Mol Biotechnol (2009) 42:168–174
DOI 10.1007/s12033-009-9150-3
RESEARCH
Cloning of a Novel Omega-6 Desaturase from Flax
(Linum usitatissimum L.) and Its Functional Analysis
in Saccharomyces cerevisiae
Rupali M. Khadake Æ Prabhakar K. Ranjekar Æ
Abhay M. Harsulkar
Published online: 12 February 2009
Ó Humana Press 2009
Abstract The D12 desaturase represents a diverse gene
family in plants and is responsible for conversion of oleic
acid (18:1) to linoleic acid (18:2). Several members of this
family are known from plants like Arabidopsis and Soybean. Using primers from conserved C- and N-terminal
regions, we have cloned a novel D12 desaturase gene
amplified from flax genomic DNA, denoted as LuFAD2-2.
This intron-less gene is 1,149-base pair long encoding 382
amino acids—putative membrane-bound D12 desaturase
protein. Sequence comparisons show that the novel
sequence has 85% similarity with previously reported flax
D12 desaturase at amino acid level and shows typical
features of membrane-bound desaturase such as three
conserved histidine boxes along with four membranespanning regions that are universally present among plant
desaturases. The signature amino acid sequence ‘YNNKL’
was also found to be present at the N terminus of the
protein, which is necessary and sufficient for ER localization of enzyme. Neighbor-Joining tree generated from
the sequence alignment grouped LuFAD2-2 among the
other FAD2 sequences from Ricinus, Hevea, Jatropha, and
Vernicia. When LuFAD2-2 and LuFAD2 were expressed in
Saccharomyces cerevisiae, they could convert the oleic
acid to linoleic acid, with an average conversion rate of
5.25 and 8.85%, respectively. However, exogenously supplied linoleic acid was feebly converted to linolenic acid
suggesting that LuFAD2-2 encodes a functional FAD2
enzyme and has substrate specificity similar to LuFAD2.
R. M. Khadake P. K. Ranjekar A. M. Harsulkar (&)
Interactive Research School for Health Affairs, Medical College
Campus, Bharati Vidyapeeth University, Pune-Satara Road,
Pune 411043, India
e-mail: aharsulkar@yahoo.com
Keywords FAD2 Omega-6 desaturase Flax (Linum usitatissimum L.) Linoleic acid Oleic acid S. cerevisiae
Abbreviations
ALA
Alpha linolenic acid; 18:3
ER
Endoplasmic reticulum
FAD
Fatty acid desaturase
FAD2 Omega-6 desaturase
LA
Linoleic acid; 18:2
PUFA Polyunsaturated fatty acid
16:0; Palmitic acid, 18:0; Stearic acid, 18:1;
Oleic acid
Introduction
The D12 fatty acid desaturase introduces a double bond at
D12 position of oleic acid and converts it to linoleic acid
(LA) in fatty acid biosynthesis pathway. Production of linoleic acid marks the synthesis of polyunsaturated fatty acid
(PUFA) from monounsaturated oleic acid and it is a major
factor in determining the quality of plant oils. Oils with high
proportion of oleic acid (18:1) and LA (18:2) are of nutritional interest for human as well as animals besides having
better keeping quality. D12 desaturation is also an imperative
prerequisite for the synthesis of omega-3 ALA (18:3) since
D12 desaturation product alone could be accepted as substrate by D15 desaturase. These desaturases are, therefore, of
biotechnological significance in creating novel sources of
omega-3 fatty acids through genetic manipulation, especially in oleaginous microbes that produce oleic acid in large
amounts. Two distinct sites exist for D12 desaturation, one is
in plastidial membrane and the other on the endoplasmic
Mol Biotechnol (2009) 42:168–174
169
reticulum (ER), both having distinct genes with specialized
signals for respective localization [1]. D12 appears to exist as
complex gene families in several genomes. In soybean, ESTbased searches by Tang et al. [2] and Schlueter et al. [3] have
identified at least seven members of this gene family in four
regions of the genome. Expression analysis has revealed that
at least three FAD2-like genes are expressed in seeds and one
house keeping gene form in most of the plant tissues. Soybean stands as a good example showing diversity and
complexity in D12 desaturase genic and genomic organization, so much that it has become an excellent resource to
study the evolutionary dynamics of a paleo-polyploid genome [3]. The desaturase genes, therefore, appear to exist in
multiple forms in many of the plant genomes such as Arabidopsis, cotton, olive, sunflower, sesame, and pomegranate.
In olive, two forms exist, OepFAD2-1 and OepFAD2-2 [4]
and three forms, HaFAD2-1, HaFAD2-2, and HaFAD2-3,
have been isolated from sunflower [5].
In flax, Fofana et al. [6] have identified two copies of
FAD2 gene expressed in developing seeds with closely
matching sequences; however, the sequences available are
incomplete. More recently, a full-length genomic clone has
been characterized from flax encoding a 378-amino acid
protein [7]. We, here, report cloning and characterization of
a new isoform of an intron-less FAD2 gene from flax
genomic DNA, which is 1,149 base pairs long, encoding a
protein of 382 amino acids, revealing all the typical features
of a membrane-bound desaturase. The deduced amino acid
sequence showed 85% similarity with previously reported
FAD2 gene from flax and shares 81% identity at nucleotide
level. Its expression in Saccharomyces cerevisiae shows
that it encodes a functional protein, which may have value
to those who work for flax quality improvement.
the start and end of the coding region with EcoRI and XhoI
sites inserted for ease of subcloning in pYES vector. PCR
amplifications were performed using flax genomic DNA as
a template and the FAD2-specific primers. A typical PCR
reaction consists of initial denaturation at 94°C for 5 min,
followed by 35 cycles, each comprising 30 s denaturation
at 94°C, 45 s annealing at 60°C, and 2 min extension at
72°C with final extension at 72°C for 5 min. The amplified
product was resolved by agarose gel electrophoresis,
expected size amplicon was purified using spin columns
(Ultra free DA, Amicon USA), inserted into pGEMT-Easy
vector (Promega) and transformed into competent Escherichia coli cells. The positive transformants were then
subjected to colony PCR for further confirmation. Plasmids
from positive colonies were isolated, designated as
pGEMT-FAD2, and sequenced from both 50 and 30 ends at
least three times.
Materials and Methods
Accession Numbers
Plant Material
The gene sequences obtained in this study have been
deposited at GenBank under accession number EU660501
(LuFAD2-2) and EU660502 (LuFAD2).
Seeds of flax variety NL 97 were obtained from the flax
breeder, Dr. P. B. Ghorpade, Nagpur Agricultural College,
Nagpur. The seedlings were grown in petri plates lined with
wet filter paper and stored at -80°C until DNA isolation.
DNA Extraction and PCR Amplification
Total genomic DNA was extracted from frozen seedlings
(1 g), using CTAB method as described by Murray and
Thompson [8] with little modifications. The forward
(D12F-GCGCGAATTCGGGATGGGTGCAGGTGGAAG
AATG) and the reverse (D12R-GCGCCTCGAGTCATCA
TAACTTATTGTTGTACCAGAA) primers were designed
from available FAD2 sequences (DQ222824.1) including
Sequence Analysis
D12-desaturase sequences were identified by the NCBI
BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/).
The open reading frame was predicted by using online
NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/).
Transmembrane regions were predicted by the TMHMM
server 2.0 (http://www.cbs.dtu.dk/services/TMHMM/).
Prediction of subcellular localization of the deduced amino
acids was conducted by using the PSORT (http://wolfpsort.
org/). Dendrogram was created using deduced amino acid
sequence of clones and the protein sequences retrieved
from the GenBank database. Multiple protein sequence
alignment was made using Clustal X and neighbor-joining
tree was generated using Phylodraw. Hydropathy plots
were derived by using TOPpred.
Expression of Omega-6 Desaturase in S. cerevisiae
The D12-desaturase genes from pGEMT-FAD2 plasmid
were sub-cloned in pYES2/CT (Invitrogen) vector for yeast
expression. The pGEMT-FAD2 plasmids were digested
with EcoRI and XhoI enzymes, and the gene was inserted
between identical restriction sites of pYES/CT vector and
the resulting plasmids were designated as pYES-FAD2.
These plasmids were propagated into E. coli and sense
orientation of the corresponding inserts relative to the
GAL1 promoter was confirmed by restriction digestion
and sequencing. The S. cerevisiae strain INVSc1
170
(MATahis3D1leu2trp1-289ura3-52/MATahis3D1leu2trp1289ura3-52, Invitrogen) was transformed with pYESFAD2 plasmid by lithium acetate method and selected on
synthetic complete medium lacking uracil. A single colony
was grown in a synthetic complete minus uracil medium
containing 2% galactose and 2% raffinose at 20°C with
shaking until stationary phase was reached. Yeast cultures
were harvested by centrifugation (4,000g, 10 min), washed
thrice with distilled water, and the pellets were then stored
at -80°C until use.
Fatty Acid Analysis
For analysis of fatty acids, cell pellets were mixed with
4 ml of 3 N methanolic-HCL for esterification, incubated
Fig. 1 Deduced amino acid
sequence alignment of
LuFAD2-2 gene with
Arabidopsis thaliana (AtFAD2,
L26296.1), Jatropha curcas
(JcFAD2, DQ157776.1),
Ricinus communis (RcFAD2;
ABK59093.1), Vernicia fordii
(VfFAD2; AF525534.1), Hevea
brasiliensis (HbFAD2;
AAY87459), and Linum
usitatissimum (LuFAD2;
DQ222824.1) FAD 2 homologs.
Boxes represent histidine motifs
and transmembrane regions are
underlined
Mol Biotechnol (2009) 42:168–174
at 80°C for 2 h and extracted in 3 ml of hexane. The
hexane extracts were dried in argon current and reconstituted in 50 ll of chloroform [9] and analyzed in Auto
System XL Gas Chromatograph (Perkin Elmer, USA)
equipped with SP-2330 Supelco capillary column 30 m
long and 0.32 mm in diameter. The temperature program
was 150°C for 10 min, followed by 10°C rise/min up to
220°C and held for 10 min. Helium (1 ml/min) was used as
a carrier gas, injector port was maintained at 240°C, and
FID detector temperature was 275°C. Appropriate fatty
acid standards were purchased from Sigma (MO, USA) and
the fatty acid peaks were identified by integrating them
with the standard’s profile. The area under the peak was
expressed as percentage fatty acid content. Estimation of
each sample was repeated minimum three times.
Mol Biotechnol (2009) 42:168–174
Results and Discussion
Isolation of a New Isoform of FAD2 Gene from Flax
Using specific primers for conserved C-terminal and Nterminal regions of FAD2 gene, two genomic amplicons
designated as FAD2/1.13 and FAD2/1.32 were amplified
from flax DNA. The clone FAD2/1.32, which showed high
sequence similarity with the earlier reported flax FAD2
gene, codes for a polypeptide of 378 amino acids with an
ORF of 1,137 bp. Another clone, FAD2/1.13 is with an
ORF of 1,149 bp and codes for 382 amino acids. The
nucleotide sequence of FAD2/1.32 gene showed 98%
similarity, whereas FAD2/1.13 gene showed 81% sequence
similarity at nucleotide level with earlier reported flax
FAD2 gene. FAD2/1.13 appears to be a new homolog of
previously reported flax FAD2 gene and therefore designated as LuFAD2-2. FAD2/1.32 gene appears to be a
previously reported gene hence designated as FAD2.
Sequence Analysis of LuFAD2-2 Gene
In agreement with other membrane-bound desaturases, the
deduced amino acid sequence of LuFAD2-2 showed typical
Fig. 2 Hydropathy plot of
LuFAD2-2 (a) and LuFAD2 (b).
Open boxes represent positions
of conserved histidine boxes
171
features including the presence of three histidine boxes,
HECGH, HRRHH, and HVAHH, a characteristic feature of
membrane-bound desaturases [10] (Fig. 1). These histidine
boxes are present in all reported membrane-bound desaturases and are essential for acquiring Fe ions and forming
the catalytic pocket at the interface of membrane and
cytoplasm after anchoring to the membrane by virtue of
specialized transmembrane regions. Moreover, a group of
different enzymes consisting of desaturases, hydroxylases,
and epoxygenases reported ubiquitously from animals,
fungi, plants, and bacteria that catalyze diverse reactions,
use the similar histidine-rich motifs to form the di-iron
center of activity.
To predict whether any signal or transit peptide is present
in the N-terminal region of LuFAD2-2 protein and to
determine its cellular localization, the algorithm for amino
acid sequence analysis (http://www.cbs.dtu.dk/services/
TargetP/) was employed [11, 12]. Any identification for
probable localization of this protein in chloroplast, mitochondria, or secretory pathway could not be recognized
ruling out the possibility of LuFAD2-2 to be a plastidial
counterpart and that it is not targeted to the photosynthetic
apparatus. On the contrary, LuFAD2-2 protein contains
‘YNNKL’ motif at the C terminus of the protein. This
172
sequence has been reported to be necessary and sufficient for
ER localization of enzyme [13], indicating that LuFAD2-2
gene encodes a microsomal enzyme.
The Hydropathy Profiles of the deduced amino acid
sequence of LuFAD2 and LuFAD2-2 were generated using
tools available at expasy site (http://www.expasy.org/).
These studies revealed five clusters of strong hydrophobic
regions (Fig. 2). These clusters are the putative membrane
spanning helices common to most of the membrane-bound
desaturases and represent well-conserved domains between
LuFAD2 and LuFAD2-2. All the histidine boxes are
located at the hydrophobic regions of the protein that make
them fall at the cytoplasmic side. A marked difference in
hydrophobicity between FAD2 and FAD2-2 could be
observed at about 105–110 bases, which corresponds to the
second transmembrane region. Amino acid substitutions at
this region such as D-V: aspartate (-ve) to valine (neutral,
aliphatic) may lead to loss of charge and S–C: serine (OH
group) to cysteine (SH group) might have contributed
toward the stronger hydrophobicity in LuFAD2-2 protein.
As a result, LuFAD2-2 might have stronger membrane
binding in this region as compared to LuFAD2 and most
probably acquires different topology after anchoring to the
membrane.
In flax cv AC Mcduff, Southern and cDNA sequence
analysis revealed presence of two closely related partial
copies of FAD2 gene named as, linFAD1 (CD760588) and
linFAD2 (CD760583) [6]. These two sequences and
recently cloned genomic DNA sequence of FAD2 (gi
77920892) when aligned, showed similarity features but
were considerably different than FAD2-2 gene reported
herein. Furthermore, Fofana et al. [14] suggested that
expression of FAD2-1 isoform of flax omega-6 desaturase
gene was consistent with the expression of seed-specific
FAD2-1 gene reported in soybean. Hence, FAD2 isoform
reported in this study is designated as FAD2-2. The flax
FAD2 gene has been found to be five amino acids shorter
than the majority of the FAD2 genes because of insertion/
deletion at position 12 from the N terminus [7]. Interestingly, FAD2-2 gene reported herein contains four amino
acids extra at position 12 from N terminus. Further, the
dendrogram generated from the sequence has revealed that
LuFAD2-2 and LuFAD2 group with the FAD genes from
Ricinus communis, Hevea brasiliensis, Vernicia fordii, and
Jatropha curcas. The linFAD1 and linFAD2 sequences
show different lineage and fall between plastidial omega-6
desaturase and fungal microsomal omega-6 desaturase;
however, this may be incorrect as the sequences are truncated from both 50 and 30 ends (Fig. 3).
Many of the FAD2 genes, which show closest similarity
with LuFAD2-2 are microsomal desaturases and are
expected to be expressed in abundance in developing seeds
where the turnover of fatty acid metabolism is very high
Mol Biotechnol (2009) 42:168–174
Fig. 3 Phylogenetic tree of deduced amino acid sequences of FAD2,
FAD6, and bifunctional desaturase genes. Arabidopsis thaliana
(AtFAD2, L26296.1; AtFAD6, U09503.1), Arachis duranensis (AdFAD2, AF272951.1), Arachis hypogaea (AhFAD2A, AF030319.1;
FAD2B, AF272950.1), Arachis ipaensis (AiFAD2; AF272952.1),
Brassica napus (BnFAD2, AF243045.1; BnFAD6, L29214.1), Brassica carinata (BcFAD2, AAD19742), Brassica juncea (BjFAD2,
ABR27357), Calendula officinalis (CoFAD2, AF343065.1), Crepis
palaestina (CpFAD2, Y16284.1), Glycine max (GmFAD2-1,
L43920.1; GmFAd2-1A, AB188250; GmFAD2-1B, AB188251.1;
GmFAD2-2, L43921.1; GmFAD2-2A, AB188252.1; GmFAD2-2B,
AB188253; GmFAD2-3, DQ532371.1; GmFAD6, L29215), Helianthus annuus (HaFAD2-1, AF251842.1; HaFAD2-2, AF251843;
HaFAD2-3,
AF251844.1),
Hevea
brasiliensis
(HbFAD2;
AAY87459), Jatropha curcas (JcFAD2, DQ157776.1; JcFAD6,
ABU96742), Linum usitatissimum (LuFAD2; DQ222824.1; LinFAD2-1, CD760583; LuFAD2-2), Mortierella alpina (MaFAD2;
AB020033.1), Mortieralla isabellina (FAD2; AF417245.1) Mucor
circinelloides (McFAD2; AB052087.1) Ricinus communis (RcFAD2;
ABK59093.1), Spinacia oleracea (FAD6; X78311.1), Vernicia fordii
(VfFAD2; AF525534.1). The tree was constructed by using the
Neighbor-Joining algorithm
owing to active accumulation of storage oil. By using the
same pair of primers in our earlier study (Khadake et al.
pers. comm.), we could detect transcript abundance at 4, 8,
12, and 16 days after anthesis in developing flax seeds. We
also found that the FAD2 transcript abundance progressively decreased with maturation. The same primer pair
amplifies LuFAD2 sequence, reported by Krasowska et al.
[7] and LuFAD2-2 sequence reported in this study. The
expression of FAD2 gene, which we measured in our earlier study, is therefore most likely to be of both genes
together. Expression of LuFAD2-2 and LuFAD2 genes
needs to be studied in a more specific manner to enable to
comment on their expression patterns during seed development. It may be relevant to note here that omega-3
desaturases also exist in two similar isoforms in flax,
Mol Biotechnol (2009) 42:168–174
173
Fig. 4 Gas chromatograms of fatty acid methyl esters from
recombinant yeast cultures. A Standard fatty acid profile. B
LuFAD2-2 gene. C LuFAD2 gene. D pYES2/CT vector alone
FAD-3A and FAD-3B, that get amplified by the same pair
of primers and we have to resort to PCR–RFLP to differentially study their expression.
Expression of Omega-6 Desaturase in S. cerevisiae
Yeast is a preferred model for testing the functionality of
plant microsomal desaturases since it lacks the PUFAs typically found in plants. Several of the plant desaturases were
functionally authenticated through yeast expression such as
Arabidopsis FAD2 [15], the tung FAD2 [16], the olive FAD2
[4], the flax FAD3 [17], the soybean FAD3 [18], the tung
FAD3 [19], and the brassica FAD3 gene [20]. We have
cloned the LuFAD2-2 ORF into the expression vector pYES2
under the inducible promoter GAL1. Yeast cells transformed
with empty vector (negative control) showed 16:0, 16:1,
18:0, and 18:1 fatty acids, while fatty acid profile of yeast
clones with recombinant pYES2 expressing LuFAD2-2 and
LuFAD2 gene showed a peak corresponding to LA (18:2)
thereby confirming the functionality of the new isoform that
catalyzed conversion of oleate to linoleate (Fig. 4).
Table 1 gives an account of conversion rates of substrate
and product fatty acids exhibited by yeast clones expressing
LuFAD2-2 and LuFAD2. The average conversion rate was
calculated as weight percent product/(weight percent substrate plus product) 9 100 in three cultures expressing the
gene. The conversion rate of 18:1 to 18:2 was 5.25 ±
0.25% for LuFAD2-2 and 8.85 ± 0.20% for LuFAD2.
When exogenous LA was supplied to these yeast cultures,
desaturation of 18:2 to 18:3 was observed suggesting ability
of both the genes to accept LA as a substrate; although the
monounsaturated oleic acid is the favored substrate. There
are ample evidences in published literature about bifunctional activity of D12/D15 desaturase [21, 22]. Moreover, it
is postulated that D12 and D15 desaturases have a common
ancestor and there is an evolutionary transition from D12 to
D15 desaturase [21, 23]. However, the amount of 18:3 we
could get was much lower than the amount of 18:2, suggesting weak D15 desaturase activity. LuFAD2-2 protein
thus showed similar substrate specificity to that of LuFAD2,
suggesting it to be a FAD2 isoform.
In conclusion, we have identified a new isoform of D12
desaturase genes from flax, which is capable of synthesizing linolenic acid by catalyzing double bond formation
in oleic acid at D12 position. The evidences at nucleic and
amino acid sequences, structural features of deduced protein, and functionality of recombinant protein expressed in
yeast strongly suggest it to be a isoform of microsomal D12
Table 1 Conversion of fatty acid by yeast cultures containing LuFAD2 and LuFAD2-2 plasmids
Clone
Substrate
Substrate accumulation
% (w/w) of total fatty acids
Product
Product accumulation %
(w/w) of total fatty acids
Conversion rate (%)
LuFAD2-2
18:1a
25.29
18:2
1.40
5.25 ± 0.25
18:1b
52.34
18:2
0.44
0.78 ± 0.05
18:2b
34.18
18:3
0.17
0.48 ± 0.02
18:1a
24.1
18:2
2.33
8.85 ± 0.20
18:1b
64.09
18:2
0.52
0.80 ± 0.11
b
18:2
25.59
18:3
0.67
1.25 ± 0.29
18:1a
24.73
–
–
–
18:1b
57.17
–
–
–
18:2b
54.49
–
–
–
LuFad2
Empty vector
Values are the means of triplicate
a
Endogenous substrate
b
Exogenous substrate
174
desaturase and hence denoted as LuFAD2-2. The existence
of this gene denotes genic complexity of desaturase genes
in flax as already evident in the other plants in this class of
microsomal desaturases.
Acknowledgments The work in this manuscript is an outcome of
the R&D project on flax supported financially by Department of
Biotechnology, Government of India. The inputs provided by BVU
also were crucial for completing the project. We thank Dr. P. B.
Ghorpade, Flax Breeder, Nagpur for supplying seeds of the flax
variety NL 97. Technical support by Ms. Ankita Khare and Mrs.
Ashwini Rajwade is acknowledged.
References
1. Ohlrogge, J., & Browse, J. (1995). Lipid biosynthesis. The Plant
Cell, 7, 957–970.
2. Tang, G. Q., Novitzky, W. P., Griffing, H. C., Huber, S. C., &
Dewey, R. E. (2005). Oleate desaturase enzymes of soybean:
Evidence of regulation through differential stability and phosphorylation. The Plant Journal, 44, 433–446. doi:10.1111/j.1365313X.2005.02535.x.
3. Schlueter, J. A., Vasylenko-Sanders, I. F., Deshpande, S., Yi, J.,
Siegfried, M., Roe, B. A., Schlueter, S. D., Scheffler, B. E., &
Shoemaker, R. C. (2007). The FAD2 gene family of soybean:
Insights into the structural and functional divergence of a paleopolyploid genome. The Plant Genome [A Supplement to Crop
Science], 47. http://www.crops.org/genome/. doi:10.2135/cropsci
2005.07.0206tpg.
4. Hernández, M. L., Mancha, M., & Martı́nez-Rivas, J. M. (2005).
Molecular cloning and characterization of genes encoding two
microsomal oleate desaturase (FAD2) from olive. Phytochemistry, 66, 1417–1426. doi:10.1016/j.phytochem.2005.04.004.
5. Martinez-Rivas, J. M., Sperling, P., Luhs, W., & Heinz, E.
(2001). Spatial and temporal regulation of three different
microsomal oleate desaturase genes (FAD2) from normal-type
and high-oleic varieties of sunflower (Helianthus annuus L.).
Molecular Breeding, 8(2), 159–168. doi:10.1023/A:10133243
29322.
6. Fofana, B., Duguid, S., & Cloutier, S. (2004). Cloning of fatty
acid biosynthetic genes b-ketoacyl CoA synthase, fatty acid
elongase, stearoyl-ACP desaturase and fatty acid desaturase and
analysis of expression in the early developmental stages of flax
(Linum usitatissimum L) seeds. Plant Science, 166, 1487–1496.
doi:10.1016/j.plantsci.2004.01.025.
7. Krasowska, A., Dziadkowiec, D., Polinceusz, A., Plonka, A., &
Łukaszewicz, M. (2007). Cloning of flax oleic fatty acid desaturase and its expression in yeast. Journal of the American Oil
Chemists’ Society, 84, 809–816. doi:10.1007/s11746-007-1106-9.
8. Murray, M. G., & Thompson, W. F. (1980). Rapid isolation of
high molecular weight plant DNA. Nucleic Acids Research,
8(19), 4321–4325. doi:10.1093/nar/8.19.4321.
9. Manku, M. S., Horrobin, D. F., Huang, Y. S., & Morse, N.
(1983). Fatty acids in plasma and red cell membranes in normal
humans. Lipids, 18, 906–908. doi:10.1007/BF02534572.
10. Shanklin, J., Whittle, E., & Fox, B. G. (1994). Eight histidine
residues are catalytically essential in a membrane-associated iron
enzyme, stearoyl-CoA desaturase, and are conserved in alkane
hydroxylase and xylene monooxygenase. Biochemistry, 33,
12787–12794. doi:10.1021/bi00209a009.
Mol Biotechnol (2009) 42:168–174
11. Emanuelsson, O., Nielsen, H., Brunak, S., & Heijne, G. (2000).
Predicting subcellular localization of proteins based on their Nterminal amino acid sequence. Journal of Molecular Biology,
300, 1005–1016. doi:10.1006/jmbi.2000.3903.
12. Emanuelsson, O., Brunak, S., Heijne, G., & Nielsen, H. (2007).
Locating proteins in the cell using TargetP, SignalP, and related
tools. Nature Protocols, 2, 953–971. doi:10.1038/nprot.2007.131.
13. McCartney, A. W., Dyer, J. M., Dhanoa, P. K., Kim, P. K.,
Andrews, D. W., McNew, J. A., et al. (2004). Membrane-bound
fatty acid desaturases are inserted co-translationally into the ER
and contain different ER retrieval motifs at their carboxy termini.
The Plant Journal, 37, 156–173. doi:10.1111/j.1365-313X.
2004.01949.x.
14. Fofana, B., Cloutier, S., Duguid, S., Ching, J., & Rampitsch, C.
(2006). Gene expression of stearoyl-ACP desaturase and D12
fatty acid desaturase 2 is modulated during seed development of
flax (Linum usitatissimum). Lipids, 41, 705–712. doi:10.1007/
s11745-006-5021-x.
15. Covello, P. S., & Reed, D. W. (1996). Functional expression of
the extraplastidial Arabidopsis thaliana oleate desaturase gene
(FAD2) in Saccharomyces cerevisiae. Plant Physiology, 111,
223–226. doi:10.1104/pp.111.1.223.
16. Dyer, J. M., Chapital, D. C., Kuan, J. W., Mullen, R. T., Turner,
C., McKeon, T. A., et al. (2002). Molecular analysis of a
bifunctional fatty acid conjugase/desaturase from tung. Implications for the evolution of plant fatty acid diversity. Plant
Physiology, 130, 2027–2038. doi:10.1104/pp.102.010835.
17. Vrinten, P., Hu, Z., Munchinsky, M. A., Rowland, G., & Qiu, X.
(2005). Two FAD3 desaturase genes control the level of linolenic
acid in flax seed. Plant Physiology, 139, 79–87. doi:10.1104/pp.
105.064451.
18. Zhang, H. T., Yang, J. S., Shan, L., & Bla, Y. P. (2006). Functional expression of a x9 -3 fatty acid desaturase gene from glycine
max in Saccharomyces cerevisiae. Chinese Journal of Biotechnology, 22, 33–38. doi:10.1016/S1872-2075(06)60004-6.
19. Dyer, J. M., Chapital, D. C., Kuan, J. W., Shepherd, H. S., Tang,
F., & Pepperman, A. B. (2004). Production of linolenic acid in
yeast cells expressing an omega-3 desaturase from tung (Aleurites
fordii). Journal of the American Oil Chemists’ Society, 81, 647–
651. doi:10.1007/s11746-004-956-x.
20. Reed, D. W., Schäfer, U. A., & Covello, P. S. (2000). Characterization of the Brassica napus extraplastidial linoleate
desaturase by expression in Saccharomyces cerevisiae. Plant
Physiology, 122(3), 715–720. doi:10.1104/pp.122.3.715.
21. Damude, H. G., Zhang, H., Farrall, L., Ripp, K. G., Tomb, J. F.,
Hollerbach, D., et al. (2006). Identification of bifunctional D12/
x9 3 fatty acid desaturase for improving the ratio of x9 3 to x9 6 fatty
acids in microbes and plants. Proceedings of the National
Academy of Sciences of the United States of America, 103(25),
9446–9451. doi:10.1073/pnas.0511079103.
22. Sayanova, O., Haslam, R., Guschina, I., Lioyd, D., Christie, W.
W., Harwood, J. L., et al. (2006). A bifunctional D12/D15
desaturase from Acanthamoeba castellanii directs the synthesis of
highly unusual n-1 series unsaturated fatty acids. The Journal of
Biological Chemistry, 281(48), 36533–36541. doi:10.1074/jbc.
M605158200.
23. Lopez Alonso, D., Garcia-Maroto, F., Rodriguez-Ruiz, J., Garrido,
J. A., & Vilches, M. A. (2003). Evolution of the membrane-bound
fatty acid desaturase. Biochemical Systematics and Ecology, 31,
1111–1124. doi:10.1016/S0305-1978(03)00041-3.