Bio 1b: Genetics Test
/44 pts
Name__________________
Answer the following questions on a SEPARATE piece of paper. Make sure to define your
alleles, write out genotypes, and show your work clearly.
1. Gymnasia, a total lack of body hair, is due to a simple autosomal recessive gene. A
normal couple wants to have children, but each had a parent with Gymnasia. What is the
probability of them having a child with Gymnasia? Show a Punnett square to justify your
answer. (4 pts)
2. In turkeys a dominant gene R produces the familiar bronze color; its recessive allele r
results in red. Another dominant gene H results in normal feathers; its recessive allele h
produces feathers with webbing. A bronze male turkey with normal feathers is mated
with a red female turkey with normal feathers. They produce a brood of 6 chicks: 2
bronze normal chicks, 2 red normal chicks; 1 bronze webbed chick and 1 red webbed
chick. (8 pts)
a. Determine the genotypes of the parents. Explain your reasoning. (2 pts)
b. Create a Punnett Square and list the expected phenotypic ratios of the offspring.
(4 pts)
c. Does the expected proportion of red normal chicks match the parent's actual
proportion of red normal chicks? If not, explain why. (2 pts)
3. When two plants with orange fruits are crossed, the following phenotypic ratios are
present in the offspring: 25% red fruit, 50% orange fruit, 25% yellow fruit. (4 pts)
a. What are the genotypes of the parent orange-fruited plants? Use a Punnett
square to support your answer. (2 pts)
b. How is fruit-color inherited? (2 pts)
4. A woman with blood type A+ marries a man with blood type B-. Positive and negative in
blood types are rhesus factor; represent a positive rhesus factor as “R” and a negative
rhesus factor as “r.” The couple has 4 children who are A+, B-, AB+, and B+. (6 pts)
a. Determine the parents genotypes. (4 pts)
b. Explain your reasoning for what the parent’s genotypes must be, and support
your answer with Punnett squares. (2 pts)
You are a genetic counselor and run a clinic to advise people on who want to become parents
but have concerns about their genetic background.
5. Your first patient of the day is Jane, a woman with no known health issues, although her
father, Frank, has hemophilia (a recessive sex-linked disorder). At a support group, Jane
met Henry, a man with hemophilia, and the two plan to marry. They want your advice. (4
pts)
1
a. Explain to them, using a Punnett Square, the probability that they will have a
child afflicted with hemophilia. (3 pts)
b. Jane and Henry had been under the impression that only boys can get
hemophilia. Is this true? Explain your answer. (1 pt)
6. Later that day, another patient comes in hoping to unravel a pedigree chart given to him
by his estranged uncle tracing the appearance of dimples in the family. The dark
symbols indicate a person with dimples. Squares are male, circles are female. (8 pts)
Study the pedigree chart below.
a. Look at the family (5 through 10) on the far right of the pedigree chart. Based on
the results shown here, assuming that dimple is an autosomal trait, make an
argument as to whether dimples are recessive or dominant. (2 pts)
b. Now let’s think about whether the dimple trait can be sex-linked or not. What
would be your determination based on that same family? (2 pts)
c. Using your decisions about inheritance from (a) and (b), fill in the genotypes of
the individuals shown in the chart using the letter “D” or “d” for the trait. If you are
not sure of an allele, remember to use the “-” symbol. (4 pts)
2
Transcription and Translation Exercise
USE THE SPACE BELOW THESE QUESTIONS TO WRITE YOUR RESPONSES.
A portion of the kernel pigment gene (in corn) is shown below. This portion of the gene encodes
the very first part of the kernel pigment protein. (10 pts)
Sense strand
Template
5’
GGTCTATGTCAGGCCACCTGCCGCGGACTATT3’
CCAGATACAGTCCGGTGGACGGCGCCTGATAA5’
3’
1. Using the bottom strand as a template, build the mRNA produced through transcription. (2
pts)
2. Using the table given below, translate the mRNA you just found in Question 1 into a
sequence of amino acids. Abbreviations are fine to use. (2 pts)
The allele of the gene above is dominant and phenotypically shows corn with a red kernel (it is
designated as R). Another allele of this gene, the r allele (which is recessive) is phenotypically a
white kernel corn and is the result of a mutation in the R allele. In the r allele, the second G
(10th nucleotide) in the template strand is replaced with an T.
3. Based on the information given, what would be the mRNA and the sequence of amino acids
produced for the mutated DNA? (2 pts)
4. How does your result in Question 4, support the fact that r is a recessive allele? (2 pts)
5. You have a red plant and you want to know if it is homozygous red or not. What cross would
you do to check that information and why? Show a Punnett square for that cross. (2 pts)
3
4