Translation Practice Name: Date: KEY Pd: Explain how proteins that are all composed of the same 20 amino acids differ among organisms The order of the amino acids will vary Use the following table to answer questions 1-5 First letter in code U C A G mRNA codon Table Second letter in code U C A Phe Ser Tyr Phe Ser Tyr Term Leu Ser Leu Ser Term Leu Pro His Leu Pro His Leu Pro GluN Leu Pro GluN Ileu Thr AspN Ileu Thr AspN Ileu Thr Lys Met Thr Lys Val Ala Asp Asp Val Ala Val Ala Glu Val Ala Glu Third letter In code U C A G G Cys Cys Term Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G Amino Acids Alanine (ala) Arginine (arg) Lysine (lys) Methionine (met) Asparagine (aspN) (start codon) Aspartic acid (asp) Cysteine (cys) Phenylalanine (phe) Proline (pro) Glutamine (gluN) Glutamic acid (glu) Serine (ser) Threonine (thr) Glycine (gly) Histidine (his) Tryptophan (trp) Tyrosine (tyr) Isoleucine (ileu) Valine (val) Leucine (leu) Terminator codons (term) Use this given the following DNA strand to answer the following questions. ATGAAAAGCAGGCCATATTAA 1. Write the complementary DNA strand TACTTTTCGTCCGGTATAATT 2. Transcribe the complementary DNA from #1 into mRNA: AUGAAAAGCAGGCCAUAUUAA 3. Translate the mRNA into #2 into Amino Acids: Met-Lys-Ser-Arg-Pro-Tyr-Term 4. How many proteins were coded for in the DNA message? One 5. The end of the tRNA molecule that is complementary to the mRNA codon is called the anticodon 6. Translate the mRNA below to list the amino acids that would result from this sequence. AUGAUCGACUAAAUGAAGCCGUGA __met-ileu-asp-term-met-lys-pro-term________ 7. How many proteins would be represented by the strand in question 6? _two__________ 8. How many amino acids are represented in your answer to question 6? six _________ 9. List the codon(s) for each of the following amino acids. a. Asparagine AAU, AAC b. Threonine ACU, ACA, ACG, ACC c. Lysine AAA, AAG d. Valine GUU, GUC, GUA, GUG 10. Write the name of the amino acid coded by each of the following mRNA codons. a. CCU Proline b. CAC Histidine c. ACG Threonine d. UUU Phenylalanine e. GAG Glutamic Acid f. UCU Serine 11. Write the DNA code for each of the following amino acids. a. Cysteine ACA, ACG b. methionine TAC c. Proline d. Tyrosine 12. Which nucleic acid carries the amino acids to the mRNA? GGA, GGG, GGT, GGC ATA, ATG tRNA 13. Write the name of the amino acid coded by each of the following DNA codes. a. TTT lysine b. TAG isoleucine c. GCG Arginine d. GTA histidine e. CGT Alanine f. CCT Glycine What do you know? 14. Identical molecules are the result of what process? DNA Replication 15. What must be broken for a DNA molecule to “unzip”? Hydrogen Bonds 16. A codon is found on what nucleic acid? mRNA 17. An anticodon is found on what nucleic acid? tRNA 18. At what cell structure does protein synthesis take place? 19. A polypeptide consists of a long chain of these. Amino acids 20. How many bases are needed to pick up an amino acid? 21. What process is represented by the picture below? replication ribosome Three 22. What process is represented by the picture below? transcription Label the structures in the diagram. A. B. C. D. E. F. G. amino acid tRNA anticodon codon mRNA rRNA (ribosome) polypeptide 23. What process occurred to make E? transcription 24. What process is occurring in the diagram to make G? translation