Chapter 12 Review The Structure of DNA: Label the nucleotide below. 1. What does DNA stand For? 2. What type of bond holds two bases together? 3. A. What is the bigger base called? B. What are the two examples of this category of base? 4. A. What is the smaller base called? B. What are the two examples of this category of base? 5. What is the shape of DNA? 6. What are the “rungs” of DNA? 7. What is the “backbone” made of? 8. In DNA, what does Guanine bond with? 9. In DNA, what does Thymine bond with? 10. How do the two side of DNA compare? (include information about the orientation) DNA Replication: Answer the following questions about DNA Replication using the pictures below. T A Picture 1 C G A BC D Picture 2 1. What is the first step to DNA Replication? 2. What type of enzyme matches up free floating nucleotides to the DNA Template strand? 3. What is the end product of DNA replication? 4. Which strands in Picture 2 are the original parent strands of DNA? 5. Which strands in Picture 2 are the newly synthesized Daughter strands ofDNA? 6. What nucleotide complements cytosine in RNA? 7. What nucleotide complements adenine in RNA? 8. Give the complementary DNA strand to the DNA below. ATCGGCGTAGCGTAAGCTACGTAGCTTTAGC 9. Where does DNA replication occur in the cell? 10. During which phase of the cell cycle does DNA replicate itself? 11. What model of replication does DNA follow?