Station 1
Your body is made of trillions of cells. Each cell has a specific job that it
performs in your body. In order to perform that job, the cell needs
instructions. Those instructions can be found in a structure in the cell
call the nucleus. Inside the nucleus, you will find your DNA. There
specific sections in your DNA called genes, which are the specific
instructions for the different jobs in your body. You have 20,000-25,000
of these genes in your DNA. That’s a
1.
2.
3.
4.
What is your body made up of?
What does a cell need to have to perform a job?
Where are the DNA found in?
Why are gene important?
Station 2
Those instructions in the genes are a code that tell your cells to produce something called
proteins. Proteins are what build up your body and make things happen. Proteins can build
muscle, help you digest your food, and carry oxygen in your blood. Hemoglobin is a protein in
your red blood cells that allow oxygen molecules to be carried around your body in your blood
stream.
1. What do the instructions in the genes do?
2. What are proteins?
3. What is hemoglobin?
Station 3
When you eat food, your body needs to break it down into smaller
more useful parts. To do that your digestive system uses several
different proteins. There are proteins to help digest fats,
carbohydrates, and even other proteins. Carbohydrase is a protein
made by cells in your pancreas and small intestine to help you break
down carbohydrates into individual sugar molecules that your body can
use.
1. What does your body do when you eat food?
2. How does your body break down food?
3. What is the name of the protein that helps break down food?
Station 4
Now back to your DNA. As stated before your DNA contains the
instructions for creating every protein in your body. These instructions
are not written in English, or Spanish, or French. They are written in a
special type of code made up of 4 molecules called nucleotides. These
four nucleotides are Adenine (A), Thymine (T), Guanine (G), and
Cytosine (C). The sequence of these nucleotides in your DNA provide
your cell with the instructions that proteins need.
1. What does DNA contain?
2. What is the code that DNA is written in?
3. How do the proteins know what to do?
Station 5
For example, the sequence in your DNA to produce hemoglobin is:
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC
CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA
CATTTATTTTCATTGC
Those instructions are complex. Sometimes changes occur in your DNA. These changes are
called mutations. A small mutation in the DNA sequence for hemoglobin can cause something
called sickle-cell disease. In the sequence below an “A” replaced a “T” in from the healthy
sequence which causes a drastic change. Can you find the where this change occurred in the
DNA sequence shown below?
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCAGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC
CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA
CATTTATTTTCATTGC
1. Is the DNA sequence to produce hemoglobin long or short?
2. What are mutations?
3. What is it called when and “A” is replaced with a “T”?
Station 6
People who have sickle cell disease have abnormally shaped red blood
cells which makes it difficult for blood to flow through the body. This
may cause extreme pain as the blood cells get stuck in the veins. The
shape of the blood cell also makes it difficult for the cells to carry
oxygen to the body making people tired all the time. Symptoms can be
treated, but people cannot be healed because the mutation can’t be
changed.
1. What is sickle cell disease?
2. What is the shape of a healthy red blood cell? An unhealthy red
blood cell?
3. Is there a cure?
Station 7
When most people think of mutations they think of mutations giving
people superpowers, but that is science fiction, not a science fact. In
fact, every individual has about 60 mutations in their DNA. However,
most of those mutations have little or no effect on you. Some are more
drastic like sickle cell disease. Most mutations occur as DNA is not
copied correctly. Some mutations may occur because of environmental
factors like UV light, radiation, and smoking. However, these mutations
only affect a few cells. These mutations can be passed on to a person’s
offspring if they affect the DNA in the reproductive cells.
1. How many mutations do humans have?
2. Are all mutations bad? Explain.
3. What can cause mutations?
Station 8
There are three types of mutations and each has a different result. A
beneficial mutation gives an organism a better chance for survival.
Examples of beneficial mutations include fur color that may allow
organisms to blend in better with their environment or resistance to
the disease malaria caused by a parasite from infected mosquitoes.
Neutral mutations have no observable effect on an organism. As
mentioned before you have about 60 mutations already. Most of those
are neutral mutations because they have little or no effect on you so
you don’t even know they are there. Harmful mutations cause
challenges for the individual who has them. The mutation that causes
sickle cell disease creates a lifetime of issues for the individual with it.
Other mutations that affect proteins like hemoglobin may also cause a
premature death because the body is not getting what it needs in order
to survive.
1. What are the three types of mutations?
2. Provide an example of a beneficial mutation
3. An example of a harmful mutation