lecture proper.
• Can you imagine what would happen if it takes many years for our body to hydrolyze the starch in the food
that we eat? Starchy food comprises an important part of our diet and our bodies use enzymes called
amylase to quickly hydrolyze starch into simple sugars.
Teacher Tip:
•
•
•
•
•
What are enzymes?
Enzymes are organic or biological catalysts. Catalysts are substances that speed up a reaction without being
used up, destroyed, or incorporated into the end product. They are vital to the regulation of the metabolic
processes of the cell. Many enzymes are proteins. We will focus on this type of enzymes in this discussion.
RNA enzymes called ribozymes will be discussed later.
What keeps spontaneous reactions from occurring more rapidly?
All chemical reactions between molecules involve the breaking and forming of bonds. Converting starch into
glucose involves contorting starch into a highly unstable state before the reaction can proceed. This unstable
state is called the transition state that happens when reactants absorb energy from their surroundings and.
This initial investment of energy in order to start a reaction is called the activation energy. It is often supplied
as thermal energy or heat absorbed by reactants from their surroundings. Reactant molecules absorb heat
which causes them to collide more frequently and more forcefully. This agitates the atoms within the
molecules that results in the likely breaking of bonds.
When the new bonds of the products form, energy is released as heat and the molecules return to stable
shapes with lower energy. This results in an overall decrease of free energy.
To illustrate the concept of activation energy,
pushing a toy car or marble up a makeshift ramp
will also help concretize the concepts of
activation energy and transition state.
•
The reaction shown in Figure 1 is spontaneous but the activation energy provides a barrier that determines
the rate of the reaction. Reactants have to absorb enough energy from their
environment to surmount this barrier before the reaction can proceed.
•
Teacher tip
Knowing this, how can you cause reactants to absorb more energy from their environment? Relate the discussion
with the hypothetical reactions in Figures 1 and 2.
How do enzymes affect reactions?
Heat speeds up reactions. This is inappropriate for biological systems because it denatures proteins, kills cells, and
speeds up all reactions, not just those that are needed. Enzymes catalyze specific reactions by lowering the
activation energy barrier and allowing the reactant molecules to absorb enough energy at moderate
temperatures. Enzymes cannot change the !G for a reaction and can only hasten reactions that would eventually
occur anyway.
View Part I of the animation at http://www.sumanasinc.com/webcontent/animations/content/enzymes/
enzymes.html. Click on ‘Show Narrative’ to reinforce the aforementioned concepts on spontaneous reactions. Ask
the learners to answer the following questions and call on a small group to explain their responses using their own
words:
•
•
What is the activation energy of a reaction?
How do enzymes affect the activation energy of a reaction?
Enzyme structure and function
66
View http://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/
animation__how_enzymes_work.html. Click on ‘Text’. Ask the learners to answer the following question and call
on a small group to explain their responses using their own words:
On a molecular level, how does the shape of an enzyme enable it to perform its function? Use
following terms in your responses: ‘active site’, ‘substrate’, ‘enzyme-substrate complex’, and
‘product’.
the
The active site and functional groups of its amino acids may lower activation energy by:
•
•
•
•
acting as a template for substrate orientation
stressing the substrates and stabilizing the transition state
providing a favorable microenvironment
participating directly in the catalytic reaction
View http://www.wiley.com/college/boyer/0470003790/animations/enzyme_binding/ enzyme_binding.htm.
Click on ‘Binding Models’. Ask the learners to answer the following questions and call on a small group to
explain their responses using their own words:
•
•
How does the shape of an enzyme enable it to perform its
function?
What is the difference between Emil Fisher’s lock-and-key model
and Daniel Koshland’s induced-fit model? Describe the current
model.
Factors that affect enzyme action
Given what the learners know about enzyme action, ask them to predict how the following factors will affect
the action of an enzyme by completing the table below. This may be done by group or by the class as a whole.
If the entire class is involved, invite a small group to fill in each row. Table 1: Factors that affect enzyme action.
View
http://moleculesoflife2010.wikispaces.c
om/file/view/Enzyme+Model.swf and
test the hypotheses using controlled
simulations. You may need to use a
timer to assess reaction rates. Do your
results agree with your predictions?
How were they similar? How were they
different?
Provide constructive feedback and clarify the reasons for the observed changes to reaction rates and enzyme
function.
Teacher tip
The video links provided here may be given as a pre-lecture assignment to stimulate prior knowledge and give the learners an idea of the
topics to be discussed.
If a computer is not available, you may ask the learners to answer the questions based on your discussion. Provide constructive feedback
and correct misconceptions. You may use models or analogies to better illustrate the concepts. Here are some suggestions: • a
handshake to demonstrate induced fit
• two pieces of a jigsaw puzzle to illustrate components of a substrate
• roleplay to show the interactions between enzymes and substrates
•
•
•
pH as a factor: acid solution,
alkaline solution, and litmus paper
amount of substrate: droppers
small test tubes or medicine caps
Explain that many living tissues contain
catalase or peroxidase that catalyzes
the reaction conversion of H2O2 → H2O
+ O2.
Cut the liver into equal-sized cubes and
demonstrate the effect of placing the
Clarify the misconception that enzymes only function in catabolic reactions or breaking down of substances. This misconception may be
liver in a 2mL solution of hydrogen
due to the learners’ first encounter of enzymes in the context of digestion. Enzymes also catalyze other types of reactions. For example,
DNA polymerase facilitates the addition of nucleotides to a polynucleotide chain.
peroxide. Evolution of gas (i.e.,
View http://web.biosci.utexas.edu/psaxena/MicrobiologyAnimations/Animations/Enzyme-Substrate/micro_enzyme-substrate.swf. Ask the learners to
answer the following question and call on a small group to explain their response in their own words:
What is the difference between a competitive and noncompetitive inhibitor?
The presence of non-protein helpers called co-factors and of organic molecules like co-enzymes may activate apoenzymes to produce holoenzymes by
binding to their active sites. Common examples may be found in popular supplements such as ions of iron, copper, zinc, or in vitamins like vitamins A, C, and
B-complex.
Enzyme regulation and metabolic control
View http://usmanscience.com/12bio/enzyme/enzyme_animations.htm. Click on ‘Allosteric Enzymes’ and ‘Feedback Inhibition’. Ask the learners to answer
the following questions and call on a small group to explain their responses in their own words:
What are allosteric enzymes?
Feedback inhibition regulates metabolic pathways that use more than one enzyme. How does feedback inhibition work?
ENRICHMENT (60 MINS)
Facilitate a laboratory activity on investigating the work of enzymes using raw liver as a source of catalase and
hydrogen peroxide as the substrate. Learners may be provided with the following:
•
temperature as a factor: ice water bath, water bath at room temperature, warm water bath
68
bubbling) will be observed. Groups of
learners may prepare solutions that
they can test using the different factors.
Instruct the learners to rank the different solutions based on the rates of reactions.
Teacher tip
This activity may be done as a class if there is not enough time to perform the laboratory work individually or in groups. You may perform
the test on all three factors or you may choose only one or two.
EVALUATION (20 MINS)
Making models of enzyme-catalyzed reactions
1. Divide the class into small groups.
2. Distribute different examples of important enzyme-catalyzed reactions to the groups.
3. Ask the groups to create models using common or recyclable materials and label the following components:
enzyme, substrate, product, and active site.
4. Ask the learners to demonstrate how this enzyme works.
Written Task
1. Divide the class into small groups.
2. List the materials for Enrichment (See previous section).
3. Ask the learners to design their own experiment in order to explore the effect of one factor on enzyme
activity. Explain that the experimental design should include:
•
•
•
•
•
a testable hypothesis
complete list of dependent and independent variables
complete list of controlled variables
logical procedure in a flowchart format
short and accurate explanation of what you expect to happen and why •
sufficient replicates
Teacher tip
Before this session, inform the learners that they will be making models of enzymecatalyzed reactions next meeting and ask them bring
recyclable materials that they can use for this activity.
In grading the models, check to see if the learners were able to label the parts correctly. Demonstrate that the substrate goes into the
active site, gets contorted and moves out as a product. Check if the substrate and the products are consistent with the reaction being
modeled (e.g., anabolic, catabolic, or recombination)
General Biology 1
Photosynthesis and
Cellular Respiration
Content Standard
The learners demonstrate an understanding of photosynthesis and cellular respiration
Describe the major features and chemical events in photosynthesis and cellular respiration
(STEM_Bio11/12-IIa-j-1)
Enrichment
Similarity of photosynthesis and cellul
respiration and connecting the concep
biological systems
Evaluation
Summary of the major events of
photosynthesis and cellular respiratio
(2) Mader, Sylvia S. (2010). Biology 10th Edition. USA:
McGraw-Hill
(3) Solomon, Eldra P. et al., (2008). Biology 8th
Edition. China: Thomson Brooks/ Cole
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
Show the overall equations of photos
cellular respiration
Resources
(1) Alumaga, Maria Jessica B. et al., (2014). Science
and Technology 9. Quezon City: Vibal Publishing
House
Learning Competency The learners:
•
Instruction/
Delivery
(4) www.biologycorner.com accessed July 19, 2015
functionally define photosynthesis and cellular respiration;
identify the reactants and products of photosynthesis and cellular respiration;
differentiate the major chemical events of photosynthesis and cellular respiration; and
summarize in a form of illustration or diagram the similarity in the organization of chloroplast and
mitochondrion in carrying out photosynthesis and cellular respiration, respectively.
Suggested Media Tools
•
•
•
240 MINS
LESSON OUTLINE
5
Introduction
Communicate to the class the oxidationreduction and the flow of energy
Motivation
Post questions on the board and ask the
5
students to identify the processes involved in energy
transformation
www.mhhe.com/maderbiology11
www.masteringbiology.com
www.biologycorner.com
For animations, video, learning outcomes, chapter
outline, image PowerPoint, essay quiz, thinking
critically, practice test and concept maps:
• http://highered.mheducation.com/sites/00734
03466/student_view0/
chapter7/image_powerpoint.html
• http://highered.mheducation.com/sites/00735
25502/student_view0/ chapter7/index.html
INTRODUCTION (5 MINS)
Review with the class that oxidationreduction (redox) reactions involve
electrons passing from one molecule to
70
another. Oxidation (also splitting) is the loss of electrons while reduction is the gain of electrons. You can show
this picture to your students and try to ask questions so that you can generate critical-thinking skills from them.
To help them visualize the concept, a diagram of redox reactions is also shown below. Ask your students which
organisms (in the picture below) photosynthesize and which respire (take note that plants both photosynthesize
ad respire at the same time). Then show the equation of redox reactions after your students have given their
responses. You may also ask examples of oxidation reactions (e.g., browning of peeled potato, banana, and
eggplant). For redox reactions examples are rusting of iron, burning of combustible material (e.g., wood, coal,
etc.)
Emphasize that the flow of energy starts with the
sun. There are two organelles that participate in
the energy flow from the sun through living
things. You can now motivate your students by
posting two questions relating to energy
transformation. Redox reactions is one type of
chemical reaction.
NOTE: Energy transformation (e.g., photosynthesis and cellular respiration is one of the difficult topics in
biology. To capture the general picture of the topic, students have to be encouraged to read and reread the key
concept, write and re-write, outline and re-outline, draw and re-draw, and to recite orally if they want the ideas
to sink in their system. Patience and steadfastness are important virtues that should be included as you study
this concept.
Remember that plants both photosynthesize and
do on aerobic respiration.
Emphasize to students the importance of
understanding the processes rather than
memorizing all the various reactions.
The following are some of the practical examples
of photosynthesis:
1. Photosynthesis helps create food chains or
food web (Note: Most modern scientists prefer
the latter because it portrays the accurate
interactions of several organisms in the
environment. The interactions make possible the
production and perpetuations of the living
creatures. Most life forms directly or indirectly
depend on plants for their basic metabolism.
Ultimately, materials from producers, herbivores,
omnivores and carnivores will be consumed by
decomposers (e.g., bacteria). These bacteria
produce waste products that increase the
nutrient content of the soil.
Teacher Tip: Note: This lesson merely describes the major features of (or an overview) photosynthesis and cellular respiration. A more
detailed concept and deeper explanation will be presented in another set of learning competencies.
Countless chemical reactions are occurring in cells to do essential life functions with the help of ATP as the
energy currency of the cells. Ask your students what are the tasks of ATP. The following are the answers:
1. Chemical work: ATP is used for building macromolecules
Teacher tip
Suggested answers:
1. Through photosynthesis 2.
Through cellular respiration
2. Transport work: ATP is used for transporting ions membranes
3. Mechanical work: ATP is used for mechanical processes such as muscle contraction, cilia movement
For additional information, tell the class that ATP is also involved in rigor mortis—a temporary stiffness of the
body that happens soon after death of a person.
B.
1. Groups that go in: Carbohydrate, oxygen and
38 ADP molecules 2. Groups that are released:
Carbon dioxide, water and 38 ATP molecules
MOTIVATION (5 MINS)
Post these two questions on the board. Ask them to identify the process involved in each question so that food
is manufactured and energy is released.
•
•
•
Which groups are released?
•
Chemical reactions for
cellular respiration:
C6H12O6 + 6 O2 + about 38 molecules of
ADP
6 CO2 + 6 H20 + about 38
molecules of ATP
How do plants harness light energy to manufacture food?
How do living organisms harness energy from food?
Then show to them the overall equation for each process as follows:
•
A.
1. Components that are utilized: Carbon dioxide,
water, sunlight (and chlorophyll can be
mentioned) 2. Groups that come out:
Carbohydrate (glucose) and oxygen
•
Which groups participate in
the reaction?
•
Which groups are released?
Chemical reactions for photosynthesis:
6 CO2 + 6 H20 + sunlight
•
C6H12O6 + 6 O2
Which groups participate in the reaction?
Thus, plants are able to produce macromolecules (e.g., carbohydrates, proteins, fats and nucleic acids) and sustain other cellular
activities because of the participation of the soil, nutrients, water, carbon dioxide, chlorophyll and sunlight as preparatory materials for
the synthesis of carbohydrates and oxygen.
Photosynthesis and bioenergy. The plant materials and animal wastes are used especially as a source of fuel.
72
INSTRUCTION/DELIVERY (145
MINS)
1. You can draw pictures of
photosynthesis and cellular
respiration in Manila paper if LCD is
not available. You can also go to
computer/printing shop and make
these pictures into tarpaulin for
long use.
•
2.
3.
4.
5.
•
•
Sample picture of Overview of Photosynthesis, Overview of the Stages of the Calvin Cycle in
Photosynthesis, Overview of Glucose Breakdown, and Overview of ATP Yield per Glucose Molecule
may be viewed at Biology 10th Edition by Mader, Sylvia S. (2010) (Retrieved July 20, 2015)
Group your students into triad according to their learning skills. Give each member accountability task to
promote mutual cooperation.
Give them questions to answer for discussions. Tell them to prepare and bring out their Manila paper and
markers.
Have them report orally to the class.
Alternatively, if the class will not be able to report reliably, roleplaying, laboratory activities, or simulations
involving computer-aided activities such as the ones found in the following sites:
http://www.reading.ac.uk/virtualexperiments/ves/preloader-photosynthesis-full.html
http://www.pbs.org/wgbh/nova/nature/photosynthesis.html
Processing Questions:
7. About how many ATP molecules does a cell obtain from the breakdown of one molecule of glucose in cellular
respiration?
8. Given the glucose, carbon dioxide and water, which one(s) is/are called high-energy molecule and which
one(s) is/are called low-energy molecule?
Suggested Answers:
1. Light-dependent reaction and light-independent reaction (also known as Calvin cycle reaction or carbon
fixation reaction).
2. The basic stages of Calvin cycle reaction are: carbon dioxide fixation, carbon dioxide reduction, RuBP
regeneration.
3. Reactants: carbon dioxide and water; products: carbohydrates and oxygen
4. Glycolysis happens in the cytoplasm of the cell; citric acid cycle (Krebs cycle) and ETC are in the
mitochondrion of the eukaryotic cell.
5. In cellular aerobic respiration: three; in anaerobic respiration: one
6. Reactants: carbohydrates, oxygen, and about 38 ADP molecules; products: carbon dioxide, water and about
38 ATP molecules
1. What are the two kinds of reactions
in photosynthesis?
2. What are the basic stages of the
Calvin cycle?
3. What are the reactants and
products of photosynthesis?
4. In which part of the cell glycolysis
happens? What about the citric acid
cycle and electron transport chain?
5. How many metabolic pathways are
there in cellular aerobic respiration?
In anaerobic respiration?
6. What are the reactants and
products of cellular respiration?
7. About 36 to 38 ATP molecules (NOTE: This number is just a ratio. Some biology authors say there are 30, 32
or 34 ATP molecules produced depending on the shuttle used to transport the electrons and on the kind of
species.)
8. High-energy molecules: glucose; low-energy molecules: carbon dioxide and water
Directions:
Fill-in the two tables below for the major events and features of photosynthesis and cellular respiration,
respectively. The option tables are given for you to answer the needed materials and end products of
photosynthesis and cellular respiration.
Major Events and Features of Photosynthesis
Reaction Series
Needed Materials
End Products
1. Light-dependent reactions (take
place in the thylakoid membrane) a.
Photochemical reactions
b. Electron transport
c. Chemiosmosis
a.
a.
b.
b.
c.
c.
2. Carbon fixation reactions (take
place in stroma)
2
2
b. NADPH, O2
c. Light energy;
pigments (chlorophyll)
d. ATP
f. Proton gradient, ADP
+ P, ATP synthase
g. Carbohydrates, ADP +
P, NADP+
h. Ribulose bisphosphate, CO2,
ATP, NADPH, necessary
enzymes
Available Choices
a. Electrons
e. Electrons, NADP
+
, H2O, electron
acceptors
Major Events and Features of Cellular Respiration
Stage
Starting Materials
End Products
1. Glycolysis ( in cytosol)
2. Preparatory reaction
74
3. Citric acid cycle
4. Electron transport and
chemiosmosis
Available Choices
a. Pyruvate, ATP, NADH
e. Acetyl CoA, H2O, NAD+,
FAD, ADP Pi
b. NADH, FADH2, O2,
ADP Pi
c. Glucose, ATP, NAD
+
, ADP Pi
d. Pyruvate, Coenzyme A,
NAD+
f. Acetyl CoA, CO2,
NADH
g. CO2, NADH, FADH2,
ATP
h. ATP, H2O, NAD+,
FAD
Suggested Answers:
Major Events and Features of Photosynthesis
Reaction Series
Needed Materials
Light-dependent reactions
(take place in the thylakoid
membrane)
End Products
a. Light-energy; pigments (chlorophyll)
b. Electron transport
b. Electrons, NADP+, H2O, electron acceptors
c. Proton gradient, ADP + P, ATP synthase
Carbon fixation reactions (take
place in stroma)
2. Ribulose bisphosphate, CO2, ATP, NADPH,
necessary enzymes
a. Photochemical reactions
a. Electrons
b. NADPH, O2
c. ATP
2.
Carbohydrates,
ADP + P, NADP+
Major Events and Features of Cellular Respiration
Stage
Starting Materials
End Products
1. Glycolysis (in cytosol)
Glucose, ATP, NAD+, ADP Pi
Pyruvate, ATP, NADH
2. Preparatory reaction
Pyruvate, Coenzyme A, NAD+
Acetyl CoA, CO2, NADH
3. Citric acid cycle
Acetyl CoA, H2O, NAD+, FAD, ADP
Pi
CO2, NADH, FADH2, ATP
4. Electron transport and
chemiosmosis
NADH, FADH2, O2, ADP Pi
ATP, H2O, NAD+, FAD
Activity: Gaseous Products of Photosynthesis
NOTE: If there is enough time and the materials are available, let the class do this activity.
Materials needed:
1000 mL beaker, 3 grams of sodium bicarbonate, Hydrilla or Elodea, funnel, test tube
Procedure:
1. Half-fill a 1000 mL beaker with tap water.
2. Add 3 grams of sodium bicarbonate.
3. Place Hydrilla or Elodea in the bottom of the beaker.
4. Put a funnel over the plant.
5. Fill the test tube with water up to the brim. Secure the mouth of the test tube with your thumb. Invert the
tube and place it on top of the funnel.
6. Place the beaker under direct sunlight. Count the bubbles that appear in the test tube after 30, 60, 90, 120,
150, 180, and 210 seconds.
7. After several minutes, slowly remove the test tube from the funnel. Place your thumb over its mouth. Turn the
tube right up and insert a glowing match to the test the presence of the oxygen in the tube.
Adapted from: Science and Technology II for the Modern World. (2003). Makati City: Diwa Scholastic Press, Inc.
Note: An illustration of the set-up will help teachers and students to visualize how the experiment should be
performed.
ENRICHMENT (25 MINS)
Directions: Show the basic similarity and differences between photosynthesis and cellular respiration. The
options are provided for in the other table below.
PART I
Photosynthesis
76
Cellular Respiration
1.
Raw materials
2.
End products
3.
Electron transfer compound
4.
Location of electron transport chain
5.
Organelle involved
6.
ATP production
7.
Source of electron for ETC
8.
Type of metabolic reaction
9.
Terminal electron acceptor for electron
transport chain
Available Choices
a)
O2
c)
Glucose, oxygen
e)
NADP+ is turned to NADPH
b)
d)
f)
Anabolism
Carbon dioxide, water
NAD+ is turned to NADH+
g)
Phosphorylation and oxidative
phosphorylation
h)
Mitochondrial inner membrane
(cristae)
i)
k)
m)
:H2O
j)
l)
n)
Mitochondrion
Thylakoid membrane
Immediate source: NADH and FADH2
p)
r)
Catabolism
Carbon dioxide, water
o)
q)
NADP+
Chloroplast
Photophosphorylation
In noncyclic electron transport
Glucose, oxygen
In noncyclic electron transport:
Suggested Answers
Photosynthesis
Cellular Respiration
1.Raw materials
Carbon dioxide, water
Glucose, oxygen
2.End products
Glucose, oxygen
Carbon dioxide, water
3.Electron transfer
compound
NADP+ is turned to NADPH
NAD+ is turned to NADH+
4.Location of electron transport
chain
Thylakoid membrane
Mitochondrial inner membrane
(cristae)
5.Organelle involved
Chloroplast
Mitochondrion
6.ATP production
Photophosphorylation
Phosphorylation and oxidative
phosphorylation
7.Source of electron for ETC
In noncyclic electron transport
:H2O (undergoes photolysis to
yield electrons, protons, and
oxygen)
Immediate source: NADH and FADH2,
Ultimate source: glucose
8.Type of metabolic reaction
Anabolism
Catabolism
9.Terminal electron acceptor for
electron transport chain
In noncyclic electron transport:
NADP+ (becomes reduced to form
NADPH)
O2 (becomes reduced to form H2O)
Connecting the Concepts with the Biological Systems
•
Chloroplasts and mitochondria play a significant role in metabolism and their enzyme-requiring pathways
permit a flow of energy through all living things.
The energy transformations that take place in these organelles results in a loss of energy in the form of heat.
Therefore, all organisms are in need of a constant supply of energy, which they get from their food.
Food is ultimately produced by plants, which have the ability to capture solar energy.
Photosynthesizing organisms form the basis of most food chains on Earth.
•
•
3.
EVALUATION (60 MINS)
Directions: Summarize the similarity of the two organelles as they carry out opposite processes. PART II
SET A: Revisit of Energy Organelles
Structure
1.
Use of Membrane
2.
Electron Transport Chain
Chloroplast
Mitochondrion
78
Enzyme
SET B: Photosynthesis versus cellular
respiration
Directions: Using the following
descriptions for photosynthesis and
cellular respiration, bring out your long
bond paper or Oslo paper, pencil, ruler,
ballpen and coloring materials. Show an
illustration/ diagram comparing the
structure and function of chloroplasts
and mitochondria. Label the parts of the organelles. The rubric for the drawing is given below.
Electron Transport Chain
In chloroplast
In Photosynthesis:
•
•
•
•
Water is oxidized and oxygen is released
Has electron transport chain located within the grana of chloroplasts, where ATP is produced by
chemiosmosis
Has enzyme-catalyzed reactions within the semi-fluid interior
Carbon dioxide is reduced to a carbohydrate
In Cellular respiration:
•
•
Oxygen is reduced to water
Has electron transport chain located within the cristae of the mitochondria, where ATP is produced by
chemiosmosis
•
Has enzyme-catalyzed reactions within the semi-fluid interior
•
A carbohydrate is oxidized to carbon dioxide
Suggested Answers:
Use of Membrane:
In chloroplast
•
An inner membrane forms the thylakoid of the grana.
In mitochondrion
•
An inner membrane forms the cristae.
•
An ETC is located on the thylakoid
membrane. Electrons passed down the
ETC have been energized by the sun;
The ETC establishes an electrochemical
gradient of H + with subsequent ATP
production by chemiosmosis. In
mitochondrion
•
An ETC is located on the cristae of
mitochondrion. Energized electrons
have been removed from glucose and
glucose products. The ETC establishes
an electrochemical gradient of H+ with
subsequent ATP production by
chemiosmosis.
Enzymes
In chloroplast
•
The stroma contains the enzymes
of the Calvin cycle. In the Calvin cycle, NADPH
and ATP are used to reduce carbon dioxide to
carbohydrate.
In mitochondrion
•
The matrix contains the enzymes of
the citric acid cycle. In citric acid cycle, the
oxidation of glucose products occurs as NADH
and ATP are produced.
Excellent (10 points)
Good (7 points)
Fair (4 points)
Content knowledge
Information is complete and accurate
Information is mostly complete and
accurate
Information is mostly incomplete and
inaccurate
Originality in
organization of ideas
Exceptionally well organized and
understandable
Generally well-organized and
understandable
Fairly understandable
Standard
80
Neatness
Completely free from mess
Almost free from mess
Too messy
Excellent (7 points)
Good (5 points)
Fair (3 points)
Contrast and intensity
of drawing
Shows exceptional artistic and skillful
color contrast; and meaningful color
concentration
Shows generally acceptable artistic and Shows generally vague color contrasts; and
skillful color contrasts; and meaningful indiscernible sense of color concentration
color concentration
Blending of colors
Color mix is exceptionally creative,
appropriate and meaningful
Color mix is generally creative,
appropriate and meaningful
Color mix needs improvement
Neatness
Completely free from mess
Almost free from mess
Too messy
Rubrics for the Drawing
Standard
PART III
Directions: Group the class into triad. Make each group construct a concept map to help them develop their understanding of photosynthesis and cellular
respiration. Prepare a rubric for easy scoring.
PART IV
Directions: Arrange the following to get the right energy flow sequence in aerobic respiration.
NADH
Electron Transport Chain
Glucose
ATP
Suggested Answers:
1. Glucose 2. NADH 3. Electron Transport Chain 4. ATP
Directions: Identify the following statements as photosynthesis or cellular respiration.
_______________1. Energy-releasing pathways _______________2.
Energy-acquiring pathways
Suggested Answers:
1. Cellular respiration
2. Photosynthesis
General Biology 1
Forms of Energy, Laws of Energy
Transformation and Role of ATP
•
•
•
•
Identify different forms of energy in their surroundings.
Present and explain a real life analogy of the ATP=ADP cycle.
Relate the experiment done and the game to free energy and
equilibrium; and ATP cycle respectively.
Explain the topics discussed in their small groups (peer
learning).
120 MINS
Content Standard
The learners demonstrate an understanding on the forms of energy, laws on energy
transformation, ATP Structure and Function and the ATP- ADP Cycle.
Learning Competency The
learners:
•
LESSON OUTLINE
Introduction Communicate the learning objectives
Explain coupled reaction processes and describe the role of ATP in energy
coupling and transfer STEM-bio11/12-IIa-j-2
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
82
5
Motivation
The “Nanay” Analogy
10
Instruction/
Delivery
a. Review on the idea of organisms as OPEN
SYSTEMS
b. Lesson Proper
60
Practice
a. Hugot “Lines”
10
b. ATP in everyday life
Enrichment
Small-group discussion (SGD)
15
Evaluation
Quiz
20
Reflection
End of topic question
Materials
Laboratory equipment needed, raw materials,
school supplies
Resources
•
Reece JB, Urry LA, Cain ML. 2010. Campbell Biology 10th. San
Francisco(CA):Pearson Benjamin Cummings; 2010. pp. 141-151.
INTRODUCTION (5 MINS)
A. Communicate Learning Objectives
MOTIVATION (10 MINS)
Start the motivation by reviewing/introducing the terms
Metabolism, Anabolism, Catabolism,
Bioenergetics, free energy, Entropy, Equilibrium, Digestion,
Cellular Respiration, Photosynthesis and ATP. After refreshing the
students with the terms and processes, group your students into
groups of 3’s and allow them to think of how they can relate their
mom (“NANAY”) to these processes. Have at least 3 groups of
students share their analogy in front of the class.
“Nanay” analogy example:
Metabolism manages materials and energy resources of the cell.
We can relate it to our mom/ Nanay because our mom is
responsible most of the time in budgeting the finances and cooks
food for the family.Entropy is the measure of disorder or
randomness, Nanay makes sure that all the things inside the house
are well organized especially after the kids played. Nanay lessens
the house’s entropy after the increase in entropy done by the kids
after playing by placing all the things in their proper places.
(NOTE: PLEASE DO THE MOTIVATION BEFORE DOING THE INTRODUCTION)
1. Introduce the learning objective by writing it on the board, then give the students 5
minutes (to work in pairs) to write down on a piece of paper what they already know
or what they expect to learn under the specified topics:
•
•
•
Forms of energy
Laws of energy transformation
Free energy and metabolism
Another set of analogies may include putting together the
ingredients of a dish to create a palatable viand as an example of
anabolism. Or removing one by one the parts of an engine to fix a
broken car as an example of catabolism.
Teacher Tip:
Through this introduction, you will have an idea where to start or how you will
approach your discussion. You may also ask your students which topic would
interest them the most and what would interest them the least.
Teacher Tip:
The teacher can also encourage the students to think of other analogies that will help them relate the
lesson to their everyday lives. Please make sure that you look for the meaning of the terms mentioned
and read about the topic to facilitate and make the discussion more interesting
As long as the analogy relates to the concepts being discussed, give credits to your students.
INSTRUCTION/DELIVERY (60 MINS)
Start the discussion by establishing that living organisms are open systems (energy and
matter can be transferred between the system and its surroundings). Remind the
students that this was already mentioned in one of the characteristics of living
organisms. Obtain and use materials for Energy, and in the unifying theme- interaction
with the environment. This way students will clearly understand that processes
(Bioenergetics) that happen within a living organism is still influenced and affects the
surroundings. The teacher may directly involve students by pointing out that humans
breath the carbon dioxide needed by plants as raw materials to produce food via
photosynthesis, the teacher may use the figure below.
Emphasize as well the role of oxygen as final electron acceptor in cellular respiration.
Students should appreciate why they need to breathe in oxygen and not other form of
gases.
Energy Flow and Chemical Recycling in Ecosystems
Energy flows into ecosystem as sunlight and ultimately leaves as
heat, while the chemical elements essential to life are recycled.
Teacher tip
In the start of the lesson, since the terms metabolism, catabolism, anabolism
were already used in the motivation, the teacher can explain it further by the use
of the downhill and uphill metabolic avenues. Downhill avenue (Catabolism)releases energy that will be used, enabling energy be stored. While Uphill avenue
(Anabolism) uses energy to build complex materials.
Solicit other examples from your students. Engage your students by giving
examples first.
If computers/laptops or lcd projectors are not available, the teacher may adjust
the discussion by preparing materials written on a manila paper. The teacher may
pave the discussion in such a way that the students will be answering or
completing tables or having the students research (homework) about the topic.
This will ensure that the students have something in line with the topic that will
84
be discussed. Instead of pictures, the teacher can ask the students to do actual processes that will depict
the different forms of energy
Teacher tip
Make sure that for every form of energy, you will be able to show a solid example
in living systems how energy forms exists and transformed.
Forms of Energy
Teacher Tip
Energy is the capacity to cause change. It is also the ability to rearrange a collection of matter. In the This part of the topic will really be the least environment different
forms of energy exist: Kinetic, Light and Potential energy. of interest of the students. That’s why exploring the trend in terms of the “hugot•
•
Kinetic- energy associated with relative motion of objects lines” may help you in engaging students.
Thermal energy-type of kinetic energy associated with random movement of atoms. When thermal Inform your students that at the end of the energy is
transferred in the form of heat. discussion you will be having the “hugot line” activity that will be based on the laws
•
Light Energy- main energy source is the sun and powers photosynthesis (anabolic process). of thermodynamics. So they can start •
Potential Energypossessed energy of a matter at rest (non- moving form)
preparing for their “hugots” as you discuss •
Chemical energy- potential energy released in a
chemical reaction the laws of thermodynamics.
Laws of Energy Transformation
Thermodynamics is the study of energy transformations that occurs in a system
(collection of matter). Living systems are considered as open systems because
energy and matter are transferred between systems and the surroundings.
1st Law: The energy of the universe is constant: Energy can be transferred and
transformed but it cannot be created nor destroyed. Plants do not produce
energy, but transforms energy from the sun. Some energy becomes unavailable to
do work because most is lost as heat. Transfer of energy and transformation makes
the matter more disordered. Disorder of matter is measured through entropy.
The teacher may also incorporate the concept on pyramid of energy, where energy
availability per trophic level decreases as one goes from produces to the top
consumer. Only the energy stored by herbivores as biomass will be available to 1st
order carnivores.
Laws of Energy Transformation
Thermodynamics is the study of energy transformations that occurs in a system
(collection of matter). Living systems are considered as open systems because
energy and matter are transferred between systems and the surroundings.
1st Law: The energy of the universe is constant: Energy can be transferred and
transformed but it cannot be created nor destroyed. Plants do not produce
energy, but transforms energy from the sun. Some energy becomes unavailable to do work because most is lost
as heat. Transfer of energy and transformation makes the matter more disordered. Disorder of matter is
measured through entropy.
2nd Law: Every energy transfer or transformation increases the energy of the universe.
•
i.e In a room full of people, breathing increases entropy since all are exhaling carbon dioxide.
•
Organisms as open system increase
order as long as the order in their
surroundings decreases. This shows
that as living organism
transfers/transforms energy to its
surroundings, the disorder
increases, thus increases entropy.
Free Energy
86
•
•
Energy that can do work under cellular conditions
Gibbs free energy is the energy in the system that can perform work when temperature and pressure are
uniform throughout the system: ∆G = ∆H – T∆S
• Also known as free energy change
• Measure of system’s instability (trend: tendency to change to a more stable state)
• Increase in G: UNSTABLE i.e. concentrated dye
• Decrease in G: STABLE i.e. dye dispersed in water
• In chemical reactions: as reaction precedes equilibrium, the free energy of reactants and products decreases
(decreases free energy). If products will be removed free energy will increase
• When systems reach maximum stability, the system reaches the state of equilibrium. If equilibrium is
reached there is NO WORK. In chemical reactions proceeding equilibrium NO NET CHANGE in the relative
concentration of reactants and products.
Teacher Tip
Use the figure used, but make sure to note that an individuals’ contribution to the disorder in surrounding is not obviously felt, but as a
group it is. Use the idea of having lots of people inside the room compared to an individual inside the room.
The teacher must take note that there is unstoppable trend towards randomization of the universe as a whole.
∆G = ∆H – T∆S, where ∆H is enthalpy (total energy), T is absolute temperature and ∆S is the change in entropy.
If it is possible to show the concentrated dye experiment (diffusion of dye in water), it will be a big help. But before asking the students to
do it, make sure that you prepare questions that will be answered to lead the students in the discussion of free energy.
•
NOTE: You may have the first two bullets answered by the students before doing your discussion. Then after the discussion have the last 3
bullets answered.
•
•
•
•
•
Describe the free energy (G) of the concentrated dye? Does it have high or low free energy? Is it stable or unstable?
When do we say that the dye reached the stable state?
Is there a way for the diffused dye system to undergo spontaneous change? How will you do it?
How will you relate the closed hydroelectric system to the set up of the dye diffusion experiment?
•
How will you relate the multistep hydroelectric system to the dye diffusion experiment?
Free Energy and Metabolism
•
Exergonic reactions- energy is
released (energy outward), more
decrease in free energy= more work
done
Endergonic reactions- energy is
absorbed (energy inward). Plants
stores energy in the form of glucose
(from carbon dioxide and water
Equilibrium and Metabolism
Equilibrium = NO WORK. This usually happened in isolated systems that reach equilibrium.
•
A cell that reaches the state of equilibrium is DEAD
•
A normal cell is not in equilibrium, because its products are not accumulated within its system, INSTEAD the
products becomes a reactant in the next step.
Teacher Tip:
ACTIVITY: Calamansi Relay ala
ATP cycle
It will be really helpful if you use the example of an isolated/closed hydroelectric system and an open hydroelectric system. A closed
hydroelectric dam will reach equilibrium while the open hydroelectric system will not since the overspill will be used by another system.
You may also think of other examples that are parallel to the hydroelectric system example.
In an oval (if there is any in your
area) or a lot where students
can play the relay divide the
class into 3 groups (10 members
per group) assuming that there
are 30 students in a class.
Define who’s going to be
number 1-10 (refer to the figure
below). At your mark they will
start the relay. Student 1 must
be able to successfully pass the
calamansi (calamansi on a plastic
spoon bitten by student 1) to the
students 2’s plastic spoon (must be
bitten). The student’s hand must be at
their back, NO USING OF HANDS. If
the calamansi falls from the spoon the
student has to go back to his/her
starting point before proceeding in
passing the calamansi to the next
player. The group that will finish first
will be the winner. The winner will be
awarded with bonus points.
•
You may also use the dye diffusion experiment that you did in explaining the isolated hydroelectric system as example. Add a drop of
concentrated dye to a glass of water. Since it is a closed hydroelectric system, the procedure stops there, where the dye already reached
the state of equilibrium
Adenosine Triphosphate (ATP)
•
•
•
•
•
•
•
•
Structure composed of: sugar ribose, nitrogen base adenine and a chain of 3-phosphate groups
Mediates most energy coupling in cells
Powers cellular work
3 main kinds of work of a cell: chemical work, transport work and mechanical work. These are possible
through energy coupling, where the cells use and exergonic process to drive an endergonic reactions.
chemical work: synthesis of polymers from monomers (pushing of endergonic reactions)
transport work: pumping of substances across membranes (against the direction of spontaneous
movement)
mechanical work: beating of cilia, contraction of muscles
also used to make RNA (since ATP is used as one of the nucleoside triphosphate)
Materials: Calamansi, plastic
spoons (30)
Do the game before discussing the ATP
hydrolysis and ATP cycle. Make sure
that you read the game mechanics and
88
do the adjustments to fit your classes. At the end of the activity discuss how it is related to ATP hydrolysis and
ATP cycle. •
Calamansi: water (for hydrolysis)
•
Students: phosphates that is cleaved
Teacher Tip: The multistep hydroelectric system can be explained through the dye diffusion experiment by using more than one glass or
the ATP. The energy equivalent
of the triphosphate tail of ATP is
compared to a compressed
spring.
water. You may show this by having the concentrated dye dropped to the first glass. Describe how the dye decreases free energy and how
it becomes more stable by diffusing. But this doesn’t end with this set up, get another dropper and obtain a sample of the colored water
from glass 1 then drop it into the clear water in glass 2. This way you are showing that the dye that had decreased its free energy and
improved to be more stable can still undergo spontaneous change. Then repeat the procedure from glass 1 to glass 2 for the succeeding
glasses. With this, you were able to show that a multi-step open hydroelectric system will not reach equilibrium because the product
becomes the reactant for the next reaction.
Teacher tip: The phosphate bonds of the ATP must not be termed as high-energy phosphate bonds. The bonds of the phosphate
groups of the ATP are not strong bonds but instead, the reactants (ATP and water) possess high energy compared to the product.
•
Students exerting effort to reach the other end: energy releasing process to allow ADP + P to produce
ATP (phosphorylation)
•
Bonus/incentive for the winner: energy
•
2 groups: ATP and ADP
Hydrolysis of ATP
•
•
•
•
•
•
process of breaking down bonds between the phosphate groups
this happens when a water molecule breaks the terminal phosphate bond
HOPO32-, abbreviated P I leaves ATP
Forming Adenosine diphosphate (ADP)
Energy is released. This comes from the chemical change of the system state of lower free energy and
NOT from the phosphate bonds.
Hydrolysis relases so much energy because of the lnegative charges of the phosphate groups. These
charges are crowded together and their mutual repulsion contributes to the instability of that region of
Teacher Tip
As for supplementary resource, you may look for
videos that clearly explains the hydrolysis of ATP
and the ATP Cycle. You may ask your students to
view it before the class (HW) or have it shown in
class as you discuss it.
Teacher Tip
Look for videos showing the 3 cellular work
powered by ATP. For the students to appreciate
these processes more and for them to clearly see that its really happening in living systems.
You may also use the lessons they had in endomembrane system and transport mechanisms to facilitate the discussion in this part of the
topic.
90
How the Hydrolysis of ATP Perform Work
•
•
•
Proof that ATP releases heat: in a test set up, the hydrolysis of ATP releases energy in the form of heat in the surrounding water.
Most of the time when an animal is exposed in a cold environment, the reaction of the body is through shivering. In this reaction of the organism,
shivering uses ATP during muscle contraction to warm the body. Since it will also be a disadvantage for organisms to generate heat during ATP
hydrolysis, in order to maintin the living conditions inside the cell, the energy released during ATP hydrolysis is used by proteins to perform work:
chemical, transport and mechanical
Hydrolysis of ATP leads to change in the shape of protein and in its ability to bind to another molecule. Phosphorylation (ADP to ATP) and
dephosphorylation (ATP to ADP) promote crucial protein shape changes during important cellular process
The Regeneration of ATP
•
•
•
•
•
•
ATP is a renewable it can be regenerated by the addition of phosphate to ADP •
Catabolism (exergonic) provides the free energy to
phosphorylate ADP.
ATP formation is not spontaneous, so there is a need to use free energy for the process to work.
ATP cycle is the shuttling of inorganic phosphate and energy.
It couples the cell’s energy yielding processes (exergonic) to energy consuming process (endergonic)
ATP regeneration happens very fast (10M molecules of ATP used ad regenerated per second)
If ATP could not be regenerated by phosphorylation of ADP, HUMANS would use nearly their body weight in ATP each day.
92
PRACTICE (10 MINS)
A.
“Hugot-lines”. Create “hugot-lines” based on the laws of transformation of energy. Ask your students to
create 3 “hugot-lines” per law under the transformation of energy. The student must give justification for each
“hugot-line” they’ll create. Make sure that the “hugot-lines” are in tune with the scientific concepts of the law of
thermodynamics.
B.
ATP in everyday life. Ask your students to make an analogy relating the concepts under ATP (ATP cycle,
ATP hydrolysis, How ATP allows organisms to do work) or the relevance of ATP in our lives. After listing the
analogies or the relevance of ATP in our lives, ask the students to write their reflection/ realization regarding the
topic.
ENRICHMENT (15 MINS)
Small Group Discussion. Allow your students to meet in groups (5 students per group) Assign each students to a
topic below:
• Forms of energy
• Transformation of energy
• Free energy and metabolism
• ATP- structure and function
This is to see how much the students understood the lesson. Encourage your students to explain the concepts in
their own words. You may allow you students to use their notes in this small discussion. If they have an access to
internet and can bring their gadgets, you may also encourage them to save videos that will help them explain
their topic.
EVALUATION (20 MINS)
The teacher can make his/her own list of questions that will allow students to practice critical thinking skills.
Having this short quiz done by group of 2s or 3s will allow students to discuss and decide among themselves. If a
student opts to answer individually, allow him/her. The teacher can prepare a multiplechoice type of evaluation if
he/she is not comfortable with this type of exam
1. Explain metabolism through creating an appropriate analogy.
2. What is the difference between Catabolic and Anabolic reaction? How do each process compliment one
another?
3. What is the importance of having exergonic reactions in the body?
4. What is the disadvantage if there are not enough endergonic reactions in the body? Relate this to the ATP
cycle.
5. What happens when energy transforms to another form? Is the yield unchanging for every transformation?
Why or Why not?
6. Which law of thermodynamics states that energy transfer or transformation increases the state of disorder of
the universe?
7. Why do we consider living organisms as open systems?
8. If free energy is higher, does it mean that the system is more stable (Y/N) N? What does this imply in the
amount of work that can be done?
94
9. If free energy is lower,does it mean that there is greater work capacity? (Y/N) N What does this imply about
the systems stability?
10. How can you tell that a cell has reached equilibrium? What properties does it display?
11. (Y/N) Is the hydrolysis of ATP reversible? If Yes, explain your answer.
12. Describe how phosphorylation works (what drives it)?
13. How does the cell go about the continuous release of heat during ATP hydrolysis?
14. What will happen to the body if the regeneration of ATP is very slow?
15. How does the multi-step open hydroelectric system explain cellular respiration?
Teacher Tip
REFLECTION (HOMEWORK FOR THE NEXT MEETING)
•
•
•
•
Encourage your students to answer this section truthfully as it will also help you
Which of the topics interest you the most? Why? improve the lesson and your approach.
Which of the topics interest you the least? Why?
Did the activities help you understand the topic (Y/N)? Explain your answer.
Did you see the significance/ connection of the topic in your life?
240 MINS
Pt.1
LESSON OUTLINE
Introduction
Assess prior knowledge through a class 10 activity
on word clustering
Motivation
Laboratory activity on separating plant 50
pigments through paper chromatography
General Biology 1
Instruction/
Delivery
Energy Transformation
Discussion on chlorophyll,
photoexcitation of chlorophyll, and the
photosystem
Practice
Formative assessment through summary
reporting
20
Content Standard
The learners demonstrate an understanding of photosynthesis.
Enrichment
Answering of critical thinking questions
20
Evaluation
Short quiz on topics discussed in the
Learning Competency
The learners explain the importance of chlorophyll and other pigments
(STEM_BIO11/12 – IIa-j-3)
120
20 lesson
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
•
separate and identify the different pigments present in plants through a simple paper chromatography experiment
discuss the role of pigments in photosynthesis
illustrate how chlorophyll absorbs and transforms light energy
define and describe a photosystem
Materials
• laboratory materials and supplies for the chromatography
experiment (i.e., chromatography or filter paper, glassware,
acetone/solvent, spinach leaf, coleus leaf, coin, pencil,
aluminum foil, ruler, and coffee stirrer)
•
prism
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition. Pp.92 – 98.
Belmont, California: Brooks/Cole-Tomson Learning.
96
INTRODUCTION (10 MINS)
1. Assess the learners’ prior knowledge of the topic by facilitating a class activity on clustering or word webbing.
Write the word CHLOROPHYLL on the board. This will serve as the ‘nucleus word’.
2. Ask the learners to think of words or images associated with the ‘nucleus word’ and let them write the words
or sketch the images around the ‘nucleus word’.
3. Encircle each word or image and draw a line from each item to the ‘nucleus word’.
4. Ask the learners to write how each word or image is related to the ‘nucleus word’ CHLOROPHYLL and have
them write the relation above or below the line that you drew.
5. Ask the learners to summarize the word web formed by the class.
6. After the summary, present the following questions to the class:
• Why are chlorophyll and other plant pigments important?
• How do chlorophyll and other plant pigments help in carrying out photosynthesis?
These essential questions shall help the learners focus in finding the correct responses.
Provide the learners with a copy of the
instructions for the activity. Guide them
as they perform the experiment.
Teacher Tip:
By assessing the learners’ prior knowledge, you
will be able to gauge what they already know
and what they still need to learn from the lesson.
This will help you design and determine the
topics that you need to include and those that
you need to reiterate and emphasize in your
discussions.
Posing essential questions at the start of a lesson
helps stimulate thoughts, promotes inquiry, and
motivates the learners to find and formulate
ways to be able to come up with the correct
responses.
MOTIVATION (50 MINS)
To help the learners acquaint themselves with different plant pigments, instruct them to perform a laboratory
activity on chromatography of plant pigments. This activity will allow them to visually demonstrate that leaves
contain different colored pigments.
Before performing the experiment, provide a brief description of chromatography.
Chromatography—is a separation technique used to identify various components of mixtures based on the
differences in their structure and/or composition. It involves a stationary phase (e.g., paper or any thin layer of
an absorbent surface) and a mobile phase (i.e., solvent containing the dissolved substances). The solvent will
move up the paper through capillary action carrying with it the dissolved substances. These substances will be
carried along at different rates because they are not equally soluble in the solvent and they will be attracted in
different degrees to the paper.
Teacher Tip: Use the following guidelines in
performing the laboratory activity:
• Make sure that the learners have
knowledge of safety practices in
the laboratory.
• Let the learners work in groups in
order to smoothly carry out the
experiment.
• Prepare the materials a day
before the activity.
Extracting Plant Pigments through
Chromatography
Objective: Perform chromatography to separate a mixture of pigments from plants Materials per
group:
•
Chromatography paper strips or filter paper about 1cm x 15cm in size
•
Acetone (solvent)
•
150 ml beaker or a tall glass jar
•
aluminum foil to serve as cover for the beaker
•
fresh spinach leaf
•
Coleus leaf or other leaf that is red in color
•
coin
•
pencil
•
ruler
•
coffee stirrer or plastic stick
3. Repeat the same process for the
Coleus leaf using a second strip of
chromatography paper.
4. Add enough acetone to cover the
bottom of the beaker or glass jar
(no more than 1cm high).
5. Attach the top of the paper strips to
a pencil or a coffee stir stick. This
can be done by making a loop with
the top of the paper and fastening it
with a paper clip or tape.
Procedure (Adapted with modifications from
<http://www.dal.ca/content/dam/dalhousie/pdf/faculty/science/imhotep/9.2-Discovering-PlantPigments.pdf>):
1. Using a pencil, draw a base line that is 2cm from the bottom of the paper strip. Be careful in handling the
chromatography paper as oil from the human skin can alter the results. Lift the paper only by its sides and be
careful not to touch its front.
6. Lay the pencil or stick across the top
of the beaker so that it suspends
the paper above the liquid.
The bottom of the paper strip must
be dipped in the solvent but the
solvent should not surpass the 2cm
baseline that is the point of origin.
2. Place the spinach leaf over the paper. Pressing hard, roll the edge of the coin, and rub the leaf onto the
paper, following the path of the line. Repeat until the line turns very dark.
7. Cover the beaker and allow 15–30 minutes for the solvent to rise through the strips.
8. Remove the paper strips just before the solvent reaches the top.
9. Lay the paper strip face up. Using the pencil, immediately mark the line where the solvent stopped before it
evaporates. This is called the solvent front.
10. Allow the strips to dry.
11. Before the pigments fade, mark the top of each color that you can identify.
12. Measure the distance (in mm) travelled by each pigment from the point of origin.
98
13. Tabulate your data. Show the
following information in your table:
color observed, distance travelled,
and probable pigment.
INSTRUCTION/DELIVERY/PRACTICE (120 MINS)
Using the learners’ observations from the experiment and the data they have gathered, have them discuss their
analysis and conclusion among their groups with the help of these guide questions:
•
•
•
•
•
Teacher Tip:
The learners’ discussion of the experiment’s
result, analysis, and conclusion will jumpstart
the lecture and discussion on pigments and their
role in photosynthesis.
Which pigments were you able to observe in your chromatogram?
Why do the pigments move at different rates through the chromatogram?
How do the spinach leaf and Coleus leaf differ from each other in terms of their pigments?
Which of the two leaves can carry out photosynthesis better? Why?
Why is it an advantage for plants to have different colored pigments?
Let the groups share their analysis and conclusion in class.
Discuss the following concepts:
Pigments
Teacher Tip:
If a prism is available, you may use it to
demonstrate the various colors of visible light.
Pigments are substances that absorb visible light. Different pigments absorb light of different wavelengths.
Light, as it encounters an object, is either reflected, transmitted, or absorbed. Visible light, with a
Teacher Tip: wavelength of 380–750nm, is the
segment in the entire range of electromagnetic spectrum that is most Encourage participation from the students important to life on earth. It is detected as
various colors by the human eye. The color that is not while discussing these concepts. absorbed by pigments of objects is transmitted or reflected and that is
the color of the object that we see.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Figure'1:!The!Electromagnetic!Spectrum!
Pigments are the means by which plants capture sun’s energy to be used in photosynthesis. However, since each
pigment absorbs only a narrow range of wavelength, there is usually a need to produce several kinds of pigments of
different colors to capture more of sun’s energy.
Chlorophyll
Chlorophyll is the greenish pigment found in the thylakoid membrane inside the chloroplast of a plant cell. The
figure below shows the location and structure of a chloroplast.
Chlorophyll absorbs blue and red light while it transmits and reflects green light. This is why leaves appear green.
100
There are several kinds of chlorophyll.
Among these, chlorophyll a plays the
most important role in photosynthesis.
It directly participates in converting solar energy to chemical energy.
Other pigments in the chloroplast play the part of accessory pigments. These pigments can absorb light and
transfer the energy to chlorophyll a. One of these accessory pigments is chlorophyll b. Some carotenoids also
contribute energy to chlorophyll a. Other carotenoids, however, serve as protection for chlorophyll by dissipating
excessive energy that will otherwise be destructive to chlorophyll.
Structure of chlorophyll
• Head—a flat hydrophilic head called porphyrin ring. It has a magnesium atom at its center. Different
chlorophylls differ on the side groups attached to the porphyrin.
•
Tail—a lipid-soluble hydrocarbon tail.
How does photoexcitation of chlorophyll happen?
1. A chlorophyll molecule absorbs photon or light energy.
2. An electron of the molecule in its normal orbital, said to be in its ground state, will be elevated to an orbital
of a higher energy. The molecule is now in an excited state. The molecule only absorbs photon that has the
energy that is equal to the energy needed for it to be able to elevate from the ground state to the excited
state.
3. The excited state is unstable. Hence, excited electrons drop back down to the ground state immediately
after, releasing energy in the form of heat and photon. This happens in isolated chlorophyll molecules.
However, chlorophyll molecule that is found in its natural environment in the thylakoid membrane forms a
photosystem together with proteins and other organic molecules to prevent the loss of energy from the
electrons.
Teacher tip
For this part, you may ask some learners to volunteer to show the location of chlorophyll in a leaf of a plant. They may do this through
drawings or sketches in the board.
Teacher tip
Reiterate the importance of the formation of photosystem. The
formation of the photosystem prevents the excited electrons
from going back to the ground state, thus
preventing the loss of energy which is
essential for photosynthesis to occur. Figure
4: Photoexcitation of Chlorophyll
Photosystem
A photosystem is an aggregate of pigments and proteins in the thylakoid membrane responsible for the
absorption of photons and the transfer of energy and electrons. It is composed of:
•
Light-harvesting complex— is also called the ‘antenna’ complex and is consisted of several different pigments (chlorophyll a,
chlorophyll b, and carotenoids) bounded with proteins. When a pigment molecule absorbs a photon, energy is passed on from one
pigment molecule to another pigment molecule until the energy reaches the reaction center.
•
Reaction-center complex—is composed of a pair of chlorophyll a and a primary electron acceptor. The primary electron acceptor is
a specialized molecule that is able to accept electrons from the pair of chlorophyll a. The pair of chlorophyll a in the reactioncenter is also specialized because they are capable of transferring an electron to the primary electron acceptor and not just
boosting the electron to a higher energy level.
There are two types of photosystem:
•
•
Photosystem II—was discovered later after the discovery of Photosystem I, but
functions first in the light reaction of photosynthesis. The chlorophyll a in the reactioncenter of Photosystem II effectively absorbs light with a wavelength of 680nm and thus
called P680.
Photosystem I—was discovered first. Its reaction-center has a chlorophyll a called P700
because it is effective in absorbing light with a wavelength of 700nm.
PRACTICE (20 MINS)
1. Divide the class into three groups. Assign each topic you discussed to each group: chlorophyll and other
pigments, photoexcitation of chlorophyll, and photosystem.
2. Instruct each group to perform a Summary Report of the topic assigned to them. Each member of the group
will have to say something about the topic without consulting their notes.
3. Give the groups enough time to organize and consolidate their report before asking them to present in class.
ENRICHMENT (20 MINS)
Ask the learners to answer the following questions:
•
•
In places where there are four seasons (i.e., winter, spring, summer, and fall), how do plants cope
with the change in season? Give a detailed description and explanation.
Chlorophyll-enriched products and supplements are now being sold in the market. Find out what
benefits these products claim. With your knowledge about chlorophyll, do you think these claims are
valid? Support your answer.
Ask the learners to share their answers in class.
Teacher tip
This activity will serve as a formative
assessment to evaluate the learners’
understanding of the lesson. This will also
provide you an opportunity to reinforce
concepts that are not clearly understood and
to rectify misconceptions, if there are any.
EVALUATION (20 MINS)
Give the students a short quiz to assess their understanding of the topics discussed in the lesson. You may
formulate other questions that can gauge their learning.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
What happens to light when it hits an object.
What wavelength of light is most important to life on earth?
How do plants capture the sun’s energy?
In what cell organelle can we find chlorophyll? In what structure of this
organelle is chlorophyll located?
What color/s of light does chlorophyll absorb? What color does it reflect?
What might be the advantage of accessory pigments?
What happens to a chlorophyll molecule when it absorbs photons?
How do chlorophyll molecules prevent the loss of energy when electrons go
back to the ground state?
What composes a photosystem?
In what part of the photosystem does the first step of light reaction takes
place?
Differentiate the two types of photosystem.
180 MINS
Pt.2
104
General Biology 1
Energy Transformation
Content Standard
The learners demonstrate an understanding of photosynthesis.
Learning Competency
The learners describe the patterns of electron flow through light reaction events
(STEM_BIO11/12–IIa-j-4)
LESSON OUTLINE
Introduction
Communicating learning competencies 20 and
outcomes; Familiarization with key terms
Motivation
Establishing the importance of
10
photosynthesis to all organisms by using plant
samples
Instruction/
Delivery
Discussion on the events of light
reactions.
60
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
•
•
•
differentiate the two stages of photosynthesis
identify the important molecules involved in the light reactions
describe the events and processes happening during light reactions
Practice
Role-playing activity
Enrichment
Think-pair-share class activity
Evaluation
Quiz on the light reactions events diagram
Materials
• samples and photos of plant products (e.g. fruits and
vegetables)
•
materials for the role-playing activity (e.g. tennis balls or soft
balls, lids, and labels)
Resources
60
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003 ). Biology: Concepts and Applications 5th edition. Pp.98 - 100.
Belmont, California: Brooks/Cole-Tomson Learning.
106
Teacher Tip:
INTRODUCTION (20 MINS)
1. Communicate the learning competencies and learning outcomes of this lesson to the class.
2. Give the learners enough time to research on the definition and description of the following keywords:
• light reactions
• noncyclic electron flow
• cyclic electron flow
• plastoquinone (Pq)
• plastocyanin (Pc)
• ATP
• photophosphorylation
• ferredoxin
• NADP+
• NADPH
• chemiosmosis
MOTIVATION (10 MINS)
1. Establish to the learners that photosynthesis is important not only to plants but also to other living
organisms such as humans.
2. Show pictures of food with vegetables or fruits to the class. You may also bring real fruits and vegetables to
the class. Let the learners identify them.
3. Ask the learners what percentage of their diet consisted of fruits and vegetables.
Ask learners to make conclusions on the role played by plants in converting the sun’s energy to a form of
energy that the human body can use.Using a pencil, draw a base line that is 2cm from the bottom of the
paper strip. Be careful in handling
the chromatography paper as oil
from the human skin can alter the
results. Lift the paper only by its
sides and be careful not to touch its
front.
Communicating the learning competencies and
learning outcomes shall give the learners an idea
on what they can expect to learn from the
lesson.
You may also opt to establish prior
understanding of the topic or lesson. You can ask
the learners to show specific hand signals
depending on how familiar they are on the
topics to be discussed. For example, they can do
a ‘thumbs up’ to indicate extensive
understanding of the specific topic, a ‘thumb to
the side’ to signify enough understanding of the
topic, and a ‘thumbs down’ to show little or no
understanding at all.
Teacher Tip:
INSTRUCTION/DELIVERY (60 MINS)
You may the students to write on the board the
chemical reaction for photosynthesis. Review the chemical reaction for photosynthesis: 6 CO2 + 6 H20 + sunlight
C6H12O6 + 6 O2
Using a diagram showing an overview of
photosynthesis, have the students figure out Ask the learners to identify which among the reactants is/are used in the light reactions and the Calvin
differences
between the two stages cycle.
involved.
Give an overview and further differentiate the two stages of photosynthesis.
•
Light reactions—use sunlight to initiate electron transfer, thereby reducing NADP+ to NADPH and
splitting water to give off oxygen as a by-product.
•
form ATP through phosphorylation
•
take place in the thylakoids of the chloroplast
•
Calvin Cycle—sometimes referred to as ‘dark reactions’ because it does not require light energy for its
processes to take place
•
incorporates CO2 into organic molecules through carbon fixation
•
uses NADPH and ATP to produce carbohydrate from the fixed carbon
•
takes place in the stroma of chloroplast
•
returns ADP, inorganic phosphate, and NADP+ to the light reactions
Show an image of the light reactions similar to the one shown in Figure 2 below:
108
Teacher Tip:
1. Light energy or photon is absorbed by
a pigment molecule of the lightharvesting complex of Photosystem
II and is passed on to other pigment
molecules nearby until the energy
makes it to the reaction center. In
the reaction center, it is absorbed
by the P680 pair of chlorophyll a.
While discussing the events in the light reaction,
make sure to engage the learners and encourage
them to participate by asking questions before
proceeding with the discussion on each step or
event.
The following could be sample questions:
• What happens to electrons when they
encounter light energy?
• How is oxygen formed in the first phase of
light reaction?
• What happens to the hydrogen ions formed
from the splitting of water molecules?
Figure 2: The Light Reactions
Teacher Tip:
From the image or diagram of the light reactions, ask the learners to identify the key players involved in the
process.
Proceed to an in-depth discussion of the steps or events in light reactions.
Light Reactions Events
You may review the concept of redox reaction in
this part. In an oxidation reaction, a molecule
loses one or more electrons and becomes more
positively charged. In a reduction reaction, a
molecule gains one or more electrons and
becomes more negatively charged. Oxidation
and reduction reactions are most often paired,
resulting to a redox reaction. As a molecule is
oxidized, the molecule that accepts the electrons
is reduced.
Teacher Tip:
Teacher Tip:
Integrate the First Law of Thermodynamics which states that energy can be transferred or transformed from one form into another but
cannot be created nor destroyed. Ask the students how the First Law of Thermodynamics is applied in Photosynthesis. Ask the learners to
cite specific events in the process that illustrates the law.
110
2. The electron in this pair of chlorophyll a is raised to an excited state and is transferred to the primary
electron acceptor. P680 loses its electron and becomes positively charged (P680+).
3. The positively charged molecule attracts electrons from a water molecule, resulting to the splitting up of H20
into two electrons, two hydrogen ions (H+), and an oxygen atom with the provision of light energy. The
oxygen atom immediately combines with another oxygen atom to form an oxygen molecule (O2) which is
then released outside the leaf through the stomata.
4. The excited electrons are then passed on from the primary electron acceptor to the electron carrier
molecules through the electron transport chain until they reach Photosystem I. The electron carrier
molecules involved here are plastoquinone (Pq), a cytochrome complex, and plastocyanin (Pc).
5. At each transfer, the electrons release small amounts of energy. This energy is used to pump hydrogen ions
across the membrane. The splitting up of water molecules results to an uneven distribution of hydrogen ions
in the stroma and the lumen. The H+ ions tries to equalize their distribution by moving from the lumen to the
stroma through the aid of a membrane protein called
ATP synthase. This is referred to as chemiosmosis. The movement of hydrogen ions through the ATP
synthase channel triggers the synthesis of ATP from ADP. The ATP contains high-energy phosphate bonds.
6. Meanwhile, photon is also absorbed and energy is passed on from one pigment molecule to another until the
energy reaches the reaction center complex of Photosystem I. The energy excites the electron present in the
pair of P700 chlorophyll a located here. The excited electron is then transferred to a primary electron
acceptor, making the P700 positively charged and now seeking electrons to fill up the missing ones. This is
filled up by the electrons from Photosystem II that are passed on through the electron transport chain.
7. The photo-excited electron from the primary electron acceptor of Photosystem I enters another electron
transfer chain, passing the electron to an iron-containing protein called ferredoxin (Fd).
8. An enzyme, the NADP+ reductase, then transfers the electron to NADP+ and stabilizes it by adding a proton
(H+) to form NADPH. NADPH is then released to the stroma and becomes part of the Calvin Cycle.
Cyclic Electron Flow
Aside from the usual route of electron flow as described in the events of the light reactions (i.e., noncyclic or
linear electron flow), photo-excited electrons may take a short-circuited route which utilizes Photosystem I but
not Photosystem II. The ferrodoxin goes back to the cycle and passes the electron to the cytochrome complex
and to the Pc until it reaches P700 chlorophyll instead of transferring the electron to NADP+reductase. Due to
this event, no NADPH is produced but ATP is still synthesized.
Figure 3: Cyclic Electron Flow
•
PRACTICE (20 MINS)
balls) that will serve as
LIGHTS, Camera, ReACTIONS!
1.
Take the class outside the classroom and look for a wide area that will allow the learners to move
around.
2.
Ask the learners to pick a role as players in light reaction events (e.g., hydrogen ions, oxygen atoms,
etc.).
3.
Let the learners plan how they are going to act out the process.
4.
You may provide the following information and materials to assist them in planning and performing the
roleplaying activity.
Materials:
112
balls (tennis balls or soft
electrons •
lids or
any material that will
serve as light energy or
photon
•
labeled cards for the
following roles:
•
sun
•
pigment molecules (several learners)
•
water molecule (i.e., oxygen atom and hydrogen ions)
•
P680
•
primary electron acceptors
•
electron carriers (i.e., Pq, cytochrome complex, Pc, and Fd)
•
ADP
•
P700
•
NADP+ reductase
•
NADP+
5.
Ask the class present their simulation of the light reactions.
6.
After the presentation, provide feedback, if there is any.
Teacher tip
For this part of the lesson, the learners shall take
on roles and act out the events that happen
during light reactions. This shall be a class effort
and shall need each learner’s cooperation to be
able to accurately act out the events. Learners
who are not directly involved in the performance
shall serve as director and scriptwriters to
ensure the smooth flow of the ‘play’.
This activity shall help the learners process the
information that they acquired. This shall ensure
that the learners acquire a deeper understanding
of the concepts.
Through this activity, you shall have an idea of
how well the learners understood the topics you
discussed. It shall give you the chance to correct
any misunderstandings and misconceptions they
might have regarding the lesson.
ENRICHMENT (60 MINS)
Teacher tip
You may also opt to formulate questions to
Think-Pair-Share
1. First, instruct the learners to determine what event/s in the light reactions they consider to be the
most significant to humans.
be answered as a quiz. The quiz may be
done individually or in pairs.
2. Next, ask the learners to look for a partner and share their response.
3. Then, ask the pairs to share their responses to the whole class. Pair: Look for a partner and discuss your answers.
EVALUATION (20 MINS)
Assess the learners’ understanding of the lesson by having them accomplish the diagram below. They need to fill in the empty shapes with the names of the
molecules involved in the processes. This activity may serve as a quiz.
Assign a homework to the class. Ask the learners to conduct a research and answer this question: What do you think is the importance of the Cyclic Electron
Flow to the process of photosynthesis and to the cell?
240 MINS
Pt.3
114
General Biology 1
LESSON OUTLINE
Introduction
Communicating learning competency and
learning outcomes; Description of the stages
of the Calvin Cycle
Motivation
Familiarization with key words and researching 20
for their meanings or definitions
Instruction/
Delivery
Discussion on the three phases of Calvin cycle 60
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
Practice
60
•
•
•
Building of a three-dimensional model of the
Calvin Cycle
Enrichment
Researching and reporting on the
photosynthetic adaptations of C3, C4, and
CAM plants
60
Evaluation
Class quiz
30
Energy Transformation
Content Standards
The learners demonstrate an understanding of photosynthesis.
10
Learning Competency
The learners describe the significant events of the Calvin Cycle (STEM_BIO11/12-IIa-j5)
•
describe the phases of the Calvin cycle
identify the important molecules needed in the Calvin cycle
identify the molecules produced in the cycle
Materials
materials for making three-dimensional models of the Calvin Cycle (e.g., clay, Styrofoam balls, beads, and art materials)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco(CA): Pearson
Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition. Belmont,
California: Brooks/Cole-Tomson Learning.
INTRODUCTION (10 MINS)
1. Present the learning competency and learning outcomes for this lesson.
2. Describe the significant events of the Calvin cycle.
3. Review the basic features of the Calvin cycle.
The Calvin Cycle
•
also referred to as light-independent reactions or “dark reactions”
•
takes place in the stroma of the chloroplast
•
second stage of photosynthesis that is involved in the formation of sugar from CO2 using chemical energy
stored in ATP and NADPH, the products of light reactions
MOTIVATION (20 MINS)
1. Write the following terms on the board: CO2
• RuBP
•
ATP
•
Rubisco
•
NADPH
•
3-phosphoglycerate (PGA)
•
G3P
•
1,3-biphosphoglycerate
2. Explain to the learners that these terms are the key players in the Calvin cycle that they need to familiarize
themselves with.
3. Instruct the learners to research the meaning and description of the molecules involved in Calvin cycle.
Teacher tip Let the learners provide the overview or description of the Calvin cycle. You may refer to the equation of photosynthesis
in introducing the topic.
116
INSTRUCTION/DELIVERY (60 MINS)
Give a lecture-discussion on Calvin cycle.
The Calvin Cycle
Important points to know:
•
The sugar that is produced in the Calvin Cycle is not the six-carbon glucose that we are familiar with. This is
formed later on. What is produced in the Calvin Cycle is a three-carbon sugar known as G3P or glyceraldehyde3-phosphate.
•
The Calvin Cycle needs to ‘spin’ three times to make one molecule of G3P from three molecules of CO2.
Teacher Tip:
You may also opt to have the learners make a
graphic organizer that shows the three phases of the Calvin Cycle. Three Phases of Calvin Cycle: Carbon Fixation
•
•
•
Carbon fixation is a process of incorporating an inorganic carbon molecule, CO2, into an organic material.
In this phase, the CO2 molecule is attached to a five-carbon sugar molecule named ribulose biphosphate (RuBP)
aided by an enzyme named rubisco or RuBP carboxylase. Rubisco is believed to be the most abundant protein
in the chloroplast and maybe on Earth.
The resulting product, a six-carbon sugar, is extremely unstable and immediately splits in half. The split forms
two molecules of a 3-phosphoglycerate (3-carbon).
Reduction
•
A phosphate group (from ATP) is then attached to each 3-phosphoglycerate by an enzyme, forming 1,3phosphoglycerate.
• NADPH swoops in and reduces 1,3-biphosphogycerate to G3P.
• For every six G3Ps produced by the Calvin Cycle, five are recycled to regenerate three molecules of RuBP. Only
one G3P leaves the cycle to be packaged for use by the cell.
• It will take two molecules of G3P to make one molecule of glucose.
• The ADP and NADP+ that is formed during the Calvin Cycle will be transported back to the thylakoid membrane
and will enter the light reactions. Here, they will be ‘recharged’ with energy and become ATP and NADPH.
Regeneration of RuBP
•
Five molecules of G3P undergo a series of complex enzymatic reactions to form three molecules of RuBP. This
costs the cell another three molecules of AT, but also provides another set of RuBP to continue the cycle.
What happens to G3P after its release from the cycle?
•
Two G3Ps can combine together to form either glucose or fructose which are both are six-carbon sugar.
•
Glucose and fructose can be combined to form sucrose.
•
Glucose can be connected in chains to form starch.
•
G3Ps can also be used in lipid and protein synthesis.
The cost of making carbohydrate:
To make one molecule of G3P, the chloroplast needs:
•
3 molecules of CO2
•
9 molecules of ATP
•
6 molecules of NADPH
PRACTICE (60 MINS)
Divide the learners into five or six groups. Orient the class on the nature of the activity, as described below:
Calvin Cycle 3-D Model Building
For this activity, each group has to gather materials that will help them build a three-dimensional model that represents the events or phases of the Calvin
Cycle. You may use clay, Styrofoam balls, beads, or recyclable materials. The outputs will be presented in class.
ENRICHMENT (60 MINS)
•
•
•
•
Ask the learners to work in groups for this activity.
Instruct them to research on photosynthetic adaptations of plants found in desert environments.
Assign the following topics for their research outputs: C3 plants, C4 plants, and CAM plants.
The groups may choose any method of presenting their outputs. They can opt for oral presentations, roleplaying, poem or song making, or using visual arts and media.
EVALUATION (30 MINS)
Ask the learners to answer the following questions:
118
•
Temperature and light intensity are two of the factors that may affect the rate of photosynthesis. Explain how
the said factors affect photosynthesis. Which of the two would you expect to have more effect on the rate at
which the Calvin Cycle proceeds? Why?
•
Many urban areas in our country are becoming less eco-friendly in exchange for new buildings and
commercialization. What do you think is the implication of this in relation to photosynthesis?
•
With your knowledge on photosynthesis, correlate the process in helping curb the effects of climate change.
General Biology 1
360 MINS
Energy Transformation - Cellular Respiration (Part 1 of
3)
LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of cellular respiration.
Introduction
As part of understanding by design, engage the
students in learning exploring and firming up.
5
Learning Competencies The learners:
•
•
Differentiate aerobic from anaerobic respiration (STEM_BIO11/12-IIa-j-6)
Motivation
Describe the role of oxygen in cellular respiration and describe pathways of electron
flow in the absence of oxygen (STEM_BIO11/12-IIa-j-10)
Specific Learning Outcomes
At the end of this lesson, the students must be able to;
1. determine the functional definition of cellular respiration;
2. compare fermentation with anaerobic and aerobic respiration;
3. explain how cells can produce ATP in the presence or absence of oxygen;
4. identify the metabolic pathways where aerobic respiration specifically occurs; and
5. explain how the lack of oxygen in the body results in eventual death of an organism.
Resources
To extend and refine your students’
understanding on energy transformation, you
may ask them regarding the function and
structure of the mitochondrion
10
Instruction/
Delivery
A series of activities with directions are indicated
below.
15
Practice
Post guide questions
Enrichment
Answer the modified true or false, make a graphic
organizer on aerobic and aerobic respiration and
accomplish the Venn diagram
60
Evaluation
Answer the multiple-choice questions and a
diagram that shows a comparison among
fermentation, aerobic and anaerobic respiration
30
240
•
Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGrawHill
•
Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
•
Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill
120
•
Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San Francisco USA:
Pearson Education, Inc.
•
Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
INTRODUCTION (5 MINS)
As part of learning exploration, let your students define cellular respiration. You may also ask students to describe process happening when they respire
using their respiratory system then connect this process of respiration to what is happening inside the cell (cellular respiration). Cellular respiration by
technical definition includes both aerobic and anaerobic respiration processes. But today cellular respiration is often used to refer to aerobic processes.
MOTIVATION (10 MINS)
To help your students analyze and identify attributes and components of the mitochondrion, ask them the following questions:
1. What are the major parts of the mitochondrion?
2. What is the function of each part?
3. What would happen if each part were missing?
4. What is your conclusion?
Give examples of answers from students and what conclusion you expect to give a good motivation to students
INSTRUCTION/DELIVERY (15 MINS)
Procedure
1. Determine and list the molecules that enter and the molecules that leave the metabolic pathways of aerobic cellular respiration.
2. The pictures below can be redrawn or printed so that the students can visualize the metabolic pathways of the glucose molecule.
3. Post the redrawn visual learning materials on the board. Tell the students to work this out individually.
Metabolic Pathways
Glycosis
Reactants and Products
Molecules that enter:
Molecules that leave:
Krebs cycle
Molecules that enter:
Molecules that leave:
Molecules that enter:
Electron Transport
Chain
Molecules that leave:
Provide
expected answers to the table
Teacher tip Teacher Tip:
To fill-out the table above, you may opt to give hint to your students:
Glycolysis: three molecules
Krebs cycle: three molecules those that enter and four those that leave ETC:
three molecules ergy forms exists and transformed.
Courtesy:
(2012).
Edition. USA:
August 13, 2015.)
Enger, Eldon D. et. al.,
Concepts in Biology 14th
McGraw-Hill (Retrieved
PROCEDURE
1. To extend and refine your students’ knowledge on cellular respiration, tell them to do the sample graphic
organizer below.
2. Fill-out the table and distinguish how the two types of respiration are alike and different. Then tell them to
write their conclusion based on the similarities and differences they have listed.
122
3. You may form three groups for this activity. Each group has to present the output(s) to the class using any
kind of visual learning materials.
Comparing Graphic Organizer
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How alike?
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How different?
Summary and Conclusion
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How alike?
Both undergo glycolysis in the cytoplasm of the cell
Both undergo substrate-level phosphorylation and oxidative phosphorylation and chemiosmosis in producing ATP molecules
Both split the 6-carbon glucose into two molecules of pyruvate, the three-carbon molecule
Both involve a series of enzyme-controlled reactions that take place in the cytoplasm
Both use NAD+ (nicotinamide adenine dinucleotide), a redox coenzyme that accepts two electrons plus a hydrogen (H+) that becomes NADH
Both performed by eukaryotic and prokaryotic cells
AEROBIC RESPIRATION
ANAEROBIC RESPIRATION
How different?
Maximum yield of 36 to 38 ATP molecules per glucose
Maximum yield of 2 ATP molecules per glucose for obligate anaerobes
Complete breakdown of glucose to carbon dioxide and water with the use of oxygen
Partial degradation of glucose without the use of oxygen (obligate anaerobes)
Multiple metabolic pathways
Single metabolic pathway (in fermentation)
Pyruvate proceeds to acetyl formation in the mitochondrion
Pyruvate is broken down to ethanol and carbon dioxide or lactate (in
fermentation)
The presence of enough oxygen in the cell makes the cell perform its job smoothly
without burning sensation
Cause burning sensation in the muscle during strenuous exercise (in
fermentation)
More efficient in harvesting energy from glucose with estimated 39% energy efficiency Less efficient in harvesting energy from glucose with 2% energy efficiency (for
(36-38 ATP) in eukaryotic organisms but much higher ATP production (38 to 40 ATP) in obligate anaerobes)
prokaryotic organisms
124
Outputs are carbon dioxide, water and ATP
Outputs are lactate, alcohol and carbon dioxide (in fermentation); but reduced
inorganic compound in anaerobic respiration
Products produce are for biochemical cycling and for the cellular processes that
require energy
Produce numerous products with economic and industrial importance through
fermentation
Slow glucose breakdown
Rapid breakdown of glucose
Electrons in NADH are transferred to electron transport chain
Electrons in NADH are transferred to electron transport chain; but in fermentation
electrons in NADH are transferred to organic molecule
Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis
Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis; but in fermentation substrate-level
phosphorylation only during glycolysis
O2 is the final electron acceptor of the electron transport system
In anaerobic respiration, inorganic substances like NO3- or SO42- are the final
acceptor of the electron transport system; but in fermentation, there is no
electron acceptor because it has no electron transport system.
Brain cells in the human body can only live aerobically. They die if molecular
oxygen is absent.
Some organisms like yeasts (eukaryotic), many bacteria (prokaryotic) and the
human muscle cells (eukaryotic) can make enough ATP to survive in
facultative anaerobes (can live in the absence or presence of oxygen). But
under anaerobic conditions lactic acid fermentation occurs. A facultative
anaerobe needs to consume the nutrient at a much faster rate when doing
the fermentation or anaerobic process.
Summary and/or Conclusion
Aerobic respiration requires molecular oxygen to happen in the cells of most eukaryotes and prokaryotes. Here, nutrients are split into a series of enzymecontrolled reactions producing an estimated 36 to 38 ATP per glucose complete breakdown. Molecular oxygen is the final acceptor of the low-energy level
electron at the end of the electron transport system that results in the production of water. In anaerobic respiration on the other hand does not require
oxygen in splitting nutrients. Some prokaryotes that live in oxygen-free environments such as water logged soil, in ponds where water does not flow, and in
the intestines of animals transfer glucose to NADH and then pass the electrons down the electron transport chain that is joined to ATP synthesis by
chemiosmosis. Nitrate and sulfate are the final acceptors of electrons. The end products are carbon dioxide, reduced inorganic substances and ATP. In
fermentation (as type of anaerobic respiration) there is no electron acceptor because it has no electron transport chain. Its products are either alcohol (and
carbon dioxide) or lactate.
Note: Clarify how many minutes should be allotted for this activity
ETC: A Metaphor
PROCEDURE
1. To describe how the electron transport system performs its function along the cristae (folds) of the mitochondrion, the students will prepare the
following materials: coloring materials, Manila paper(s), color papers, markers, pencil, and ruler.
2. The learners will make an analogy or a metaphor on how the electrons are being passed on to electron transport chain that result in the release of water.
3. In their drawing, they have to illustrate the participation of NADH, FADH2, hydrogen proton ion, electrons and oxygen along the electron transport
system. Review your students that the simultaneous cooperation of these carrier molecules and hydrogen atoms are being used to run ATP production by
chemiosmosis. They have to show that ATP and water are two of the products of ETC.
4. To facilitate their understanding, you can give them metaphoric examples such as bucket relay for ETC and a stair. A sample illustration is given below for
your reference.
5. Form four groups for this activity. You may form rubric for this part focusing on appropriateness of illustration with all key ideas and elements are put
together correctly.
126
Stair image courtesy of: Mader, Sylvia S. (2013). Biology 10th Edition. USA: McGraw-Hill (Retrieved August 15, 2015.)
Directions: The pictures below describe the pathways of electron in the absence of oxygen. Analyze it by arranging the seven metabolic pathways from
numbers 1 to 7 provided for you in the opposite table. The same procedure is followed in another table for fermentation with numbers 1 to 6.
Images courtesy of: Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill (Retrieved August 17, 2015.)
128
Metabolic Pathways Outside the Mitochondria: Glycolysis
(Note: This is not sequenced.)
Metabolic Pathways Outside the Mitochondria: Glycolysis (Note:
Arrange the pathways in order from 1 to 7.)
1 Water is released as 3PG is oxidized.
1
2 G3P is oxidized as NAD+ receives high energy-electrons coming
2
from the hydrogen atoms of C6H12O6.
3 Substrate-level ATP synthesis occurs.
3
4 Two Pyruvate molecules (3-carbon) are produced as the end
4
products of glycolysis.
5 Splitting of the 6-carbon sugar produces 3-carbon molecules.
5
6 Substrate-level ATP synthesis occurs (also called as substrate-
6
level phosphorylation).
7 Two ATP molecules are used to start glycolysis.
Metabolic Pathways Outside the mitochondria: Fermentation
(Note: This is not sequenced.)
G3P is oxidized as NAD+ receives high energy-electrons coming
from the hydrogen atoms of C6H12O6.
NAD+ is “freed” to return to the glycolytic pathway to pick up
more electrons.
Two ATP molecules are used to start glycolysis.
Two molecules of pyruvate are converted to ethanol (with CO2
as by-product) and lactate.
Splitting of BPG into two molecules of pyruvate is couple to
substrate-level ATP synthesis.
Splitting of the 6-carbon sugar produces 3-carbon molecules.
7
Metabolic Pathways Outside the Mitochondria:
Fermentation (Note: Arrange the pathways in order from
1 to 6.)
PRACTICE (240 MINS)
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Explain how NAD+, pyruvate, oxygen and ATP are involved in aerobic cellular respiration.
What is the role of oxygen in cellular respiration.
What are the members of the chain in the electron transport system?
What do the cristae (or folds) in the mitochondrion contain?
What happens to the hydrogen ions (H+) carried by NADH and FADH2?
Contrast the energy-investment step with the energy-payoff step of glycolysis.
How is aerobic cellular respiration different between prokaryotic and eukaryotic organisms?
What happens during electron transport and what it has to do with a proton pump?
Using arrows show in simple diagram the metabolic for glycolysis.
Explain how ATP can continue to be produced in the absence of oxygen.
Suggested Answers:
1. NAD+ accepts electrons and delivers them to the ETS. Pyruvate is the product of glycolysis. It is converted to acetyl-CoA and transferred to the Krebs cycle.
Oxygen is the final electron acceptor of the ETS and combines with hydrogen to form water. ATP is used in glycolysis to get the process going but ultimately
it is the most valuable molecule produced by aerobic respiration. All parts of aerobic respiration result in a net yield of ATP.
2. Oxygen molecule is the final acceptor of electrons from ETC. It receives the low energy electron from the last of the carriers (that is, cytochrome oxidase).
After receiving electrons, the oxygen molecule combines with hydrogen ions, and water is formed.
3. The members of the chain in sequence are the following: NADH-Q reductase, coenzyme Q, cytochrome reductase, cytochrome c, cytochrome oxidase.
These are the members of the chain which accept high-energy level electrons which they pass from one molecule to another.
4. The cristae contain the chain members (carrier molecules and protein complexes, ATP synthase complex and ATP channel protein (bulk of ATP is produced
by chemiosmosis).
5. The complexes of the ETC use the released energy to pump these hydrogen ions from the matrix into the intermembrane space of mitochondria.
6. If you want to earn, you really need to invest, and therefore you need a capital of some amount. During the energy-investment step, 2 ATPs are used to
split glucose into 2 pyruvate molecules. The split of glucose produces a gross of 4 ATPs and 2 NADH. 4 ATP- 2 ATP = 2 ATP net in the glycolysis.
7. Prokaryotic organisms do not have mitochondria. These organisms use a slightly different way to perform the Krebs cycle and ETC that results in slightly
more ATP than is produced by eukaryotic organisms.
8. The electron transport chain consists of a series of molecules which accept electrons and transfer them from one molecule to another. As electron is passed
on along the series, energy is released to run ATP production. As this happens, protons are pumped from one location to another in the mitochondrion.
130
Protons begin to build up in their new location. This creates a chemical gradient producing a bulk of ATP by chemiosmosis. These ATP molecules can be
used by the cell to do work.
9. Glucose
G3P
BPG
3PG
PEP
pyruvate
10. ATP can still be produced without oxygen. This can be done through anaerobic fermentation. A net of 2 ATP molecules are produced during glycolysis.
Glucose proceeds through the glycolysis pathway, producing pyruvate. This process “frees” NAD+ and it returns to the glycolytic pathway to up more
electrons to become NADH again.
ENRICHMENT (60 MINS)
Directions: This is a modified true or false activity. Write the word TRUE if the underlined word/phrase being referred to is correct. If it is false, change the
word/phrase to make the whole statement correct based on the concept of cellular respiration. Write your answer on the space provided before each
number.
_________1. Fermentation and anaerobic respiration enable the cells to produce ATP without the use of oxygen.
_________2. The term cellular respiration includes both aerobic and anaerobic processes.
_________3. Fermentation is a complete degradation of sugars or other fuel that occurs without the use of
oxygen.
_________4. An electron transport system consists of a number of molecules, majority are proteins, located in the
matrix of the mitochondria of eukaryotic cells and the plasma membrane of aerobic prokaryotes. _________5. Pyruvate oxidation
and the citric acid cycle, oxidative phosphorylation: electron transport chain and
chemiosmosis are the metabolic
stages reserved for cellular respiration.
_________6. The breakdown of glucose to carbon dioxide is completed in the electron transport chain. _________7. ATP
synthase is the enzyme that makes the bulk of the ATP from ADP and Pi by chemiosmosis _________8. ATP synthase uses the
energy of an existing hydrogen ion gradient to power ATP synthesis.
_________9. Phosphorylation of ADP to form ATP stores at least 14.6 kcal per molecule of ATP.
________10. Citric acid cycle generates 2 ATP whether oxygen is present or not, whether the conditions are
aerobic or anaerobic.
Suggested Answers:
1) True 2) True 3) Partial or incomplete 4) Cristae or folds 5) True 6) Krebs cycle 7) True 8) True 9) 7.3 kcal 10) glycolysis
Directions: Accomplish the table below by comparing aerobic and anaerobic respiration
Factors
Aerobic Respiration
Anaerobic Respiration
Factors
Aerobic Respiration
Anaerobic Respiration
Main function
Production of ATP from food such as
carbohydrate, lipid and protein
Production of ATP without the use of oxygen
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Cytoplasm and mitochondrion
36 to 38 ATP per glucose molecule
Long-term
Does not produce
Yes
Through the electron transport system
Cytoplasm
2 ATP per glucose molecule
Short-term
Produces
No
In lactic acid fermentation (i.e., muscle cells; in
alcohol fermentation (pyruvate is converted to
carbon dioxide and ethanol)
Participating cells
Most cells
Yeast, other fungi, prokaryotes, muscle cells
Main function
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Participating cells
Suggested Answers:
Directions: Compare aerobic and anaerobic respiration by accomplishing the Venn diagram below. Venn Diagram
of Aerobic and Anaerobic Respiration
132
EVALUATION (30 MINS)
Directions: Compare fermentation with anaerobic and aerobic respiration by analyzing the diagram below.
Diagram courtesy of: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill (Retrieved August 13, 2015)
1. What are the three kinds of enzyme-controlled reactions so that the chemical-bond energy from a certain nutrient is released to the cell in the form of
ATP?
2. What are the hydrogen electron acceptors for aerobic and anaerobic respiration as well as in fermentation?
3. These are the by-products of aerobic respiration that are considered low-energy molecules.
4. What are the outputs produced by anaerobic respiration? What about in fermentation?
5. What are two general metabolic mechanisms by which certain cells can oxidize organic fuel and generate ATP without the use of oxygen?
Suggested Answers:
1. Aerobic respiration, anaerobic respiration, and fermentation
2. aerobic respiration — molecular oxygen, anaerobic respiration — nitrate or sulfate, fermentation – pyruvate 3. Water
and carbon dioxide
4. Anaerobic respiration—ATP, water reduced acceptor (nitrate or sulfate), fermentation, ATP, carbon dioxide, alcohol or lactate
134
5. Anaerobic respiration and fermentation
Directions: This is a multiple-choice task. Encircle the letter of the correct answer.
1. Majority of the CO2 is released during
a.
Glycolysis
b.
Citric acid cycle
c.
Electron transport chain
d.
Oxidative phosphorylation
2. Cellular respiration processes that do not use O2 are called
a.
heterotrophic organism.
b.
anaerobic organism.
c.
aerobic organism.
d.
anabolic
3. The positively charged hydrogen ions that are released from the glucose during cellular respiration eventually
combine with _________ ion to form ______
a.
another hydrogen, a gas
b.
a carbon, carbon dioxide
c.
an oxygen, water
d.
a pyruvic acid, lactic acid
4. The Krebs cycle (also known as citric acid cycle or tricarboxylic acid) and ETC are biochemical pathways
which eukaryotic organelle?
a.
nucleus
b.
ribosome
c.
chloroplast
performed in
d.
mitochondrion
5. Anaerobic pathways that oxidize glucose to generate ATP energy by using an organic molecule as the ultimate
hydrogen acceptor are called
a.
fermentation.
b.
reduction.
c.
Krebs cycle.
d.
Electron pumps
6. When skeletal muscle cells function anaerobically, they accumulate the compound________, which causes
muscle
soreness.
a.
pyruvic acid
b.
malic acid
c.
carbon dioxide
d.
lactic acid
7. Each molecule of fat can release ______ of ATP, compared with a molecule of glucose.
a.
smaller amounts
b.
the same amount
c.
larger amount
d.
only twice the amount.
8. In complete accounting of all ATPs produced in aerobic respiration, there a total of ________ATPs: ______
ETC, _____ from glycolysis, and _______ from the Krebs cycle.
a.
36, 32, 2, 2
b.
38, 34, 2, 2
c.
36, 30, 2, 4
d.
38, 30, 4, 4
136
from the
9. The chemical activities that remove electrons from glucose result in the glucose being
a.
reduced.
b.
oxidized.
c.
phosphorylated.
d.
hydrolyzed.
10. Which of the following is NOT true of the citric acid cycle? The citric acid cycle
a.
includes the preparatory reaction
b.
produces ATP by substrate-level ATP synthesis
c.
occurs in the mitochondria
d.
is a metabolic pathway, as is glycolysis
Suggested Answers:
1. b 2.b 3.c 4.d 5.a 6.d 7.c 8.a 9.b
10. a
General Biology 1
Energy Transformation - Cellular
Respiration (Part 2 of 3)
Content Standard
The learners demonstrate an understanding of cellular respiration.
Specific Learning Outcomes
At the end of this lesson, the students must be able to:
1. Identify the major stages of cellular respiration;
2. Identify the organelles involved for each stage of cellular
respiration.
3. Describe the following for each stage of cellular respiration:
process, starting materials, and end products of aerobic
respiration.
420 MINS
Learning Competencies The learners:
•
•
Explain the features and sequence the chemical events of cellular respiration
(STEM_Bio11/12-IIa-j-7)
Distinguish major features of glycolysis, Krebs cycle, electron transport system,
and chemiosmosis (STEM_Bio11/12-IIa-j-8)
LESSON OUTLINE
Introduction
Communicate to the class the learning
competencies. Review the reactants and
products of cellular respiration
5
Motivation
Show a picture of students eating at the
school canteen, then show questions
15
Instruction/
Delivery
A 3-D model of a mitochondrion made from
re-usable materials
Enrichment
Do the jigsaw activity and people hunting and 90
applying knowledge of biochemical pathways
Evaluation
Fill-in the necessary information for cellular
respiration and the 3-2-1 Closing
250
60
Resources
•
•
•
Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San Francisco USA: Pearson Education,
Inc.
Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole
Suggested Media Tools:
•
www.mhhe.com/maderbiology11
•
www.masteringbiology.com
•
www.biologycorner.com
For animations, video, learning outcomes, chapter outline, image PowerPoint, essay quiz, thinking
critically, practice test and concept maps
http://highered.mheducation.com/sites/0073403466/student_view0/ chapter7/image_powerpoint.html
http://highered.mheducation.com/sites/0073525502/student_view0/ chapter7/index.html
INTRODUCTION (5 MINS)
Communicate to the class the learning competencies. Then go over the reactants and
products of cellular respiration.
You may ask them the following questions:
1. How many molecules of ADP as reactant are needed to
produce about 38 molecules of ATP for eukaryotic organisms?
2. Which groups in the cellular respiration equation go in?
3. Which groups are released?
Suggested Answers:
1. About 36 to 38 ADP molecules (NOTE: This number is just a
ratio. Some biology authors say there are 30, 32 or 34 ADP (or
ATP) molecules depending on the shuttle used to transport the
electrons and on the kind of species.)
2. Groups that go in: carbohydrate and molecular oxygen
3. Groups that are released: carbon dioxide, water and energy
(ATP)
NOTE: Cellular respiration is one of the more difficult topics in
biology. To capture the general picture of the topic, students have
to be encouraged to read and re-read the key concept, write and
re-write, outline and re-outline, draw and re-draw, and to recite
orally if they want the ideas to sink in their system. Patience and
steadfastness are important virtues that should be included as you
study this concept.
MOTIVATION (15 MINS)
Post a color picture of a group of students eating at the school
canteen. To establish healthy academic atmosphere and
camaraderie, ask them if they know one who is a friend of them.
Then ask the following questions:
1. If one of the students who ate would pay to the cashier a bill in
US dollar, would the cashier accept the money as a form of
payment for the food ordered?
138
Teacher tip
Emphasize that both prokaryotic and eukaryotic organisms need food in order to get the energy needed to
adapt to many things in the environment and to perform bodily processes such as growth, repair,
reproduction, maintenance of homeostasis, etc.
4. Just like the US dollar bill and the 1000-peso money cheque,
the glucose (carbohydrate) in the food that we eat is a
principal high-energy molecule that has to be digested into
smaller molecules in order to release the high energy
molecule that is highly recognized by the cell. What do you
call this molecule that serves as the “energy currency of the
cell”?
5. After this group of students ate the food at their school
canteen, how do they obtain energy from these food (protein,
carbohydrate, fat) molecules?
Process the answers of the students related to the US dollar bill.
Give the relationship of this analogy to the current topic.
INSTRUCTION/DELIVERY (250 MINS)
Suggested Answers:
1.
2.
3.
4.
No
Encash the 1000-peso cheque first at the bank.
Convert the US dollar bill to Philippine Peso and encash the 1000-peso bill cheque at the bank.
ATP or Adenosine Triphosphate, a form of nucleic acid
2. If one of the students ate combo meal and the amount of the food eaten is P49.00
and he gave out 1000-peso money cheque to the cashier, what do you think the
cashier would ask to the student? (Assuming that the student is the first customer
of the day).
3. What should the students do (one with a US dollar bill and one with a 1000-peso
money cheque) to make their money more functional?
Activity 1: 3-D Mitochondrion Model
1. Let your class form triad. Give a model color picture of a
mitochondrion that will serve as their guide for the 3-D
mitochondrion. Print color pictures of a mitochondrion and
give one to each group.
2. To make a 3-D model of a mitochondrion, prepare the
following materials: Old newspapers, metal wires, starch
(serves as paste), vinegar, acrylic paint, and paintbrush.
3. The sizes of the 3-D model mitochondrion are: Length — 24
inches, width — 14 inches, height — 8 inches.
4. From the metal wire, mold a mitochondrion based on the
sizes given. The cristae of the mitochondrion can be formed
through the metal wire.
5. Prepare a mixture for the starch (this will serve as your paste)
as follows: 2 cups water, 2 cups starch, 1 cup vinegar. Mix the
materials together under normal fire for 3-5 minutes.
6. With the old newspapers collected from the students’ neighbors, tell your
students to wet the newspapers with paste and glue them on to the metal wire.
7. Let the model dry up before they paint the 3-D model mitochondrionProvide
expected answers to the table
1. Inform your students to bring the following materials: Oslo
paper (or long bond paper), coloring materials, pencil and a
ballpen.
2. Let them draw and color, and label the model picture of a
mitochondrion below.
3. The rubric for the drawing and coloring is given to help in the
objective scoring of the output coming from your students.
4. The students will proceed to labeling. There are 10 blanks to
be filled-in.
5. Then proceed to discussion by giving them processing
questions.
5. The complex food molecules are broken down by digestion into simpler substances that are absorbed
by the body through the bloodstream. These food molecules will then be transported to all their cells.
Breaking down of food is a catabolic process that converts the energy in the chemical bonds of nutrients
to chemical energy stored in ATP that occur inside the cells of these students. This process in known as
cellular respiration.
NOTE: The US dollar currency is not directly used in everyday transaction. It has to be converted into
usable form such as the Philippine money.
Cellular respiration is different from organismic respiration. The latter refers to the exchange of gases such
as oxygen and carbon dioxide with the environment by living organisms, particularly animals with special
organs such as lungs and gills, for gas exchange.)
Teacher Tip
Inform the groups of students one week prior to this topic to give way to the preparation and designing of
a 3-D model of a mitochondrion. You may form three groups. Give each group a model color picture of a
mitochondrion that will serve as their template for the 3-D.
Rubrics for Drawing and Coloring
Teacher tip
̌For the drawing, coloring and labeling of the parts of a mitochondrion, you may
print the picture in color and post it on the board for everyone to see.
Activity 2: Drawing, Coloring and Labeling
Standard
Excellent (7 points)
Good (5 points)
Fair (3 points)
Contrast and intensity of
drawing
Shows exceptional artistic
and skillful color contrast;
and meaningful color
concentration
Shows generally acceptable
artistic and skillful color
contrasts; and meaningful
color concentration
Shows generally vague color
contrasts; and indiscernible
sense of color concentration
Blending of colors
Color mix is exceptionally
creative, appropriate and
meaningful
Color mix is generally creative,
appropriate and meaningful
Color mix needs
improvement
Neatness
Completely free from mess
Almost free from mess
Too messy
140
Model Picture of a Mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition.
China: Thomson Brooks/Cole (Retrieved July 20, 2015)
Activity 3: Sequencing Cellular Respiration
Procedure:
1. Group the class into three. Fill-in the missing information to
make the graphic organizer complete. Few examples are given.
2. Report the output to the class. You will be graded according to
the following rubric.
NOTE: Students might find this difficult to accomplish. To facilitate
better understanding for this Teacher tip Insight:
The reason why we humans breathe is to get the oxygen into our cells. Recall that
at the end of the electron transport chain, hydrogen ions are being welcomed by
the oxygen molecules to produce a by-product called water.
activity, tell them to research on the major events of cellular respiration (e.g. how glucose gets into the cell and how it becomes converted into ATP). Your
students should be able to see the major events (though the events are happening simultaneously). You may also prepare a set of reading materials
(including diagrams and/or pictures) given to each group and let every member of the group analyze the text and be able to sequence and narrate the major
events of cellular respiration.
Suggested Rubrics
Standard
Content knowledge
Excellent (10 points)
Good (7 points)
Fair (4 points)
Information is complete
and accurate
Information is mostly
complete and accurate
Information is mostly
incomplete and
inaccurate
Originality in
organization of ideas
Exceptionally well
organized and
understandable
Generally well-organized
and understandable
Fairly understandable
STAGE 1: Glycolysis
This is what happens:
During this stage, glucose (the six-carbon molecule) is split into two molecules of
pyruvate (which contains three carbons). A net of two ATP molecules is produced by
substrate-level phosphorylation during glycolysis. In addition, there are four
hydrogen atoms are removed and are used to produce two NADH (an electroncarrier molecule that enters mitochondrion Note: You can say more at this stage.
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole (Retrieved August 2, 2015)
142
This is what happens:
STAGE 4: ______________________
Activity 4: Watch Summary Video for Aerobic Respiration (If materials are available)
Cellular Respiration Video\www.youtube.comwatchv=00jbG_cfGuQ.mp4 (Retrieved August 3, 2015)
Cellular Respiration Video\www.youtube.comwatchv=-Gb2EzF_XqA.mp4 (Retrieved August 3, 2015)
Directions: With the help of your instructional materials (e.g. in tarpaulin form, PowerPoint Presentation or even simple pictures that are visually attractive
and accurate) ask the following processing questions. Allow the pictures and the boardwalk to speak to your students.
Processing Questions:
1. How many metabolic pathways are present in aerobic respiration?
2. Where in the cell part does glycolysis take place? What about the formation of Acetyl CoA, Krebs cycle and the electron transport chain and
chemiosmosis?
3. How many reduced NADH molecules are produced after the glucose has been completely broken down to ATP? And what stage of the aerobic
respiration is glucose completely broken down to carbon dioxide?
144
4.
5.
6.
7.
8.
9.
10.
As glucose is split in the cytosol of the cell, is there a release of carbon dioxide as by-product of the reaction?
What molecule accepts the hydrogen atoms at the end of electron transport chain?
What is the major goal of NADH and FADH2 in aerobic respiration?
Why do you think the cell needs to digest glucose or any other nutrients such as protein and fats?
Among the metabolic pathways of cellular respiration, which phase is the major contributor of ATP?
What happens to pyruvate if oxygen is not available in the cell?
How many acetyl-CoAs are produced from each glucose molecule?
Suggested Answers:
1. Three metabolic pathways
2. Glycolysis takes place in the cytoplasm or cytosol; formation of acetyl CoA, Krebs cycle, ETC and chemiosmosis all take place in the mitochondrion
3. 10 NADH molecules; glucose is completely broken down carbon dioxide at the Krebs cycle
4. No
5. Oxygen molecule
6. The goal of NADH and FADH2 is to transport the electrons coming from the hydrogen atoms (in glucose) to the electron transport chain
7. The cell has to digest glucose, fat, and protein in order to convert them into usable form of energy molecule called adenosine triphosphate. This ATP is
the only molecule that is recognized by the cell for all of its cellular activities.
8. Among the metabolic pathways in aerobic respiration, the electron transport chain (or oxidative phosphorylation) makes about 90 per cent of ATP per
glucose molecule.
9. The pyruvate will not proceed to the formation of acetyl CoA. The pyruvate will become lactic acid in animal and alcohol in plant. 10. Two
3. All the members in each group will
ENRICHMENT (90 MINS)
be given enough time to read over
Directions: Read the procedures below on how the jigsaw and expert groups are formed. PART I:
their assigned topic for them to
Jigsaw Activity Procedure:
become familiar with it.
1. Form a group having four members. Each student-member in the group will be assigned to a certain phase of
4. From the “jigsaw group” previously
cellular respiration (1. glycolysis, 2. preparatory reaction, 3. citric acid cycle, 4.electron transport chain). Each
formed, the so-called “expert
group will be called “jigsaw group”.
group” will then be formed. Those
2. Each group will be given handouts (with texts and pictures/diagrams—samples of these pictures are shown
assigned in glycolysis from each
below) with the help of its leader and distribute them to his/her group mates. The handouts contain
group will be grouped as “expert
information about cellular respiration. Other helpful tools such as biology textbook, Internet can be used to
group” in glycolysis. The same
facilitate their learning of the topic.
procedure will be done to
preparatory reaction, citric acid cycle and electron transport chain — “expert groups” will
be formed from these remaining topics.
5. These “expert groups” will be given enough time to discuss the main points of their
assigned topic and to rehearse for the presentation.
6. After a certain amount of time, each student from the “expert group” will go back to
his/her “jigsaw group”.
7. Each member from the “jigsaw group” will this time begin to present his/her topic to the
whole class.
Teacher tip
•
•
•
•
•
Encourage each member to ask question(s) for clarifications.
Provide cellular respiration handouts/ diagrams for each group to discuss.
For this part, provide a rubric for the presentation that each group has to make.
Writing the definitions of the terms can help your students better understand the concept.
Glycolysis – means “sugarsplitting” that occurs in the cytosol of the cell. It does not require oxygen to breakdown glucose into
pyruvate.
•
Krebs cycle – completes the metabolic breakdown of glucose to carbon dioxide and produces 2 ATP.
•
Oxidative phosphorylation – a process occurring in mitochondria and accounts for majority of the ATP
production.
•
Electron Transport Chain – contains the chain members (carrier and protein complexes, ATP synthase
complex and ATP channel protein. These membrane proteins shuttle electrons during the redox reactions.
The electrons will be used to produce ATP by chemiosmosis.
•
NADH and FADH2 – these are electron acceptor molecules that contain high-energy
Standard
electrons. They transport the electrons to ETC to produce many more ATPs by
oxidative phosphorylations.
Content knowledge
•
ATP synthase – is an enzyme
that is responsible for the great production of ATPs. This happens when it uses the energy
coming from H+ ions to bind ADP and phosphate group together to produce ATP.
Originality in
organization of ideas
Teacher Tip
Excellent (10 points)
Good (7 points)
Fair (4 poin
Information is complete
and accurate
Information is mostly
complete and accurate
Information
incomplete
inaccurate
Exceptionally well
organized and
understandable
Generally wellorganized
and understandable
Fairly under
The diagram on the left shows the total energy produced from the complete breakdown of glucose by aerobic respiration.
146
Rubric for the Report
PART II
People Hunt
1.
Prepare four sets of paper strips. Set A contains the four stages of cellular respiration. Set B contains the summary for each stage. Set C
contains starting materials for each stage. Set D contains end products for each stage.
2.
Twelve students will be asked to volunteer. Randomly, each of these volunteers will be given strips of paper (NOTE: tell them not to
read yet the information written on the strip of paper).
3.Student-volunteers will be asked to scatter around the room. After this, instruct them that there are four stages of cellular respiration (please refer back to
the procedure number 1). The student-volunteers will be given time to find their group mates correctly for each specific stage based on the paper strip(s)
they are holding.
4.
Tell each group for each stage to line up at the four corners of the room (north, south, east, west side of the room) and check if each member has
found their group mates correctly.
Summary of Cellular Respiration
Stage
Summary
Some Starting Materials
Some End Products
1. Glycolysis (in cytosol)
Series of reactions in which glucose is degraded to pyruvate; net profit of 2 Glucose, ATP, NAD+, Pi
ATPs; hydrogen atoms are transferred to carriers; can proceed
anaerobically
Pyruvate, ATP, NADH
2. Formation of acetyl CoA
(in mitochondria)
Pyruvate is degraded and combined with coenzyme A to form acetyl CoA;
hydrogen atoms are transferred to carriers; CO 2 is released
Pyruvate, coenzyme A,
NAD+
Acetyl CoA, CO2,
NADH
3. Citric acid cycle (in
mitochondria)
Series of reactions in which the acetyl portion of acetyl CoA is degraded to
CO2; hydrogen atoms are transferred to carriers; ATP is synthesized
Acetyl CoA, H2O, NAD+, FAD,
ADP, Pi
CO2, NADH, FADH2, ATP
4. Electron transport and
chemiosmosis (in
mitochondria)
Chain of several electron transport molecules; electrons are passed along
chain; released energy is used to form a proton gradient; ATP is
synthesized as protons diffuse down the gradient; oxygen is final electron
acceptor
NADH, FADH2, O2, ADP, Pi
ATP, H2O, NAD+, FAD
Applying Knowledge of Biochemical Pathways
As scientists have developed a better understanding of the processes of aerobic cellular respiration and anaerobic cellular respiration, several practical
applications of this knowledge have developed:
148
•
Although for centuries people have
fermented beverages such as beer
and wine, they have often plagued
by sour products that were
undrinkable. Once people
understood that there were yeasts
that produce alcohol under
anaerobic conditions and bacteria
that converted alcohol to acetic
acid under aerobic conditions, it
was a simple task to prevent acetic
acid production by preventing
oxygen from getting to the
fermenting mixture.
•
When it was discovered that the
bacterium that causes gas gangrene
uses anaerobic respiration and is, in
fact, poisoned by the presence of
oxygen, various oxygen therapies
were developed to help cure
patients with gangrene. Some
persons with gangrene are placed in
hyperbaric chambers, with high
oxygen levels under high pressure.
In other patients, only the affected
part of the body is enclosed. Under
such conditions, the gangrenecausing bacteria die or are
inhibited.
•
Spoilage, or putrefaction, is the
anaerobic respiration of proteins
with the release of nitrogen and
sulfur-containing organic
compounds as products. Protein
fermentation by the bacterium
Clostridium produces foul-smelling
chemicals such as putrescine,
cadavarine, hydrogen sulfide, and
methyl mercaptan. Clostridium
perfringens and C. sporogenes are
the two anaerobic bacteria
associated with the disease gas
gangrene. A gangrenous wound is a
foul-smelling infection resulting
from the fermentation activities of
those two bacteria.
•
Because many disease-causing
organisms are prokaryotic and have
somewhat different pathways and
enzymes than do eukaryotic
organisms, it is possible to develop
molecules, antibiotics that
selectively interfere with the
enzymes of prokaryotes without
affecting eukaryotes, such as us
humans.
150
•
When physicians recognized that
the breakdown of fats releases
ketone bodies, they were able to
diagnose diseases such as diabetes
and anorexia more easily, because
people with these illnesses have
bad breath.
•
In starvation and severe diabetes
mellitus, the body does not
metabolize sugars properly, and it
shifts to using fats as its main
source of energy. When this occurs,
the Krebs cycle is unable to perform
as efficiently and the acetyl CoA
does not move into the
mitochondria. It accumulates in the
blood. To handle this problem, the
liver converts acetyl CoA to ketone
bodies (e.g., acetoacetic acid). As
ketone bodies accumulate in the
blood, the pH decreases and the
person experiences ketosis, or
ketoacidosis, with symptoms such
as an increased breathing rate; in
untreated cases, it can lead to
depression of the central nervous
system, coma, and death.
Adapted from: Enger, Eldon D. et al., Concepts in Biology 14th edition. USA: McGraw-Hill
EVALUATION (60 MINS)
Table 1 Suggested Answers:
Teacher tip
Directions: Complete the tables below by filling-in the necessary information for aerobic respiration.
Glycolysis outputs:
•
Table 1: Inputs and Outputs of Glycosis
•
•
•
Glycosis
Inputs
2 pyruvate
• 2 NADH
2 ADP
4 ATP total
2 ATP net gain
Outputs
Table 2 Suggested Answers:
Citric Acid Cycle inputs:
1.
Glucose
1
2.
2 NAD+
2
3.
2 ATP
3
4.
4 ADP + 4 P
4
•
•
•
•
2 acetyl groups
6 NAD+
2 FAD
2 ADP + 2 P
Table 3 Suggested Answers:
Total:
First Column
Glycolysis-ATP-SLP= 2 ATP net Krebs-ATP-SLP= 2
ATP
Table 2: Inputs and Outputs of Citric Acid Cycle
Total-ATP-SLP= 4 ATP
Citric Acid Cycle
Inputs
Outputs
1
1. 4 CO2
2
2. 6 NADH
3
3. 2 FADH2
4
4. 2 ATP
Second Column
Glycolysis-HEA= 2 NADH
Prep-HEA= 2 NADH
Krebs-HEA= 6 NADH and 2 FADH2
Third Column
Glycolysis-ATP-OP= 4-6 ATP
Prep-OP= 6 ATP
Krebs-ATP-OP= 18 ATP and 4 ATP
Prep-S= 6 ATP
Krebs-S= 24 ATP Total-S=
36-38 ATP
Table 3: ATP Harvest from Aerobic Respiration
Phases in
Aerobic
Respiration
ATP produced by
Substrate-Level
Phosphorylation
High-energy
Electron
Acceptors
ATP produced by
Oxidative
Phosphorylation
Sub-total
Table 4 Suggested Answers:
Glycolysis
Preparatory
Reaction
Starting materials
G: Glucose, ATP, NAD+, ADP, P
F: Pyruvate, CoA, NAD+
K: Acetyl CoA, H2O, NAD+, FAD, ADP, P E:
NADH, FADH2, O2, ADP, P
--
Krebs cycle
Total
--
Table 4: Starting Materials and End Products of Aerobic Respiration
Stage
Glycolysis (in cytosol)
Formation of Acetyl CoA (in
mitochondria)
Starting Materials
End Products
End Products
G: Pyruvate, ATP, NADH
F: Acetyl CoA, CO2, NADH
K: CO2, NADH, FADH2, ATP
E: ATP, H2O, NAD+, FAD
General Biology 1
--
Krebs cycle (in mitochondria)
Electron Transport Chain and
Chemiosmosis (in mitochondria
--
Directions: As part of performance assessment, let the students do the 3-2-1 Closing. On their ½ crosswise
paper, they write
3 things/concepts/key ideas they have learned in the lesson(s);
2 things/concepts/key ideas they have questions about the lesson(s); and
1 thing/concept/key idea they want the teacher to know about in connection to the lesson(s) discussed.
Teacher tip
Total-ATP-OP=32-34
Fourth Column
Glycolysis-S= 6-8 ATP
Energy
Transformatio
n - Cellular
Respiration
(Part 3 of 3)
Content Standard
The learners demonstrate an
understanding of cellular respiration.
Performance Standard
152
The leaners prepare simple fermentation setups using common fruits to produce wine or vinegar via
microorganisms
Practice Answer the guide questions
Learning Competency The learners:
vinegar making
•
Evaluation
Enrichment
1. Explain the advantages and disadvantages of fermentation and aerobic respiration (STEM_Bio11/12-IIa-j-12)
aerobic
Specific Learning Outcomes
At the end of this lesson, the students must be able to:
1. Tabulate and explain the advantages and disadvantages of fermentation, anaerobic respiration and aerobic
respiration;
2. Show the similarities and differences of fermentation, anaerobic respiration and aerobic respiration;
3. Compare the pathways of carbohydrate, fat, and protein catabolism.
Prepare materials for
Compare and explain
40
respiration,
anaerobic
respiration and
fermentation, their
advantage and
disadvantage
240 MINS
Resources
LESSON OUTLINE
Introduction
•
Discuss the nature of science with regard to
15
cellular respiration. Raise several questions for
the students to think about
Motivation
Show a diagram of metabolic pool concept and 5
ask few questions
Instruction/
Delivery
Let the students do activities on advantages
and disadvantages of aerobic and anaerobic
respiration and fermentation together with
their similarities and differences; prepare
homemade virgin coconut oil and
fermentation
•
•
15
INTRODUCTION (15 MINS)
Communicate the learning competencies for this topic. You can enumerate some products (or show pictures) of
fermentation. You may opt to insert and discuss the nature of science with regard to cellular respiration. For
•
•
Alumaga, Maria Jessica B. et al., (2014).
Science and Technology 9. Quezon City:
Vibal Publishing House
Bawalan, Divina D. and Chapman, Keith
R. (2006). Virgin Coconut Oil: Production
Manual for Micro- and Village-scale
Processing. Thailand:
FAO Regional Office for Asia and the
Pacific
Mader, Sylvia S. (2010). Biology 10th
Edition. USA: McGraw-Hill
Rabago, Lilia M. et al., (2014). Science
and Technology Laboratory Manual and
Workbook for Grade 9 Quezon City:
Vibal Group, Inc.
Solomon, Eldra P. et al., (2008). Biology
8th Edition. China: Thomson
Brooks/Cole
instance, athletes and trainers today are constantly finding ways to improve their performance in a particular
event such as in triathlon by boosting cellular respiration. Why is meant by carbo-loading?
Or as you go to the supermarket, you will see several kinds of energy drinks, are they safe to drink? What are the
health implications if a person drinks them excessively? What about energy-boosting vitamins, are they really
beneficial for the body? Or is it safe to drink an energy-boosting fluid rich in vitamin B-complex and other related
substances when your stomach is empty? If you want to jump-start your mitochondria, would you rely on
alternative medicine? These are interesting issues to discuss and bring to the whole class to think about.
MOTIVATION (5 MINS)
Show a metabolic pool concept to the class and ask the following questions:
1. What are the three kinds of food that provide the building blocks for the cells, and that all can provide energy?
2. What are the basic metabolic pathways organisms use to extract energy from carbohydrates in aerobic
respiration? What about for proteins and fats? Are the pathways the same or not?
3. To which pathway do glycerol and fatty acids of fat enter?
Suggested Answers:
1. Carbohydrates, proteins, and fats.
2. Glycolysis, Krebs cycle, electron transport chain—for carbohydrates, proteins and fats. The metabolic
pathways for these three kinds of food are the same except that for proteins and fats, there are additional
steps to get fats and proteins ready to enter the specific pathway as shown in the diagram.
3. Glycerol enters glycolysis; fatty acids enter preparatory reaction.
INSTRUCTION/DELIVERY (15 MINS)
Directions: Tabulate and explain the advantages and disadvantages of fermentation, anaerobic respiration and aerobic respiration. Show their similarities
and differences.
Procedure:
1. Form five groups. Each group has an assigned topic to work on. The following groups are as follows:
•
GROUP 1: To work on the differences among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can as long as
the description written fits for the particular organism.
154
•
GROUP 2: To work on the similarities among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can as long as
the description written fits for the particular organism.
•
GROUP 3: To work on and explain the advantages and disadvantages of aerobic respiration.
•
GROUP 4: To work on and explain the advantages and disadvantages of anaerobic respiration.
•
GROUP 5: To work on and explain the advantages and disadvantages of fermentation.
2. Show to the class a sample table on how you want them to display, outline and report the information to the whole class.
3. Tell them to prepare Manila papers, marker, or any visual materials.
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Differences
Aerobic Organisms
Similarity
Anaerobic Organisms
Fermenting Organisms
Aerobic, Anaerobic and Fermenting
Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Advantages of Aerobic Respiration
Advantages of Anaerobic Respiration
Advantages of Fermentation
Disadvantages of Aerobic Organisms
Disadvantages of Anaerobic Organisms
Disadvantages of Fermenting Organisms
Suggested Answers:
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Differences
Similarity
Aerobic Organisms •
Use oxygen.
Anaerobic Organisms • Do
Fermenting Organisms
Aerobic, Anaerobic and
not use oxygen.
•
•
Fermenting Organisms •
ATP is produced.
•
H2O is the by-product.
•
Electron acceptor is O2
and is reduced to water.
•
With electron transport
chain.
With electron transport
chain.
•
Occur in prokaryotes and
eukaryotes.
•
Electron acceptor is nitrate •
or sulfate.
•
Occur in prokaryotes.
•
•
•
•
•
H2O and potassium
nitrite are the byproducts.
Requires no special
organelles
•
•
•
Do not use oxygen.
Lactate (lactate fermentation) or ethyl alcohol
(alcoholic fermentation) is the byproduct.
Final acceptors of electrons are pyruvate
reduced to lactate, and acetaldehyde reduced
to ethyl alcohol.
No electron transport chain.
Occur in prokaryotes and eukaryotes.
Simple and faster alternative to cellular
respiration
Requires no special organelles
Glycolysis and waste product formation are
two sets of reactions that occur.
•
CO2 is the waste product.
•
Electrons are transferred from
glucose to NADH.
168
Advantages of Aerobic Respiration
Advantages of Anaerobic Respiration
Advantages of Fermentation
•
All available energy extracted from glucose is •
36 to 38 ATP.
All available energy extracted from
glucose is 40 ATP (because
prokaryotes have no mitochondria).
•
All available energy extracted from glucose is 2 ATP.
•
Certain bacteria produce chemicals of industrial
importance such as isopropanol, butyric acid, acetic
acid when bacteria ferment—breakdown of sugars in
the absence of oxygen.
•
Foods that are fermented last longer because these
fermenting organisms have removed many of the
nutrients that would attract other microorganisms.
•
Can breathe heavily to refill the cells with
oxygen so that lactate is removed from the
muscle cells.
Yeasts ferment fruits and wine is produced. Grain is
also fermented to produce beer. They also cause the
bread to rise due to CO2, a by-product, and alcohol is
lost in the bread.
•
Lactate is returned to the liver to become
pyruvate or glucose again.
Yeasts and lactobacillus together produce sour taste in
wheat beer.
•
Yeasts and Acetobacter aceti spoil wine to become
vinegar.
•
Bacterial fermentation produces yogurt (due to
Streptococcus thermophilus and Lactobacillus
bulgaricus), sour cream, cheese, brine cucumber
pickles, sauerkraut, and kimchi.
•
Clostridium bacteria can produce nail polish remover
and rubbing alcohol from the acetone and isopropanol
they make
•
Soy sauce is produced by adding mold
(Aspergillus), yeasts and fermenting bacteria.
•
39% energy transferred from glucose to ATP.
•
Slow breakdown of glucose into ATP.
•
•
Organisms can do more work for a longer
time with the slow and efficient breakdown
of ATP.
43% energy transferred from glucose
to ATP.
•
Complete breakdown of glucose.
•
•
•
•
Animals and the human muscle cells can
adapt and perform lactic acid fermentation
for a rapid burst of energy.
Complete breakdown of glucose.
Disadvantages of Aerobic Organisms
Disadvantages of Anaerobic Organisms
158
Disadvantages of Fermenting Organisms
•
61% of glucose metabolism becomes heat
and enters the environment.
•
Human brain cells cannot perform lactic acid
fermentation.
•
Human muscle cells feel the burning
sensations and pain when lactate
accumulates in the cell and experience
oxygen debt.
•
57% of glucose metabolism becomes heat and
enters the environment.
•
Consumption of 2 ATP is fast.
•
Ethanol and lactate, the by-products of
fermentation, have a lot of energy reserves—
prokaryotes and eukaryotes cannot extract
the energy in lactate and ethanol using
anaerobic method.
•
Needs a large supply of glucose to perform
the same work as in aerobic respiration.
•
Glucose is partially oxidized.
Directions: Compare aerobic respiration, anaerobic respiration and fermentation in terms of the following factors listed in the
first column.
Activity Title: Comparison of Aerobic and Anaerobic Respiration and Fermentation
Factors
Aerobic Respiration
Anaerobic Respiration
Fermentation
Immediate fate of electrons in
NADH
Terminal electron acceptor of
electron transport chain
Reduced Product(s) formed
Mechanism of ATP synthesis
Suggested Answers:
Factors
Aerobic Respiration
Anaerobic Respiration
Fermentation
Immediate fate of
electrons in NADH
Transferred to electron
transport chain
O2
Terminal electron
acceptor of electron
transport chain
Reduced Product(s)
formed
Mechanism of ATP
synthesis
Inorganic substances such
as NO3-- or SO4 2-
No electron transport
chain
Water
Relatively reduced
inorganic substances
Relatively reduced organic
compounds
(e.g., alcohol or lactate)
Oxidative
phosphorylation/
chemiosmosis; also
substrate-level
phosphorylation
Oxidative phosphorylation/
chemiosmosis; also
substrate-level
phosphorylation
Substrate-level
phosphorylation only
(during glycolysis)
Activity Title: Homemade Virgin Coconut Oil and Fermentation
Materials needed:
Fermentation containers (food-grade transparent plastics), basin or stainless stock pots, ladle (long spoon with
deep bowl), cheesecloth (katsa), five fully matured nuts and coconut water, funnel, hand soap, water, cotton
wool, glass bottle or PET bottle
Procedures:
•
•
The natural fermentation method has two parts: (1) extraction and preparation of coconut milk and
(2) processing of VCO from the milk
The process for extracting, preparing and processing of VCO from the coconut milk are as follows: 1.
Teacher Tip:
Fermentation refers to the addition of yeast or a specific microorganism or enzyme to a raw material to produce a desired product. But
for the so-called natural fermentation method, we will produce VCO that does not require any addition of microorganisms or substance.
When the coconut milk mixture is allowed to stand for at least 10 hours, the VCO will naturally separate from water and protein. Several
theories say that the separation of these substances is due to the presence of airborne acetic acid bacteria (Acetobacter aceti). A. aceti
breaks the protein bonds in the coconut milk causing the mixture to separate distinctively.
160
1. a. Selecting nuts — select fully five
matured nuts (12 to 13 months)
and de-husk; the husk should be
turning brown.
2. Splitting and grating — split the dehusked nut into two manually and
grate. Place the
3. First milk extraction — extract the
milk from the grated coconut meat
by hand using cheesecloth (katsa).
Mix the grated coconut milk and
the coconut water. Materials to be
used such as fermentation
containers, basin, ladle, and cheese
cloth should be prepared neat and
clean to avoid contamination. Wash
your hands vigorously with water
and soap.to kill and remove the
presence of microorganisms that
may alter the quality of VCO. Press
the coconut meat thoroughly using
your cheese cloth. Set aside the
milk obtained using your clean
fermentation container(s). Prepare
the coconut residue (sapal) for the
second round of milk extraction.
4. Second milk extraction — the ratio
of mixing is 2 cups of milk residue
(sapal) is to 1 cup of water coming
from the first milk extraction.
5. Mixing of first and second milk
extracts — mix well the first and
6.
7.
8.
9.
10.
second coconut milk extracts for 10 minutes.
Preparing for the fermentation containers — place the coconut milk extract in clean fermentation
container(s). Cover the container(s) loosely as shown below. Place the container(s) in a place where
temperature is 35 to 40oC. Allow the coconut milk mixture to settle for 16 to 24 hours for natural
fermentation of the coconut milk extract to occur.
Separating the oil and fermented curd layers — separate the oil from the fermented curd by using ladle to
scoop the oil off the top. Note: dispose of the water phase and gummy portion by diluting with water
before draining into a grease trap. The fermented curd can be heated to remove the residual class B oil that
can be used for making skin care and herbal soap products. The toasted curd can also be mixed with other
compost material and use as organic fertilizer.
Filtering the oil — filter the VCO to remove adhering particles of fermented curd.
Packaging and storage — the recommended packaging material for VCO is glass. PET bottles can be used in
cases where the VCO is immediately consumed. Note: Class A VCO is always waterclear. Class B VCO is
yellow. The latter happens when the process of coconut milk extraction is invaded by unwanted
microorganisms or sanitary protocols are not followed strictly such as washing the hands with antibacterial
soap or washing the materials with antibacterial detergent soap.
Tell them to report their output to the class.
Another theory says that the enzyme present in the coconut makes the separation of substances to occur. The socalled ‘fermentation
method’ happens when after 16 to 24 hours of settling, the water smells and tastes sour. The so-called ‘natural’ explains that there is no
addition of any other substance or microorganism in fermenting the virgin coconut oil.
Also the ‘virgin’ in the virgin coconut oil implies that there is no substance added to make the oil.
Modified Natural Fermentation Method
PRACTICE (160 MINS)
Procedure:
Directions:
1. Explain why cells of most multicellular organisms cannot live long without oxygen.
2. How does poison like cyanide interfere with activity of electron transport chain in the mitochondrion?
3. Why is it beneficial for pyruvate to be reduced when oxygen in not available during the fermentation process?
4. If fermentation is a fast easy way to get ATP without oxygen and without requiring complex organelles, then why is there a slow more complex process
involving oxygen?
Suggested Answers:
1. The ATP produced during glycolysis is insufficient to sustain life processes. As a result, molecular oxygen has to appear to supply a bulk of ATP (almost
90%) to the body cells. And hence, most cells of multicellular organisms cannot live long without oxygen, especially the human brain cells which cannot
undergo glycolysis.
2. Lack of oxygen is not the only factor that interferes with the electron transport system. Some poisons like
cyanide inhibit the normal activity of the cytochrome found in the ETC. Cyanide binds tightly to the iron in
the last cytochrome, making it unable to transport electrons to oxygen. This cyanide also blocks the passage
of electron through the ETC. As this happens the production of ATP stops — and death ensues.
3. The reduction of pyruvate into lactate and alcohol ensures that NAD+ is regenerated, which is required for
the first step in the energy-harvesting step of glycolysis. As NAD+ returns to the earlier reaction, it becomes
reduced to NADH. In this way, glycolysis and substrate-level ATP synthesis continue to occur even without
the presence of oxygen.
4. In aerobic respiration, the molecules are broken down slowly to get much more of that energy out and the
left over products have useful energy left in them. Imagine a racing car were to get instantly all the energy
from fuel. If this happened, the racing car could not run longer mileage.
ENRICHMENT (5 MINS)
Activity Title: Vinegar Making
Materials needed:
9 cups of coconut water, 2 cups of brown sugar, ½ teaspoon yeast, 2 clean cheesecloth, transparent bottles for
transferring the mixture, gas stove, rubber bands, cooking pan, funnel, 2 cups of mother vinegar, jar(s) spoon for
mixing
Procedure:
SET A: Preparation and alcoholic fermentation
1. Using cheesecloth, filter the
coconut water and place it a clean
cooking pan. Then add 2 cups of
brown sugar. Mix thoroughly using
a spoon until the sugar crystals are
dissolved completely.
2. Heat the mixture at low fire for 20
minutes. As you do this, do not
cover the cooking pan and do not
boil the mixture. After 20 minutes,
let the mixture cool for 30 minutes
to 1 hour.
3. Add ½ teaspoon of yeast. Mix very
well. Afterwards, transfer the
mixture to clean transparent
Teacher Tip:
This can be done at home as group assignment.
Just give your students precautionary measures.
Instructions can be given for five minutes. Tell
them to document their output and submit it via
YouTube or Facebook.
Vinegar is a sour-tasting condiment and
preservative. It can be prepared by two
successive microbial processes. The first phase is
done through alcoholic fermentation by a
eukaryotic organism called yeast. The second
phase is by oxidation of alcohol by a prokaryotic
organism called Acetobacter aceti. This
bacterium is responsible for converting the
alcohol in wine to acetic acid or vinegar. Since coconut is abundant in our country, use this example to show the principle of fermentation
process involving microorganisms and the series of reactions that take place as coconut water is converted into vinegar.
4. bottle(s). Cover the bottle(s) with cheesecloth. The small pores in the cheesecloth will allow the gas from inside the bottle to exit.
5. Place the mixture in a safe place to allow the process of fermentation.
Note: From the day you added yeasts to the mixture you will observe alcoholic fermentation that is characterized by the release of bubbles. The bubbles
indicate the presence of carbon dioxide. When bubbles no longer appear in the mixture, then alcoholic fermentation has ceased already. The formation of
bubbles will be observed for approximately one week. To ferment means to break the sugar in the absence of oxygen.
SET B: Acetous Fermentation
After one week, transfer the mixture to a jar. Then add 2 cups of mother vinegar to a jar. Cover the jar with cheesecloth to allow oxygen to enter into the jar.
Place the jar in a safe place. Wait for one month to allow acetous fermentation.
EVALUATION (40 MINS)
Directions: Compare and explain aerobic respiration, anaerobic respiration and fermentation in terms of the following:
1. Immediate fate of electron transfer
2. Terminal electron acceptor of electron transport chain
3. Reduced product(s) formed
4. Mechanism of ATP synthesis
Tabulate your answers. Then give at least three advantages and at one disadvantage for aerobic respiration, anaerobic respiration and fermentation.
General Biology 1
120 MINS
ATP in Cellular Metabolism and Photosynthesis
164
LESSON OUTLINE
Content Standards
The learners demonstrate an understanding of:
1. ATP-ADP Cycle
Introduction
Review of prerequisite and related topics
Motivation
Engage students with questions of purpose
30
2. Photosynthesis
3. Respiration
Performance Standard
The learners shall be able to prepare simple fermentation setup using common fruits to
Instruction/
produce wine or vinegar via microorganisms.
Learning Competencies
• The learners describe reactions that produce and consume ATP (STEM_BIO11/12IIa-j-9)
•
Delivery/
Practice
Practice
The learners compute the number of ATPs needed or gained in photosynthesis and
respiration (STEM_BIO11/12_IIa-j-11)
Evaluation
5
Lecture on Photosynthesis, ATP
Production, and Cellular Metabolism
60
Group Activity
15
Quiz
10
Resources
Specific Learning Outcome
At the end of the lesson, the learners shall be able to compute the number of
Shown/presented on the different parts of the Teaching
Guide ATPs needed or gained in photosynthesis and respiration
INTRODUCTION (30 MINS)
Clearly communicate learning competencies and objectives. At the end of the session, the learners shall be able to compute the number of ATPs needed or
gained in photosynthesis and respiration. Also, allow the readers to connect and/or review prerequisite knowledge. Review structure of ATP (Adenosine
Triphosphate) and how it is used as the energy currency of the cell.
During PHOTOSYNTHESIS:
•
Energy from sunlight is harvested and used to drive the synthesis of glucose from CO2 and H2O. By converting the energy of sunlight to a usable form of
potential chemical energy, photosynthesis is the ultimate source of metabolic energy for all biological systems.
•
Photosynthesis takes place in two distinct stages.
(A) In the light reactions, energy from sunlight drives the synthesis of ATP and NADPH, coupled to the formation of O2 from H2O.
(B) In the dark reactions (named because they do not require sunlight), the ATP and NADPH produced by the light reactions drive glucose synthesis.
•
In eukaryotic cells, both the light and dark reactions of photosynthesis occur within chloroplasts—the light reactions in the thylakoid membrane and the
dark reactions within the stroma.
Stages of Cellular Metabolism:
1. Glycosis
2. Pyruvate grooming (between Glycolysis and Citric acid cycle
3. Kreb’s Cycle/Citric Acid Cycle/Acid Cycle
4. Electron Transport Chain and Oxidality
166
Compare and Contrast Cellular Respiration and Photosynthesis
Cellular Respiration
Photosynthesis
Production of ATP
Yes; theoretical yield is 38 ATP molecules per glucose
but actual yield is only about 30-32.
Yes
Reactants
C6H12O6 and 6O2
6O2 and 12H2O and light energy
Requirement of sunlight
Sunlight not required; cellular respiration occurs at all
times.
Can occur only in presence of sunlight
Chemical Equation (formula)
6O2 + C6H12O6 --> 6CO2 +6H2O + ATP (energy)
6CO2 + 12H2O + light --> C6H12O6 + 6O2 + 6H20
Process
Production of ATP via oxidation of organic sugar
compounds. [1] glycolosis: breaking down of sugars;
occurs in cytoplasm [2] Krebs Cycle: occurs in
mitochondria; requires energy [3] Electron Transport
Chain-- in mitochondria; converts O2 to water.
The production of organic carbon (glucose and starch)
from inorganic carbon (carbon dioxide) with the use of
ATP and NADPH produced in the light dependent
reaction
Fate of oxygen and carbon dioxide
Oxygen is absorbed and carbon dioxide is released.
Carbon dioxide is absorbed and oxygen is released.
Energy required or released?
Releases energy in a step wise manner as ATP molecules Requires energy
Main function
Breakdown of food. Energy release.
Production of food. Energy Capture.
Chemical reaction
Glucose is broken down into water and carbon dioxide
(and energy).
Carbon dioxide and water combine in presence of
sunlight to produce glucose and oxygen.
Stages
4 stages: Glycolysis, Linking Reaction (pyruvate
oxidation), Krebs cycle, Electron Transport Chain
(oxidative phosphorylation).
2 stages: The light dependent reaction, light
independent reaction. (AKA light cycle & calvin cycle)
What powers ATP synthase
H+ proton gradient across the inner mitochondria
membrane into matrix. High H+ concentration in the
intermembrane space.
H+ gradient across thylakoid membrane into stroma.
High H+ concentration in the thylakoid lumen
Products
6CO2 and 6H20 and energy(ATP)
C6H12O6 (or G3P) and 6O2 and 6H2O
Cellular Respiration
Photosynthesis
What pumps protons across the membrane
Electron transport chain. Electrochemical gradient
creates energy that the protons use to flow passively
synthesizing ATP.
Electron transport chain
Occurs in which organelle?
Mitochondria Glycolysis (cytoplasm)
Chloroplasts
Final electron receptor
O2 (Oxygen gas)
NADP+ (forms NADPH )
Occurs in which organisms?
Occurs in all living organisms (plants and animals).
Occurs in plants, protista (algae), and some bacteria.
Electron source
Glucose, NADH + , FADH2
Oxidation H2O at PSII
Catalyst - A substance that increases the rate of a
chemical reaction
No catalyst is required for respiration reaction.
Reaction takes places in presence of chlorophyll.
High electron potential energy
From breaking bonds
From light photons.
Photosynthesis (source: http://www.diffen.com/difference/Cellular_Respiration_vs_Photosynthesis)
MOTIVATION (5 MINS)
Teacher asks students “Why study photosynthesis and cellular respiration?” Photosynthesis - Lead
discussion into the importance of
1. Photosynthesis in selection of plants/trees for reforestation, agriculture and biodiversity conservation. (http://bioenergy.asu.edu/photosyn/ study.html)
2. Cellular Respiration in food production (pretzels, beer, soy sauce, pickles, vinegar, yeast-risen bread, or any other product that requires fermentation or
microbial breakdown of compounds in food), athletics (sports nutrition and event-specific training) and others.
168
INSTRUCTION/DELIVERY/PRACTICE (60 MINS)
Lecture on Photosynthesis and ATP Production
ATP is formed by the addition of a phosphate group to a molecule of adenosine diphosphate (ADP); or to state it in chemical terms, by the phosphorylation of
ADP. This reaction requires a substantial input of energy, much of which is captured in the bond that links the added phosphate group to ADP. Because light
energy powers this reaction in the chloroplasts, the production of ATP during photosynthesis is referred to as photophosphorylation.
The light reaction uses the energy from photons to create ATP and NADPH, which are both forms of chemical energy used in the dark reaction (=Calvin Cycle).
Calvin Cycle, through a series of chemical reactions, takes the carbon from carbon dioxide and turns it into glucose, which is a sugar that cells use as energy.
Carbon dioxide is a fully oxidized molecule. What that means is basically it does not have a lot of chemical energy. The Calvin Cycle turns carbon dioxide into
the much more reduced molecule, glucose, which has much more energy.
Where ATP comes into play is that it functions as a reduced molecule that provides the chemical energy that transforms the carbons in the carbon dioxide
molecules into progressively more reduced molecules until you get glucose. Thus, ATP is used to power the change from 3phosphoglycerate to 1,3bisphosphoglycerate, which is then turned into 2 glyceraldehyde 3-phosphate (G3P) molecules with NADPH (an energy source similar to ATP). One of these
G3P molecules gets turned into glucose. The other one is transformed by ATP into ribulose bisphosphate (RuBP), which then picks up carbon dioxide and the
cycle begins again.
Lecture on Cellular Metabolism and ATP Production
What is the difference between substrate-level phosphorylation and oxidative phosphorylation?
Substrate-level phosphorylation – is the formation of ATP by the direct transfer of a PO3 group to ADP. (Source:
https://quizlet.com/11951424/metabolism-final-exam-flash-cards/)
Oxidative phosphorylation – is the process that explains how molecules of FADH2 and NADH are used to make ATP. The term “oxidative” is used because
oxygen accepts an electron while the gradient made by the movement of electrons powers the creation ATP. (Source:
http://www.dbriers.com/tutorials/2012/04/substrate-level-vs-oxidative-phosphorylation/) Other references that can be used:
https://online.science.psu.edu/biol110_sandbox_8862/node/8924 http://www.neshaminy.k12.pa.us/Page/20741
Review Stages of Cellular Metabolism and the products produced at each stage (ATP by substrate level phosphorylation, CO2, NADH and FADH2)
Four Major Reaction Pathways
1. Glycolysis
2. Conversion of Pyruvate to Acetyl CoA (also called Oxidation of Pyruvate, Pyruvate Processing, Pyruvate Grooming)
3. Kreb’s Cycle (Citric Acid Cycle, Tricarboxylic Acid Cycle)
4. Electron Transport Chain (Chemiosmosis)
Other references that can be used:
•
•
•
•
•
•
•
•
•
•
https://courses.candelalearning.com/ap2x1/chapter/carbohydrate-metabolism/
http://www.uic.edu/classes/bios/bios100/lectures/respiration.htm
http://www.neshaminy.k12.pa.us/Page/20741
http://sp.uconn.edu/~bi102vc/1102fall11/ATP.html
http://biology.tutorvista.com/cell/cellular-respiration.html
https://en.wikibooks.org/wiki/Biology,_Answering_the_Big_Questions_of_Life/Metabolism/Metabolism3
http://people.ucalgary.ca/~rosenber/CellularRespirationSummary.html
http://antranik.org/intro-to-cellular-respiration-the-production-of-atp/
http://sandwalk.blogspot.com/2007/12/how-cells-make-atp-substrate-level.html
http://study.com/academy/lesson/substrate-level-phosphorylation-and-oxidative-phosphorylation.html •
http://www.diffen.com/difference/Cellular_Respiration_vs_Photosynthesis
Stage of Cellular Metabolism
Substrate-Level Phosphorylation
Oxidative Phosphorylation through ETC
NADH
Subtotal1
Glycolysis
2
2
4-6 2
Pyruvate Grooming
(Decarboxylation of Pyruvate)(x2)3
0
2
6
Citric acid cycle ( x 2)3
2
6
18
Subtotal
4
28-30
SUMMARY TABLE – Number of ATP molecules formed from 1 molecule of glucose
170
Total
FADH2
Subtotal1
2
4
4
36-38
The amount of ATP produced is estimated from the number of protons than passes through the inner mitochondrial membrane (via the electron acceptors of
the electron transport chain (ETC) and the number of ATP produced by ATP Synthase.
1.
Assumption = Each NADH will generate 3 ATPs while FADHs will generate 2 ATPs.
2.
The number of ATP produced depends on the acceptor that receives the hydrogen ions and electrons from the NADH formed during glycolysis in the
cytoplasm.
3.
Glycolysis results in formation of 2 molecules of pyruvic acid/pyruvate thus values are multiplied by 2.
STAGE
LOCATION
WHAT
HAPPENS?
REACTANT (What
goes in)
PRODUCTS (What
comes out)
ATP PRODUCED BY
Substrate Level
Phosphorylation
Oxidative Phosphorylation
NADH
FADH2
Glycolysis
Pyruvate Processing/
Grooming
Citric Acid Cycle
Oxidative
Phosphorylation
PRACTICE (15 MINS)
Using previous lessons and this lecture, students grouped into 2-3 are asked to answer the table below. Teacher provides the initial number of glucose
molecules that will undergo cellular metabolism.
Practice Questions
(Available at the following sites: Students are asked to watch a video and answer questions after watching the video). Photosynthetic Electron
Transport and ATP Synthesis
•
https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/photosynthetic_electron_transport_and_atp_synthesis.html Calvin
Cycle
•
https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/calvin_cycle.html
EVALUATION (10 MINS)
Questions for Exam/Quiz
•
https://quizlet.com/11951424/metabolism-final-exam-flash-cards/
•
https://quizlet.com/17507853/biochemistry-ii-practice-questions-oxidative-phosphorylation-flash-cards/
•
http://faculty.une.edu/com/courses/bionut/distbio/obj-512/Chap21-practice%20questions.htm
•
http://web.mnstate.edu/provost/Chem410ETSOxPhosQuest.pdf
•
https://www.khanacademy.org/test-prep/mcat/biomolecules/krebs-citric-acid-cycle-and-oxidative-phosphorylation/e/oxidativephosphorylationquestions
•
https://mcb.berkeley.edu/labs/krantz/mcb102/MCB102-SPRING2008-EXAM-KEY_v3.pdf
RUBRICS/ASSESSMENT GUIDE
LEARNING COMPETENCY
ASSESSMENT TOOL
Exemplary (8-10)
Satisfactory (5-7)
The learners shall be
able to describe the
following:
Student participation
(During lecture)
Student was able to answer
the question without
referring to his/her notes plus
the follow-up question.
Student was able to answer Student was able to
the question without
answer the question but
referring to his/ her notes; read from his/her notes.
Was not able to answer
follow up question.
Student participation
(During Practice)
Students in the team equally Student listened to the
Student was a passive
contributed to the discussion discussion but contribution participant and
and the answering of the
contribution was minimal.
to the team
table provided
was lesser than the other
members
Student was interested in
other matters not related
to the exercise.
Examination
Obtained 90-100% correct
answers in the exam
Obtained percentile <50%
correct answers in the
exam
Compute the number of
ATPs needed or gained
in photosynthesis and
respiration
Obtained 70-80.99%
correct answers in the
exam
172
Developing (3-4)
Obtained 50-69.99%
correct answers in the
exam
Beginning (1-2)
(1) Student was not able to
answer the question. (2)
Student read from notes of
his/her classmate..
Biographical Notes
FLORENCIA G. CLAVERIA, Ph.D.
Team Leader
Dr. Florencia G. Claveria is the current Chair of the CHED
Technical Panel for Biology and Molecular Biology. She is also member of
the Commission’s Technical Panel for Math and Science. She is currently
Vice Chancellor for Academics, Research, and Operations at the De La
Salle Araneta University.
She is a full professor at the De La Salle University-Manila where
she served as Dean of the College of Science for 6 academic years. Dr
Claveria finished her doctorate in Biological Sciences at the University of
Cincinnati, through a Fulbright-Hays grant. She completed her master’s in
Zoology at the Ghen State University, through a grant from the
Government of Belgium. She earned her bachelor’s degree in Biology at
St. Louis University. Her written scholarly works include contributions to
academic publications such as the Philippine Textbook of Medical
Parasitology, Journal of Protozoology Research, and The Journal of
Veterinary Medical Science.
DAWN T. CRISOLOGO
Team Leader
Ms. Dawn Crisologo is a Special Science Teacher at the Philippine Science
High School-Main Campus in Diliman, Quezon
City and specializes in advanced topics in Ecology, Evolution and
Biodiversity, Anatomy, Physiology, and Methods in Science and
Technology Research. She is a member of the Asian Association of Biology
Educators, Wildlife Conservation Society of the Philippines, and Biology
Teachers Association of the Philippines. Her works are included in The
Philippine BIOTA Journal and three editions of the Science Blast textbook.
Ms. Crisologo is currently finishing her master’s in Environmental Science
at the University of the Philippines Diliman. She completed her bachelor’s
degree in Biology at the same university.
CHUCKIE FER CALSADO
Writer
Mr. Chuckie Fer Calsado is Special Science Teacher IV at the
Philippine Science High School Main Campus where he has been teaching
for 8 years. He is a member of biological organisations like the Biology
Teachers Association of the Philippines, the Asian Association for Biology
Education, and Concerned Artists of the Philippines among many others.
He has published academic papers such as Implication of Students’
Cognitive Style, Personal Demographics, Values and Decision Making in
Environmental Education and the Role of Education in the Prevention of
Child Trafficking in Nepal. Mr. Calsado finished his Master’s in Bioethics
at the Monash University and his bachelor’s degree in Biology at the
University of the Philippines DIliman.
AILEEN C. DELA CRUZ
Writer
Ms. Aileen Dela Cruz has been serving as the Science Research
Analyst at the Philippine Science High School - Main Campus since 2004.
Her academic interests range from microbiology, food safety and
nutrition, and laboratory safety and she has been involved in trainings
and conferences on the same fields of study. Her published scholarly
works include series of textbooks on 21st Century Learning. Ms. Dela Cruz
earned her bachelor’s degree in Biology at the University of the
Philippines Baguio.
DOREEN D. DOMINGO, PH.D.
years now. Her published works include researches on parasitology,
climatology, and community nutrition. Dr Flores has conducted and
attended seminars on Biology in the country and abroad, including the
Training on
Biological Control at the US Department of AgricultureAgricultural
Research Service and Congress meetings on Parasitology. She is a twotime recipient of the Don Ramon J. Araneta Chair in Ecology among other
citations. Dr. Flores earned her Doctorate, Master’s, and Bachelor’s
degrees in Biology at the De La Salle University.
Writer
Dr. Doreen D. Domingo is a Professor at the Mariano Marcos
State University where she teaches both in the graduate and
undergraduate levels. She is currently the Chief of Alumni Relations for
the university. Dr. Domingo finished her doctorate in Biology (magna cum
laude) at St. Louis University through a research grant from CHED and the
Microbial Forensics and Biodefense Laboratory, Indiana University. She
completed her Doctor of Education on Educational Management, her
master’s degree in Education major in Biology, and her bachelor’s degree
in Biology at the Mariano Marcos State University. Dr. Domingo’s
scholarly works were published on the International Referred Journal and
the National Referred Journal.
JUSTIN RAY M. GUCE
Writer
Mr. Justin Ray Guce is a Special Science Teacher I at the Philippine
Science High School Main Campus in DIliman, Quezon City where he
teaches for 9 years. He has served as a Trainer of student representatives
for Science Olympiad competitions and has delivered presentations in a
number of Biology workshops and conventions. Mr Guce is a member of
the Wildlife Conservation Society of the Philippines and the Biology
Teachers Association of the Philippines. Mr Guce is currently finishing his
master’s in Biology Education at the University of the Philippines Diliman
where he also graduated his bachelor’s degree in Biology.
JANET S. ESTACION, Ph.D.
Writer
Dr. Janet Estacion is current Officer-in-Charge at the Institute of
Marine and Environmental Science in Silliman Unive rsity where she has
been teaching for 30 years now. She headed researches on marine
conservation and the recovery of reefs. Her scholarly works appeared on
different publications such as the Philippine Science Letters and the
Silliman Journal. Dr. Estacion earned her doctorate degree in Zoology at
the James Cook University of North Queensland. She completed her
master’s degree in Marine Biology at the University of the Philippines
Diliman and her bachelor’s degree in Biology at the Silliman University.
NOLASCO H. SABLAN
Writer
Mr. Nolasco Sablan is Teacher III at the Parada National High
School and is a DepEd teacher for 11 years now. He has worked as
resource speaker, trainer, and writer for different institutions in the
education sector, including the Ateneo de Manila University, Metrobank
Foundation Inc., and the Department of Education. Mr. Nolasco Sablan
earned his master’s degree in Biology Education at the Ateneo de Manila
University and completed his bachelor’s degree in Education major in
General Science at the Philippine Normal University.
MARY JANE C. FLORES, Ph.D.
Writer
Dr. Mary Jane C. Flores is Assistant Professor 3 at the College of
Science in the De La Salle University where she has been teaching for 20
174
JOHN DONNIE RAMOS, Ph.D.
Technical Editor
Dr. John Donnie Ramos is a Member of CHED’s Technical Panel
for Biology and Microbiology and Board Member of the Philippine Society
for Biochemistry and Molecular Biology. He is currently the Dean of the
College of Science at the University of Santo Tomas where he teaches
molecular biology, immunology and genetics, and allergology. Dr. Ramos
completed his doctorate in Molecular Biology at the National University
of Singapore. He finished his master’s degree in Biological Sciences at the
University of Santo Tomas and his bachelor’s degree in Biology at the
Philippine Normal University. Dr. Ramos is recipient of the NAST-TWAS
Prize for Young Scientist in the Philippines in 2010, and Outstanding
Young Scientist by the National Academy of Science and Technology in
2005.
JOY R. JIMENA
Copyreader
Ms. Joy Jimena is currently Planning Officer II at the
Information Management Bureau of the Department of Social Welfare
and Development. She also previously worked with other government
agencies such as the Department of National Defense and Philippine
Commission on Women, and Social Security System. Ms. Jimena
graduated at the University of the Philippines Diliman with a degree in
Public Administration.
RENAN U. ORTIZ
Illustrator
Mr. Renan Ortiz is a teacher and visual artist who has
collaborated in local and international art exhibitions such as the
SENSORIUM at the Ayala Museum, Populus in Singapore,
Censorship_2013 Move On Asia in South Korea, and the Triumph of
Philippine Art in New Jersey, USA. Mr. Ortiz’s solo exhibitions include
versereverse at the Republikha Art Gallery. He first completed his
bachelor’s degree in Political Science at the University of the Philippines
Manila before finishing his bachelor’s degree in Fine Arts major in
Painting at the University of the Philippines Diliman. Mr. Ortiz is an
awardee of the Cultural Center of the Philippines’ CCP Thirteen Artists
Awards in 2012.
DANIELA LOUISE B. GO
Illustrator
Ms Daniela Louise Go is a freelance illustrator and graphic
designer, specializing on graphic design, brand and campaign design, and
copywriting. She has worked as illustrator for Stache Magazine,
Philippine Daily Inquirer, and Summit Media Digital. Ms Go is a member
of organisations such as the UP Graphic and UP Grail in which she also
served as designer and illustrator. Her works have been part of art
exhibitions including Freshly Brewed, Wanton Hypermaterialism, and
Syntheses 2014: Graduate Exhibit. Ms. Go graduated her bachelor’s
degree in Fine Arts Major in Visual Communication at the University of
the Philippine Diliman.