A- Principle of Genetics and
Biodiversity
Principles of Evolution
• How Did Evolutionary Thought Evolve?
– Early biological thought did not include the concept of
evolution.
– Exploration of new lands revealed a staggering diversity of
life.
– Fossil discoveries showed that life had changed over
Time.
– Some scientists devised non-evolutionary explanations for
fossils.
– A few scientists speculated that life had evolved with time.
– Geology provided evidence that Earth is exceedingly old.
– Some pre-Darwin biologists proposed mechanisms for
evolution.
– Darwin and Wallace proposed a mechanism of evolution.
Fossils of extinct organisms
•
Fossils provide strong support for the idea that today's organisms were not
created all at once, but arose over time by the process of evolution. If all
species were created simultaneously, we would not expect (a) trilobites to
be found in older rock layers than (b) seed ferns, which in turn would not be
found deeper than (c) dinosaurs, such as Allosaurus. Trilobites became
extinct about 230 million years ago, seed ferns about 150 million years ago,
and dinosaurs 65 million years ago.
Principles of Evolution
• Darwin studied a group of closely related
species of finches on the Galapagos Islands.
• Each species specializes in eating a different
type of food and has a beak of characteristic
size and shape, because natural selection has
favored the individuals best suited to exploit
each food source efficiently.
• Aside from the differences in their beaks, the
finches are quite similar.
a.
b.
c.
d.
Large ground finch, beak suited to large seeds
Small ground finch, beak suited to small seeds
Warbler finch, beak suited to insects
Vegetarian tree finch, beak suited to leaves
How Does Natural Selection Work?
• Natural Selection modifies populations over time.
• Fossils provide evidence of evolutionary change over
time.
• Comparative Anatomy gives evidence of Descent with
Modification.
• Homologous structures provide evidence of Common
Ancestry.
• Functionless structures are inherited from ancestors.
• Many organisms have vestigial structures that serve no
apparent function. The (a) salamander, (b) whale, and
(c) snake all inherited hindlimb bones from a common
ancestor; the bones remain functional in the salamander
but are vestigial in the whale and snake.
How Do We Know That Evolution Has
Occurred?
•
•
•
Some anatomical similarities result from
evolution in similar environments
Embryological similarity suggests common
ancestry
Modern biochemical and genetic analyses
reveal relatedness among diverse organisms.
• Convergent evolution can produce outwardly similar
structures that differ anatomically. The wings of (a)
insects and (b) birds and the sleek, streamlined shapes
of (c) seals and (d) penguins are examples of such
analogous structures.
• The early embryonic stages of a (a) lemur type of
monkeys, (b) pig, and (c) human show strikingly similar
anatomical features.
What Is the Evidence That Populations Evolve
by Natural Selection?
• Controlled Breeding Modifies Organisms
• Evolution by Natural Selection Occurs Today
– When fewer predators are present, brighter coloration
can evolve.
– Natural Selection can lead to pesticide resistance.
– Experiments can demonstrate Natural Selection.
– Selection acts on random variation to favor the traits
that work best in particular environments
Dog diversity illustrates artificial selection
• A comparison of (a) the ancestral dog (the gray wolf, Canis lupus)
and (b) various breeds of modern dogs. Artificial selection by
humans has caused a great divergence in size and shape of dogs in
only a few thousand years.
How Are Populations, Genes, and
Evolution Related?
• Genes and the environment interact to
determine traits.
• The gene pool is the sum of the genes in a
population.
• Evolution is the change over time of allele
frequencies within a population.
• The equilibrium population is a hypothetical
population that does not evolve.
What Causes Evolution?
• Mutations are the source of Genetic Variability
– Mutations are rare, but important
– Mutations are not Goal-Directed
• Mutations occur spontaneously
• Gene flow between populations changes Allele
Frequencies.
• Allele frequencies may drift in small populations.
– Population size matters
– A population bottleneck Is an example of Genetic Drift
– Population bottlenecks reduce variation
The Effect of Population Size on Genetic Drift
• Each colored line represents one computer simulation of
the change over time in the frequency of allele A in a (a)
large or (b) small population in which two alleles, A and
a, were initially present in equal proportions, and in
which randomly chosen individuals reproduced.
Population Bottlenecks Reduce Variation
• (a) A population bottleneck may drastically reduce genetic
and phenotypic variation because the few organisms that
survive may carry similar sets of alleles. Both (b) the northern
elephant seal and (c) the cheetah passed through population
bottlenecks in the recent past, resulting in an almost total loss
of genetic diversity.
What Causes Evolution?
• Isolated founding populations may produce
bottlenecks
• Mating within a population Is almost never
random
• All genotypes are not equally beneficial
– Antibiotic resistance evolves by natural selection
– Penicillin resistance illustrates key points about
evolution
A Compromise Between Opposing Pressures
• (a) A male giraffe with a long neck is at a definite advantage in combat
to establish dominance.
• (b) But a giraffe's long neck forces it to assume an extremely awkward
and vulnerable position when drinking. Thus, drinking and male–male
contests place opposing evolutionary pressures on neck length.
How Does Natural Selection Work?
• Natural selection stems from unequal reproduction
• Natural selection acts on phenotypes
• Some phenotypes reproduce more successfully than
others.
–
–
–
–
An environment has non-living and living components
Competition acts as an agent of selection
Both predator and prey act as agents of selection
Sexual selection favors traits that help an organism mate
• Selection can influence populations in three ways
– Directional selection shifts character traits in a specific direction
– Stabilizing selection acts against individuals who deviate too far
from the average
– Disruptive selection adapts individuals within a population to
different habitats.
The Tree of Life
• All living things share a common
ancestor.
• We can draw a Tree of Life to
show how every species is related.
• Evolution is the process by which
one species gives rise to another
and the Tree of Life grows
en.wikipedia.org/wiki/Image:Phylogenetic_tree.svg
Evolution as Theory and Fact
• Confusion sometimes arises as to
whether Evolution is a theory or a fact.
Actually it is both!
• The theory of Evolution deals with how
Evolution happens. Our understanding
of this process is always changing.
• Evolution is also a fact as there is a
huge amount of indisputable evidence
for its occurrence.
Talk Outline
Part 1: How was evolution discovered?
Discussion: Should Creationism and Evolution be
given “equal time” in science lessons?
Part 2: How does evolution work?
Practical: Natural Selection in the Peppered Moth
Part 3: What is the evidence for evolution?
Discovery (2): Transmutation
• Around 1800, scientists began to
wonder whether species could
change or transmute.
• Lamarck thought that if an animal
acquired a characteristic during its
lifetime, it could pass it onto its
offspring.
• Hence giraffes got their long necks
through generations of straining to
Jean Baptiste de Lamarck reach high branches.
commons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg
en.wikipedia.org/wiki/Image:Giraffe_standing.jpg
Discovery (3): Fossils and Strata
http://en.wikipedia.org/wiki/
ImageWilliam_Smith.g.jpg
http://en.wikipedia.org/wiki/Image:
Geological_map_of_Great_Britain.jpg
http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpg
William Smith, his geology map & some of his fossil specimens
At about the same time, geologists like William Smith were
mapping the rocks and fossils of Britain. He and others showed
that different species existed in the past compared with today.
Discovery (4): Darwin’s Voyage
• From 1831-1836, a
young naturalist called
Charles Darwin toured
the world in HMS
Beagle.
Voyage of the Beagle
en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpg
en.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg
• He was dazzled by the
amazing diversity of
life and started to
wonder how it might
have originated
Discovery (5): Survival of the Fittest
• In his Origin of Species,
published in 1859, Darwin
proposed how one species
might give rise to another.
Natural Selection
explains adaption
• Where food was limited,
competition meant that only
the fittest would survive.
• This would lead to the natural selection
of the best adapted individuals and
eventually the evolution of a new species.
en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg
Darwin in 1860
Discovery (6): Huxley v. Wilberforce
• Darwin’s idea of
Evolution by Natural
Selection was met with
huge controversy.
Bishop Wilberforce v. T. H. Huxley
• A famous debate in
1860 pitted Bishop
Wilberforce against
Darwin’s bulldog,
Thomas Henry Huxley.
• Evolutionists got the better of the debate, but few were convinced
by Darwin’s idea of Natural Selection.
www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg
Discovery (7): Genetics
Mendel and his peas
• From 1856-63, a monk called Gregor
Mendel cultivated 29,000 pea plants
to investigate how evolution worked
i.e., how characteristics were passed
down the generations.
• He figured out the basic principles of
genetics. He showed that offspring
received characteristics from both
parents, but only the dominant
characteristic trait was expressed.
Mendel’s work only came to light in
1900, long after his death
en.wikipedia.org/wiki/Image:Mendel.png
en.wikipedia.org/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg
Discovery (8): Making Sense
• In the early 20th century, scientist started to
make sense of how evolution worked.
• Building on Mendel’s genetics, studies
showed how characteristics in a population
could be selected by environmental
pressures.
Julian Huxley
and the
Modern Synthesis
• This Modern Synthesis, as Julian Huxley
called it, brought Darwin’s Natural Selection
back to the centre of evolutionary theory.
en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg
Discovery (9): Opposition
• Despite the achieval of
scientific consensus on
evolution, some Christian
groups continued to
oppose the concept.
Outside the Scopes Trial
• In 1925, the teaching of
evolution was outlawed
in Tennessee, USA,
resulting in the infamous
Scopes Monkey Trial
www.templeton-cambridge.org/fellows/vedantam/publications/2006.02.05/eden_and_evolution/
Mechanism (1): All in the Genes
• The genetic make-up of
an organism is known as
its genotype.
• An organism’s genotype
and the environment in
which it lives determines
its total characteristic traits
i.e. its phenotype.
Genotype
Phenotype
commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG
Mechanism (2): DNA
• The double-helix
structure of DNA
was discovered
in 1953.
Watson and Crick and
their model of DNA
DNA
replication
www.chem.ucsb.edu/~kalju/chem110L/public/tutorial/images/WatsonCrick.jpg
en.wikipedia.org/wiki/DNA
• This showed how
genetic information
is transferred from
one cell to another
almost without error.
Mechanism (3): Mutation
Types of mutation
• However, occasional
mutations or copying errors
can and do occur when
DNA is replicated.
• Mutations may be caused
by radiation, viruses, or
carcinogens.
Mutant fruitfly
• Mutations are rare and often have
damaging effects. Consequently organisms
have special enzymes whose job it is to
repair faulty DNA.
upload.wikimedia.org/wikipedia/commons/7/79/Types-of-mutation.png
humansystemstherapeutics.com/bb.htm
Mechanism (4): Variation
• Nevertheless, some
mutations will persist and
increase genetic variation
within a population.
• Variants of a particular
gene are known as alleles.
For example, the one of
the genes for hair colour
comprises brown/blonde
alleles.
majorityrights.com/index.php/weblog/comments/racial_variation_in_so
me_parts_of_the_skull_involved_in_chewing/
Mechanism (5): Natural Selection
Selection of dark gene
• Mutant alleles spread through a
population by sexual reproduction.
• If an allele exerts a harmful effect,
it will reduce the ability of the
individual to reproduce and the
allele will probably be removed
from the population.
• In contrast, mutants with favorable
effects are preferentially passed on
en.wikipedia.org/wiki/Image:Mutation_and_selection_diagram.svg
Mechanism (6): Peppered Moth
Haldane and the peppered moth • The Peppered Moth is an
example of Natural Selection
in action discovered by Haldane


http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg
en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg
en.wikipedia.org/wiki/J._B._S._Haldane
• During the Industrial Revolution
the trees on which the moth
rested became soot-covered.
• This selected against the allele for pale
colour in the population (which were
poorly camouflaged from predators)
and selected for the dark colour allele.
Mechanism (7): Microevolution
• The dog is another example of how
selection can change the frequency
of alleles in a population.
• Dogs have been artificially selected
for certain characteristics for many
years, and different breeds have
different alleles.
Dogs are
wolves
• All breeds of dog belong to the same
species, Canis lupus (the wolf) so this
is an example of Microevolution as no
new species has resulted.
www.puppy-training-solutions.com/image-files/dog-breed-information.jpg
Mechanism (8): Macroevolution
• However, if two populations of a
species become isolated from
one another for tens of thousands
of years, genetic difference may
become marked.
• If the two populations can no-longer
interbreed, new species are born.
This is called Macroevolution.
Galapagos finches
• Darwin’s Galapagos finches are
an example of this process in action.
www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
Mechanism (9): Speciation Today?
• The mosquito was introduced to
the London Underground during
its construction around 1900.
London Underground Mosquito
en.wikipedia.org/wiki/Image:Gb-lu-Angel-southbound.jpg
en.wikipedia.org/wiki/Culex
• It became infamous in the War
for attacking people sheltering
from the Blitz.
• Studies indicate several genetic
differences from its above-ground
ancestors. Interbreeding between
populations is difficult suggesting
that speciation may be occurring.
Activity
Natural Selection in the Peppered Moth
http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg
en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg
Evidence (1): Biochemistry
• The basic similarity of all living things suggests
that they evolved from a single common ancestor.
• As we have already seen, all living things pass
on information from generation to generation
using the DNA molecule.
• All living things also use a molecule
called ATP to carry
energy around the
DNA for
Information organism.
Transfer
en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png
ATP for
Energy
Transfer
Evidence (2): Similar Genes
HUMAN
CHIMPANZEE
GORILLA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
• If evolution is true then we might also expect that closely
related organisms will be more similar to one another than more
distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.
Evidence (3): Comparative Anatomy
• Similar comparisons can be made
based on anatomical evidence.
• The skeleton of humans and
gorillas are very similar suggesting
they shared a recent common
ancestor, but very different from the
more distantly related
woodlouse…
Human and
Gorilla
yet all have a common
shared characteristic:
bilateral symmetry
Woodlouse
en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg
Evidence (4): Homology
The pentadactyl limb
is ancestral to all
vertebrates…
but modified for different uses
en.wikipedia.org/wiki/Image:Evolution_pl.png
Evidence (5): Vestigial Structures
• As evolution progresses, some
structures get side-lined as they
are not longer of use. These
are known as vestigial structures.
• The coccyx is a much reduced
version of an ancestral tail, which
was formerly adapted to aid
balance and climbing.
The coccyx is a vestigial tail
en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg
Evidence (6): Fossil Record
http://en.wikipedia.org/wiki/Geologic_time_scale
© World Health Org.
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png
© NASA
origins
bacteria
complex cells
dinosaurs
humans
The fossil record shows a sequence from simple bacteria to
more complicated organisms through time and provides the most
compelling evidence for evolution.
Evidence (7): Transitional fossils
• Many fossils show a clear
transition from one species,
or group, to another.
• Archaeopteryx was found
in Germany in 1861. It
share many characteristics
with both dinosaurs and
birds.
Archaeopteryx
en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG
• It provides good evidence
that birds arose from
dinosaur ancestors
Evidence (8): Geography
• Geographic spread of
Marsupials organisms also tells of
their past evolution.
• Marsupials occur in
two populations today
in the Americas and
Australia.
• This shows the group
evolved before the
continents drifted apart
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml
en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
Evidence (9): Antibiotic resistance
Staphylococcus
• We are all familiar with
the way that certain
bacteria can become
resistant to antibiotics
• This is an example of natural selection in
action. The antibiotic acts as an
environmental pressure. It weeds out
those bacteria with low resistance and
only those with high resistance survive
to reproduce.
http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svg
en.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg
Reproduction
Asexual
Reproduction
– involves only 1 parent
– offspring genetically
identical to parent
– involves regular body
cells
– its quick
Vs
Sexual
Reproduction
– involves 2 parents
– offspring genetic mix of
both parents leads to
genetic diversity
– involves specialized germ
cells
– its slow
Sexual reproduction starts from spermatogenesis and