Mansour2018 Article EffectsOfDietaryInclusionOfMor

advertisement
Fish Physiol Biochem (2018) 44:1223–1240
https://doi.org/10.1007/s10695-018-0515-z
Effects of dietary inclusion of Moringa oleifera leaves
on growth and some systemic and mucosal immune
parameters of seabream
Abdallah Tageldein Mansour & Liang Miao &
Cristóbal Espinosa & José María García-Beltrán &
Diana C. Ceballos Francisco & M. Ángeles Esteban
Received: 31 October 2017 / Accepted: 8 May 2018 / Published online: 25 May 2018
# Springer Science+Business Media B.V., part of Springer Nature 2018
Abstract The effect of the dietary incorporation of
drumstick, Moringa oleifera, leaf meal (MOL; 0, 5, 10
and 15%) on the growth, feed utilization, some skin
mucus and systemic immune parameters and intestinal
immune-related gene expression in gilthead seabream
(Sparus aurata) specimens. The experiment lasted
4 weeks. The results revealed that MOL can be incorporated in S. aurata diet up to 10% with no significant
negative effect on growth and feed utilization. However,
there was a significant decrease with MOL at a level of
15% after 2 weeks of feeding. The systemic immune
status of fish fed with the different levels of MOL
showed an improvement in head kidney leucocyte
phagocytosis, respiratory burst and peroxidase activities. Also, serum humoral components, including protease, ACH50 and lysozyme activities and IgM level,
increased with MOL inclusion especially at the 5%
level. MOL at 5% improved skin-mucosal immunity
A. T. Mansour
Fish and Animal Production Department, Faculty of Agriculture
(Saba Basha), Alexandria University, Alexandria 21531, Egypt
L. Miao
Key Laboratory of Applied Marine Biotechnology, Ministry of
Education, Ningbo University, Ningbo 315211, China
C. Espinosa : J. M. García-Beltrán :
D. C. Ceballos Francisco : M. Á. Esteban (*)
Fish Innate Immune System Group, Department of Cell Biology
and Histology, Faculty of Biology, Regional Campus of
International Excellence “Campus Mare Nostrum”, University of
Murcia, 30100 Murcia, Spain
e-mail: [email protected]
such as protease, antiprotease, peroxidase and lysozyme
activities. Moreover, the feeding of MOL revealed an
upregulation of the intestinal mucosal immunity genes
(lyso and c3), tight junction proteins (occludin and zo-1)
and anti-inflammatory cytokines (tgf-β) with a downregulation of pro-inflammatory cytokine (tnf-α). Therefore, it is recommended to incorporate MOL in S. aurata
diets at a level of 5% for the best immune status or 10%
for the high growth performance and acceptable immune surveillance.
Keywords Moringa oleifera . Growth . Mucosal
immunity . Innate immune response . Intestinal immune
genes . Gilthead seabream (Sparus aurata)
Introduction
The importance of finfish aquaculture is increasing rapidly worldwide, in part due to the reduction of natural
stocks and the increase of consumer demand for healthy
proteins (Hoseinifar et al. 2017a). However, a major
obstacle in the development and sustainability of the
aquaculture sector is the occurrence of diseases in the
farming system, which can lead to serious economic
loss (Holmes et al. 2016). Moreover, the uncontrolled
use of antibiotics in some farming practices to treat or
prevent diseases has led to an increase in the occurrence
of multi-resistant bacterial strains (Cabello 2006). This
serious phenomenon has attracted growing global public health concern and justified the need for investment
in alternative forms of infectious disease treatment
1224
(Marti et al. 2014). The prevention and management
measures are the central concern to overcome such
outbreaks of diseases. In terms of environmentally
friendly methods of disease management and fish welfare, immunostimulants are considered an effective tool
for modulating the fish immune system and are also
relatively cheap compared to synthetic drugs
(Chakraborty et al. 2014; Hoseinifar et al. 2016a).
The administration of various immunostimulants in
fish improved the immune system in both systemic and
mucosal levels. At the systemic immune level, it boosts
the functions of phagocytic natural killer cells and increases the levels of humoral components such as complement, lysozyme and antibodies (Ardó et al. 2008;
Bahi et al. 2017; Dügenci et al. 2003; Hoseinifar et al.
2016a).
Furthermore, immunostimulants have the ability to
reinforce the mucosal defence barrier including the fish
skin and mucus, which are crucial for the prevention of
the external aggressions on all aquatic animals (Esteban
2012), whereas skin mucus has a high capacity to avoid
the adhesion and colonization of pathogenic bacteria
(Benhamed et al. 2014; Hoseinifar et al. 2017b) and
represents a rich source of several immune molecules
such as antimicrobial peptides, lectins, lysozymes and
immunoglobulins (Cordero et al. 2016; Esteban 2012;
Jurado et al. 2015).
Also, immunostimulants affected the gut health and
maintained the intestinal immune defence against external pathogen invasion (Gomez et al. 2013; Wen et al.
2014). The gut immunity depends on tight junction
proteins and gut-associated lymphoid tissue (Lazado
and Caipang 2014). The tight junction proteins represent
a physical barrier in the intestinal wall against pathogen
invasion and also regulate the absorption function of the
gut (Grosell et al. 2010). For its part, gut-associated
lymphoid tissue consists of lymphocytes, monocytes
and macrophages, which produce immune components,
such as lysozyme, complement and acid phosphatase
(Wen et al. 2014).
Medicinal plants are increasingly studied worldwide
because many researchers have demonstrated their potential effects on growth and survival, as well as on the
antimicrobial properties against aquatic organisms
(Chakraborty et al. 2014; Murthy and Kiran 2013).
Also, these plants have been used for thousands of years
in many animal species. Therefore, they could be used
for different purposes in aquaculture, whereas they
could serve as natural sources of antimicrobial
Fish Physiol Biochem (2018) 44:1223–1240
compounds, which are naturally renewable, less expensive, acceptable and less likely to give rise to the problems of intolerance (Hoseinifar et al. 2016b; Van Hai
2015). Among these, Moringa (Moringa oleifera,
Moringaceae family) has been the object of several
animal research studies due to its rich phytochemical
content and well-known bactericidal potential (Coppin
et al. 2013; Sikder et al. 2013). Moringa is a rapidly
growing tree that was commonly known as a drumstick
tree, horseradish tree and kelor tree in ancient Roman,
Greek and Egyptian medicines (Sreelatha et al. 2011).
Moringa is a widely cultivated tree in the tropic and
subtropic regions of Asia and Africa and is widely
adapted and cultivated in most countries of the world
(Morton 1991).
Medicinally, several parts of Moringa including
leaf, root, bark, gum, fruit (pods), flowers, seed and
seed oil are generally known for their multiple pharmacological effects (Morimitsu et al. 2000). Nevertheless, the leaves represent the main yield of this
tree (24 t dry matter hactare−1 year−1) (Sánchez et al.
2006), and also they contain the best nutritional and
medicinal properties than the other parts (Sikder
et al. 2013), whereas Moringa leaves are considered
a valuable source of nutrients, such as protein, calcium and vitamins A and C (Siddhuraju and Becker
2003), as well as pigments including carotenoids,
lutein, alpha-carotene, beta-carotene, xanthins and
chlorophyll (Aslam et al. 2005). Also, they are a
rich source of flavonoid constituents, including
quercetin, kaempferol glucosides and glucoside
malonates (Anwar et al. 2007; Coppin et al. 2013).
The biological properties of Moringa include antioxidant, antimicrobial, anti-inflammatory and immunityboosting activities (Coppin et al. 2013). Moreover, these
properties promoted the growth performance of several
fish species, such as Clarias gariepinus (Ozovehe
2013), Oreochromis niloticus (Afuang et al. 2003;
Dongmeza et al. 2006), Cyprinus carpio (Yuangsoi
and Masumoto 2012) and Pangasius bocourti
(Yuangsoi et al. 2014). Moringa clearly provides an
inexhaustible source of phytochemicals with miscellaneous action mechanisms (Sreelatha et al. 2011).
To the best of our knowledge, there are no available studies that focus on the use of Moringa
(M. oleifera) leaf meal as an immunostimulant for
fish. Accordingly, the present study was designed to
evaluate the effects of increasing dietary levels of
Moringa leaves on growth, feed utilization, some
Fish Physiol Biochem (2018) 44:1223–1240
skin mucus and systemic immune parameters and
intestinal immune-related gene expression in
gilthead seabream (S. aurata).
1225
photoperiod of 12 h light to 12 h dark. The Ethical
Committee of the University of Murcia approved the
fish handling procedures.
Experimental design and sample collection
Materials and methods
Plant material and diet preparation
M. oleifera leaves (MOL) were collected from the
experimental farm of the Botany Department, Faculty of Agriculture (Saba Basha), Alexandria University (Egypt). The air-dried leaves were ground to
a fine powder by an electric grinder. A total of four
isonitrogenous and isoenergetic diets were prepared
in order to contain 45% crude protein through the
inclusion of MOL powder at different levels (0, 5,
10 and 15%) in a commercial diet. Prior to feed
preparation, the proximate composition of the
MOL, yellow corn meal (used to adjust the final
protein levels in all diets) and a commercial pellet
diet (Skretting, Spain) was determined according to
AOAC (2000) (Table 1). The pellets were crushed
and mixed with MOL powder alone or in combination with yellow corn meal (Dongmeza et al. 2006),
and then tap water was added slowly to make
clumped diets. The final products were extruded at
room temperature with a 2-mm die meat grinder, and
the resulting pellets were dried in a forced-air oven
(37 °C, 24 h) before packaged in polypropylene
bags and stored at 4 °C until use.
Experimental fish
Ninety-six gilthead seabream (S. aurata) specimens
(138.75 ± 4.65 g body weight), obtained from a local
farm (Murcia, Spain), were kept in recirculating aquaculture tanks (2 m3) in the Marine Fish Facility at the
University of Murcia, Spain. The fish were kept in the
laboratory for 1 month as a quarantine period to ensure
the absence of disease.
Furthermore, the fish were acclimatized in the
experimental tanks (400 l per tank) for 15 days
before the start of the trial and assigned to eight
tanks at the initial stocking density of 12 fish per
tank. The fish were fed daily with a commercial diet
at a rate of 3% body weight two times per day. The
water temperature was maintained at 22 ± 1 °C with
a flow rate of 800 l h−1 and 28‰ salinity and a
Fish were weighed, measured and randomly divided
into eight identical tanks (two replicates per treatment) and fed with the experimental diets (3% of
body weight, two times a day). Following 2 or
4 weeks of feeding, six specimens from each aquarium were sampled. Before sampling, fish were
starved for 24 h and anaesthetized by using clove
oil (50 mg l−1 water). Skin mucus was collected by
scraping, avoiding contamination with blood, urine
and/or faeces. Mucus samples were transferred into
1.5-ml tubes and centrifuged (10,000 × g, 15 min,
4 °C). Supernatants were then collected and stored
at −80 °C until subsequent use. Blood samples were
collected from the caudal vein with an insulin syringe and left in 1.5-ml tubes to clot at 4 °C for 4 h,
and the serum was collected after centrifugation
(10,000 × g, 5 min, 4 °C) and stored at −80 °C until
use. The fish was dissected to obtain the anterior
intestine. The intestine samples were stored in
TRIzol Reagent (Invitrogen) 0.5 ml per 0.2 g tissue
at −80 °C and used for gene expression analysis.
The head kidney (HK) leucocytes were insulated
to investigate the cellular immune activities (Esteban
et al. 1998). Briefly, HK leucocytes were removed,
cut into small fragments, passed through a cell
strainer (100 μm nylon) and transferred to 10 ml
of sRPMI [RPMI-1640 culture medium (SigmaAldrich) supplemented with 0.35% sodium chloride,
2% (v/v) foetal calf serum (Sigma-Aldrich),
10 μl ml−1 heparin (Sigma-Aldrich), 100 IU ml−1
penicillin (Flow) and 100 mg ml−1 streptomycin
(Flow)]. Then, HK leucocytes were washed twice
(400 × g, 10 min) with sRPMI (without heparin)
and counted (Z2 Coulter Particle Counter) to adjust
the viable cells at 1 × 107 cells ml−1 using the trypan
blue exclusion test.
Growth performance and feed utilization
The body weight and length (fork length) of each
fish were measured before and at the end of the
experiment in order to calculate the weight gain,
condition factor (CF) and thermal unit growth
1226
Fish Physiol Biochem (2018) 44:1223–1240
Table 1 Proximate chemical composition of ingredients and experimental diets
Ingredients (g kg−1)
Experimental diets
0%
5%
Ingredients
10%
15%
Commercial
diet
Moringa
leaves
Yellow corn
meal
Commercial diet1
925.0
900.0
875.0
850.0
–
–
–
Moringa leaves
–
50.0
100.0
150.0
–
–
–
Corn flour
75.0
50.0
25.0
–
–
–
–
Chemical composition (g kg−1 dry mater bases)
Dry matter
920.10
91.5
910.8
900.0
940.0
909.0
920.0
Crude protein (CP)
450.2
448.3
446.3
444.3
480.0
242.0
83.0
Ether extract (EE)
169.5
166.3
163.0
159.8
18.00
4.50
4.00
Crude fibre (CF)
59.2
59.2
59.2
59.3
36.0
173.0
24.0
Ash
59.2
59.2
59.2
59.3
63.0
38.0
12.0
Nitrogen-free extract (NFE)2
286.0
284.1
282.1
280.2
241.0
502.0
841.0
Gross energy (GE; kJ g−1 DM)3
22.2
22.0
21.8
21.6
22.57
16.12
18.00
P/E ratio (mg CP kJ−1)4
20.3
20.4
20.5
20.6
9.55
10.65
4.99
1
Commercial pellet diet: D-2 Optibream AE 1P (Skretting, Spain)
2
NFE: nitrogen-free extract calculated using the following equation: NFE = 100 − (crude protein + ether extract + crude fibre + ash)
3
Gross energy calculated on the basis of 23.6, 39.4 and 17.2 kJ gross energy per g protein, ether extract and NFE respectively (NRC 1993)
4
P/E ratio: protein energy ratio (mg crude protein per kJ gross energy) = CP/GE 9 1000
coefficient (TGC) for each of the experimental
groups:
Weight gain ¼ W f −W 0 3
CF ¼ 100 weight=length
TGC ¼
1
1
D
W 3f −W 03 = ∑ T i
1000
i¼1
where Wf is the final weight (g), W0 is the initial weight
(g), Ti is the mean daily temperature (°C) and D is the
number of days (Cho 1990).
The following parameters were also studied:
Survival ð%Þ ¼ 100 ðfinal fish number=initial stocked numberÞ
Feed intake g diet kg−1 fish
¼ ðfeed intake ðgÞ 1000Þ=fish weight ðgÞ
Feed conversion ratio ðFCRÞ
¼ feed intake ðgÞ=weight gain ðgÞ
Protein efficacy ratio ðPERÞ
¼ weight gain ðgÞ=protein intake ðgÞ
Innate immune parameters
Cellular immune parameters
Phagocytic activity
The phagocytosis of Saccharomyces cerevisiae (strain
S288C) by gilthead seabream HK leucocytes was studied
by flow cytometry (Rodríguez et al. 2003). Briefly,
100 μl of 107 HK leucocytes in sRPMI and 60 μl of
S. cerevisiae (5 × 107 cells ml−1 of sRBMI) were mixed
and centrifuged (400 × g, 5 min, 22 °C), before being
resuspended and incubated at 22 °C for 30 min. Then,
samples were placed on ice to stop phagocytosis and
diluted by 400 μl ice-cold phosphate-buffered saline
(PBS). The fluorescence of the extracellular yeast cells
was quenched by adding 40 μl ice-cold trypan blue (0.4%
in PBS). Standard samples of fluorescein isothiocyanatelabelled S. cerevisiae or HK leucocytes were included in
each phagocytosis assay. All samples were analyzed in a
flow cytometer to analyze the phagocytic cells. Phagocytic ability was defined as the percentage of phagocytic
cells with one or more ingested yeast, and phagocytic
capacity was the mean fluorescence intensity.
Fish Physiol Biochem (2018) 44:1223–1240
Respiratory burst
The respiratory burst activity of gilthead seabream
(S. aurata) HK leucocytes was studied by a chemiluminescence method (Bayne and Levy 1991).
Briefly, 100 μl of 107 HK leucocytes in sRPMI
was placed in triplicate wells of a 96-well flat-bottomed plate. Then, 100 μl of HBSS (Hank’s balanced salt solution, Gibco) containing 1 μg ml−1
phorbol myristate acetate (PMA, Sigma) and
10−4 M luminol (Sigma) was added to each well.
The plate was shaken and immediately read in a
plate reader for 1 h at 2-min intervals. The kinetic
of the reactions was analyzed every 2 min during
1 h, and the maximum slope of each curve was
calculated. Backgrounds of luminescence were calculated using reactant solutions containing luminol
but not PMA.
Head kidney leucocyte peroxidase activity
The peroxidase activity in HK leucocytes was measured
according to Quade and Roth (1997). Briefly, 5 μl of 107
HK leucocytes was placed in sRPMI per well in a 96well flat-bottomed plate with 50 μl of cetyltrimethyl
ammonium bromide (0.02%, Sigma) and shaken for
10 min at 60 rpm in the dark; 100 μl of 20 mM
3,3′,5,5′-tetramethylbenzidine hydrochloride (TMB,
Sigma) and 5 mM H2O2 was added per well. The colour
change reaction was stopped after 2 min by adding 50 μl
of 2 M sulphuric acid, and the optical density was read at
450 nm in a plate reader. Standard samples without
leucocytes were used as blanks.
Humoral immune parameters in skin mucus and serum
Total protein
The total protein concentration in skin mucus and
serum samples was determined using the
Coomassie Brilliant Blue G-250 method (Bradford
1976). Briefly, 5 μl of the samples in triplicate was
incubated with 250 μl of the Bradford reagent
(Sigma-Aldrich) in 96-well flat-bottomed plates,
and similar volumes of bovine serum albumin
(Sigma-Aldrich) were used in serial dilutions as a
standard. After incubating the plates (10 min, room
1227
temperature, in darkness), the absorbance at 550 nm
was read in a plate (BMG, FLUOstar Omega). The
total protein concentration present in each sample
was expressed as milligrammes per millilitres and
used to standardize the humoral immune parameters
of skin mucus and serum.
Proteases
Protease activity was determined using the azocasein
hydrolysis assay (Ross et al. 2000). Briefly, 10 μl of
mucus and serum sample (diluted at 1/10 in 100 mM
ammonium bicarbonate buffer) was incubated for 24 h
at 30 °C in a 96-well flat-bottomed plate with 125 μl of
100 mM ammonium bicarbonate buffer containing 2%
azocasein (Sigma-Aldrich) for serum or 0.7% azocasein
for skin. 10% trichloroacetic acid (TCA) was used as a
stop solution. The mixture was then centrifuged
(10,000 × g, 10 min) and the supernatants were transferred to a 96-well flat-bottomed plate in triplicate containing 100 μl per well of 1 N NaOH, and the OD was
read using a plate reader at 450 nm. Samples were
replaced by trypsin (5 mg ml−1, Sigma) as a positive
control (100% of protease activity) or by the buffer as a
negative control (0% activity).
Antiproteases
Total antiprotease activity was determined in skin mucus and serum by the ability of serum to inhibit trypsin
activity (Hanif et al. 2004). Briefly, 10 μl of samples
was incubated (10 min, 22 °C) with the same volume of
standard trypsin solution (5 mg ml−1) in a 96-well flatbottomed plate. After adding 100 μl of 100 mM ammonium bicarbonate buffer and 125 μl of buffer containing
2% azocasein (Sigma-Aldrich), the samples were incubated (2 h, 30 °C); then, 250 μl TCA (10%) was added
and incubated again (30 min, 30 °C). The mixture was
then centrifuged (10,000 × g, 10 min), and the supernatant was collected to a 96-well plate containing 100 μl
per well of 1 N NaOH before the OD was read at
450 nm. Buffer replaced serum and trypsin as a positive
control, and buffer replaced the serum as a negative
control. The antiprotease activity was expressed as the
percentage of trypsin inhibition: % trypsin inhibition =
(trypsin OD − sample OD)/trypsin OD × 100.
1228
Peroxidase activity
Peroxidase activity in skin mucus and serum was measured according to Quade and Roth (1997). Briefly, 5 μl
of serum or 10 μl of skin mucus was diluted with 45 μl
HBSS without Ca+2 or Mg+2 in 96-well flat-bottomed
plates before adding 100 μl of 20 mM TMB (Sigma)
and 5 mM H2O2. The colour change reaction was
stopped after 2 min by adding 50 μl of 2 M sulphuric
acid, and the OD was read at 450 nm in a plate reader.
Blank samples without serum or mucus samples were
used.
Natural haemolytic complement activity
Alternative complement pathway activity was measured
in serum using sheep red blood cells (SRBC,
Biomedics) as targets (Ortuño et al. 1998). Equal volumes of SRBC suspension (6%) in phenol red-free
Hank’s buffer (HBSS) containing Mg+2 and EGTA (ethylene glycol tetraacetic acid) were mixed with serially
diluted serum to give the final serum concentrations
ranging from 10 to 0.078% in 96-well round (U)-bottomed plates and incubated (90 min, 22 °C). The samples were centrifuged (400 × g, 5 min, 4 °C) to avoid
unlysed erythrocytes. The relative haemoglobin content
of the supernatants was assessed by measuring their OD
at 550 nm in a plate reader. The values of maximum
(100%) and minimum (spontaneous) haemolysis were
obtained by adding 100 μl of distilled water or HBSS to
100 μl samples of SRBC, respectively.
The degree of haemolysis (Y) was estimated, and the
lysis curve for each specimen was obtained by plotting Y
(1-Y)−1 against the volume of serum added (ml) on a
log-log scaled graph. The volume of serum producing
50% haemolysis (ACH50) was determined, and the
number of ACH50 units per millilitres was obtained for
each experimental fish.
Fish Physiol Biochem (2018) 44:1223–1240
was added to 180 μl of sodium phosphate buffer. The
OD was measured at 450 nm after 20 min at 35 °C in a
microplate reader. The amounts of lysozyme present in
skin mucus and serum were obtained from a standard
curve made with hen egg white lysozyme (HEWL,
Sigma) through serial dilutions in the above buffer. Skin
mucus and serum lysozyme values are expressed as
microgrammes per millilitre equivalent of HEWL activity. All analyses were conducted in triplicate.
Total IgM levels
Total serum IgM levels were analyzed using the
enzyme-linked immunosorbent assay (ELISA) (Cuesta
et al. 2004). Briefly, 20 μl per well of 1/500-diluted
serum or 1/4 skin mucus samples was placed in 96well flat-bottomed plates in triplicate, and the proteins
were coated by overnight incubation at 4 °C with 200 μl
of carbonate-bicarbonate buffer (35 mM NaHCO3 and
15 mM Na2CO3, pH 9.6). Rinsed three times with PBT
(20 mM Tris-HCl, 150 mM NaCl and 0.05% Tween 20,
pH 7.3), the plates were blocked for 2 h at room temperature with blocking buffer containing 3% bovine
serum albumin (BSA, Sigma) in PBT, followed by three
rinses with PBT. The plates were then incubated for 1 h
with 100 μl per well of a mouse anti-gilthead seabream
(S. aurata) IgM monoclonal antibody (Aquatic Diagnostics Ltd.) (1/100 in blocking buffer), washed and
incubated with the secondary antibody anti-mouse
IgG-HRP (1/1000 in blocking buffer, Sigma). After
exhaustive rinsing with PBT, the plates were developed
using 100 μl of 0.42 mM TMB solution, prepared
immediately in 100 mM citric acid/sodium acetate buffer (pH 5.4) containing 0.01% H2O2. The reaction was
allowed to proceed for 10 min and stopped by the
addition of 50 μl of 2 M H2SO4, and the plates were
read at 450 nm. Negative controls consisted of samples
without serum or without a primary antibody, whose
OD values were subtracted from each sample value.
Lysozyme activity
Gene expression analysis by real-time qPCR
Lysozyme activity was measured according to the turbidimetric method described by Swain et al. (2007) with
some modifications. Briefly, 20 μl of skin mucus and
serum was placed in 96-well flat-bottomed plates. To
each well, 180 μl of freeze-dried Micrococcus
lysodeikticus (0.2 mg ml−1, Sigma-Aldrich) in 40 mM
sodium phosphate (pH 6.2) was added as a substrate. As
blanks of each sample, 20 μl of skin mucus and serum
Relative expression was studied after 2 and 4 weeks of
feeding trial for several selected genes related to mucosal immunity [lysozyme (lyso) and complement component (c3)], tight junction proteins [occludin and zona
occludens 1 (zo-1)] and pro- and anti-inflammatory
cytokines [interleukin 8 (il-8), tumour necrosis
factor-α (tnf-α), interleukin 10 (il-10) and transforming
Fish Physiol Biochem (2018) 44:1223–1240
growth factor β (tgf-β)]. The RNA was extracted from
0.2 g of the S. aurata interior intestine using TRIzol
Reagent (Chomczynski 1993). It was then quantified,
and the purity was assessed by spectrophotometry; the
260:280 ratios were 1.8–2.0. The RNA was then treated
with DNase I (Promega) to remove genomic DNA
contamination. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using the SuperScript
III reverse transcriptase (Invitrogen) with an oligo-dT18
primer. The expression of selected genes (Table 2) was
analyzed by real-time qPCR on an ABI PRISM 7500
(Applied Biosystems) using SYBR Green PCR Core
Reagents (Applied Biosystems). Reaction mixtures
(containing 10 μl of 2x SYBR Green Supermix, 5 μl
of primers (0.6 μM each) and 5 μl of cDNA template)
were incubated (10 min, 95 °C, followed by 40 cycles of
15 s at 95 °C, 1 min at 60 °C, and finally 15 s at 95 °C,
1 min at 60 °C and 15 s at 95 °C. The geometric mean of
ribosomal protein S18 and elongation factor 1-α genes
was used as a reference gene to normalize cDNA loading (according to the results of our preliminary experiment (data are not shown) and Vandesompele et al.
(2002)). The 2−ΔΔCT method was used to calculate the
expression results after verifying that the primers
1229
amplified with an efficiency of approximately 100% as
described in Livak and Schmittgen (2001).
Statistical analysis
All data were tested for homogeneity by Levene’s tests,
and the normal distribution was checked by the ShapiroWilk test. The normally distributed data and transformed non-normal data were treated using one-way
ANOVA by SPSS (Standard Version 17.0; SPSS Inc.,
Chicago, Illinois). Duncan’s multiple range test was
used to compare the differences between means when
significant F values were observed at the P ≤ 0.05 level
(Duncan 1955).
Results
Growth performance
The growth performance of S. aurata fed with diets
containing different MOL levels (0, 5, 10 or 15%) is
presented in Table 3. The weight gain and thermal unit
growth factor of fish fed with the 5 and 10% MOL-
Table 2 Primers used for real-time qPCR
Gene name
Abbreviation
GeneBank number
Primer sequences (5′ → 3′)
Ribosomal protein S18
18s
AM490061
F: GAAAGCATTTGCCAAGAAT
R: AGTTGGCACCGTTTATGGTC
Elongation factor 1-α
ef1-α
AF184170
F: TGTCATCAAGGCTGTTGAGC
R: GCACACTTCTTGTTGCTGGA
Lysozyme
lyz
AM749959
F: CAGGGCTGGAAATCAACTA
R: CCAACATCAACACCTGCAAC
Complement component
c3
CX734936
F: TAGACAAAGCGGTGGCCTA
R: GTGGGACCTCTCTGTGGAAA
Occludin
occludin
JQ692876
F: GTGCGCTCAGTACCAGCAG
R: TGAGGCTCCACCACACAGTA
Zona occludens 1
zo-1
FM159812
F: ACGACAAGCGCCTGTTAAGT
R: TCCTGAGCTTCCGACATTTT
Interleukin 8
il-8
AM765841
F: GCCACTCTGAAGAGGACAGG
R: TTTGGTTGTCTTTGGTCGAA
Tumour necrosis factor-α
tnf-α
AJ413189
F: TCGTTCAGAGTCTCCTGCAG
R: TCGCGCTACTCAGAGTCCATG
Interleukin 10
il-10
FG261948
F: AGGCAGGAGTTTGAAGCTGA
R: ATGCTGAAGTTGGTGGAAGG
Transforming growth factor-beta
tgf-β
AF424703
F: GCATGTGGCAGAGATGAAGA
R: TTCAGCATGATACGGCAGAG
1230
Fish Physiol Biochem (2018) 44:1223–1240
Table 3 Growth performance of gilthead seabream, S. aurata, specimens fed with different dietary treatments (control, 5% Moringa, 10%
Moringa and 15% Moringa) after 2 and 4 weeks (mean ± SE, n = 12)
Items
Control
5% Moringa
Weight gain (g per fish)
Thermal growth factor
Condition factor
2 weeks
2 weeks
4 weeks
2 weeks
4 weeks
4 weeks
Survival (%)
37.00 ± 2.73a
67.89 ± 4.05a
18.69 ± 1.38a
34.29 ± 2.04a
2.02 ± 0.06
2.03 ± 0.10
100
a
a
a
32.07 ± 1.58a
1.96 ± 0.10
2.07 ± 0.08
100
a
a
37.33 ± 7.39
a
63.50 ± 3.14
a
18.86 ± 3.73
10% Moringa
34.10 ± 3.02
55.28 ± 8.79
17.22 ± 1.53
27.92 ± 4.44
2.03 ± 0.08
1.97 ± 0.15
100
15% Moringa
11.67 ± 2.32b
21.50 ± 2.05b
5.89 ± 1.17b
10.86 ± 1.03b
2.15 ± 0.08
1.98 ± 0.15
100
Different letters denote statistically significant differences among groups
supplemented diets for 2 or 4 weeks were similar to the
growth performance obtained for the control fish (0%
MOL). Meanwhile, there was a significant deterioration
in the growth performance of fish fed with 15% MOL.
Moreover, MOL maintained the general health status
and survival of the fish, which clearly presented normal
CF, with no signs of any specific disease and no mortality at any time during the experimental period.
The same trend was observed for the feed and protein
utilization parameters. Feed intake, FCR and PER of
fish fed with the diets supplemented with up to 10%
MOL did not differ significantly from the control group
values throughout the experimental period (Table 4).
However, increasing the Moringa content to 15% significantly decreased FCR and PER.
Cellular immune parameters
In terms of the cellular immune responses of S. aurata
HK leucocytes (Fig. 1), the phagocytosis ability significantly increased with all the MOL diets (5, 10 or 15%)
with respect to the values recorded for the control group
after 2 or 4 weeks of feeding. The phagocytosis capacity
and respiratory burst were significantly affected after 2
or 4 weeks respectively, depending on the experimental
group, in favour of the fish fed with the highest MOL
percentage. The leucocyte peroxidase activity was also
significantly higher in fish fed with 5% MOLsupplemented diets for 4 weeks, with respect to the
value of the control group (Fig. 1).
Serum immune parameters
Serum protease activity increased with increasing dietary MOL inclusion levels for both administration times,
and the differences observed with the highest MOL
supplementation level were significant after 4 weeks,
compared to the control (Fig. 2). Similarly, the ACH50
levels improved significantly with 5% MOL treatment
after 2 weeks and with all MOL inclusion levels after
4 weeks of feeding (Fig. 2). Also, serum lysozyme
activity significantly increased with all MOL inclusion
levels after 2 or 4 weeks of feeding (Fig. 2). The effect of
MOL inclusion on IgM became evident after 4 weeks of
treatment, where the highest value was recorded in fish
fed with 10% MOL. However, the serum antiprotease
Table 4 Feed and protein utilization of gilthead seabream, S. aurata, specimens fed with different dietary treatments (control, 5% Moringa,
10% Moringa and 15% Moringa) after 2 and 4 weeks (mean ± SE, n = 12)
Items
Control
5% Moringa
10% Moringa
15% Moringa
Feed intake (g kg−1 fish)
Feed conversion
ratio (g)
2 weeks
Protein efficiency ratio (g)
4 weeks
2 weeks
4 weeks
172.21 ± 3.83
337.33 ± 7.70a
0.95 ± 0.08a
1.16 ± 0.07a
2.41 ± 0.18a
1.96 ± 0.12a
171.56 ± 7.87
a
a
a
a
1.94 ± 0.10a
a
1.89 ± 0.30a
b
0.83 ± 0.08b
168.69 ± 3.91
160.15 ± 5.68
334.38 ± 7.45
1.04 ± 0.17
a
346.97 ± 17.54
b
392.77 ± 15.16
a
0.87 ± 0.09
b
2.24 ± 0.39
Different letters denote statistically significant differences among groups
2 weeks
1.16 ± 0.06
a
1.35 ± 0.23
b
2.81 ± 0.28
4 weeks
2.55 ± 0.51
2.67 ± 0.24
1.18 ± 0.24
Fish Physiol Biochem (2018) 44:1223–1240
1231
Fig. 1 Cellular immune activities of head kidney leucocytes of
gilthead seabream fed with different diets (control, 5, 10 and 15%
Moringa) for 2 and 4 weeks. a Phagocytic ability. b Phagocytic
capacity. c Respiratory burst. d Peroxidase activity. Bars represent
the mean ± SE (n = 12). Different letters denote significant differences between treatments (P < 0.05)
and peroxidase activities did not show any significant
changes with the different treatments even after 4 weeks
(Fig. 2).
4 weeks in fish fed with 5 and 10% MOL, although
the observed increases were not statistically significant.
Intestinal mucosal immunity
Skin mucus immune parameters
The mucus humoral immune components are presented
in Fig. 3. The protease activity in mucus tended to
increase with increasing MOL supplementation levels
after 2 weeks although the effect was lost after 4 weeks.
Meanwhile, the activity of antiprotease in mucus increased for both administration times, especially in fish
fed with 5% or 10% MOL after 4 weeks. The lysozyme
activity was significantly higher in fish fed with MOL
diets for both administration times compared to the
control values. However, IgM was not affected by the
dietary administration of MOL. The level of the mucus
peroxidase was significantly higher in fish fed with all
the MOL concentrations than in the control group after
2 weeks, the differences that were maintained after
The effects of dietary MOL on intestinal mucosal immunity were determined by studying the relative gene
expression of several immune-related genes as well as
some inflammatory molecules in the proximal intestine
of S. aurata after 2 and 4 weeks (Fig. 4a, b) of treatment.
Among the intestinal mucosal immune components,
lyso mRNA levels in the gut from fish fed with 15%
MOL for 2 or 4 weeks were higher, but not to a statistically significant extent, than the levels recorded for the
other treatments and the control. Moreover, the mRNA
level of c3 was upregulated significantly in fish fed with
15% MOL and non-significantly in fish fed with 5%
MOL compared to the expression levels found in the
intestine of the control fish. The effect of dietary MOL
on the tight junction proteins of the S. aurata intestine
1232
Fish Physiol Biochem (2018) 44:1223–1240
Fig. 2 Serum humoral immune activities of gilthead seabream
specimens fed with different diets (control, 5, 10 and 15%
Moringa) for 2 and 4 weeks. a Protease. b Antiprotease. c
Complement. d Peroxidase. (e) Lysozyme. (f) IgM. Bars represent
the mean ± SE (n = 12). Different letters denote significant differences between treatment groups (P < 0.05)
showed an increasing pattern of mRNA levels of
occludin and zo-1 after 4 weeks in fish fed with MOL,
especially at 5%.
The relative expression of pro-inflammatory cytokines showed a downward trend for il-8 in fish fed
with the MOL diets for 2 or 4 weeks. Similarly, the
mRNA levels of tnf-α decreased in fish fed with
MOL for both experimental periods, except in the
case of fish fed with 15% MOL for 2 weeks. The
mRNA levels of tgf-β were significantly upregulated
in fish fed with all the MOL diets for 2 or 4 weeks,
except in fish fed with 10% MOL for 2 weeks.
Meanwhile, the mRNA expression levels of il-10
were not affected by dietary MOL (except a downregulation in the intestine of fish fed with 10% MOL
for 2 weeks).
Fish Physiol Biochem (2018) 44:1223–1240
1233
Fig. 3 Skin mucus humoral immune activities of gilthead
seabream specimens fed with different diets (control, 5, 10 and
15% Moringa) for 2 and 4 weeks. a Protease. b Antiprotease. (c)
Lysozyme. d IgM. e Peroxidase. Bars represent the mean ± SE
(n = 12). Different letters denote significant differences between
treatment groups (P < 0.05)
Discussion
reported that C. gariepinus fed with diets containing
10% MOL showed the same growth performance in
terms of weight gain, specific growth rate and feed
conversion ratio as those fed with a MOL-free diet. In
the same way, MOL was used to substitute up to 10% of
the dietary protein in a diet fed to O. niloticus without
any significant reduction in fish growth (Ritcher et al.
2003). The herbivorous Tilapia rendalli accepted a diet
with 25% of fish meal protein replaced by MOL without
any significant effect compared to the control group
The present findings demonstrate that MOL can be
incorporated in the S. aurata diet up to 10% without
having any significant negative effect on growth performance or feed and protein utilization. However, there is
a slight downward trend for the same parameters with
10% MOL after 4 weeks of feeding, which became
significant with 15% MOL inclusion level. The present
results agree with the findings of Ozovehe (2013) who
1234
Fish Physiol Biochem (2018) 44:1223–1240
Fig. 4 Relative expression of genes related to the immune system
in the intestine of gilthead seabream fed with different diets (control, 5, 10 and 15% Moringa) for 2 (a) and 4 (b) weeks. Bars
represent the mean ± SE (n = 12). Different letters denote significant differences between treatment groups (P < 0.05)
(Hlophe and Moyo 2014a). The ability of MOL to
successfully replace up to 10% of the S. aurata diet in
the present study can be attributed to its high nutritional
quality as it includes micronutrients such as vitamins C
and A, calcium, iron and potassium, while its protein
content ranges from 24 to 28% on a dry weight basis
(Ramalingum and Mahomoodally 2014).
However, in the present study, when Moringa was
included in the S. aurata diet at 15%, a significant reduction in growth and feed utilization was observed compared
to the values recorded for fish fed with the control diet.
Similarly, C. gariepinus fed with a diet containing 20%
Moringa also showed lower growth, while replacing 25%
of fish meal by MOL reduced both growth performance
and feed utilization of this fish species (Hlophe and Moyo
2014b). Such detrimental effects may be related to negative effects on the fish liver because several liver function
enzymes were seen to have an increase in the animal
serum (among them, alanine aminotransferase (AST), aspartate aminotransferase (ALT) and alkaline phosphatase),
suggesting hepatocyte damage (Ozovehe 2013).
In the same trend, MOL extracted by methanol could
replace up to 30% of the total ration of O. niloticus with
equivalent growth to the control; however, using raw
MOL (13.5%) or methanolic extract (10%) showed a
significant retardation of growth, which clearly illustrated a removal of some toxic substances from MOL by
methanolic extraction (Afuang et al. 2003). Therefore,
the reduction in growth performance observed in the
present study with MOL at 15% may be related to
increased levels of some antinutritional factors in the
diet, which would disrupt some physiological functions
of the treated fish. Indeed, Moringa contains phytic acid,
tannin and saponins, which may cause growth retardation at high levels (Afuang et al. 2003; Yuangsoi et al.
2014). A high level of phytates could interrupt protein
digestibility due to the formation of phytic acid-protein
complexes (Thompson 1993) and reduced mineral bioavailability (Spinelli et al. 1983). For its part, tannin is
known to disrupt protein digestibility (Ritcher et al.
2003), while the presence of saponins was seen to
negatively affect growth in rainbow trout and Chinook
Fish Physiol Biochem (2018) 44:1223–1240
salmon and cause damage in the intestine of both fish
(Bureau et al. 1998). In the same sense, O. niloticus fed
with different diets supplemented with different MOL
extracts including methanol extract of tannin-reduced
fraction, saponin-enriched fraction and tannin- and
saponin-reduced fraction showed a significant reduction
in growth performance (Dongmeza et al. 2006). Further
studies are needed in order to clarify the possible toxic
effects of high dietary levels of Moringa proteins on
fish.
To the best of our knowledge, there is little or no
information on incorporating plant leaf proteins in
S. aurata diets. The only available study focuses on
alfalfa leaves used in the diet of sharp snout seabream
(Diplodus puntazzo), and it was seen that the proteins
contained in the alfalfa leaves could not promote growth
to the same extent as fishmeal even when a low level
(7%) was used (Chatzifotis et al. 2006). Interestingly,
the results of the present work demonstrated that MOL
could replace up to 10% of the gilthead seabream diet,
which can be attributed to the high nutritional quality of
the macro- and micronutrients present in MOL (Sánchez
et al. 2006; Sreelatha et al. 2011), along with the presence of protease inhibitors, saponins, phytoestrogens
and antivitamins in alfalfa (Chatzifotis et al. 2006).
Regarding the innate immune system of fish, the
present results point to an improvement in the functions
of the main cellular activities involving phagocytes in
fish fed with MOL-supplemented diets up to a 10%
inclusion level. More specifically, the phagocytic ability
and capacity, respiratory burst and peroxidase activities
increased in HK leucocytes in fish fed with these supplemented diets compared to the values obtained for HK
leucocytes from the control fish. These findings are
consistent with the improvement seen in the cellular
immunity of Wistar rats after feeding with alcoholic
and hydroalcoholic extracts of MOL at 50, 100 and
200 mg/kg body weight (Banji et al. 2012). Also, the
in vivo administration of an ethanolic extract of MOL
increased the phagocytosis index in normal or immunosuppressive mice (Gupta et al. 2010). Phagocytic cells
are the first step in the second line of the animal defence
mechanism, which differentiate, recognize and attack
the antigen and represent the antigenic fragment in the
outer surface which triggers the immune response cascade (Dalmo et al. 1997). Indeed medicinal plants (including Moringa) may have a dual function in the
activation of phagocytic cells. They contain many active
components (such as polysaccharides, alkaloids or
1235
flavonoids) which activate the phagocytic function
(Ardó et al. 2008), and they provide a strong antioxidant
status that ameliorates the negative stress caused by free
radicals produced in the phagocytosis process (Dalmo
et al. 1997; Siddhuraju and Becker 2003).
Together with the cells involved in immunity, there
are numerous humoral factors involved in the immune
defence, including several antibacterial components
(e.g. protease, antiprotease, complement, peroxidase,
lysozyme and immunoglobulins) (Yano 1996). In the
present study, the inclusion of MOL in the S. aurata diet
improved the humoral immunity, affecting the levels of
protease, natural haemolytic complement activity, lysozyme and IgM. These results agree with the previous
ones describing a similar improvement in humoral immunity (particularly increases in serum Ig and circulating antibody titres) in mice treated with different (aqueous, alcoholic, hydroalcoholic or methanolic) extracts of
MOL (Banji et al. 2012). Reflecting the increase in
ACH50 observed in the present study, an improvement
in ACH50 levels was reported in S. aurata fed with
fenugreek-supplemented diets (Bahi et al. 2017).
As regards the significant improvement in lysozyme
levels recorded in the present study following MOL
inclusion in the diets up to 15%, quite similar results
were reported by Kasiga et al. (2014) who found that
MOL can be used to replace 30% of soya bean in
O. niloticus diets without a significant reduction of lysozyme levels. However, lysozyme levels decreased significantly in Dicentrarchus labrax fed with an all-plant diet
compared to a diet containing fish meal (Geay et al.
2011). Interestingly, the present study points to an improvement in lysozyme levels with the inclusion of MOL
in the S. aurata diet. This difference may be related to the
total replacement of fish meal with plant protein (Geay
et al. 2011), which may have disrupted the amino acid
profile of the diets, in contrast with the partial replacement which was carried out in our experiment. Moreover,
M. oleifera provides a rich and rare combination of
zeatin, quercetin, β-sitosterol, caffeoylquinic acid and
kaempferol, which may stimulate the immune function
and, at the same time, have antifungal and antibacterial
activities (Anjorin et al. 2010).
The present results also demonstrate the stimulatory
effect of dietary MOL on skin-mucosal immunity. More
specifically, skin mucus antiprotease and peroxidase activities were significantly increased in fish fed with 5 and
10% MOL in the diet. Fish mucus is a rich source of
antimicrobial peptides and Ig (Cordero et al. 2016;
1236
Esteban 2012), while antiproteases have bactericidal and
anti-inflammatory properties that work with other mucosal
compounds to protect the animal from bacterial invasion
(Esteban 2012; Jurado et al. 2015). Similarly, other mucus
compounds (IgM and peroxidase activity) were increased
in S. aurata fed with diets enriched with palm fruit extracts
(Cerezuela et al. 2016). The enhancement of these immune
parameters in fish fed with the MOL-supplemented diets
could be attributed to the presence of the phytochemicals
present in MOL, such as carotenoids, vitamins, minerals,
amino acids, sterols, glycosides, alkaloids, flavonoids,
moringine, moringinine, phytoestrogens, caffeoylquinic
acids and phenolics (Anwar et al. 2007).
In animals, the intestine is in direct and continuous
contact with different pathogens, such as bacteria, viruses and antigens derived from the ingested feed (Snoeck
et al. 2005). Therefore, maintaining adequate intestinal
immunity is of utmost importance to prevent bacterial
translocation and enteritis, whereas impairment of the
intestinal immune response will result in high mortality
in fish (Luo et al. 2014). The present findings show that
occludin and zo-1 mRNA levels tended to increase after
4 weeks of feeding fish with all MOL levels, but especially with 5% MOL. This could be due to the particular
activity of some compounds present in Moringa leaves:
for example, kaempferol promotes the actin cytoskeletal
association (occludin and zo-1) in Caco-2 cells and
maintains barrier integrity (Suzuki et al. 2011) while
quercetin enhances the intestinal barrier function
through the assembly of some tight junction proteins
(Suzuki and Hara 2009).
Moreover, the present findings point to an improvement in the relative expression of mucosal immune
substances (lyso and c3) in the intestine of S. aurata
fish, especially with 15% MOL. These compounds represent the second line of defence mechanism in the
intestine wall, and improving its levels in the current
study protects against potentially harmful agents in fish,
as reported with olive flounder, Paralichthys olivaceus
(Palaksha et al. 2008), and grass carp, Ctenopharyngodon idella (Wen et al. 2014), whereas intestinal immunity appears to be closely related to the composition
of dietary nutrients (Snoeck et al. 2005).
Immune cells produce different types of cytokines,
which maintain lymphocyte homeostasis (Sanjabi et al.
2009). In the intestine, cytokines orchestrate the immune function, which is often associated with the inflammation response (Luo et al. 2014). In the current
findings, the expression of the pro-inflammatory
Fish Physiol Biochem (2018) 44:1223–1240
cytokines (il-8 and tnf-α) were downregulated in fish
fed with the different levels of MOL in the present study.
In agreement, Sashidhara et al. (2009) reported a significant inhibition of tnf-α and il-2 with the M. oleifera root
extract. Also, Praengam et al. (2015) reported a suppression effect of the digested M. oleifera boiled pod on IL1β and IL-8 of Caco-2 cells.
Tnf-α is a cornerstone in the inflammatory response,
which triggers a cascade of cytokine production and
regulates cellular activation and proliferation, cytotoxicity and apoptosis (Gómez and Balcázar 2008). An
increase in tnf-α was found to reduce transepithelial
resistance and increase the epithelial permeability of
intestinal epithelial cells (Resta–Lenert and Barrett
2006).
The downregulation of il-8 and tnf-α observed in the
present study may partially be attributed to the inhibiting
effects of MOL on the phosphorylation of inhibitor
kappa B protein and mitogen-activated protein kinases
(Muangnoi et al. 2012; Praengam et al. 2015).
Moreover, tgf-β mRNA was upregulated by the different MOL treatments, especially by 5% MOL. The
cytokine tgf-β is one of the main anti-inflammatory
cytokines and ensures the prevention of autoimmunity
to self-antigens (Kronenberg and Rudensky 2005). Also, tgf-β maintains peripheral tolerance by helping in the
survival of naïve T cells (Veldhoen et al. 2008). Accordingly, MOL inclusion in the S. aurata diet improves the
innate immune response in the intestine through the
upregulation of tgf-β. In agreement with this, MOL
proved to be a rich source of flavonoid malonates, which
exhibit anti-inflammatory activity (Coppin et al. 2013).
Again, the general reduction in immune performance
with high levels of MOL in the S. aurata diets may be
related to the increase of some toxic substances in the
diet. This trend agrees with the significant reduction in
white blood cell clusters and increase in serum enzymes
(AST and ALT), accompanied by cellular infiltration,
congestion and hydropic degeneration of hepatocytes
observed in rats treated with high doses of MOL
(Ajibade et al. 2012).
To conclude, MOL meal can be incorporated in
S. aurata diets up to 10% with no significant depression
of growth performance. Meanwhile, increasing inclusion level of MOL up to 15% decreased significantly
growth performance and feed utilization. Moreover, the
results demonstrate that the inclusion of 5% MOL in the
diet of S. aurata improves fish growth and the immune
status which is evident at mucosal level (some skin
Fish Physiol Biochem (2018) 44:1223–1240
mucus characters and intestine gene expression level) as
well as at systemic level (HK leucocyte activity and
some humoral components).
Acknowledgements The authors wish to thank Alexandria University, Egypt, for the post-doctoral grant (Alex GYR) for Dr.
Abdallah T. Mansour.
Funding information This research was funded by MINECO cofunded with European Regional Development Funds
(ERDF/FEDER) (grant number AGL2014-51839-C5-1-R) and
by the Fundación Séneca de la Región de Murcia (grant number
19883/GERM/15, Grupo de Excelencia).
References
Afuang W, Siddhuraju P, Becker K (2003) Comparative nutritional
evaluation of raw, methanol extracted residues and methanol
extracts of moringa (Moringa oleifera Lam.) leaves on
growth performance and feed utilization in Nile tilapia
(Oreochromis niloticus L.). Aquac Res 34:1147–1159.
https://doi.org/10.1046/j.1365-2109.2003.00920.x
Ajibade T, Olayemi F, Arowolo R (2012) The haematological and
biochemical effects of methanol extract of the seeds of
Moringa oleifera in rats. J Med Plants Res 6:615–621.
https://doi.org/10.5897/JMPR11.1258
Anjorin TS, Ikokoh P, Okolo S (2010) Mineral composition of
Moringa oleifera leaves, pods and seeds from two regions in
Abuja, Nigeria. Int J Agric Biol 12:431–434
Anwar F, Latif S, Ashraf M, Gilani AH (2007) Moringa oleifera: a
food plant with multiple medicinal uses. Phytother Res 21:
17–25. https://doi.org/10.1002/ptr.2023
AOAC (2000) Association of official analytical chemists.
International official methods of analysis. 17th edition.
Arlington, Virginia, USA
Ardó L, Yin G, Xu P, Váradi L, Szigeti G, Jeney Z, Jeney G (2008)
Chinese herbs (Astragalus membranaceus and Lonicera japonica) and boron enhance the non-specific immune response of Nile tilapia (Oreochromis niloticus) and resistance
against Aeromonas hydrophila. Aquaculture 275:26–33.
https://doi.org/10.1016/j.aquaculture.2007.12.022
Aslam M, Anwar F, Nadeem R, Rashid U, Kazi T, Nadeem M
(2005) Mineral composition of Moringa oleifera leaves and
pods from different regions of Punjab, Pakistan. Asian J Plant
Sci 4:417–421
Bahi A, Guardiola F, Messina C, Mahdhi A, Cerezuela R, Santulli
A, Bakhrouf A, Esteban M (2017) Effects of dietary administration of fenugreek seeds, alone or in combination with
probiotics, on growth performance parameters, humoral immune response and gene expression of gilthead seabream
(Sparus aurata L.). Fish Shellfish Immunol 60:50–58.
https://doi.org/10.1016/j.fsi.2016.11.039
Banji OJ, Banji D, Kavitha R (2012) Immunomodulatory effects
of alcoholic and hydroalcoholic extracts of Moringa olifera
Lam leaves. Indian J Exp Biol 50:270–276
Bayne CJ, Levy S (1991) Modulation of the oxidative burst in
trout myeloid cells by adrenocorticotropic hormone and
1237
catecholamines: mechanisms of action. J Leukoc Biol 50:
554–560
Benhamed S, Guardiola FA, Mars M, Esteban MÁ (2014)
Pathogen bacteria adhesion to skin mucus of fishes. Vet
M i c r o b i o l 1 7 1 : 1 – 1 2 . h t t p s : / / d o i . o rg / 1 0 . 1 0 1 6 / j .
vetmic.2014.03.008
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254.
https://doi.org/10.1016/0003-2697(76)90527-3
Bureau DP, Harris AM, Cho CY (1998) The effects of purified
alcohol extracts from soy products on feed intake and growth
of Chinook salmon (Oncorhynchus tshawytscha) and rainbow trout (Oncorhynchus mykiss). Aquaculture 161:27–43.
https://doi.org/10.1016/S0044-8486(97)00254-8
Cabello FC (2006) Heavy use of prophylactic antibiotics in aquaculture: a growing problem for human and animal health and
for the environment. Environ Microbiol 8:1137–1144.
https://doi.org/10.1111/j.1462-2920.2006.01054.x
Cerezuela R, Guardiola FA, Cuesta A, Esteban MÁ (2016)
Enrichment of gilthead seabream (Sparus aurata L.) diet with
palm fruit extracts and probiotics: effects on skin mucosal
immunity. Fish Shellfish Immunol 49:100–109. https://doi.
org/10.1016/j.fsi.2015.12.028
Chakraborty SB, Horn P, Hancz C (2014) Application of phytochemicals as growth-promoters and endocrine modulators in
fish culture. Rev Aquacult 6:1–19. https://doi.org/10.1111
/raq.12021.
Chatzifotis S, Esteban AG, Divanach P (2006) Fishmeal replacement by alfalfa protein concentrate in sharp snout sea bream
Diplodus puntazzo. Fisheries Sci 72:1313–1315. https://doi.
org/10.1111/j.1444-2906.2006.01290.x
Cho CY (1990) Fish nutrition, feeds and feeding: with special
emphasis on salmonid aquaculture. Food Rev Int 6:333–357.
https://doi.org/10.1080/87559129009540876
Chomczynski P (1993) A reagent for the single-step simultaneous
isolation of RNA, DNA and proteins from cell and tissue
samples. BioTechniques 15:532–537
Coppin JP, Xu Y, Chen H, Pan M-H, Ho C-T, Juliani R, Simon JE,
Wu Q (2013) Determination of flavonoids by LC/MS and
anti-inflammatory activity in Moringa oleifera. J Funct
F o o d s 5 : 1 8 9 2 – 1 8 9 9 . h t t p s : / / d o i . o rg / 1 0 . 1 0 1 6 / j .
jff.2013.09.010
Cordero H, Morcillo P, Cuesta A, Brinchmann MF, Esteban MA
(2016) Differential proteome profile of skin mucus of
gilthead seabream (Sparus aurata) after probiotic intake
and/or overcrowding stress. J Proteome 132:41–50.
https://doi.org/10.1016/j.jprot.2015.11.017
Cuesta A, Meseguer J, Esteban M (2004) Total serum immunoglobulin M levels are affected by immunomodulators in
seabream (Sparus aurata L.). Vet Immunol Immunopathol
101:203–210. https://doi.org/10.1016/j.vetimm.2004.04.021
Dalmo R, Ingebrigtsen K, Bøgwald J (1997) Non-specific defence
mechanisms in fish, with particular reference to the reticuloendothelial system (RES). J Fish Dis 20:241–273. https://doi.
org/10.1046/j.1365-2761.1997.00302.x
Dongmeza E, Siddhuraju P, Francis G, Becker K (2006) Effects of
dehydrated methanol extracts of moringa (Moringa oleifera
Lam.) leaves and three of its fractions on growth performance
and feed nutrient assimilation in Nile tilapia (Oreochromis
1238
niloticus (L.)). Aquaculture 261:407–422. https://doi.
org/10.1016/j.aquaculture.2006.08.006
Dügenci SK, Arda N, Candan A (2003) Some medicinal plants as
immunostimulant for fish. J Ethnopharmacol 88:99–106.
https://doi.org/10.1016/S0378-8741(03)00182-X
Duncan DB (1955) Multiple range and multiple F test. Biometrics
11:1–42. https://doi.org/10.2307/3001478
Esteban MÁ (2012) An overview of the immunological defenses
in fish skin. ISRN Immunology 2012:1–29. https://doi.
org/10.5402/2012/853470
Esteban M, Mulero V, Muñoz J, Meseguer J (1998) Methodological
aspects of assessing phagocytosis of Vibrio anguillarum by
leucocytes of gilthead seabream (Sparus aurata L.) by flow
cytometry and electron microscopy. Cell Tissue Res 293:133–
141. https://doi.org/10.1007/s004410051105
Geay F, Ferraresso S, Zambonino-Infante JL, Bargelloni L,
Quentel C, Vandeputte M, Kaushik S, Cahu CL, Mazurais
D (2011) Effects of the total replacement of fish-based diet
with plant-based diet on the hepatic transcriptome of two
European sea bass (Dicentrarchus labrax) half-sibfamilies
showing different growth rates with the plant-based diet.
BMC Genomics 12:522. https://doi.org/10.1186/14712164-12-522
Gómez GD, Balcázar JL (2008) A review on the interactions
between gut microbiota and innate immunity of fish. FEMS
Immunol Med Microbio 52:145–154. https://doi.org/10.1111
/j.1574-695X.2007.00343.x
Gomez D, Sunyer JO, Salinas I (2013) The mucosal immune
system of fish: the evolution of tolerating commensals while
fighting pathogens. Fish Shellfish Immunol 35:1729–1739.
https://doi.org/10.1016/j.fsi.2013.09.032
Grosell M, Farrell AP, Brauner CJ (2010) Fish physiology: the
multifunctional gut of fish vol 30. Academic Press, Elsevier,
Londone,NW1 7BY, UK
Gupta A, Gautam MK, Singh RK, Kumar MV, Rao CV, Goel R,
Anupurba S (2010) Immunomodulatory effect of Moringa
oleifera Lam. extract on cyclophosphamide induced toxicity
in mice. Indian J Exp Biol 48:1157–1160
Hanif A, Bakopoulos V, Dimitriadis G (2004) Maternal transfer of
humoral specific and non-specific immune parameters to sea
bream (Sparus aurata) larvae. Fish Shellfish Immunol 17:
411–435. https://doi.org/10.1016/j.fsi.2004.04.013
Hlophe S, Moyo N (2014a) A comparative study on the use of
Pennisetum clandestinum and Moringa oleifera as protein
sources in the diet of the herbivorous Tilapia rendalli.
Aquacult Int 22:1245–1262. https://doi.org/10.1007
/s10499-013-9744-4
Hlophe SN, Moyo NA (2014b) Replacing fishmeal with kikuyu
grass and moringa leaves: effects on growth, protein digestibility, histological and haematological parameters in Clarias
gariepinus. Turk J Fish Aquatic Sc 14:795–806. https://doi.
org/10.4194/1303-2712-v14_3_22
Holmes AH, Moore LS, Sundsfjord A, Steinbakk M, Regmi S,
Karkey A, Guerin PJ, Piddock LJ (2016) Understanding the
mechanisms and drivers of antimicrobial resistance. Lancet 387:
176–187. https://doi.org/10.1016/S0140-6736(15)00473-0
Hoseinifar SH, Ringø E, Shenavar Masouleh A, Esteban MÁ
(2016a) Probiotic, prebiotic and synbiotic supplements in
sturgeon aquaculture: a review. Rev Aquacult 8:89–102.
https://doi.org/10.1111/raq.12082
Fish Physiol Biochem (2018) 44:1223–1240
Hoseinifar SH, Zoheiri F, Lazado CC (2016b) Dietary
phytoimmunostimulant Persian hogweed (Heracleum
persicum) has more remarkable impacts on skin mucus than
on serum in common carp (Cyprinus carpio). Fish Shellfish
Immunol 59:77–82. https://doi.org/10.1016/j.fsi.2016.10.025.
Hoseinifar SH, Dadar M, Ringø E (2017a) Modulation of nutrient
digestibility and digestive enzyme activities in aquatic animals: the functional feed additives scenario. Aquac Res 48:
3987–4000. https://doi.org/10.1111/are.13368
Hoseinifar SH, Safari R, Dadar M (2017b) Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: insights from zebrafish model.
Gen Comp Endocrinol 243:78–83. https://doi.org/10.1016/j.
ygcen.2016.11.008
Jurado J, Fuentes-Almagro CA, Guardiola FA, Cuesta A, Esteban
MÁ, Prieto-Álamo M-J (2015) Proteomic profile of the skin
mucus of farmed gilthead seabream (Sparus aurata). J
Proteome 1 20:21– 34. https://d oi.org/1 0.1016 /j.
jprot.2015.02.019
Kasiga T, Chen R, Sink T, Lochmann R (2014) Effects of reduced
soybean-meal diets containing Moringa oleifera or Leucaena
leucocephala leaf meals on growth performance, plasma lysozyme, and total intestinal proteolytic enzyme activity of juvenile
Nile tilapia, Oreochromis niloticus, in outdoor tanks. J World
Aquacult Soc 45:508–522. https://doi.org/10.1111/jwas.12143
Kronenberg M, Rudensky A (2005) Regulation of immunity by
self-reactive T cells. Nature 435:598–604. https://doi.
org/10.1038/nature03725
Lazado CC, Caipang CMA (2014) Mucosal immunity and
probiotics in fish. Fish Shellfish Immunol 39:78–89.
https://doi.org/10.1016/j.fsi.2014.04.015
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT
method. Methods 25:402–408
Luo J-B, Feng L, Jiang W-D, Liu Y, Wu P, Jiang J, Kuang S-Y, Tang
L, Zhang Y-A, Zhou X-Q (2014) The impaired intestinal
mucosal immune system by valine deficiency for young grass
carp (Ctenopharyngodon idella) is associated with decreasing
immune status and regulating tight junction proteins transcript
abundance in the intestine. Fish Shellfish Immunol 40:197–
207. https://doi.org/10.1016/j.fsi.2014.07.003
Marti E, Variatza E, Balcazar JL (2014) The role of aquatic ecosystems as reservoirs of antibiotic resistance. Trends Microbiol 22:
36–41. https://doi.org/10.1016/j.tim.2013.11.001
Morimitsu Y, Hayashi K, Nakagama Y, Horio F, Uchida K, Osawa
T (2000) Antiplatelet and anticancer isothiocyanates in
Japanese horseradish, wasabi. Biofactors 13:271–276.
https://doi.org/10.1016/S0047-6374(00)00114-7.
Morton JF (1991) The horseradish tree, Moringa pterygosperma
(Moringaceae)—a boon to arid lands? Econ Bot 45:318–
333. https://doi.org/10.1007/BF02887070
Muangnoi C, Chingsuwanrote P, Praengamthanachoti P, Svasti S,
Tuntipopipat S (2012) Moringa oleifera pod inhibits inflammatory mediator production by lipopolysaccharide-stimulated
RAW 264.7 murine macrophage cell lines. Inflammation 35:
445–455. https://doi.org/10.1007/s10753-011-9334-4
Murthy KS, Kiran B (2013) Review on usage of medicinal plants
in fish diseases. Int J Pharm Bio Sci 4:975–986
NRC (1993) National Research Council, Nutrient Requirements of
Fishes. National Academy of Sciences, Washington, DC,
USA
Fish Physiol Biochem (2018) 44:1223–1240
Ortuño J, M. A. Esteban, V. Mulero, J. Meseguer (1998) Methods
for studying the haemolytic, chemoattractant and opsonic
activities of seabream (Sparus aurata L.) serum. In: A. C.
Barnes, G. A. Davidson, M. Hiney, D. McInthos (eds)
Methodology of fish disease research. Fisheres research service, Aberdin pp 97–100
Ozovehe BN (2013) Growth performance, haematological indices
and some biochemical enzymes of juveniles Clarias
gariepinus (Burchell 1822) fed varying levels of Moringa
oleifera leaf meal diet. J Aquac Res Development 4:166–
172. https://doi.org/10.4172/2155-9546.1000166.
Palaksha K, Shin G-W, Kim Y-R, Jung T-S (2008) Evaluation of
non-specific immune components from the skin mucus of
olive flounder (Paralichthys olivaceus). Fish Shellfish
Immunol 24:479–488. https://doi.org/10.1016/j.
fsi.2008.01.005
Praengam K, Muangnoi C, Dawilai S, Awatchanawong M,
Tuntipopipat S (2015) Digested Moringa oleifera boiled
pod exhibits anti-inflammatory activity in Caco-2 cells. J
Herbs Spices Med Plants 21:148–160. https://doi.
org/10.1080/10496475.2014.932880
Quade MJ, Roth JA (1997) A rapid, direct assay to measure
degranulation of bovine neutrophil primary granules. Vet
Immunol Immunopathol 58:239–248. https://doi.
org/10.1016/S0165-2427(97)00048-2
Ramalingum N, Mahomoodally MF (2014) The therapeutic potential of medicinal foods. Adv Pharmacol Sci 2014:1–18.
https://doi.org/10.1155/2014/354264
Resta-Lenert S, Barrett KE (2006) Probiotics and commensals
reverse TNF-α–and IFN-γ–induced dysfunction in human
intestinal epithelial cells. Gastroenterology 130:731–746.
https://doi.org/10.1053/j.gastro.2005.12.015
Ritcher N, Siddhuraju A, Becker K (2003) Evaluation of nutritional quality of moringa (Moringa oleifera Lam.) leaves as
alternative protein source for Tilapia (Oreochromis niloticus
L.). Aquaculture 217:599–611. https://doi.org/10.1016
/S0044-8486(02)00497-0
Rodríguez A, Esteban M, Meseguer J (2003) Phagocytosis and
peroxidase release by seabream (Sparus aurata L.)
leucocytes in response to yeast cells. Anat Rec A: Discov
Mol Cell Evol Biol 272(1):415–423
Ross NW, Firth KJ, Wang A, Burka JF, Johnson SC (2000)
Changes in hydrolytic enzyme activities of naive Atlantic
salmon Salmo salar skin mucus due to infection with the
salmon louse Lepeophtheirus salmonis and cortisol implantation. Dis Aquat Org 41:43–51. https://doi.org/10.3354
/dao041043
Sánchez NR, Ledin S, Ledin I (2006) Biomass production and
chemical composition of Moringa oleifera under different
management regimes in Nicaragua. Agrofor Syst 66:231–
242. https://doi.org/10.1007/s10457-005-8847-y
Sanjabi S, Zenewicz LA, Kamanaka M, Flavell RA (2009) Antiinflammatory and pro-inflammatory roles of TGF-β, IL-10,
and IL-22 in immunity and autoimmunity. Curr Opin
Pharmacol 9:447–453. https://doi.org/10.1016/j.
coph.2009.04.008
Sashidhara KV, Rosaiah JN, Tyagi E, Shukla R, Raghubir R,
Rajendran SM (2009) Rare dipeptide and urea derivatives
from roots of Moringa oleifera as potential antiinflammatory and antinociceptive agents. Eur J Med Chem
44:432–436. https://doi.org/10.1016/j.ejmech.2007.12.018
1239
Siddhuraju P, Becker K (2003) Antioxidant properties of various
solvent extracts of total phenolic constituents from three
different agroclimatic origins of drumstick tree (Moringa
oleifera Lam.) leaves. J Agric Food Chem 51:2144–2155.
https://doi.org/10.1021/jf020444+.
Sikder K, Sinha M, Das N, Das D, Datta S, Dey S (2013) Moringa
oleifera leaf extract prevents in vitro oxidative DNA damage.
Asian J Pharm Clin Res 6:159–163
Snoeck V, Goddeeris B, Cox E (2005) The role of enterocytes in the
intestinal barrier function and antigen uptake. Microb Infect 7:
997–1004. https://doi.org/10.1016/j.micinf.2005.04.003
Spinelli J, Houle CR, Wekell JC (1983) The effect of phytates on
the growth of rainbow trout (Salmo gairdneri) fed purified
diets containing varying quantities of calcium and magnesium. Aquaculture 30:71–83. https://doi.org/10.1016/00448486(83)90153-9
Sreelatha S, Jeyachitra A, Padma P (2011) Antiproliferation and
induction of apoptosis by Moringa oleifera leaf extract on
human cancer cells. Food Chem Toxicol 49:1270–1275.
https://doi.org/10.1016/j.fct.2011.03.006
Suzuki T, Hara H (2009) Quercetin enhances intestinal barrier
function through the assembly of zonnula occludens-2,
occludin, and claudin-1 and the expression of claudin-4 in
Caco-2 cells. J Nutr 139:965–974
Suzuki T, Tanabe S, Hara H (2011) Kaempferol enhances intestinal barrier function through the cytoskeletal association and
expression of tight junction proteins in Caco-2 cells. J Nutr
141:87–94. https://doi.org/10.3945/jn.110.125633
Swain P, Dash S, Sahoo P, Routray P, Sahoo S, Gupta S, Meher P,
Sarangi N (2007) Non-specific immune parameters of brood
Indian major carp Labeo rohita and their seasonal variations.
Fish Shellfish Immunol 22:38–43. https://doi.org/10.1016/j.
fsi.2006.03.010
Thompson LU (1993) Potential health benefits and problems
associated with antinutrients in foods. Food Res Int 26:
131–149. https://doi.org/10.1016/0963-9969(93)90069-U
Van Hai N (2015) The use of medicinal plants as immunostimulants
in aquaculture: a review. Aquaculture 446:88–96. https://doi.
org/10.1016/j.aquaculture.2015.03.014
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De
Paepe A, Speleman F (2002) Accurate normalization of realtime quantitative RT-PCR data by geometric averaging of
multiple internal control genes. Genome Biol 3:research0034. 0031. doi:https://doi.org/10.1186/gb-2002-3-7research0034.
Veldhoen M, Uyttenhove C, Van Snick J, Helmby H, Westendorf
A, Buer J, Martin B, Wilhelm C, Stockinger B (2008)
Transforming growth factor-β ‘reprograms’ the differentiation of T helper 2 cells and promotes an interleukin 9–
producing subset. Nat Immunol 9:1341–1346
Wen H, Feng L, Jiang W, Liu Y, Jiang J, Li S, Tang L, Zhang Y,
Kuang S, Zhou X (2014) Dietary tryptophan modulates
intestinal immune response, barrier function, antioxidant status and gene expression of TOR and Nrf2 in young grass carp
(Ctenopharyngodon idella). Fish Shellfish Immunol 40:275–
287. https://doi.org/10.1016/j.fsi.2014.07.004
Yano T (1996) The non-specific immune system: humoral defence. In: EdsIwada G, Nakanishi T (eds) The fish immune
system: organism, pathogen and environment, Academic
Press San Diego, pp 105–156
1240
Yuangsoi B, Masumoto T (2012) Replacing moringa leaf
(Moringa oleifera) partially by protein replacement in soybean meal of fancy carp (Cyprinus carpio). Songklanakarin J
Sci Technol 34:479–485
Fish Physiol Biochem (2018) 44:1223–1240
Yuangsoi B, Klahan R, Charoenwattanasak S (2014) Partial replacement of protein in soybean meal by moringa seed cake
(Moringa oleifera) in bocourti’s catfish (Pangasius
bocourti). Songklanakarin J Sci Technol 36
Download
Related flashcards
Create Flashcards