Name: Date: Period: DNA Replication Below are some strands of DNA. Only one strand is shown. Create the complementary strands. I have broken the strand into pieces of 3 nucleotides to make it easier to read. 1. ATA / CGA / TCG / ATC / GAT / TTT / CAG / TCA / GTT / CAA 2. CAT / CAT / ATA / CCC / AAA / CAA / CTT / GGC / GGA / AGG 3. AAA / CAC / GGT / GAA / CGG / GGG / ATG / GAA / TGA / GGC 4. GGTTACTAGCATCAACAGGGGTGACATTTTCAAAACC 5. AAGCATCAGTCATGCATGCGTAGCTTTTGCATGGCTTGACTG Answer the questions on the back! 1. What is DNA replication? 2. Why does DNA have to replicate itself? 3. Which three enzymes help DNA to replicate? 4. Describe the shape of the DNA molecule. 5. What does “semi-conservative” mean? 6. What is the function of DNA?