Mol Biotechnol (2009) 42:168–174 DOI 10.1007/s12033-009-9150-3 RESEARCH Cloning of a Novel Omega-6 Desaturase from Flax (Linum usitatissimum L.) and Its Functional Analysis in Saccharomyces cerevisiae Rupali M. Khadake Æ Prabhakar K. Ranjekar Æ Abhay M. Harsulkar Published online: 12 February 2009 Ó Humana Press 2009 Abstract The D12 desaturase represents a diverse gene family in plants and is responsible for conversion of oleic acid (18:1) to linoleic acid (18:2). Several members of this family are known from plants like Arabidopsis and Soybean. Using primers from conserved C- and N-terminal regions, we have cloned a novel D12 desaturase gene amplified from flax genomic DNA, denoted as LuFAD2-2. This intron-less gene is 1,149-base pair long encoding 382 amino acids—putative membrane-bound D12 desaturase protein. Sequence comparisons show that the novel sequence has 85% similarity with previously reported flax D12 desaturase at amino acid level and shows typical features of membrane-bound desaturase such as three conserved histidine boxes along with four membranespanning regions that are universally present among plant desaturases. The signature amino acid sequence ‘YNNKL’ was also found to be present at the N terminus of the protein, which is necessary and sufficient for ER localization of enzyme. Neighbor-Joining tree generated from the sequence alignment grouped LuFAD2-2 among the other FAD2 sequences from Ricinus, Hevea, Jatropha, and Vernicia. When LuFAD2-2 and LuFAD2 were expressed in Saccharomyces cerevisiae, they could convert the oleic acid to linoleic acid, with an average conversion rate of 5.25 and 8.85%, respectively. However, exogenously supplied linoleic acid was feebly converted to linolenic acid suggesting that LuFAD2-2 encodes a functional FAD2 enzyme and has substrate specificity similar to LuFAD2. R. M. Khadake P. K. Ranjekar A. M. Harsulkar (&) Interactive Research School for Health Affairs, Medical College Campus, Bharati Vidyapeeth University, Pune-Satara Road, Pune 411043, India e-mail: aharsulkar@yahoo.com Keywords FAD2 Omega-6 desaturase Flax (Linum usitatissimum L.) Linoleic acid Oleic acid S. cerevisiae Abbreviations ALA Alpha linolenic acid; 18:3 ER Endoplasmic reticulum FAD Fatty acid desaturase FAD2 Omega-6 desaturase LA Linoleic acid; 18:2 PUFA Polyunsaturated fatty acid 16:0; Palmitic acid, 18:0; Stearic acid, 18:1; Oleic acid Introduction The D12 fatty acid desaturase introduces a double bond at D12 position of oleic acid and converts it to linoleic acid (LA) in fatty acid biosynthesis pathway. Production of linoleic acid marks the synthesis of polyunsaturated fatty acid (PUFA) from monounsaturated oleic acid and it is a major factor in determining the quality of plant oils. Oils with high proportion of oleic acid (18:1) and LA (18:2) are of nutritional interest for human as well as animals besides having better keeping quality. D12 desaturation is also an imperative prerequisite for the synthesis of omega-3 ALA (18:3) since D12 desaturation product alone could be accepted as substrate by D15 desaturase. These desaturases are, therefore, of biotechnological significance in creating novel sources of omega-3 fatty acids through genetic manipulation, especially in oleaginous microbes that produce oleic acid in large amounts. Two distinct sites exist for D12 desaturation, one is in plastidial membrane and the other on the endoplasmic Mol Biotechnol (2009) 42:168–174 169 reticulum (ER), both having distinct genes with specialized signals for respective localization [1]. D12 appears to exist as complex gene families in several genomes. In soybean, ESTbased searches by Tang et al. [2] and Schlueter et al. [3] have identified at least seven members of this gene family in four regions of the genome. Expression analysis has revealed that at least three FAD2-like genes are expressed in seeds and one house keeping gene form in most of the plant tissues. Soybean stands as a good example showing diversity and complexity in D12 desaturase genic and genomic organization, so much that it has become an excellent resource to study the evolutionary dynamics of a paleo-polyploid genome [3]. The desaturase genes, therefore, appear to exist in multiple forms in many of the plant genomes such as Arabidopsis, cotton, olive, sunflower, sesame, and pomegranate. In olive, two forms exist, OepFAD2-1 and OepFAD2-2 [4] and three forms, HaFAD2-1, HaFAD2-2, and HaFAD2-3, have been isolated from sunflower [5]. In flax, Fofana et al. [6] have identified two copies of FAD2 gene expressed in developing seeds with closely matching sequences; however, the sequences available are incomplete. More recently, a full-length genomic clone has been characterized from flax encoding a 378-amino acid protein [7]. We, here, report cloning and characterization of a new isoform of an intron-less FAD2 gene from flax genomic DNA, which is 1,149 base pairs long, encoding a protein of 382 amino acids, revealing all the typical features of a membrane-bound desaturase. The deduced amino acid sequence showed 85% similarity with previously reported FAD2 gene from flax and shares 81% identity at nucleotide level. Its expression in Saccharomyces cerevisiae shows that it encodes a functional protein, which may have value to those who work for flax quality improvement. the start and end of the coding region with EcoRI and XhoI sites inserted for ease of subcloning in pYES vector. PCR amplifications were performed using flax genomic DNA as a template and the FAD2-specific primers. A typical PCR reaction consists of initial denaturation at 94°C for 5 min, followed by 35 cycles, each comprising 30 s denaturation at 94°C, 45 s annealing at 60°C, and 2 min extension at 72°C with final extension at 72°C for 5 min. The amplified product was resolved by agarose gel electrophoresis, expected size amplicon was purified using spin columns (Ultra free DA, Amicon USA), inserted into pGEMT-Easy vector (Promega) and transformed into competent Escherichia coli cells. The positive transformants were then subjected to colony PCR for further confirmation. Plasmids from positive colonies were isolated, designated as pGEMT-FAD2, and sequenced from both 50 and 30 ends at least three times. Materials and Methods Accession Numbers Plant Material The gene sequences obtained in this study have been deposited at GenBank under accession number EU660501 (LuFAD2-2) and EU660502 (LuFAD2). Seeds of flax variety NL 97 were obtained from the flax breeder, Dr. P. B. Ghorpade, Nagpur Agricultural College, Nagpur. The seedlings were grown in petri plates lined with wet filter paper and stored at -80°C until DNA isolation. DNA Extraction and PCR Amplification Total genomic DNA was extracted from frozen seedlings (1 g), using CTAB method as described by Murray and Thompson [8] with little modifications. The forward (D12F-GCGCGAATTCGGGATGGGTGCAGGTGGAAG AATG) and the reverse (D12R-GCGCCTCGAGTCATCA TAACTTATTGTTGTACCAGAA) primers were designed from available FAD2 sequences (DQ222824.1) including Sequence Analysis D12-desaturase sequences were identified by the NCBI BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/). The open reading frame was predicted by using online NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/). Transmembrane regions were predicted by the TMHMM server 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). Prediction of subcellular localization of the deduced amino acids was conducted by using the PSORT (http://wolfpsort. org/). Dendrogram was created using deduced amino acid sequence of clones and the protein sequences retrieved from the GenBank database. Multiple protein sequence alignment was made using Clustal X and neighbor-joining tree was generated using Phylodraw. Hydropathy plots were derived by using TOPpred. Expression of Omega-6 Desaturase in S. cerevisiae The D12-desaturase genes from pGEMT-FAD2 plasmid were sub-cloned in pYES2/CT (Invitrogen) vector for yeast expression. The pGEMT-FAD2 plasmids were digested with EcoRI and XhoI enzymes, and the gene was inserted between identical restriction sites of pYES/CT vector and the resulting plasmids were designated as pYES-FAD2. These plasmids were propagated into E. coli and sense orientation of the corresponding inserts relative to the GAL1 promoter was confirmed by restriction digestion and sequencing. The S. cerevisiae strain INVSc1 170 (MATahis3D1leu2trp1-289ura3-52/MATahis3D1leu2trp1289ura3-52, Invitrogen) was transformed with pYESFAD2 plasmid by lithium acetate method and selected on synthetic complete medium lacking uracil. A single colony was grown in a synthetic complete minus uracil medium containing 2% galactose and 2% raffinose at 20°C with shaking until stationary phase was reached. Yeast cultures were harvested by centrifugation (4,000g, 10 min), washed thrice with distilled water, and the pellets were then stored at -80°C until use. Fatty Acid Analysis For analysis of fatty acids, cell pellets were mixed with 4 ml of 3 N methanolic-HCL for esterification, incubated Fig. 1 Deduced amino acid sequence alignment of LuFAD2-2 gene with Arabidopsis thaliana (AtFAD2, L26296.1), Jatropha curcas (JcFAD2, DQ157776.1), Ricinus communis (RcFAD2; ABK59093.1), Vernicia fordii (VfFAD2; AF525534.1), Hevea brasiliensis (HbFAD2; AAY87459), and Linum usitatissimum (LuFAD2; DQ222824.1) FAD 2 homologs. Boxes represent histidine motifs and transmembrane regions are underlined Mol Biotechnol (2009) 42:168–174 at 80°C for 2 h and extracted in 3 ml of hexane. The hexane extracts were dried in argon current and reconstituted in 50 ll of chloroform [9] and analyzed in Auto System XL Gas Chromatograph (Perkin Elmer, USA) equipped with SP-2330 Supelco capillary column 30 m long and 0.32 mm in diameter. The temperature program was 150°C for 10 min, followed by 10°C rise/min up to 220°C and held for 10 min. Helium (1 ml/min) was used as a carrier gas, injector port was maintained at 240°C, and FID detector temperature was 275°C. Appropriate fatty acid standards were purchased from Sigma (MO, USA) and the fatty acid peaks were identified by integrating them with the standard’s profile. The area under the peak was expressed as percentage fatty acid content. Estimation of each sample was repeated minimum three times. Mol Biotechnol (2009) 42:168–174 Results and Discussion Isolation of a New Isoform of FAD2 Gene from Flax Using specific primers for conserved C-terminal and Nterminal regions of FAD2 gene, two genomic amplicons designated as FAD2/1.13 and FAD2/1.32 were amplified from flax DNA. The clone FAD2/1.32, which showed high sequence similarity with the earlier reported flax FAD2 gene, codes for a polypeptide of 378 amino acids with an ORF of 1,137 bp. Another clone, FAD2/1.13 is with an ORF of 1,149 bp and codes for 382 amino acids. The nucleotide sequence of FAD2/1.32 gene showed 98% similarity, whereas FAD2/1.13 gene showed 81% sequence similarity at nucleotide level with earlier reported flax FAD2 gene. FAD2/1.13 appears to be a new homolog of previously reported flax FAD2 gene and therefore designated as LuFAD2-2. FAD2/1.32 gene appears to be a previously reported gene hence designated as FAD2. Sequence Analysis of LuFAD2-2 Gene In agreement with other membrane-bound desaturases, the deduced amino acid sequence of LuFAD2-2 showed typical Fig. 2 Hydropathy plot of LuFAD2-2 (a) and LuFAD2 (b). Open boxes represent positions of conserved histidine boxes 171 features including the presence of three histidine boxes, HECGH, HRRHH, and HVAHH, a characteristic feature of membrane-bound desaturases [10] (Fig. 1). These histidine boxes are present in all reported membrane-bound desaturases and are essential for acquiring Fe ions and forming the catalytic pocket at the interface of membrane and cytoplasm after anchoring to the membrane by virtue of specialized transmembrane regions. Moreover, a group of different enzymes consisting of desaturases, hydroxylases, and epoxygenases reported ubiquitously from animals, fungi, plants, and bacteria that catalyze diverse reactions, use the similar histidine-rich motifs to form the di-iron center of activity. To predict whether any signal or transit peptide is present in the N-terminal region of LuFAD2-2 protein and to determine its cellular localization, the algorithm for amino acid sequence analysis (http://www.cbs.dtu.dk/services/ TargetP/) was employed [11, 12]. Any identification for probable localization of this protein in chloroplast, mitochondria, or secretory pathway could not be recognized ruling out the possibility of LuFAD2-2 to be a plastidial counterpart and that it is not targeted to the photosynthetic apparatus. On the contrary, LuFAD2-2 protein contains ‘YNNKL’ motif at the C terminus of the protein. This 172 sequence has been reported to be necessary and sufficient for ER localization of enzyme [13], indicating that LuFAD2-2 gene encodes a microsomal enzyme. The Hydropathy Profiles of the deduced amino acid sequence of LuFAD2 and LuFAD2-2 were generated using tools available at expasy site (http://www.expasy.org/). These studies revealed five clusters of strong hydrophobic regions (Fig. 2). These clusters are the putative membrane spanning helices common to most of the membrane-bound desaturases and represent well-conserved domains between LuFAD2 and LuFAD2-2. All the histidine boxes are located at the hydrophobic regions of the protein that make them fall at the cytoplasmic side. A marked difference in hydrophobicity between FAD2 and FAD2-2 could be observed at about 105–110 bases, which corresponds to the second transmembrane region. Amino acid substitutions at this region such as D-V: aspartate (-ve) to valine (neutral, aliphatic) may lead to loss of charge and S–C: serine (OH group) to cysteine (SH group) might have contributed toward the stronger hydrophobicity in LuFAD2-2 protein. As a result, LuFAD2-2 might have stronger membrane binding in this region as compared to LuFAD2 and most probably acquires different topology after anchoring to the membrane. In flax cv AC Mcduff, Southern and cDNA sequence analysis revealed presence of two closely related partial copies of FAD2 gene named as, linFAD1 (CD760588) and linFAD2 (CD760583) [6]. These two sequences and recently cloned genomic DNA sequence of FAD2 (gi 77920892) when aligned, showed similarity features but were considerably different than FAD2-2 gene reported herein. Furthermore, Fofana et al. [14] suggested that expression of FAD2-1 isoform of flax omega-6 desaturase gene was consistent with the expression of seed-specific FAD2-1 gene reported in soybean. Hence, FAD2 isoform reported in this study is designated as FAD2-2. The flax FAD2 gene has been found to be five amino acids shorter than the majority of the FAD2 genes because of insertion/ deletion at position 12 from the N terminus [7]. Interestingly, FAD2-2 gene reported herein contains four amino acids extra at position 12 from N terminus. Further, the dendrogram generated from the sequence has revealed that LuFAD2-2 and LuFAD2 group with the FAD genes from Ricinus communis, Hevea brasiliensis, Vernicia fordii, and Jatropha curcas. The linFAD1 and linFAD2 sequences show different lineage and fall between plastidial omega-6 desaturase and fungal microsomal omega-6 desaturase; however, this may be incorrect as the sequences are truncated from both 50 and 30 ends (Fig. 3). Many of the FAD2 genes, which show closest similarity with LuFAD2-2 are microsomal desaturases and are expected to be expressed in abundance in developing seeds where the turnover of fatty acid metabolism is very high Mol Biotechnol (2009) 42:168–174 Fig. 3 Phylogenetic tree of deduced amino acid sequences of FAD2, FAD6, and bifunctional desaturase genes. Arabidopsis thaliana (AtFAD2, L26296.1; AtFAD6, U09503.1), Arachis duranensis (AdFAD2, AF272951.1), Arachis hypogaea (AhFAD2A, AF030319.1; FAD2B, AF272950.1), Arachis ipaensis (AiFAD2; AF272952.1), Brassica napus (BnFAD2, AF243045.1; BnFAD6, L29214.1), Brassica carinata (BcFAD2, AAD19742), Brassica juncea (BjFAD2, ABR27357), Calendula officinalis (CoFAD2, AF343065.1), Crepis palaestina (CpFAD2, Y16284.1), Glycine max (GmFAD2-1, L43920.1; GmFAd2-1A, AB188250; GmFAD2-1B, AB188251.1; GmFAD2-2, L43921.1; GmFAD2-2A, AB188252.1; GmFAD2-2B, AB188253; GmFAD2-3, DQ532371.1; GmFAD6, L29215), Helianthus annuus (HaFAD2-1, AF251842.1; HaFAD2-2, AF251843; HaFAD2-3, AF251844.1), Hevea brasiliensis (HbFAD2; AAY87459), Jatropha curcas (JcFAD2, DQ157776.1; JcFAD6, ABU96742), Linum usitatissimum (LuFAD2; DQ222824.1; LinFAD2-1, CD760583; LuFAD2-2), Mortierella alpina (MaFAD2; AB020033.1), Mortieralla isabellina (FAD2; AF417245.1) Mucor circinelloides (McFAD2; AB052087.1) Ricinus communis (RcFAD2; ABK59093.1), Spinacia oleracea (FAD6; X78311.1), Vernicia fordii (VfFAD2; AF525534.1). The tree was constructed by using the Neighbor-Joining algorithm owing to active accumulation of storage oil. By using the same pair of primers in our earlier study (Khadake et al. pers. comm.), we could detect transcript abundance at 4, 8, 12, and 16 days after anthesis in developing flax seeds. We also found that the FAD2 transcript abundance progressively decreased with maturation. The same primer pair amplifies LuFAD2 sequence, reported by Krasowska et al. [7] and LuFAD2-2 sequence reported in this study. The expression of FAD2 gene, which we measured in our earlier study, is therefore most likely to be of both genes together. Expression of LuFAD2-2 and LuFAD2 genes needs to be studied in a more specific manner to enable to comment on their expression patterns during seed development. It may be relevant to note here that omega-3 desaturases also exist in two similar isoforms in flax, Mol Biotechnol (2009) 42:168–174 173 Fig. 4 Gas chromatograms of fatty acid methyl esters from recombinant yeast cultures. A Standard fatty acid profile. B LuFAD2-2 gene. C LuFAD2 gene. D pYES2/CT vector alone FAD-3A and FAD-3B, that get amplified by the same pair of primers and we have to resort to PCR–RFLP to differentially study their expression. Expression of Omega-6 Desaturase in S. cerevisiae Yeast is a preferred model for testing the functionality of plant microsomal desaturases since it lacks the PUFAs typically found in plants. Several of the plant desaturases were functionally authenticated through yeast expression such as Arabidopsis FAD2 [15], the tung FAD2 [16], the olive FAD2 [4], the flax FAD3 [17], the soybean FAD3 [18], the tung FAD3 [19], and the brassica FAD3 gene [20]. We have cloned the LuFAD2-2 ORF into the expression vector pYES2 under the inducible promoter GAL1. Yeast cells transformed with empty vector (negative control) showed 16:0, 16:1, 18:0, and 18:1 fatty acids, while fatty acid profile of yeast clones with recombinant pYES2 expressing LuFAD2-2 and LuFAD2 gene showed a peak corresponding to LA (18:2) thereby confirming the functionality of the new isoform that catalyzed conversion of oleate to linoleate (Fig. 4). Table 1 gives an account of conversion rates of substrate and product fatty acids exhibited by yeast clones expressing LuFAD2-2 and LuFAD2. The average conversion rate was calculated as weight percent product/(weight percent substrate plus product) 9 100 in three cultures expressing the gene. The conversion rate of 18:1 to 18:2 was 5.25 ± 0.25% for LuFAD2-2 and 8.85 ± 0.20% for LuFAD2. When exogenous LA was supplied to these yeast cultures, desaturation of 18:2 to 18:3 was observed suggesting ability of both the genes to accept LA as a substrate; although the monounsaturated oleic acid is the favored substrate. There are ample evidences in published literature about bifunctional activity of D12/D15 desaturase [21, 22]. Moreover, it is postulated that D12 and D15 desaturases have a common ancestor and there is an evolutionary transition from D12 to D15 desaturase [21, 23]. However, the amount of 18:3 we could get was much lower than the amount of 18:2, suggesting weak D15 desaturase activity. LuFAD2-2 protein thus showed similar substrate specificity to that of LuFAD2, suggesting it to be a FAD2 isoform. In conclusion, we have identified a new isoform of D12 desaturase genes from flax, which is capable of synthesizing linolenic acid by catalyzing double bond formation in oleic acid at D12 position. The evidences at nucleic and amino acid sequences, structural features of deduced protein, and functionality of recombinant protein expressed in yeast strongly suggest it to be a isoform of microsomal D12 Table 1 Conversion of fatty acid by yeast cultures containing LuFAD2 and LuFAD2-2 plasmids Clone Substrate Substrate accumulation % (w/w) of total fatty acids Product Product accumulation % (w/w) of total fatty acids Conversion rate (%) LuFAD2-2 18:1a 25.29 18:2 1.40 5.25 ± 0.25 18:1b 52.34 18:2 0.44 0.78 ± 0.05 18:2b 34.18 18:3 0.17 0.48 ± 0.02 18:1a 24.1 18:2 2.33 8.85 ± 0.20 18:1b 64.09 18:2 0.52 0.80 ± 0.11 b 18:2 25.59 18:3 0.67 1.25 ± 0.29 18:1a 24.73 – – – 18:1b 57.17 – – – 18:2b 54.49 – – – LuFad2 Empty vector Values are the means of triplicate a Endogenous substrate b Exogenous substrate 174 desaturase and hence denoted as LuFAD2-2. The existence of this gene denotes genic complexity of desaturase genes in flax as already evident in the other plants in this class of microsomal desaturases. Acknowledgments The work in this manuscript is an outcome of the R&D project on flax supported financially by Department of Biotechnology, Government of India. The inputs provided by BVU also were crucial for completing the project. We thank Dr. P. B. Ghorpade, Flax Breeder, Nagpur for supplying seeds of the flax variety NL 97. Technical support by Ms. Ankita Khare and Mrs. Ashwini Rajwade is acknowledged. References 1. Ohlrogge, J., & Browse, J. (1995). Lipid biosynthesis. The Plant Cell, 7, 957–970. 2. Tang, G. Q., Novitzky, W. P., Griffing, H. C., Huber, S. C., & Dewey, R. E. (2005). Oleate desaturase enzymes of soybean: Evidence of regulation through differential stability and phosphorylation. The Plant Journal, 44, 433–446. doi:10.1111/j.1365313X.2005.02535.x. 3. Schlueter, J. A., Vasylenko-Sanders, I. F., Deshpande, S., Yi, J., Siegfried, M., Roe, B. A., Schlueter, S. D., Scheffler, B. E., & Shoemaker, R. C. (2007). The FAD2 gene family of soybean: Insights into the structural and functional divergence of a paleopolyploid genome. The Plant Genome [A Supplement to Crop Science], 47. http://www.crops.org/genome/. doi:10.2135/cropsci 2005.07.0206tpg. 4. Hernández, M. L., Mancha, M., & Martı́nez-Rivas, J. M. (2005). Molecular cloning and characterization of genes encoding two microsomal oleate desaturase (FAD2) from olive. Phytochemistry, 66, 1417–1426. doi:10.1016/j.phytochem.2005.04.004. 5. Martinez-Rivas, J. M., Sperling, P., Luhs, W., & Heinz, E. (2001). Spatial and temporal regulation of three different microsomal oleate desaturase genes (FAD2) from normal-type and high-oleic varieties of sunflower (Helianthus annuus L.). Molecular Breeding, 8(2), 159–168. doi:10.1023/A:10133243 29322. 6. Fofana, B., Duguid, S., & Cloutier, S. (2004). Cloning of fatty acid biosynthetic genes b-ketoacyl CoA synthase, fatty acid elongase, stearoyl-ACP desaturase and fatty acid desaturase and analysis of expression in the early developmental stages of flax (Linum usitatissimum L) seeds. Plant Science, 166, 1487–1496. doi:10.1016/j.plantsci.2004.01.025. 7. Krasowska, A., Dziadkowiec, D., Polinceusz, A., Plonka, A., & Łukaszewicz, M. (2007). Cloning of flax oleic fatty acid desaturase and its expression in yeast. Journal of the American Oil Chemists’ Society, 84, 809–816. doi:10.1007/s11746-007-1106-9. 8. Murray, M. G., & Thompson, W. F. (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research, 8(19), 4321–4325. doi:10.1093/nar/8.19.4321. 9. Manku, M. S., Horrobin, D. F., Huang, Y. S., & Morse, N. (1983). Fatty acids in plasma and red cell membranes in normal humans. Lipids, 18, 906–908. doi:10.1007/BF02534572. 10. Shanklin, J., Whittle, E., & Fox, B. G. (1994). Eight histidine residues are catalytically essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monooxygenase. Biochemistry, 33, 12787–12794. doi:10.1021/bi00209a009. Mol Biotechnol (2009) 42:168–174 11. Emanuelsson, O., Nielsen, H., Brunak, S., & Heijne, G. (2000). Predicting subcellular localization of proteins based on their Nterminal amino acid sequence. Journal of Molecular Biology, 300, 1005–1016. doi:10.1006/jmbi.2000.3903. 12. Emanuelsson, O., Brunak, S., Heijne, G., & Nielsen, H. (2007). Locating proteins in the cell using TargetP, SignalP, and related tools. Nature Protocols, 2, 953–971. doi:10.1038/nprot.2007.131. 13. McCartney, A. W., Dyer, J. M., Dhanoa, P. K., Kim, P. K., Andrews, D. W., McNew, J. A., et al. (2004). Membrane-bound fatty acid desaturases are inserted co-translationally into the ER and contain different ER retrieval motifs at their carboxy termini. The Plant Journal, 37, 156–173. doi:10.1111/j.1365-313X. 2004.01949.x. 14. Fofana, B., Cloutier, S., Duguid, S., Ching, J., & Rampitsch, C. (2006). Gene expression of stearoyl-ACP desaturase and D12 fatty acid desaturase 2 is modulated during seed development of flax (Linum usitatissimum). Lipids, 41, 705–712. doi:10.1007/ s11745-006-5021-x. 15. Covello, P. S., & Reed, D. W. (1996). Functional expression of the extraplastidial Arabidopsis thaliana oleate desaturase gene (FAD2) in Saccharomyces cerevisiae. Plant Physiology, 111, 223–226. doi:10.1104/pp.111.1.223. 16. Dyer, J. M., Chapital, D. C., Kuan, J. W., Mullen, R. T., Turner, C., McKeon, T. A., et al. (2002). Molecular analysis of a bifunctional fatty acid conjugase/desaturase from tung. Implications for the evolution of plant fatty acid diversity. Plant Physiology, 130, 2027–2038. doi:10.1104/pp.102.010835. 17. Vrinten, P., Hu, Z., Munchinsky, M. A., Rowland, G., & Qiu, X. (2005). Two FAD3 desaturase genes control the level of linolenic acid in flax seed. Plant Physiology, 139, 79–87. doi:10.1104/pp. 105.064451. 18. Zhang, H. T., Yang, J. S., Shan, L., & Bla, Y. P. (2006). Functional expression of a x9 -3 fatty acid desaturase gene from glycine max in Saccharomyces cerevisiae. Chinese Journal of Biotechnology, 22, 33–38. doi:10.1016/S1872-2075(06)60004-6. 19. Dyer, J. M., Chapital, D. C., Kuan, J. W., Shepherd, H. S., Tang, F., & Pepperman, A. B. (2004). Production of linolenic acid in yeast cells expressing an omega-3 desaturase from tung (Aleurites fordii). Journal of the American Oil Chemists’ Society, 81, 647– 651. doi:10.1007/s11746-004-956-x. 20. Reed, D. W., Schäfer, U. A., & Covello, P. S. (2000). Characterization of the Brassica napus extraplastidial linoleate desaturase by expression in Saccharomyces cerevisiae. Plant Physiology, 122(3), 715–720. doi:10.1104/pp.122.3.715. 21. Damude, H. G., Zhang, H., Farrall, L., Ripp, K. G., Tomb, J. F., Hollerbach, D., et al. (2006). Identification of bifunctional D12/ x9 3 fatty acid desaturase for improving the ratio of x9 3 to x9 6 fatty acids in microbes and plants. Proceedings of the National Academy of Sciences of the United States of America, 103(25), 9446–9451. doi:10.1073/pnas.0511079103. 22. Sayanova, O., Haslam, R., Guschina, I., Lioyd, D., Christie, W. W., Harwood, J. L., et al. (2006). A bifunctional D12/D15 desaturase from Acanthamoeba castellanii directs the synthesis of highly unusual n-1 series unsaturated fatty acids. The Journal of Biological Chemistry, 281(48), 36533–36541. doi:10.1074/jbc. M605158200. 23. Lopez Alonso, D., Garcia-Maroto, F., Rodriguez-Ruiz, J., Garrido, J. A., & Vilches, M. A. (2003). Evolution of the membrane-bound fatty acid desaturase. Biochemical Systematics and Ecology, 31, 1111–1124. doi:10.1016/S0305-1978(03)00041-3.