SUPPLEMENTARY INFORMATI 7376189144ON Adipogenic activity of 2-ethylhexyl diphenyl phosphate via peroxisome proliferator-activated receptor γ pathway Weijie Suna, Xiaoyu Duana, Hao Chena, Lianying Zhanga,b, Hongwen Suna a MOE Key Laboratory of Pollution Processes and Environmental Criteria, College of Environmental Science and Engineering, Nankai University, Tianjin 300350, China b School of Environmental Science and Safety Engineering, Tianjin University of Technology, Tianjin 300384, China. E-mail: sunhongwen@nankai.edu.cn (H. W. Sun). lianyingzh@yahoo.com (L. Y. Zhang) 1 Table S1. Primers Used for RT-qPCR Gene Primer sequences Sequences (5'to 3’) FABP4 Forward TTCGATGAAATCACCGCAGAC Reverse GCTCATGCCCTTTCATAAACTC Lpl Forward GCCCAGCAACATTATCCAGT Reverse GGTCAGACTTCCTGTTACGC Adip Forward CCCAAGGGAACTTGTGCAGGTTGGATG Reverse GTTGGTATCATGGTAGAGAAGAAAGCC Fasn Forward GATTAGCCTAAGACTGAAGCAT Reverse CTGCTCCCTTGAGTCAGTAAA β-actin Forward ACACCCCAGCCATGTACG Reverse TGGTGGTGAAGCTGTAGCC 2 Fig S1. Effects of EHDPP and Rosi on the HEK-293T cell viability. HEK-293T cell were transiently transfected with pBIND-PPARγ-LBD and pGL4.35[luc2P/9XGAL4UAS/Hygro] using Lipofectamine 2000. The cells were then treated with DMSO (0.5%), EHDPP (0.1~10 μM), or Rosi (1 μM) for 24 h and the cell viability was measured by CCK-8 assay. The data are expressed as means ± SEM (n=4). The results are presented as fold-change relative to the DMSO vehicle. 3 Fig S2. Effects of EHDPP on 3T3-L1 cell viability. 3T3-L1 cells were exposed to DMSO (0.5%), EHDPP (0.1~10 μM) for 10 days. The data are expressed as means ± SEM (n=4). The results are presented as fold-change relative to the DMSO vehicle. 4