Uploaded by Adi Arev

B&E Lab Bacteria Sequences

advertisement
>Gene 1
TGGAGGGCTATACATGCAGTCGAACGCGTTGGCCCAATTGATTGATGGTGCTTGCACCTGATTGATTTTG
GTCGCCAACGAGTGGCGGACGGGTGAGTAACACGTAGGTAACCTGCCCAGAAGCGGGGGACAACATTTGG
AAACAGATGCTAATACCGCATAACAGCGTTGTTCGCATGAACAACGCTTAAAAGATGGCTTCTCGCTATC
ACTTCTGGATGGACCTGCGGTGCATTAGCTTGTTGGTGGGGTAACGGCCTACCAAGGCGATGATGCATAG
CCGAGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCATACTCCTACGGGAGGCAGCAGTA
>Gene 2
TCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAACCAACAGATTC
ACTTCGGTGATGACGTTGGGAACGCGAGCGGCGGATGGGTGAGTAACACGTGGGGAACCTGCCCCATAGT
CTGGGATACCACTTGGAAACAGGTGCTAATACCGGATAAGAAAGCAGATCGCATGATCAGCTTATAAAAG
GCGGCGTAAGCTGTCGCTATGGGATGGCCCCGCGGTGCATTAGCTAGTTGGTAGGGTAACGGCCTACCAA
GGCAATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTA
>Gene 3
ATGGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGA
AGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGC
GGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAG
GGGCAATTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGG
CGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACG
>Gene 4
TTGATTTAATTTTGAACGAGTGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCCTTAAGTGGGGGATA
ACATTTGGAAACAGATGCTAATACCGCATAAATCCAAGAACCGCATGGTTCTTGGCTGAAAGATGGCGTA
AGCTATCGCTTTTGGATGGACCCGCGGCGTATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAATGA
TACGTAGCCGAACTGAGAGGTTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCTACGGGAGGCA
GCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTNAAGAAGGCTTTCG
Download
Random flashcards
Arab people

15 Cards

Pastoralists

20 Cards

Radioactivity

30 Cards

Marketing

46 Cards

Create flashcards