Name: _____________________________________ Date: ____________ Catch the Hacker Dr. Johnson was recently hacked by a crazed information thief, and luckily he was able to avoid his prized research being taken. He has gone into hiding out of fear that he will be attacked again, but he was able to gather several clues about the identity of his attacker before disconnecting from the grid. Because Dr. Johnson is a geneticist, he has sent his clues in the form of a special code: the genetic code. If you recall the order of the amino acids give the instructions to make different proteins that organisms need to sustain life. Your job is to use the codon wheel to transcribe and translate these messages to determine the correct amino acid sequence and help identify the hacker. After each sequence is translated, write the single letter abbreviation for each amino acid to discover the clue. Use the clues to determine the HACKER. The Suspects: Chubby- The Judge Lose-Lonnie The Lawyer Skinny- The Deputy Ralph- The Oil Tycoon Pete-The Professor Example DNA message: AAGATTCTTCTTGAAAGA Transcription: ______ Lys-Ile-Leu-Leu-Glu-Arg ____________________________ Translation: _________ KILLER _____________________________________________________ What is the Clue? _______________________________________________________________ DNA message #1: CATGCCACT Transcription: __________________________________________________________________ Translation: ____________________________________________________________________ What is the Clue? _______________________________________________________________ DNA message #2: TTTGCTTGTATTGCTCTC CATGCTATTAGG Transcription: __________________________________________________________________ Translation: ____________________________________________________________________ What is the Clue? _______________________________________________________________ DNA message #3: TTTGAAGCTACTCACGAACGTCTTGAAAGCAGT Transcription: __________________________________________________________________ Translation: ____________________________________________________________________ What is the Clue? _______________________________________________________________ DNA message #4: TTGGCATGG Transcription: __________________________________________________________________ Translation: ____________________________________________________________________ What is the Clue? _______________________________________________________________ 1. Based on each clue, who do you think hacked Dr. Johnson?