Custom TaqMan® Assays
For New SNP Genotyping and Gene Expression Assays
Design and Ordering Guide
For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.
Information in this document is subject to change without notice.
APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO
THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. TO THE FULLEST EXTENT ALLOWED BY LAW, IN NO EVENT SHALL APPLIED
BIOSYSTEMS BE LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL, INCIDENTAL,
INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING BUT NOT
LIMITED TO THE USE THEREOF, WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF
SUCH DAMAGES.
NOTICE TO PURCHASER: LIMITED LICENSE
A license to perform the patented 5' Nuclease Process for research is obtained by the purchase of (i) both Licensed Probe and Authorized 5' Nuclease Core
Kit, (ii) a Licensed 5’ Nuclease Kit, or (iii) license rights from Applied Biosystems.
The TaqMan® SNP Genotyping Assays and TaqMan® Gene Expression Assays contain Licensed Probe. Use of this product is covered by US patent claims
and patent claims outside the US. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims
for using only this amount of product for the purchaser’s own internal research. The right to use this product in the 5’ Nuclease Process under the
applicable claims of US patent claims and corresponding patent claims outside the United States, can be obtained through purchase of an Authorized 5'
Nuclease Core Kit. Except under separate license rights available from Applied Biosystems, no right under any other patent claim, or to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, or to
sublicense, repackage with other products, or resell in any form, is conveyed expressly, by implication, or by estoppel. This product is for research use only.
Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained from the Director
of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
TRADEMARKS
Trademarks of Life Technologies Corporation and its affiliates include: Applied Biosystems®, AB Logo™, FAM™, Life Technologies™ (Stylized), SNPBrowser™,
and VIC®.
TaqMan® is a trademark of Roche Molecular Systems, Inc.
BLAST® is a trademark of the National Library of Medicine.
Windows® is a registered trademark of the Microsoft Corporation in the US and other countries.
All other trademarks are the sole property of their respective owners.
© 2010 Life Technologies Corporation. All rights reserved.
Part Number 4367671 Rev. F
07/2010
Contents
About This Guide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Purpose . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Prerequisites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Safety information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
PROTOCOL
Custom TaqMan® Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
Product information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
Section 1 Custom TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . . . . . . . 11
Design Custom TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
Order Custom TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
Section 2 Custom TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . . . . . . 25
Design Custom TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
Order Custom TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Section 3 Reorder Custom TaqMan® Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Reorder online . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
Reorder legacy assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
APPENDIX A
Order Other TaqMan® Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
Section A.1 Order Other TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . 49
Enter custom primer/probe pairs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
Search for Pre-designed TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . . . . . . . . . . 52
Section A.2 Order Other TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . 53
Enter custom primer/probe pairs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Search for Pre-designed TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . . . . . . . . . . 56
APPENDIX B
Bioinformatics Tools for Evaluating Target Sequences . . . . . . . . 57
Verify sequence uniqueness with a BLAST database search . . . . . . . . . . . . . . . . . . . . . . . . . . 58
Find exon-exon boundaries (gene expression assays only) . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
Find exon information using the Vertebrate Genome Annotation Database . . . . . . . . . . . . . 66
Mask sequence repeats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69
Detect and mask nontarget sequence polymorphisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
Custom TaqMan® Assays Design and Ordering Guide
3
Contents
APPENDIX C
Using File Builder Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
Create the submission file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
Validate the format . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
Send the sequence information to Applied Biosystems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
APPENDIX D
Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
Assay failed design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
Assay failed manufacturing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
Documentation and Support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Related documentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Obtaining support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
4
Custom TaqMan® Assays Design and Ordering Guide
About This Guide
Purpose
The Custom TaqMan® Assays Design and Ordering Guide provides reference information
for ordering Custom TaqMan Assays using the Custom TaqMan® Assay Design Tool
on the Applied Biosystems web site.
Prerequisites
This guide is intended for scientists and technicians who want to order Custom
TaqMan® SNP Genotyping Assays, Custom TaqMan® Gene Expression Assays, and
Custom Plus TaqMan® RNA Assays from the Applied Biosystems website. It uses
conventions and terminology that assume a working knowledge of molecular biology,
PCR, TaqMan® Assays, the internet, and internet-based browsers.
Safety information
Safety alert words
Four safety alert words appear in Applied Biosystems user documentation at points in
the document where you need to be aware of relevant hazards. Each alert word—
IMPORTANT, CAUTION, WARNING, DANGER—implies a particular level of
observation or action, as defined below:
IMPORTANT! – Indicates information that is necessary for proper instrument
operation, accurate chemistry kit use, or safe use of a chemical.
CAUTION! – Indicates a potentially hazardous situation that, if not avoided,
may result in minor or moderate injury. It may also be used to alert against
unsafe practices.
WARNING! – Indicates a potentially hazardous situation that, if not avoided,
could result in death or serious injury.
DANGER! – Indicates an imminently hazardous situation that, if not avoided,
will result in death or serious injury. This signal word is to be limited to the most
extreme situations.
Custom TaqMan® Assays Design and Ordering Guide
5
About This Guide
Safety information
6
Custom TaqMan® Assays Design and Ordering Guide
DESIGN AND ORDERING GUIDE
Custom TaqMan® Assays
Product information
About the design pipeline
Applied Biosystems designs, synthesizes, and delivers analytically quality-controlled
Custom TaqMan® Assays sets based on sequence information that you supply. All
information that you supply is secure and confidential.
Use the Custom TaqMan® Assays Design Tool to order:
• Custom TaqMan® SNP Genotyping Assays – Custom assays for performing
genotyping studies with single-nucleotide polymorphisms (SNPs), multiple
nucleotide polymorphisms (MNPs), or insertions/deletions (in/dels).
• Custom TaqMan® Gene Expression Assays – Custom assays for quantitative
gene expression analysis and DNA sequence detection.
• Custom Plus TaqMan® RNA Assays – Custom assays, for quantitative analysis
of coding and non-coding transcripts, that are designed using the bioinformatics
feature of the Custom TaqMan® Assays Design Pipeline. For Custom Plus
Taqman RNA Assays, the design pipeline performs bioinformatic analysis and
quality control of the input sequences to ensure the best possible assay designs.
IMPORTANT! Applied Biosystems does not provide the assay sequences for
Custom Plus TaqMan® RNA Assays.
Custom TaqMan® Assays Design and Ordering Guide
7
Custom TaqMan® Assays
Product information
About the Custom TaqMan® Assay Design Tool
After you select the sequences to study, access the Custom TaqMan® Assay Design
Tool on the Applied Biosystems web site to enter target sequences, import sequence
information from a file, or search the Applied Biosystems database for sequences.
After selecting the target sequences, submit the sequences to Applied Biosystems for
custom designs.
From the Custom TaqMan® Assay Design Tool, you can select assays to order, then
submit your order. Applied Biosystems manufactures, packages, and ships the
TaqMan® Assays to you.
Using the Custom TaqMan® Assay Design Tool, you can also:
• Enter custom primer/probe pairs – Submit the sequences for the forward primer,
reverse primer, and probe(s), then Applied Biosystems synthesizes the oligos and
formulates a custom assay using your oligonucleotide sequences.
• Search for Pre-Designed TaqMan® Assays – Search the Applied Biosystems
database for pre-designed Inventoried or Made-to-Order TaqMan® Assays.
• Perform a bioinformatics analysis of input sequences – Have the design tool
perform bioinformatic analysis on your input sequences to design the best custom
TaqMan® assays for your needs.
The bioinformatics analysis of the design tool:
– Generates custom assay designs using data from public molecular biology
resources (Entrez and GeneBank).
– Provides enhanced search that can restrict the assay design to include
sequences that are unique to a specific organism (for transgenic
experiments).
– Displays candidate assay designs in context with genomic and transcript
data.
– Masks input sequences for SNPs and low-complexity sequence.
– Performs in silico quality control of candidate assay designs to ensure
accuracy and uniqueness of potential assays.
IMPORTANT! Applied Biosystems does not provide the sequences for
assays designed using the bioinformatics analysis feature of the assay
design pipeline.
8
Custom TaqMan® Assays Design and Ordering Guide
Custom TaqMan® Assays
Product information
Part numbers
Part numbers for the Custom TaqMan® Assays indicate the type of assay and the
number of reactions you want to order (see Table 1 and Table 2). For SNP assays, you
can order human and nonhuman assays; the next section, “Considerations for
selecting SNP Genotyping Assays for human sequences”, explains instances when you
should not choose a human assay, even when the sequence is human.
Table 1 Part numbers for TaqMan® SNP Genotyping Assays
Product
Custom TaqMan® SNP
Genotyping Assays, Human
TaqMan®
Custom
SNP
Genotyping Assays, Non
Human
Scale
Part
number
Number of
5-μL reactions
Assay mix
concentration
Small
4331349
1,500
40✕
Medium
4332072
5,000
40✕
Large
4332073
12,000
80✕
Small
4332077
1,500
40✕
Medium
4332075
5,000
40✕
Large
4332076
12,000
80✕
Table 2 Part numbers for TaqMan® Gene Expression Assays
Product
Custom TaqMan® Gene
Expression Assays
Custom Plus
Assays‡
TaqMan®
RNA
Scale
Part
number
Number of
20-μL reactions
Assay mix
concentration
Small
4331348
360
20✕
Medium
4332078
750
20✕
Large
4332079
2,900
60✕
Small
4441114
360
20✕
Medium
4441117
750
20✕
Large
4441118
2,900
60✕
‡ Assay sequences are not provided for Custom Plus TaqMan® RNA Assay orders.
Considerations for selecting SNP Genotyping Assays for human sequences
Applied Biosystems performs a functional test on all human SNP Genotyping Assays.
Genomic DNAs (gDNAs) from 20 unrelated individuals (from 4 populations and both
sexes) are amplified under universal conditions with the SNP Genotyping Assay to
test for amplification and clustering. Human SNP Genotyping Assays that fail this test
are not shipped. Consequently, if you expect SNP Genotyping Assays to human targets
to fail the functional test, order the nonhuman SNP Genotyping Assays. Failures can
occur for the following reasons:
• For human cDNA sequences, the test fails because intronic sequences prevent
primer or probe binding, or separate assay component binding sites and prevent
efficient amplification because of longer amplicon size.
• For human Y-chromosome-specific sequences, the test fails because >90% of the
samples in the test must amplify to pass, and the female samples in the functional
test do not amplify.
Custom TaqMan® Assays Design and Ordering Guide
9
Custom TaqMan® Assays
Product information
Custom assay design workflow
This workflow is for submitting target sequences for Applied Biosystems to design
and manufacture Custom TaqMan® Assays.
Design Custom TaqMan® Assays
Select target sequence
Select and qualify target sites
Order Custom TaqMan Assays Using the
Custom TaqMan Assay Design Tool
Access the Custom TaqMan® Assays Design Tool
(Gene expression assays only)
Configure the bioinformatics settings
Enter sequences
• Enter or copy and paste the sequence
information
• Find target sequences
• Import sequence information from a file
(File Builder or FASTA)
Select assays
Review and order
10
Custom TaqMan® Assays Design and Ordering Guide
SECTION 1
1
Section 1 Custom TaqMan® SNP Genotyping
Assays
This section covers:
■
Design Custom TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . . . . . . . . 12
Review target sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
Select target sites. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
■
Order Custom TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . . . . . . . . . . . . 16
Access the Custom TaqMan® Assay Design Tool . . . . . . . . . . . . . . . . . . . . . . . . . . 16
Enter sequences. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
Select assays. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
Review and order . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
Custom TaqMan® Assays Design and Ordering Guide
11
1
Custom TaqMan® Assays
Design Custom TaqMan® SNP Genotyping Assays
Design Custom TaqMan® SNP Genotyping Assays
Review target sequences
Overview
The success of your Custom TaqMan® Assay depends largely on the quality of the
sequence data that you submit for the design process.
After you select your target sequence, verify that it meets criteria for:
• Allele frequency
• Length
• Accuracy
• Uniqueness
IMPORTANT! The quality assurance that is performed during manufacture of
the primers and probes can ensure only that the yield and content of the primers
and probes meet specifications. Although Applied Biosystems cannot guarantee
the biological performance of the assays, reviewing your sequences as described
in this document improves the possibility of success for your assay.
Note: Human assays are tested against 20 unique DNA samples to ensure that
the assays generate at least one cluster.
Biological
significance
Verify that:
• The SNP is confirmed by more than one line of experimental evidence, for
example, that the SNP is a “double hit” or a validated SNP.
• Minor Allele Frequency (MAF) data are available for the SNP.
• The SNP occurs in the population (ethnic group) that you are examining.
These biological qualifiers give confidence that a SNP is well studied and may be
useful as a marker in your particular study.
Allele frequency
criteria
The minor allele frequency (MAF) indicates the frequency of the uncommon allele in a
population (Traditionally, only the minor allele frequency is reported. The major allele
frequency is implied, and it is calculated as 1–MAF.). From the MAF, you can estimate
the size of the sample population that you need to detect a specified minor allele and to
provide statistically significant results. If your sample is considerably smaller than the
calculated value, consider using an assay for another SNP (one with a larger MAF) or
increasing the sample size.
For a known SNP, try to find the allele frequency from resources such as the NCBI
dbSNP, HapMap, or other project databases. Use the Hardy-Weinberg Equilibrium
equation to determine the likelihood that a SNP with a known MAF in a specified
population is detectable in a sample of a particular size in the same population.
The Hardy-Weinberg Equilibrium equation is:
p2 + 2pq + q2 = 1
where p and q represent the allele frequencies.
The values for p2, 2pq, and q2 correspond to the fraction of a known population that
would be homozygous for the p allele (p:p), heterozygous (p:q), and homozygous for
the q allele (q:q).
12
Custom TaqMan® Assays Design and Ordering Guide
Section 1 Custom TaqMan® SNP Genotyping Assays
Design Custom TaqMan® SNP Genotyping Assays
1
MAF example calculation
For a SNP with a MAF of 5% (0.05), the predicted spread of genotypes is 0.0025 q:q,
0.095 p:q, and 0.9025 p:p. In a test of 20 genomic DNA samples from this population,
you might expect to see:
• Approximately 0 homozygotes for q, the minor allele
• 2 heterozygotes
• 18 homozygotes for p, the major allele
To detect a homozygote for the minor allele, the sample size would need to be
approximately 400 individuals.
Sequence length
criteria
A sequence length of approximately 600 bases is optimal, but the sequence length can
vary from 100 to 5000 bases.
Increasing the sequence length increases the assay design possibilities, although
usually SNP assays produce amplicons of <200 base pairs. Provide a longer input
sequence if your target sequence has low-complexity or contains N-masked
nucleotides.
Select the sequence so that the target site is near the center of the submitted sequence.
About masking
sequences
The Custom TaqMan® Assays Design Pipeline does not design a primer or probe that
spans an ambiguous base (an N). The presence of one or more Ns at a site forces the
design pipeline to design the assay at another site in the sequence.
You can use Ns, therefore, to mask (hide) sites where you do not want an assay to be
designed, such as sites that contain ambiguous bases, known repeats, and/or
polymorphisms. Keep in mind, however, that the more Ns you use to mask undesired
sites, the more you restrict the assay design possibilities.
The next topic describes specific situations where you should consider masking your
target sequence.
Evaluate sequence
accuracy and
uniqueness criteria
For more information about the tools that are used to evaluate target sequences, refer
to Bioinformatic Evaluation of a Sequence for Custom TaqMan® SNP Genotyping Assays
(PN 4371003).
1. If you performed the sequencing yourself, perform multiple sequencing reactions
to eliminate any ambiguities.
2. Except for the SNP(s) that you want to study, mask each ambiguous base in your
sequence with an N.
For example, the bases in bold text in the sequence below are ambiguous:
ACGTGACGTGACGTGACGTGACGTGGATYGTGRSRSTCCT
If you mask each ambiguous base with an N, the resulting sequence is:
ACGTGACGTGACGTGACGTGACGTGGATNGTGNNNNTCCT
Too many Ns can restrict the possibilities for assay design. It may be better to
resequence your gene to eliminate ambiguities than to mask the ambiguities with
Ns.
Custom TaqMan® Assays Design and Ordering Guide
13
1
Custom TaqMan® Assays
Design Custom TaqMan® SNP Genotyping Assays
3. Using other resources such as public databases, determine if your target sequence
is unique within the organism of study or if similar sequences exist in the
database.
For example, you may find similar sequences in databases of curated gene
sequences such as Entrez Gene, at:
http://www.ncbi.nih.gov/entrez/query.fcgi?db=gene
If other similar sequences exist, determine the degree of similarity. Multiple target
sites in the genome interfere with the function of the assays.
4. Using your target sequence as the query, perform a Basic Local Alignment Search
Tool (BLAST®) database search to find regions of your sequence that are similar to
sequences in the database. See “Verify sequence uniqueness with a BLAST
database search” on page 58 for instructions.
5. If you find regions of your sequence that are similar to sequences in the database,
mask those regions of your sequence with Ns.
14
Custom TaqMan® Assays Design and Ordering Guide
Section 1 Custom TaqMan® SNP Genotyping Assays
Design Custom TaqMan® SNP Genotyping Assays
1
Select target sites
Guidelines for
selecting potential
target sites
For SNP assays, each target site identifies a SNP, an MNP, or an insertion/deletion
(indel). For the remainder of this section, “SNP” is used to refer to any of these three
types of target site.
Select:
• At least one target site.
Note: No more than one assay is synthesized for each sequence, regardless
of the number of target sites you enter. Entering more sites increases the
assay design possibilities.
• Target sites that are more than 40 bases away from the 5´ and 3´ ends.
• Target sites that are more than two bases away from any Ns.
If this is your target site,
AGTGAACGCGATA[G/A]GCANCTCCTGCCC
verify that no Ns are within two bases.
• Target sites that are more than two bases away from any other SNPs.
• At least one specific SNP for assay design (and mask all the remaining nontarget
SNPs with Ns).
Review sequences
for repeats and
polymorphisms
Assays that are designed in regions of a sequence that contain repeats and/or
polymorphisms are likely to produce nonspecific amplification and probe binding. To
reduce the likelihood of nonspecific amplification and probe binding, mask repeats
and polymorphisms.
1. Run the sequence through a program such as RepeatMasker to detect common
repetitive elements. See “Mask sequence repeats” on page 69.
2. In the masked sequence that is generated by the program, determine if any of
your target SNPs are:
• In a masked repeat
• Within 2 bases of a masked repeat
If either condition exists, select another SNP because a primer or a probe cannot
be designed within 2 bases of an N.
3. Run a BLAST® database search using the masked sequence from step 2 against
the dbSNP, a database of SNPs from various species. See “Detect and mask
nontarget sequence polymorphisms” on page 73.
4. If you find nontarget SNPs, mask the nontarget SNPs with Ns. Select another SNP
if any of your target SNPs is within 2 bases of a masked SNP.
Custom TaqMan® Assays Design and Ordering Guide
15
1
Custom TaqMan® Assays
Order Custom TaqMan® SNP Genotyping Assays
Order Custom TaqMan® SNP Genotyping Assays
Access the Custom TaqMan® Assay Design Tool
1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store:
a. At the top of the Applied Biosystems home page, click Store Log In.
b. In the Store Log In page, log into the website as instructed. If you are a(n):
• Existing customer, enter your user name and password, then
click Login.
• New customer, click Register Now, then complete the registration
process as instructed.
Note: You must log into the Applied Biosystems store before you can
complete an order.
2. Go directly to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
Navigate to the Custom TaqMan® Assay Design Tool:
a. Place the cursor over Products, then under Assay Searches, click TaqMan®
SNP Genotyping Assays.
b. Click the Related Products tab, then in the Assay row, click Custom
TaqMan® SNP Genotyping Assays.
c. In the Start Here box, click Custom TaqMan® Assay Design Tool.
3. To enter, find, or import the target sequence and SNPs for Applied Biosystems to
design and manufacture Custom TaqMan® SNP Genotyping Assays, click Order
Custom Genotyping Assays.
Note: You can also use the Custom TaqMan Assay Design Tool to order
custom primer/probe pairs or to order Pre-designed TaqMan® Assays. See
Appendix A, “Order Other TaqMan® Assays” on page 47 for more
information.
16
Custom TaqMan® Assays Design and Ordering Guide
Section 1 Custom TaqMan® SNP Genotyping Assays
Order Custom TaqMan® SNP Genotyping Assays
1
Enter sequences
In the Enter Sequences tab, you can enter sequence information three different ways:
• Enter the sequence information (page 18).
• Find target sequences in the Applied Biosystems database (page 19).
• Import sequence information from File Builder or a FASTA-formatted file
(page 20).
Field
Name
Requirement
• Has 4 to 16 characters.
• Uses only alphanumeric, underscore, hyphen, and period characters.
• Has no spaces or tabs.
• Does not begin with a hyphen.
Custom TaqMan® Assays Design and Ordering Guide
17
Custom TaqMan® Assays
1
Order Custom TaqMan® SNP Genotyping Assays
Field
Sequence
Requirement
• Enter the sequence in the 5′ to 3′ direction.
• Enter from 100 to 5000 bases.
• Use only A, C, G, T, and N, except where SNP or indel target sites are marked.
• Convert the IUPAC codes R, Y, M, K, S, W, H, B, V, and D to N, except for marked SNP target sites where
you translate the ambiguity code to the appropriate bases.
• Enclose each target site with square brackets [ ].
• Within the brackets that enclose:
– SNP targets: Enter the base for the first allele followed by a forward slash (/), and then the base for
the second allele. For example, convert R to [A/G].
– MNP targets: Enter from one to six bases for the first allele followed by a forward slash (/), and then
one to six bases for the second allele.
– Insertion/deletion (indel) targets: Enter from one to six bases for the insertion followed by a forward
slash(/), then an asterisk (*) for the deletion.
• Mask with Ns any SNPs, MNPs, or indels that are not of interest.
Note: The probe for the first allele is labeled with a VIC® dye; the probe for the second allele is
labeled with a 6-FAM™ dye.
SNP,
SNP#,
SNP
Name
• Each SNP target site of interest:
– Is marked with square brackets.
– Has the bases for 2 alleles of the SNP, separated by a forward slash.
• Each MNP target site of interest:
– Is marked with square brackets.
– Has 1 to 6 bases to the left of the forward slash and 1 to 6 bases to the right of the forward slash.
(The number of bases on each side of the slash does not have to be the same.)
• Each Indel target site of interest:
– Is marked with square brackets.
– Has 1 to 6 bases to the left of a forward slash and an asterisk to the right of the forward slash.
Enter the sequence
information
You can enter or copy and paste the sequence information directly in the Enter
Sequences tab.
1. In the Name field, enter the name for the sequence.
2. In the Sequence field, enter the entire sequence of interest in the 5′ to 3′ direction.
Remove any spaces, tabs, and line breaks.
3. Click Check Format to validate the format of the sequence(s). If an error message
is displayed, correct the format of the sequence information, then click Check
Format again. Repeat until the format is validated.
Note: For each IUPAC code that represents an ambiguous base, you are
asked to provide your conversion option.
4. Enter a SNP Name for each SNP in the entered sequence.
Note: The combination of target name and sequence name must be unique.
5. (Optional) To enter another sequence:
a. Click + Enter More Sequences.
18
Custom TaqMan® Assays Design and Ordering Guide
Section 1 Custom TaqMan® SNP Genotyping Assays
Order Custom TaqMan® SNP Genotyping Assays
1
b. Repeat step 1 through step 4 in an empty row.
6. Select the species and the scale. See “Part numbers” on page 9 for the number of
reactions for each scale.
Note: See “Considerations for selecting SNP Genotyping Assays for
human sequences” on page 9 to determine whether to select human or
nonhuman assays.
7. Click Submit For Assay Design.
Note: The button is inactive until the format of the sequence information is
free of errors.
Find target
sequences in the
Applied Biosystems
database
You can search the Applied Biosystems database for target sequences to submit for
custom assay designs.
1. In the Enter Sequences tab, click Search for Sequences.
2. Enter the chromosome location or search the database for the gene of interest.
To enter the chromosome location:
a. Select the Species, Chromosome (number), Chrom Start (chromosome start),
and Chrom Stop (chromosome stop).
b. Click Submit.
To search the database for the transcript sequences:
a. Select the Field to Search (Keyword, Gene Name, Gene Symbol, Accession
Number, Entrez Gene ID, rs Number, or Cytoband), Species, Criteria
(Contains, Matches, Begins With, or Ends With), and the Search Term.
b. Click Submit to view a list of genes that meet your search criteria, sorted
according to the gene symbol.
c. In the Search Results, click Select for the gene of interest.
3. In the Genome Map, select the sequence:
a. View the genome map to find the SNP(s) of interest.
• To zoom in: Click-drag the genome map left or right to center the
desired location, then click
until the desired view is achieved.
• To zoom out: Click
until the desired view is restored.
b. To redefine the range for the genome map, enter the chromosome number
and the chromosome start and stop locations, then click Show Targets.
c. Click a SNP to add the sequence to the Possible Targets list.
4. Add the sequence(s) to the Target List. Enter a name for each sequence that you
want to submit, then click Add All to add all the possible sequences, or click Add
for each sequence for which you want a custom assay design.
5. In the Target List, click Add to Design when you are done adding sequences to
add the sequence information for the selected sites to the Edit Sequences tab.
Custom TaqMan® Assays Design and Ordering Guide
19
1
Custom TaqMan® Assays
Order Custom TaqMan® SNP Genotyping Assays
6. In the Enter or Search for Sequence Information, click Check Format to validate
the format of the sequence(s). If an error message is displayed, correct the format
of the sequence information, then click Check Format again. Repeat until the
format is validated.
Note: For each IUPAC code that represents an ambiguous base, you are
asked to provide your conversion option.
7. Enter a SNP Name for each SNP in the entered sequence.
Note: The combination of SNP name and sequence name must be unique.
8. Click Submit For Assay Design.
Note: The button is inactive until the format of the sequence information is
free of errors.
Import sequence
information from
File Builder or a
FASTA-formatted file
You can import files that you created or validated using File Builder software or that
contain sequences in FASTA format.
1. In the Enter/Edit Sequence Information page, click Open/Import File.
2. For the File Type, select:
• File Builder if your file was created/validated using File Builder Software.
• FASTA if your file is in FASTA format.
3. Click Browse to find the file to import.
4. Select the text file (*.txt) that contains your sequences in File Builder or FASTA
format, then click Open.
5. Click Import File.
The sequence information from the file is added to the Enter/Edit Sequence
Information page.
Note: For FASTA-formatted files, the Custom TaqMan® Assay Design Tool
imports only the first 16 characters of the assay name into the Assay Name
field. If your file contains multiple sequences with headers that are similar
in the first 16 characters, edit the Assay Name field to distinguish between
the sequences.
Select assays
After you submit
your sequences
After you submit your sequences for assay design, you can either wait for the Custom
TaqMan® Assay Design Tool to complete your design (step 3 below), or you can close
your browser and return to your order at a later time (step 2 below). After receiving
your sequence, Applied Biosystems sends you an e-mail to confirm that your
sequences were submitted. The email contains a link to your design job in the Custom
TaqMan® Assay Design Tool that you can use to view the status of your job.
When the Custom TaqMan® Assay Design Tool completes your design job,
Applied Biosystems sends another e-mail to notify you that you can view the
candidate designs. You can use the link in the notification e-mail to view the design
report in the Custom TaqMan® Assay Design Tool.
20
Custom TaqMan® Assays Design and Ordering Guide
Section 1 Custom TaqMan® SNP Genotyping Assays
Order Custom TaqMan® SNP Genotyping Assays
Select assays to
order
1
1. If you closed the Custom TaqMan® Assay Design Tool after submitting your
sequence(s), follow the link in the notification e-mail to the Custom TaqMan®
Assay Design Tool.
2. In the Design Details section of the Select Assays tab, select the row that
corresponds to the submission.
For each design job, the Design Details table displays the:
• Batch ID – The ID assigned to the submission by Applied Biosystems.
• Submitted – The date that you submitted the sequence information.
• Status – The status of the design: Completed or Pending.
• Details – The assays in each batch that passed, failed, or were not designed.
3. Review the Design Results in the Select Assays tab.
For each assay, the Design Results table displays:
• ID/Name – A unique 7-character identifier assigned to each custom assay
that contains the name entered during assay submission. You can use an
Assay ID to reorder a Custom TaqMan® Assay.
• Type – The type of assay: Custom TaqMan® SNP Genotyping Assay or
Custom TaqMan® Gene Expression Assay.
• Design Status – The status of the design: Passed, Failed, or Pending.
• Size – The size or scale of the assay to order. For available sizes/scales, see
page 9.
• Quantity – The number of assays to order.
4. For each assay that you want to order:
a. In the Size column, select the assay size or scale in the dropdown list.
b. In the Quantity column, enter the quantity to order.
5. Click Add All to add all assays to the order, or click Add next to each assay that
you want to order. Selected assays are added to the Shopping List.
6. When you are done adding assays to your order, click Order Now to proceed to
the checkout.
Review and order
Review the order
1. In the Review & Order tab, confirm the assays to order:
• To delete an assay, enter 0 in the Quantity field.
• To change the size, select a different part number and size from the Size
dropdown list. For available sizes/scales, see page 9.
• To change the quantity, enter a different number in the Quantity field.
• To add more items to your Shopping List, click the Home, Search, or Select
Assays tab in the Custom TaqMan Assay Design Tool.
Custom TaqMan® Assays Design and Ordering Guide
21
1
Custom TaqMan® Assays
Order Custom TaqMan® SNP Genotyping Assays
2. Select the option to determine how you will receive the assays.
• Click Singles View to receive the assays in individual tubes.
• Click Plate View to receive the assays in the wells of a 96-well plate.
Note: Human and non-human assays cannot be plated on the same
plate.
Note: You can append assays to previously created plate
configurations.
Place the order
In the Review & Order tab, you can place your order three different ways:
• Place the order online through the Applied Biosystems secure store (page 22).
• Email the order to Applied Biosystems (page 22).
• Print and fax or mail the order to Applied Biosystems (page 23).
Order through the Applied Biosystems website
1. Click Add to Basket to add the items from your Shopping List to the basket in the
Applied Biosystems Store.
2. In the Store Log In page, enter your User Name and Password.
3. Select the shopping basket, then click Add to Basket.
4. Review the shopping basket in the Applied Biosystems Store, then click
Continue.
5. In the Shipping & Billing page, enter the Shipping Address, Billing Address,
Contact Information, Payment Information, Shipping Method, Special
Instructions, and Options. When you finish, click Continue.
6. Review the summary, click Place Order or Add To Configurator depending on
the reaction format that you selected, then follow the instructions to complete the
order.
Email the order to Applied Biosystems
IMPORTANT! Personal e-mail software is not required to e-mail the order form to
Applied Biosystems. The order form is transmitted via an encrypted secure
socket layer (SSL) that ensures maximum security of the order data.
1. Click Email to AB or any e-mail address to display the e-mail order form.
2. Complete the form as instructed, then click E-Mail Order Form.
3. (Optional) Click Print Order Form to print a hardcopy of the order for your
records.
4. When you are finished, click Close Order Form to return to the
Applied Biosystems website.
22
Custom TaqMan® Assays Design and Ordering Guide
Section 1 Custom TaqMan® SNP Genotyping Assays
Order Custom TaqMan® SNP Genotyping Assays
1
Print and fax or mail the order to Applied Biosystems
1. Click Print for fax/mail order or hardcopy record to display a printer-friendly
order form.
2. Click Print Window to send the order form to your printer, then follow the
instructions to configure the printed hardcopy.
3. When the form has printed successfully, click Close Window to return to the
Applied Biosystems website.
Custom TaqMan® Assays Design and Ordering Guide
23
1
24
Custom TaqMan® Assays
Order Custom TaqMan® SNP Genotyping Assays
Custom TaqMan® Assays Design and Ordering Guide
SECTION 2
2
Section 2 Custom TaqMan® Gene Expression
Assays
This section covers:
■
Design Custom TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . . . . . . . . 26
■
Order Custom TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . . . . . . . . . 27
Access the Custom TaqMan® Assay Design Tool . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Configure the bioinformatics settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
Enter sequences. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
Select assays. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
Review and order . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
Custom TaqMan® Assays Design and Ordering Guide
25
2
Custom TaqMan® Assays
Design Custom TaqMan® Gene Expression Assays
Design Custom TaqMan® Gene Expression Assays
The Custom TaqMan® Assay Design Tool can search for predesigned TaqMan® assays
or assist you in designing custom TaqMan® assays for quantitative gene expression
analysis. The following table describes the TaqMan® assay products that you can order
using the tool.
Product
TaqMan® Gene
Expression Assays
Description
Predesigned and optimized TaqMan® assays developed by
Applied Biosystems. The Applied Biosystems website offers more
than 1,000,000 predesigned TaqMan® Gene Expression Assays for
a variety of species. All assays are designed using the
Applied Biosystems validated bioinformatics pipeline, eliminating
the need for primer design or PCR optimization.
To search for and order predesigned TaqMan® Gene Expression
Assays, go to “Search for Pre-designed TaqMan® Gene Expression
Assays” on page 56.
Custom Plus
TaqMan® RNA Assays
Custom TaqMan® assays that are designed to input sequences
using the Custom TaqMan® Assay Design Tool bioinformatics
analysis feature. The bioinformatics analysis feature automates
most aspects of the assay design process. The tool uses data from
public molecular biology resources (Entrez and GeneBank) to assist
you in designing optimal TaqMan® assays.
To use the Custom TaqMan® Assay Design Tool bioinformatics
analysis feature to design Custom Plus assays, go to “Order
Custom TaqMan® Gene Expression Assays” on page 27.
IMPORTANT! Applied Biosystems does not provide the
sequences for Custom Plus TaqMan® RNA Assays designed
using the bioinformatic analysis feature of the assay design
pipeline.
Custom TaqMan®
Gene Expression
Assays
Custom TaqMan® assays manufactured to input sequences without
the use of the Custom TaqMan® Assay Design Tool bioinformatics
analysis feature.
If you have already performed a bioinformatics analysis of your
input sequences:
1. Review the information in Appendix B to validate the quality of
your input target sequence(s).
2. Go to “Order Custom TaqMan® Gene Expression Assays” on
page 27 to order Custom TaqMan® Gene Expression Assays.
26
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
2
Order Custom TaqMan® Gene Expression Assays
Access the Custom TaqMan® Assay Design Tool
1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store:
a. At the top of the Applied Biosystems home page, click Store Log In.
b. In the Store Log In page, log into the website as instructed. If you are a(n):
• Existing customer, enter your user name and password, then
click Login.
• New customer, click Register Now, then complete the registration
process as instructed.
Note: You must log into the Applied Biosystems store before you can
complete an order.
2. Go directly to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
Navigate to the Custom TaqMan® Assay Design Tool:
a. Place the cursor over Products, then under Assay Searches, click TaqMan®
Gene Expression Assays.
b. Click the Related Products tab, then in the Assay row, click Custom
TaqMan® Gene Expression Assays.
c. In the Start Here box, click Custom TaqMan® Assay Design Tool.
3. To enter, find, or import the target sequence for Applied Biosystems to design and
manufacture Custom TaqMan® Gene Expression Assays, click Order Custom
Gene Expression Assays.
Note: You can also use the Custom TaqMan Assay Design Tool to order
custom primer/probe pairs or to order Pre-designed TaqMan® Assays. See
Appendix A, “Order Other TaqMan® Assays” on page 47 for more
information.
Custom TaqMan® Assays Design and Ordering Guide
27
2
Custom TaqMan® Assays
Order Custom TaqMan® Gene Expression Assays
Configure the bioinformatics settings
1. Select the species associated with the sequence(s) that you are submitting.
Note: If you are designing a Custom TaqMan® Gene Expression Assay for
use with a transgenic organism, select the species associated with the
transgene sequence(s).
2. Select an option to indicate whether you want to use the bioinformatics analysis
feature of the assay design tool.
The Custom TaqMan® Assay Design Tool…
Option
No bioinformatic analysis
on my sequences
Designs an assay to the given input sequence without
bioinformatic sequence analysis.
Note: If you choose to perform your own
bioinformatic analysis, review the information in
Appendix B to validate the quality of your input
target sequence(s) and for more information on
bioinformatics analysis tools.
Yes, please perform
bioinformatic analysis on
my sequences
Designs the best possible assays to your input sequences
using the full bioinformatic power of the assay design
pipeline.
By selecting this option, the assay design pipeline:
1. Aligns the input sequence(s) to the genome of the
selected species and its known transcripts.
2. Masks the input sequence(s) for SNPs and lowcomplexity sequence.
3. Designs assays for the input sequence(s) based on the
options you have chosen, and performs in silico quality
control to ensure the best possible assay design.
IMPORTANT! Applied Biosystems does not provide
the sequences for assays designed using the
bioinformatic analysis feature of the assay design
pipeline.
3. If you choose to perform a bioinformatics analysis:
a. Select the option to determine the specificity of your assay design(s).
Option
28
The assay design tool…
The assays detect only my input
sequences (most specific/
transcript-level analysis)
Limits the bioinformatics analysis to include
assays that amplify only the sequence(s) that
you provide.
The assays may detect other
transcript variants at the same
locus (gene-level analysis)
Provides recommended assay designs that
can amplify other variants of the sequence(s)
that you provide at the same locus.
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
2
b. (Optional) Select the species that candidate assays must not detect (such as
for transgenic experiments).
Note: Selecting an organism from the list causes the assay design
pipeline to exclude assays that detect sequences that are present in the
genome of the selected organism.
Custom TaqMan® Assays Design and Ordering Guide
29
Custom TaqMan® Assays
2
Order Custom TaqMan® Gene Expression Assays
Enter sequences
In the Enter Sequences tab, you can enter sequence information three different ways
after you indicate your target species and bioinformatics analysis preference:
• Enter the sequence information (page 31).
• Find target sequences in the Applied Biosystems database (page 31).
• Import sequence information from File Builder or a FASTA-formatted file
(page 33).
Field
Name
Requirement
• Has 4 to 16 characters.
• Uses only alphanumeric, underscore, hyphen, and period characters.
• Has no spaces or tabs.
• Does not begin with a hyphen.
Sequence
• Enter the sequence in the 5′ to 3′ direction.
• Enter from 61 to 5000 bases.
• Use only A, C, G, T, and N.
• Convert the IUPAC codes R, Y, M, K, S, W, H, B, V, and D to N.
• Convert U to T.
• Remove any spaces, tabs, or line breaks.
Target
Position
& Name
30
• The target position indicates the base position of the target site from the 5´ end.
• The target position indicates where to design the TaqMan® probe.
• The target site name contains no more than four alphanumeric characters.
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
Enter the sequence
information
2
You can enter or copy and paste the sequence information directly in the Enter
Sequences tab.
1. In the Name field, enter the name for the sequence.
2. In the Sequence field, enter the entire sequence of interest in the 5′ to 3′ direction.
Remove any spaces, tabs, and line breaks.
3. Click Check Format to validate the format of the sequence(s). If an error message
is displayed, correct the format of the sequence information, then click Check
Format again. Repeat until the format is validated.
Note: The only characters that are allowed in a sequence for gene
expression assays are: A, C, G, T, and N. The Custom TaqMan® Assay
Design Tool converts all other characters to Ns.
4. In the Target Site Position & Name column, select:
• Manual to enter the target position and target name. In the Pos field, enter
the number of bases between the target site and the 5′ end, then in the Name
field, enter the target name. Click + Enter More Targets to enter more target
sites.
• Automatic to have the TaqMan® Assays design pipeline select a target from
multiple unspecified sites.
Note: If you select “Automatic” and you chose to perform a
bioinformatic analysis on your input sequences (step 2 on page 28),
then the design pipeline will design assays for all predicted exon
junctions.
5. (Optional) To enter another sequence:
a. Click + Enter More Sequences.
b. Repeat step 1 through step 4 in an empty row.
6. Click Continue.
Note: The button is inactive until the format of the sequence information is
free of errors.
After you submit your sequence(s) for design, the Custom TaqMan® Assay Design
Tool automatically searches for predesigned assays that match your input sequence(s).
If found, the tool displays all compatible predesigned TaqMan® assays before
presenting you with the custom assay designs.
Find target
sequences in the
Applied Biosystems
database
You can search the Applied Biosystems database for target sequences to submit for
custom assay designs.
1. In the Enter Sequences tab, click Search for Sequences by Keyword or Location.
2. Search the database for the gene of interest.
To enter the chromosome location:
a. Select the Species, Chromosome (number), Chrom Start (chromosome start),
and Chrom Stop (chromosome stop).
b. Click Submit.
Custom TaqMan® Assays Design and Ordering Guide
31
2
Custom TaqMan® Assays
Order Custom TaqMan® Gene Expression Assays
To search the database for the gene:
a. Select the Field to Search (Keyword, Gene Name, Gene Symbol, Accession
Number, Entrez Gene ID, or RNAdb ID, or RNAdb Gene Symbol), Species,
Criteria (Contains, Matches, Begins With, or Ends With), and the Search
Term.
b. Click Submit to view a list of genes that meet your search criteria, sorted
according to the gene symbol.
c. In the Search Results, click Select for the gene of interest.
3. In the Genome Map, select the sequence:
a. If available, view the genome map to find the transcript(s) of interest. The
genome map is available only for human, mouse, and rat.
• To zoom in: Click-drag the genome map left or right to center the
desired location, then click
until the desired view is achieved.
• To zoom out: Click
until the desired view is restored.
b. To redefine the range for the genome map, enter the chromosome start and
stop locations, then click Submit.
c. To view both GenBank and RefSeq mRNA transcripts within the displayed
range of the genome map, select Show GenBank mRNAs.
d. Select two exons (blue boxes), then click the bracket that joins the exons to
add the sequence to the Possible Sequences list. If the transcript contains
only one exon, select the exon, then click the bracket that appears above the
exon to add the sequence to the Possible Sequences list. To select the entire
transcript, click the transcript between exons, then click the bracket joining
all of the exons to add the transcript to your possible targets.
4. Add the sequence(s) to the Target List. Enter a name for each sequence that you
want to submit, then click Add All to add all the possible sequences, or click Add
for each sequence for which you want a custom assay design.
5. In the Target List, click Add to Design when you are done adding sequences to
add the sequence information for the selected sites to the Edit Sequences tab.
6. In the Enter or Search for Sequence Information, enter a name for any unnamed
sequences, then click Check Format to validate the format of the sequence(s). If an
error message is displayed, correct the format of the sequence information, then
click Check Format again. Repeat until the format is validated.
7. In the Target Site Position & Name column, select:
• Manual to enter the target position and target name. In the first field, enter
the number of bases between the target site and the 5′ end, then in the
second field, enter the target name. Click + Enter More Targets to enter more
target sites.
Note: If you searched for sequences and selected two or more exons,
the target position(s) and name(s) are automatically populated with
the exon junction information.
• Automatic to have the TaqMan® Assays Design Pipeline select a target from
multiple unspecified sites.
32
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
2
8. Click Continue.
Note: The button is inactive until the format of the sequence information is
free of errors.
After you submit your sequence(s) for design, the Custom TaqMan® Assay Design
Tool automatically searches for predesigned assays that match your input sequence(s).
If found, the tool displays all compatible predesigned TaqMan® assays before
presenting you with the custom assay designs.
Import sequence
information from
File Builder or a
FASTA-formatted file
You can import files that you created or validated using File Builder software or that
contain sequences in FASTA format.
1. In the Enter/Edit Sequence Information page, click Open/Import File.
2. For the File Type, select:
• File Builder if your file was created/validated using File Builder Software.
• FASTA if your file is in FASTA format.
3. Click Browse to find the file to import.
4. Select the text file (*.txt) that contains your sequences in File Builder or FASTA
format, then click Open.
5. Click Import File.
The sequence information from the file is added to the Enter/Edit Sequence
Information page.
Note: For FASTA-formatted files, the Custom TaqMan® Assay Design Tool
imports only the first 16 characters of the assay name into the Assay Name
field. If your file contains multiple sequences with headers that are similar
in the first 16 characters, edit the Assay Name field to distinguish between
the sequences.
After you submit your sequence(s) for design, the Custom TaqMan® Assay Design
Tool automatically searches for predesigned assays that match your input sequence(s).
If found, the tool displays all compatible predesigned TaqMan® assays before
presenting you with the custom assay designs.
Custom TaqMan® Assays Design and Ordering Guide
33
2
Custom TaqMan® Assays
Order Custom TaqMan® Gene Expression Assays
Select assays
After you submit
your sequences
After you submit your sequences for assay design, you can either wait for the Custom
TaqMan® Assay Design Tool to complete your design (step 2 below), or you can close
your browser and return to your order at a later time (step 1 below). After receiving
your sequence, Applied Biosystems sends you an e-mail to confirm that your
sequences were submitted. The email contains a link to your design job in the Custom
TaqMan® Assay Design Tool that you can use to view the status of your job.
When the Custom TaqMan® Assay Design Tool completes your design job,
Applied Biosystems sends another e-mail to notify you that you can view the
candidate designs. You can use the link in the notification e-mail to view the design
report in the Custom TaqMan® Assay Design Tool.
Select assays to
order
Before viewing the custom assay design results, review the alignment maps for your
input sequences that have compatible pre-designed TaqMan® assays. After receiving
your sequences, the assay design tool searches for predesigned TaqMan® Gene
Expression or TaqMan Non-Coding Assays that match your input sequence(s) 100%. If
you choose not to use predesigned assays, you can proceed directly to the Custom
Assay Design screen to review your assay designs.
Note: If you closed the browser after submitting your input sequences, you can
view matching predesigned assays by following the link in either of the
notification e-mails that you receive from Applied Biosystems.
1. If you closed your browser after submitting your sequence(s):
a. Follow the link in your notification e-mail to the Custom TaqMan® Assay
Design Tool, then click Back to Predesigns in the Select Assays web page.
b. Choose from the following. If you want to:
• Review predesigned TaqMan® assays that match your submitted
sequences, go to step 2.
• Skip the predesigned assay review and instead view the custom
TaqMan® assay designs for your input sequences, go to step 3 on
page 36.
34
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
2
2. View and select the predesigned TaqMan® assays:
a. In the Select Assays tab, review the input sequences that have matching
compatible predesigned TaqMan® Gene Expression Assays.
For each input sequence, the Design Details table displays the following:
• Sequence Name – The unique identifier that you gave to the sequence.
The sequence name is referred to as the “Assay Name” after you order
the assay.
Note: Click Important Information to display any notices or
warnings associated with the input sequence.
• Assay IDs – The unique identifiers of the predesigned TaqMan® Gene
Expression Assays.
The following columns are displayed only if you use the custom assay
design tool to perform bioinformatics analysis:
• Genome Match – A measure of how closely the input sequence matches
the chosen genome, where the number is the percentage of nucleotides
in the input sequence that match the chosen genome. The assay design
tool displays only matches greater than 90%.
• Genome Position – The chromosomal position to which the assay
sequence is aligned within the associated genome in the following
format:
<chromosome number> : <chromosome start> - <chromosome stop>
The design tool displays the genome position if the input sequence
aligns with less than a 90% match to the genome, the design tool does
not display the genome position.
• Locus – The unique loci to which the sequence aligns in the genome.
Note: The assay design tool displays only the top three unique
loci that have ≥90% alignment to the input sequence.
The following columns are displayed if you chose to perform your own
bioinformatics analysis:
• Availability – The availability of the related predesigned TaqMan®
Gene Expression Assay: Inventoried or Made-To-Order.
• Assay Type – The coding status of the related predesigned TaqMan®
Gene Expression Assay: Coding or Non-coding.
• Amplicon Length – The number of bases that compose the amplicon of
the associated custom TaqMan® assay.
Custom TaqMan® Assays Design and Ordering Guide
35
2
Custom TaqMan® Assays
Order Custom TaqMan® Gene Expression Assays
b. For each input sequence, click Alignment Map to display the compatible
predesigned TaqMan® Gene Expression Assays in context with the input
sequence and the associated genome.
Note: Alignment maps are not available for all species; the option is
displayed only if data is available.
c. Click Add All to add all assays to the order, or click Add next to each assay
that you want to order. Selected assays are added to the Shopping List.
d. When you are done adding assays to your order:
• Click Order Now and go to “Review and order” on page 38 to complete
your order without reviewing the custom assay designs.
• Click Proceed to Custom Assays and go to step 3 to view the list of
candidate custom assays designed to your input sequence(s).
3. In the Design Details section of the Select Assays tab, select the row that
corresponds to the submission.
For each design job, the Design Details table displays the:
• Batch ID – The ID assigned to the submission by Applied Biosystems.
• Type – The type of assay(s) designed: GTP (Custom TaqMan® SNP
Genotyping Assay), GX (Custom TaqMan® Gene Expression Assay), and
GXP (Custom Plus TaqMan® RNA Assay).
• Submitted – The date that you submitted the sequence information.
• Status – The status of the design: Completed or Pending.
• Details – The assays in each batch that passed, failed, or were not designed.
36
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
2
4. Review the Design Results in the Select Assays tab.
For each sequence, the Design Results table displays:
• Assay Name – The unique identifier that you gave to the sequence.
Note: Click Alignment Map to view the alignment map for the input
sequence and the associated custom assay designs. (An alignment
map is available only if you used the assay design tool to perform a
bioinformatics analysis of the input sequence.)
Note: Click Target Sequence to view the nucleic acid sequence of the
associated sequence.
• Assay ID – A 7-character alphanumeric identifier assigned by
Applied Biosystems to each Custom TaqMan® Assay.
• Status – The status of the associated TaqMan® assay: PASS or FAIL.
The following columns are also displayed if you used the assay design tool to
perform a bioinformatics analysis of the input sequences:
• Locus – The unique loci to which your input sequence aligns in the genome.
The display tool shows only the top three unique loci matches.
• Genome Position – The chromosomal position to which the input sequence
aligns within the associated genome in the following format:
<chromosome number> : <chromosome start> - <chromosome stop>
• Amplicon Size – The number of bases that compose the amplicon of the
associated Custom TaqMan® assay.
5. For each assay that you want to order:
a. In the Size column, select the assay size or scale in the dropdown list.
b. In the Quantity column, enter the quantity to order.
6. Click Add All to add all assays to the order, or click Add next to each assay that
you want to order. Selected assays are added to the Shopping List.
7. When you are done adding assays to your order:
• Click Order Now and go to “Review and order” on page 38 to proceed to the
checkout.
• Click Continue and go to step 8 to review related products and controls for
use with your assays.
8. Review the Related Products and add control assays or kits as needed:
a. Click the [ + ] next to any reagent kits that you want to order.
b. For each assay that you want to order, select the assay that matches the probe
dyes, the primer concentrations, and the number of reactions that you want.
c. Click Add next to each assay that you want to order. Selected assays are
added to the Shopping List.
Custom TaqMan® Assays Design and Ordering Guide
37
2
Custom TaqMan® Assays
Order Custom TaqMan® Gene Expression Assays
d. Click Order Now.
Review and order
Review the order
In the Review & Order tab, confirm the assays to order:
• To delete an assay, enter 0 in the Quantity field.
• To change the size, select a different part number and size from the Size
dropdown list. For available sizes/scales, see page 9.
• To change the quantity, enter a different number in the Quantity field.
Place the order
In the Review & Order tab, you can place your order three different ways:
• Place the order online through the Applied Biosystems secure store (page 38).
• Email the order to Applied Biosystems (page 39).
• Print and fax or mail the order to Applied Biosystems (page 39).
Order through the Applied Biosystems website
1. Click Add to Basket to add the items from your Shopping List to the basket in the
Applied Biosystems Store.
2. In the Store Log In page, enter your User Name and Password.
3. Select the shopping basket, then click Add to Basket.
4. Review the shopping basket in the Applied Biosystems Store, then click
Continue.
5. In the Shipping & Billing page, enter the Shipping Address, Billing Address,
Contact Information, Payment Information, Shipping Method, Special
Instructions, and Options. When you finish, click Continue.
6. Review the summary, click Place Order, then follow the instructions to complete
the order.
38
Custom TaqMan® Assays Design and Ordering Guide
Section 2 Custom TaqMan® Gene Expression Assays
Order Custom TaqMan® Gene Expression Assays
2
Email the order to Applied Biosystems
IMPORTANT! Personal e-mail software is not required to e-mail the order form to
Applied Biosystems. The order form is transmitted via an encrypted secure
socket layer (SSL) that ensures maximum security of the order data.
1. Click Email to AB or any e-mail address to display the e-mail order form.
2. Complete the form as instructed, then click E-Mail Order Form.
3. (Optional) Click Print Order Form to print a hardcopy of the order for your
records.
4. When you are finished, click Close Order Form to return to the
Applied Biosystems website.
Print and fax or mail the order to Applied Biosystems
1. Click Print for fax/mail order or hardcopy record to display a printer-friendly
order form.
2. Click Print Window to send the order form to your printer, then follow the
instructions to configure the printed hardcopy.
3. When the form has printed successfully, click Close Window to return to the
Applied Biosystems website.
Custom TaqMan® Assays Design and Ordering Guide
39
2
40
Custom TaqMan® Assays
Order Custom TaqMan® Gene Expression Assays
Custom TaqMan® Assays Design and Ordering Guide
SECTION 3
3
Section 3 Reorder Custom TaqMan® Assays
This section covers:
■
Reorder online. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
■
Reorder legacy assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
Custom TaqMan® Assays Design and Ordering Guide
41
3
Custom TaqMan® Assays
Reorder online
Reorder online
You can reorder assays through the Applied Biosystems website in two ways: using
the Quick Order service or the Custom TaqMan® Assay Design Tool.
Reorder using Quick Order
1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store:
a. At the top of the Applied Biosystems home page, click Store Log In.
b. In the Store Log In page, enter your user name and password, then
click Login.
Note: You must log into the Applied Biosystems store before you can
complete the order.
2. In the Applied Biosystems webpage, click
Quick Order.
3. Enter or copy/paste the order data for the assays of interest:
• Manual entry – Enter one or more part number-ID combinations, then enter
a value in the Quantity field.
• Copy/paste entry – Copy and paste the part numbers-ID combination data
into the Part Numbers/IDs* field.
4. Select a basket, then click Add to Basket to process the order.
Note: If you do not select a basket, your default basket (My Basket) will be
used. To create another basket, click Manage Shopping Baskets.
5. Complete the order as directed.
Reorder using the standard ordering service
1. Go to www.appliedbiosystems.com, then log into the Applied Biosystems store:
a. At the top of the Applied Biosystems home page, click Store Log In.
b. In the Store Log In page, enter your user name and password, then
click Login.
Note: You must log into the Applied Biosystems store before you can
complete the order.
2. Go directly to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
42
Custom TaqMan® Assays Design and Ordering Guide
Section 3 Reorder Custom TaqMan® Assays
Reorder online
3
Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan®
Assay Design Tool:
a. Place the cursor over Products, then under Assay Searches, click TaqMan®
SNP Genotyping Assays or TaqMan® Gene Expression Assays.
b. Click the Related Products tab, then in the Assay row, click Custom
TaqMan® SNP Genotyping Assays or Custom TaqMan® Gene Expression
Assays.
c. In the Start Here box, click Custom TaqMan® Assay Design Tool.
3. Click Reorder Existing Custom Assays.
4. In the Search tab, search for existing custom assays:
a. From the Fields to be Searched dropdown list, select: Assay ID, Legacy
Assay-ID, Assay Name, Date Range, Sales Order #
Note: Legacy assays are Custom TaqMan® Assays that were designed
before the release of the Custom TaqMan® Assay Design Tool.
LegacyAssay IDs are IDs assigned to custom assays, ordered before
February 2009, that consist of the sequence and target names,
separated by a hyphen.
b. Select the criteria: Matches or Contains.
c. Enter the Term to search.
d. (Required for legacy IDs) Enter the Sales Order #.
e. Click Search.
5. For each assay that you want to order:
a. Select the assay size in the dropdown list in the Size column.
b. Enter the number of tubes to order in the Quantity column.
6. Click Add All to add all assays to the order, or click Add next to each assay to
order. Selected assays are added to the Shopping List.
Custom TaqMan® Assays Design and Ordering Guide
43
3
Custom TaqMan® Assays
Reorder legacy assays
Reorder legacy assays
Legacy assays are Custom TaqMan® Assays that were designed before the release of
the Custom TaqMan® Assay Design Tool. LegacyAssay IDs were generated differently
from Assay IDs. Use the procedures in this section to reorder legacy assays by e-mail
or by regular or express mail.
IMPORTANT! To reorder legacy Custom TaqMan® Assays, you need information
from the Assay Information File (AIF) that was shipped to you with the
previous assay.
Reorder online
To reorder legacy assays online using Quick Order, see “Reorder online” on page 42.
Reorder by e-mail
1. Address the message:
• For orders to North America:
orders@appliedbiosystems.com
• For orders to Europe:
assays.europe@appliedbiosystems.com
• For other regions, contact your local Applied Biosystems office or visit
www.appliedbiosystems.com/support/contact
2. In the subject line, enter Reorder for Custom TaqMan Assay.
3. In the message body enter the:
• Sales order number – The number in the Assay Information File (AIF) that
was shipped to you with your previous Custom TaqMan® Assays order.
• Assay ID – The ID from the AIF.
• Part number – The number that indicates the type of assay and the scale that
you want to order.
• Quantity – The number of tubes to order.
• Purchase order number
or
Credit card information – The name as it appears on the card, the card
number, and the expiration date.
• Contact information – The name, e-mail address, telephone number, and
address of the person to contact if problems occur.
• Shipping information – The name, address (including room number,
building, department, and the ATTN line information), and telephone
number of the person to receive shipment.
• Invoice information – The name, e-mail address, physical address, and
telephone number of the purchasing agent or person to receive invoice
details.
4. Send the message.
44
Custom TaqMan® Assays Design and Ordering Guide
Section 3 Reorder Custom TaqMan® Assays
Reorder legacy assays
3
Reorder by regular or express mail
1. Prepare an order document containing the:
• Sales order number – The number in the Assay Information File (AIF) that
was shipped to you with your previous Custom TaqMan® Assays order.
• Assay ID – The ID from the AIF.
• Part number – The number that indicates the type of assay and the scale that
you want to order.
• Quantity – The number of tubes to order.
• Purchase order number
or
Credit card information – The name as it appears on the card, the card
number, and the expiration date.
• Contact information – The name, e-mail address, telephone number, and
address of the person to contact if problems occur.
• Shipping information – The name, address (including room number,
building, and department), and telephone number of the person to receive
shipment.
• Invoice information – The name, e-mail address, physical address, and
telephone number of purchasing agent or person to receive invoice details.
IMPORTANT! To prevent delays, include all information in the order
document.
2. Print a copy of the order document.
3. Send the printed copy of your order document to the appropriate address (see
page 82).
Custom TaqMan® Assays Design and Ordering Guide
45
3
46
Custom TaqMan® Assays
Reorder legacy assays
Custom TaqMan® Assays Design and Ordering Guide
APPENDIX A
Order Other TaqMan® Assays
A
This appendix covers:
■
Section A.1 Order Other TaqMan® SNP Genotyping Assays . . . . . . . . . . . . . . 49
■
Enter custom primer/probe pairs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
■
Search for Pre-designed TaqMan® SNP Genotyping Assays. . . . . . . . . . . . . . . . . 52
■
Section A.2 Order Other TaqMan® Gene Expression Assays . . . . . . . . . . . . . . 53
■
Enter custom primer/probe pairs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
■
Search for Pre-designed TaqMan® Gene Expression Assays . . . . . . . . . . . . . . . . . 56
Custom TaqMan® Assays Design and Ordering Guide
47
A
48
Appendix A Order Other TaqMan® Assays
Custom TaqMan® Assays Design and Ordering Guide
SECTION A.1
Section A.1 Order Other TaqMan® SNP
Genotyping Assays
A.1
Enter custom primer/probe pairs
Submit the sequences for the forward primer, reverse primer, and TaqMan® MGB
probes, then Applied Biosystems synthesizes the oligos and formulates a custom assay
using your oligonucleotide sequences.
Format requirements
Field
Requirement
Assay Name
Enter 4 to 16 characters.
Forward
Primer
• Enter the sequence in the 5′ to 3′ direction.
• Enter 9 to 45 nucleotides.
• Use only A, C, G, and T.
• Remove any spaces, tabs, or line breaks.
Reverse
Primer
• Enter the sequence in the 5′ to 3′ direction.
• Enter 9 to 45 nucleotides.
• Use only A, C, G, and T.
• Remove any spaces, tabs, or line breaks.
Probe 1
• Enter the sequence in the 5′ to 3′ direction.
• Enter 9 to 45 nucleotides.
• Use only A, C, G, and T.
• Remove any spaces, tabs, or line breaks.
Note: The probe for the first allele is labeled with VIC dye.
Probe 2
• Enter the sequence in the 5′ to 3′ orientation.
• Enter between 9 and 45 nucleotides.
• Use only A, C, G, and T.
• Remove any spaces, tabs, or line breaks.
Note: The probe for the second allele is labeled with 6-FAM dye.
Custom TaqMan® Assays Design and Ordering Guide
49
A
Appendix A Order Other TaqMan® Assays
Enter custom primer/probe pairs
Access the Custom TaqMan® Assay Design Tool
1. Go directly to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan®
Assay Design Tool:
a. Place the cursor over Products, then under Assay Searches, click TaqMan®
SNP Genotyping Assays.
b. Click the Related Products tab, then in the Assay row, click Custom
TaqMan® SNP Genotyping Assays.
c. In the Start Here box, click Custom TaqMan® Assay Design Tool.
2. In the Custom TaqMan® SNP Genotyping Assays section, click Enter Custom
Primer/Probe Pairs.
You will enter the sequences for the forward primer, reverse primer, and
TaqMan® MGB probes, then Applied Biosystems will synthesize the oligos and
formulate a custom assay mix using your custom primer and probe sequences.
Enter the sequences
1. Enter 4 to 16 characters for the Assay Name.
2. Enter 9 to 45 nucleotides (A, C, G, or T) for the Forward Primer sequence.
3. Enter 9 to 45 nucleotides (A, C, G, or T) for the Reverse Primer sequence.
4. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe 1 sequence.
5. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe 2 sequence.
6. (Optional) To enter more than one custom primer/probe pair, click + Add New
Sequence, then repeat step 1 through step 5.
50
Custom TaqMan® Assays Design and Ordering Guide
Section A.1 Order Other TaqMan® SNP Genotyping Assays
Enter custom primer/probe pairs
A
Import sequence information from a file
1. Click Open/Import File.
The uploaded file must be a tab-delimited text file (.txt) that includes all of the
following information, including the column headers:
• Assay name (first column) – Enter a name for the assay (followed by a Tab
character).
• FAM probes sequence (second column) – Enter the sequence of the FAM/
MGB probe in the 5′ to 3′ direction (followed by a Tab character).
• Forward primer sequence (third column) – Enter the forward primer
sequence in the 5′ to 3′ direction (followed by a Tab character).
• Reverse primer sequence (fourth column) – Enter the reverse primer
sequence in the 5′ to 3′ direction.
Note: To include multiple sequences in the file, enter the assay information
in the following lines of the file in the same format. Do not repeat the
heading information.
The following is an example of properly formatted file:
Assay nameFAM probes sequenceForward primer sequenceReverse primer sequence
mysequenceACGACTGATCGATCGGGTACCGGTATACGTAGTTGATTACGATACCACGTACACA
Note: For more information on how to format the file, click Import File
Format Requirements.
2. Click Browse, select the file, then click Open.
3. Click Import File.
Check the format and submit your sequences
After you finish entering custom primer/probe pairs, check the format of the
sequences.
1. Click Check Format, then correct the sequence information as needed.
2. Click Submit.
A confirmation message is displayed with an AB Workspace Batch ID.
3. Click Continue to proceed to the Select Assays page.
(Optional) Save the sequence information in a file
After you check the format, you can save the sequence information in a *.txt file.
1. Click Save File.
2. In the Save File dialog box, select a location for the file, enter a file name, then
click Save.
Custom TaqMan® Assays Design and Ordering Guide
51
A
Appendix A Order Other TaqMan® Assays
Search for Pre-designed TaqMan® SNP Genotyping Assays
Search for Pre-designed TaqMan® SNP Genotyping Assays
Search the Applied Biosystems database for pre-designed Inventoried or Made-toOrder TaqMan® Assays.
To perform an Assay Search with complete search capabilities, place the cursor over
Products, then under Assay Searches, click TaqMan® SNP Genotyping Assays.
Access the Custom TaqMan® Assay Design Tool
1. Go to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan®
Assay Design Tool:
a. Place the cursor over Products, then under Assay Searches, click TaqMan®
SNP Genotyping Assays.
b. Click the Related Products tab, then in the Assay row, click Custom
TaqMan® SNP Genotyping Assays.
c. Below How to Order, click Custom TaqMan® Assay Design Tool.
2. To search the database for pre-designed Applied Biosystems Inventoried or
Made-to-Order TaqMan® SNP Genotyping Assays, click Search for Pre-designed
TaqMan® SNP Genotyping Assays.
52
Custom TaqMan® Assays Design and Ordering Guide
SECTION A.2
Section A.2 Order Other TaqMan® Gene
Expression Assays
A.2
Enter custom primer/probe pairs
Submit the sequences for the forward primer, reverse primer, and TaqMan® MGB
probe, then Applied Biosystems synthesizes the oligos and formulates a custom assay
using your oligonucleotide sequences.
Format requirements
Field
Requirement
Assay Name
Enter 4 to 16 characters.
Forward
Primer
• Enter the sequence in the 5′ to 3′ direction.
• Enter 9 to 45 nucleotides.
• Use only A, C, G, and T.
• Convert U to T.
• Remove any spaces, tabs, or line breaks.
Reverse
Primer
• Enter the sequence in the 5′ to 3′ direction.
• Enter 9 to 45 nucleotides.
• Use only A, C, G, and T.
• Convert U to T.
• Remove any spaces, tabs, or line breaks.
Probe
• Enter the sequence in the 5′ to 3′ direction.
• Enter 9 to 45 nucleotides.
• Use only A, C, G, and T.
• Convert U to T.
• Remove any spaces, tabs, or line breaks.
Note: The probe sequence must be for a TaqMan® MGB probe.
Custom TaqMan® Assays Design and Ordering Guide
53
A
Appendix A Order Other TaqMan® Assays
Enter custom primer/probe pairs
Access the Custom TaqMan® Assay Design Tool
1. Go directly to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
Go to www.appliedbiosystems.com, then navigate to the Custom TaqMan®
Assay Design Tool:
a. Place the cursor over Products, then under Assay Searches, click TaqMan®
Gene Expression Assays.
b. Click the Related Products tab, then in the Assay row, click Custom
TaqMan® Gene Expression Assays.
c. In the Start Here box, click Custom TaqMan® Assay Design Tool.
2. In the Custom TaqMan® Gene Expression Assays section, click Enter Custom
Primer/Probe Pairs.
You will enter the sequences for the forward primer, reverse primer, and
TaqMan® MGB probe labeled with FAM™ dye, then Applied Biosystems will
synthesize the oligos and formulate a custom assay mix using your custom
primer and probe sequences.
Enter the sequences
1. Enter 4 to 16 characters for the Assay Name.
2. Enter 9 to 45 nucleotides (A, C, G, or T) for the Forward Primer sequence.
3. Enter 9 to 45 nucleotides (A, C, G, or T) for the Reverse Primer sequence.
4. Select and enter the information for the TaqMan® MGB probe:
a. Select the Dye (6-FAM).
b. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe sequence.
5. (Optional) To enter more than one custom primer/probe pair, click + Add New
Sequence, then repeat step 1 through step 4.
54
Custom TaqMan® Assays Design and Ordering Guide
Section A.2 Order Other TaqMan® Gene Expression Assays
Enter custom primer/probe pairs
A
Import sequence information from a file
1. Click Open/Import File.
The uploaded file must be a tab-delimited text file (.txt) that includes all of the
following information, including the column headers:
• Assay name (first column) – Enter a name for the assay (followed by a Tab
character).
• FAM probes sequence (second column) – Enter the sequence of the FAM/
MGB probe in the 5′ to 3′ direction (followed by a Tab character).
• Forward primer sequence (third column) – Enter the forward primer
sequence in the 5′ to 3′ direction (followed by a Tab character).
• Reverse primer sequence (fourth column) – Enter the reverse primer
sequence in the 5′ to 3′ direction.
Note: To include multiple sequences in the file, enter the assay information
in the following lines of the file in the same format. Do not repeat the
heading information.
The following is an example of properly formatted file:
Assay nameFAM probes sequenceForward primer sequenceReverse primer sequence
mysequenceACGACTGATCGATCGGGTACCGGTATACGTAGTTGATTACGATACCACGTACACA
Note: For more information on how to format the file, click Import File
Format Requirements.
2. Click Browse, select the file, then click Open.
3. Click Import File.
Check the format and submit your sequences
After you finish entering custom primer/probe pairs, check the format of the
sequences.
1. Click Check Format, then correct the sequence information as needed.
2. Click Submit.
A confirmation message is displayed with an AB Workspace Batch ID.
3. Click Continue to proceed to the Select Assays page.
(Optional) Save the sequence information in a file
After you check the format, you can save the sequence information in a *.txt file.
1. Click Save File.
2. In the Save File dialog box, select a location for the file, enter a file name, then
click Save.
Custom TaqMan® Assays Design and Ordering Guide
55
A
Appendix A Order Other TaqMan® Assays
Search for Pre-designed TaqMan® Gene Expression Assays
Search for Pre-designed TaqMan® Gene Expression Assays
Search the Applied Biosystems database for pre-designed Inventoried or Made-toOrder TaqMan® Assays.
Access the Custom TaqMan® Assay Design Tool
1. Go to the Custom TaqMan® Assay Design Tool web site:
www.appliedbiosystems.com/cadt
OR
Go to www.appliedbiosystems.com, navigate to the Custom TaqMan® Assay
Design Tool, place the cursor over Products, then under Assay Searches, click
TaqMan® Gene Expression Assays.
2. Click Search For Pre-designed TaqMan® Gene Expression Assays.
56
Custom TaqMan® Assays Design and Ordering Guide
APPENDIX B
B
Bioinformatics Tools for Evaluating
Target Sequences
This appendix gives detailed instructions for bioinformatics tools available for
evaluating target sequences, as described earlier in this protocol. The following steps
are covered:
• Verifying sequence uniqueness with a BLAST database search
• Finding exon information using the Entrez Gene database
• Finding exon information using the manually curated Vertebrate Genome
Annotation database
• Masking sequence repeats
• Detecting and Masking nontarget sequence polymorphisms found in dbSNP
Note: See Bioinformatic Evaluation of a Sequence for Custom TaqMan® Gene
Expression Assays (PN 4371002) or Bioinformatic Evaluation of a Sequence for
Custom TaqMan® SNP Genotyping Assays (PN 4371003) for a complete discussion
of the bioinformatics analysis and techniques required for Custom TaqMan®
Assay design.
Custom TaqMan® Assays Design and Ordering Guide
57
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Verify sequence uniqueness with a BLAST database search
Verify sequence uniqueness with a BLAST database search
Objectives for a BLAST database search
Whether you have sequenced your target or obtained the sequence from a sequence
database, you need to determine:
• If unique primers and probes can be generated for the sequence.
• Homologs in gene families can present a problem, as can orthologous sequences
when you work in a transgenic system.
• If there are polymorphisms in the sequence of interest.
• To verify uniqueness, you search for regions of sequence similarity between the
target sequences and databases of known sequences. To make your assay as
specific as possible, you can mask regions of similarity before submitting your
sequence for design, so they are not considered in the assay design. You can use
BLAST®, a sequence comparison algorithm and database searching program to
search the NCBI nucleic acid and protein public databases.
Run a BLAST database search
1. Go to www.ncbi.nlm.nih.gov/blast and follow the instructions on the BLAST
home page.
Instructions on how to use the software are posted on the website.
2. Select nucleotide BLAST (blastn) to access the BLAST database search page.
3. In the Enter Query Sequence field on the BLAST database search page, enter the
sequence in any of three formats:
• FASTA format – “>”, followed by one description line, with the sequence on
the following line
• Text-only sequence – No numbers or nonsequence text
• Sequence identifiers – Accession number, accession.version number, gi
numbers or others
For more information about these formats, go to: www.ncbi.nlm.nih.gov/blast/
html/search.html
4. Choose the appropriate database to search.
• For Gene Expression assays, if you search with a cDNA sequence, search the
default Human genomic + transcript database for human assays.For other
species, click Others and specify the appropriate database.
• For SNP assays, search the default Human genomic + transcript database
for human assays.For other species, click Others and specify the appropriate
database.
58
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Verify sequence uniqueness with a BLAST database search
B
5. In the Algorithm parameters section, you can:
• Filter species-specific repeats from a dropdown menu.
• Filter and mask low-complexity regions.
Enter the query sequence
Select a database
Filter low-complexity regions
and species-specific repeats
Select masking
6. Click
to submit your search.
7. Click Formatting Options. Wait for the results to be displayed.
Custom TaqMan® Assays Design and Ordering Guide
59
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Verify sequence uniqueness with a BLAST database search
Evaluating BLAST database results
There are three parts to BLAST® database search results:
• Graphical overview
• List of matching sequences
• Sequence alignments
Graphical overview
The graphical overview is a graphical representation of the database sequences that
align to your query sequence, with the query sequence represented by the thick red
numbered line at the top of the graph.
Figure 1 Graphical representation of BLAST database search results
60
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Verify sequence uniqueness with a BLAST database search
B
List of matching sequences
Matching sequences are listed from best to worst score. The top match is the best hit
(which may be the sequence with which you queried the database). The link to the left
of the sequence name opens the GenBank record for the sequence. This record contains
the complete sequence, species information, journal references, feature descriptions,
and other information.
The Score indicates the degree of similarity between your sequence and the sequence
to which it is being aligned. The higher the score is, the more similar the sequences are.
Figure 2 List of matching sequences in the results of a BLAST database search (shortened for
display purposes)
Each sequence alignment also has an E (Expect) value. The E value represents the
number of hits you can “expect” to find by chance when searching a database of a
particular size. The lower the E value, the more significant the match.
Look for matches with E values of less than ~0.1; matches with larger E values can be
ignored.
You can go to the sequence alignment by clicking the Score link.
Custom TaqMan® Assays Design and Ordering Guide
61
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Verify sequence uniqueness with a BLAST database search
Sequence alignments
This section shows the alignments between your query sequence (Query) and each
sequence (Sbjct) in the list of hits. You can use these alignments to help assess the
degree of similarity. The Score and Expect values are displayed underneath the
sequence identifiers. The number of bases aligned, percent identity, and the strand that
was aligned to your query sequence and the database hit are shown.
Figure 3 Individual sequence alignment from the results of a BLAST database search
62
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Find exon-exon boundaries (gene expression assays only)
B
Find exon-exon boundaries (gene expression assays only)
For gene expression assays, you may use the exon-exon boundaries as the target
position(s) in your submission file. Using the exon-exon boundaries as the target
position excludes the detection of genomic DNA by the assay.
For instructions on searching for exon-exon boundaries in the:
• Entrez Gene database, see the next section, “Find exon information using the
Entrez Gene database”.
• Genome Annotation database, see “Find exon information using the Vertebrate
Genome Annotation Database” on page 66.
Find exon information using the Entrez Gene database
Entrez Gene is a searchable database of genes, from RefSeq genomes, defined by
sequence and/or located in the NCBI Map Viewer.
1. Go to www.ncbi.nlm.nih.gov/Entrez.
2. In the list of available databases, click Gene.
3. In the Entrez Gene page, enter a gene name, symbol, or keyword, then click Go.
Custom TaqMan® Assays Design and Ordering Guide
63
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Find exon-exon boundaries (gene expression assays only)
4. In the results list, click the gene name.
5. In the display list, select Gene Table.
64
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Find exon-exon boundaries (gene expression assays only)
B
6. Scroll to view the exon information, which includes the exon start and stop bases
for the gene sequence.
7. From the exon-exon boundaries, select target positions.
After you select one or more target positions, identify and mask any repeats
(“Mask sequence repeats” on page 69) and polymorphisms (“Detect and mask
nontarget sequence polymorphisms” on page 73).
Custom TaqMan® Assays Design and Ordering Guide
65
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Find exon information using the Vertebrate Genome Annotation Database
Find exon information using the Vertebrate Genome Annotation
Database
Search the Vertebrate Genome Annotation Database
The Vertebrate Genome Annotation (Vega) is part of the Ensembl project. The Vega
database is a collection of manually curated gene sequences. It includes information
about exon locations.
1. Go to vega.sanger.ac.uk
2. Select human, mouse, dog, or zebra fish as the species of interest.
3. At the top-right corner of the web page, in the field next to the Find dropdown
list, enter a gene identifier, such as gene name, gene ID, or accession number, then
click
.
4. When the results are returned, click the link for the gene of interest.
Information about the gene is displayed in a table in the Curated Locus Report.
66
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Find exon information using the Vertebrate Genome Annotation Database
B
5. In the Curated Locus Report, click Transcript info for the sequence of interest.
In the Vega Transcript Report, the cDNA sequence is displayed with the exons
shown in alternating blue and black text.
Custom TaqMan® Assays Design and Ordering Guide
67
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Find exon information using the Vertebrate Genome Annotation Database
6. From Show the following features, select one or more target positions (for gene
expression assays), then click
.
7. After you select targets, identify and mask any repeats and polymorphisms in
your sequence (see the next section “Mask sequence repeats”) and “Detect and
mask nontarget sequence polymorphisms” on page 73).
68
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Mask sequence repeats
B
Mask sequence repeats
RepeatMasker is a program that screens DNA sequences for interspersed repeats and
low-complexity. The output is a detailed annotation of the repeats in the query
sequence as well as a modified version of the query sequence in which all the
annotated repeats have been masked.
Sequence format requirements
You can enter one sequence at a time or multiple sequences (in a batch).
The format for the sequence should be:
Note: FASTA format – “>”, followed by one description line, with the sequence
on the following line.
RepeatMasker does not allow SNPs marked with brackets. If your sequence has
SNPs, you must remove the brackets and convert the bases to the corresponding
IUPAC ambiguity code before submitting the sequence to search.
Procedure
1. Go to www.repeatmasker.org, then under Services, click RepeatMasking.
Custom TaqMan® Assays Design and Ordering Guide
69
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Mask sequence repeats
2. In the web page that appears, enter your sequence into the form on the web page
by:
• Copying and pasting your sequence.
or
• Uploading it from a file.
3. Select the appropriate source of your DNA from the DNA source list.
Note: The default genome library is Human. Because interspersed repeats
are species-specific, be sure to select the appropriate repeat library to
search.
4. To display the results of the search in your web browser, select html for Return
Format and Return Method.
5. Click Submit Sequence.
Evaluate RepeatMasker results
The RepeatMasker results are displayed as:
• A summary of the types of repeats found
• A table annotating the masked sequences
• The masked sequence
Note: The results shown below are from the Web service RepeatMasker.
70
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Mask sequence repeats
B
Examples of
summary of the
types of repeats
found
Example of a table
annotating the
masked sequences
Custom TaqMan® Assays Design and Ordering Guide
71
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Mask sequence repeats
The masked sequence
The search returns the submitted sequence with all low-complexity sequences
replaced with Ns, so that the returned sequence is the same length as the original.
Figure 4 Masked sequence from the RepeatMasker “Masked File”
You can copy the masked sequence directly from the results and use it for other
searches or paste the masked sequence into the Custom TaqMan® Assay Design Tool
or into File Builder software.
72
Custom TaqMan® Assays Design and Ordering Guide
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Detect and mask nontarget sequence polymorphisms
B
Detect and mask nontarget sequence polymorphisms
The dbSNP database is one of many repositories for both single-base nucleotide
substitutions and short-deletion and insertion polymorphisms in human DNA. You
can detect nontarget SNPs in your sequence by running a BLAST® search against the
dbSNP database.
To search for sequence polymorphisms in dbSNP:
1. Go to: www.ncbi.nlm.nih.gov/SNP/snp_blastByOrg.cgi
2. In the Program dropdown list, select blastn.
3. For Use Megablast, select Yes.
4. Choose the appropriate species.
5. In the query field, enter the masked sequence from RepeatMasker, in FASTA
format.
6. Click Submit Query.
7. In the page that opens, specify the options for formatting your results.
8. Click View Report, then wait for the results to appear.
Custom TaqMan® Assays Design and Ordering Guide
73
B
Appendix B Bioinformatics Tools for Evaluating Target Sequences
Detect and mask nontarget sequence polymorphisms
Evaluating dbSNP BLAST database results
The output is similar to BLAST® database results described in “Evaluating BLAST
database results” on page 60: a graphical display of matches to the query sequence, a
list of sequences producing significant alignments to your query, and the actual
sequence alignments.
The alignments from dbSNP are slightly different from those in the previous BLAST
database search. In the dbSNP results, the matching bases in the sequence from the
database are not shown. Only the mismatching bases or gaps are shown, in red text.
Figure 5 Sequence alignment output from a BLAST database search of the dbSNP
database
Look for mismatches in the alignments to identify documented SNPs. Mask these
SNPs in your target sequence by changing the bases to “N” so that no primer or
probe is designed using the SNPs. If the mismatching bases in the sequence from the
database (“Sbjct”) are A, C, G, T or N, the mismatch is simply a sequence mismatch,
not a documented SNP.
74
Custom TaqMan® Assays Design and Ordering Guide
APPENDIX C
Using File Builder Software
C
Overview
About File Builder Software
After qualifying your sequence of interest, you can format the sequence information in
a submission file. When the submission file is formatted correctly, the Custom
TaqMan® Assays Design Pipeline can use the file to design the applicable primers and
probes.
File Builder software has a wizard that guides you through the process of creating a
submission file, minimizing your effort and ensuring that the file is correctly
formatted.
Workflow
Using File Builder Software in the design and ordering process involves these
procedures:
1. Create the submission file (page 76).
2. Validate the format (page 77).
3. Send the file to Applied Biosystems:
• Import the file into the Custom Assay Design Tool (page 80).
• Send the file using File Builder software (page 80).
• Email the file (page 81).
or
• Send a copy of the file by regular or express mail (page 82).
Custom TaqMan® Assays Design and Ordering Guide
75
C
Appendix C Using File Builder Software
Create the submission file
Create the submission file
Obtain File Builder software
Applied Biosystems supplies free software that helps you prepare and format your
submission file and submit your order. To obtain File Builder software for Macintosh®
or Windows® operating systems:
1. Go to www.appliedbiosystems.com/filebuilder.
2. In the Software column, click the icon for the type of computer you are using,
either PC or MAC.
3. After you save the software to your computer, double-click the File Builder icon
and follow the instructions to install the program.
Create the submission file
1. Start the File Builder software.
2. In the File Builder main menu, click Build New File using the Wizard, then
follow the Wizard to create, validate, and save your submission file.
76
Custom TaqMan® Assays Design and Ordering Guide
Appendix C Using File Builder Software
Validate the format
C
Validate the format
Validate the format
If you created your submission file manually without using the File Builder Software,
verify that your file is correctly formatted before you send it.
1. Start the File Builder software.
2. In the File Builder main menu, select Open/Validate an Existing File.
Submission file contents
Each submission file that you create must have:
• A header line
• One or more sequence record lines
Submission file examples
In the examples below, the header line and sequence records are labeled and the
sequences are shortened for display purposes.
Example for SNP
genotyping
submission files
Sequence records
Header line
SNP target site
>John Smith 999 786 5432 part number 4332072 smith@yourSNP.com
seq_00001 AGT...GAA[A/G]CGGATAAGTGCACTC[G/T]CTG...ACC 1=s33g,2=s33t
seq_00001 AGT...GAACGAGATAGGAAGCAAC[TC/CT]GAAT...CCC 1=sn1f
seq_00002 GAG...TGGAGCAACA[TAGC/*]GCTTTCCGCAATT...TAC 1=34d
Indel site
Sequence
Sequence name
MNP site
Target
Example for gene
expression
submission files
Sequence records
Header line
>John Smith 999 786 5432 part number 4332079 smith@yourgx.com
seq_000004 AGT...GAACGAGATAGGCAGCTCCTGCCCCATCC...AAG 13=m13,20=txyz
seq_000005 TTA...CGGCCCTGAGGGGGACGAATCGAGTATCATTT...TCT 15=tryk
seq_000005 TTA...CGGCCCTGAGGGGGACGAATCGAGTATCATTT...TCT ANY=ANY
Sequence name
Sequence
Custom TaqMan® Assays Design and Ordering Guide
Target
77
C
Appendix C Using File Builder Software
Validate the format
Submission file format requirements
The table below shows the format requirements for each element of a submission file.
IMPORTANT! If the submission file is not formatted properly, the Custom
TaqMan® Assays Design Pipeline cannot process your order.
Table 1 Submission file format requirements
Element
File
Format requirements
Contains:
• A header line
• A sequence record for each assay
• Sequences for only one part number (only SNP assays or gene
expression assays and only one scale)
Header line
• Is the first line of the file.
• Starts with a greater-than symbol (>).
• Has a name, a telephone number, one part number, and an email
address.
• Has no more than 255 characters.
• Has no letters with diacritics, such as umlauts or accents.
• Ends with a carriage return.
Each
sequence
record
• Exists as a single line.
• Has a sequence name, a sequence, and at least one target.
• Has only two spaces: one after the sequence name and one after the
sequence.
• Has no spaces within the record name, sequence, or target.
• Ends with a carriage return.
Each
sequence
name
• Has no more than 10 characters.
• Uses only alphanumeric, underscore, hyphen, and period characters.
• Has no spaces or tabs.
• Does not begin with a hyphen.
Each
sequence
• Is presented in the 5´ to 3´ orientation.
• Has 61 to 5000 characters for gene expression sequences and 100 to
5000 characters for SNP assay sequences (at least 40 bases on either
side of the SNP).
• Has no line numbering, spaces, tabs, or line breaks.
• Consists of only the characters A, C, G, T, or N, except where SNP or
indel target sites are marked.
78
Custom TaqMan® Assays Design and Ordering Guide
Appendix C Using File Builder Software
Validate the format
Element
Each
sequence
(SNP
genotyping
assays)
C
Format requirements
• SNP target site of interest:
– Is marked with square brackets.
– Has the bases for two alleles of the SNP, separated by a forward
slash.
• MNP target site of interest:
– Is marked with square brackets.
– Has 1 to 6 bases to the left of the forward slash and 1 to 6 bases to
the right of the forward slash. (The number of bases on each side of
the slash does not have to be the same.)
• Indel target site of interest:
– Is marked with square brackets.
– Has 1 to 6 bases to the left of a forward slash and an asterisk to the
right of the forward slash.
• Targets listed in 5' to 3' order if multiple targets are present.
Each target
(gene
expression
assays)
Has:
• A target position, equals sign, and target site name
• A target position that indicates the base position of the target site from
the 5´ end
• A target site name with no more than four alphanumeric characters
• Commas to separate multiple targets
• No spaces or tabs
• No Ns within five bases of the target position
• Targets listed in 5' to 3' order if multiple targets are present
IMPORTANT! At least one target is included in each sequence
record. For sequences without specific target sites, you can use
“any” for the target position and target name and the Custom
TaqMan® Assays Design Pipeline will design the assay.
Each SNP
(SNP
genotyping
assays)
Has:
• A SNP number, equals sign, and name
• A target position that indicates the order of the SNP target site from the
5´ end
• A SNP name with no more than four alphanumeric characters
• Commas to separate multiple sites
• Its sequence presented in 5´ to 3´ order
• No spaces or tabs
• No Ns within two bases of the SNP
• No other SNPs within two bases
Submission
file
• Is saved as a text-only document.
• Has the extension .txt.
• Has a file name with no more than 12 alphanumeric characters.
Custom TaqMan® Assays Design and Ordering Guide
79
C
Appendix C Using File Builder Software
Send the sequence information to Applied Biosystems
Send the sequence information to Applied Biosystems
Ways to submit the file
After you create your submission file and verify that it is formatted properly, send the
submission file to Applied Biosystems:
• Import the file into the Custom TaqMan Assay Design Tool.
• Send the file using File Builder software.
• Email the file to Applied Biosystems.
or
• Send a copy of the file via regular or express mail.
Note: For volume discounts and predefined purchasing agreements, speak
with your Applied Biosystems sales representative before submitting your
order.
Import the file into the Custom Assay Design Tool
You can import the sequence information from the submission file into the Custom
TaqMan® Assay Design Tool. Using the tool, you can submit the imported sequence
information for custom designs.
To use the Custom TaqMan® Assay Design Tool:
• See page 20 for Custom TaqMan® SNP Genotyping Assays.
• See page 33 for Custom TaqMan® Gene Expression Assays.
Send the file using File Builder software
You can use File Builder software to submit the file and place an order over the
internet. You must have an account at the Applied Biosystems Store to place an order.
For your convenience, the File Builder Software contains a link to the
Applied Biosystems web site where you can create an account.
1. After you save your file in File Builder software, click Add Current File to
Shopping Basket.
2. In the Applied Biosystems Store dialog box, enter your User ID and Password,
then click OK to start the file upload and place the order in your shopping basket:
80
Custom TaqMan® Assays Design and Ordering Guide
Appendix C Using File Builder Software
Send the sequence information to Applied Biosystems
C
Note: If you do not have an account, click the click here link in the dialog
box. Your web browser opens the Applied Biosystems web site where you
can create an account. Enter the required information, click Continue, then
return to the Applied Biosystems Store dialog box in File Builder software.
When the upload is complete, a message is displayed.
3. Click the link in the message to go to the Applied Biosystems Store.
4. In the Applied Biosystems Store, log in, navigate to the shopping basket, enter
any required billing and contact information, then place the order.
Email the file
1. Address the message:
• For orders to North America: orders@appliedbiosystems.com
• For orders to Europe: assays.europe@appliedbiosystems.com
• For other regions, contact your local Applied Biosystems office or visit: http:/
/www.appliedbiosystems.com/support/contact
2. In the subject line, type Custom TaqMan Assay Order.
3. In the message body type the:
• Order information – The submission file name and the part number listed in
the header line of the submission file.
Note: If you are attaching more than one submission file, provide the
submission file name and the corresponding part number for each file.
• Purchase order number or Credit card information – Name as it appears on
the card, the card number, and the expiration date.
• Contact information – Name, email address, telephone number, and address
of the person to contact if problems occur.
• Shipping information – Name, address (including room number, building,
department, and the ATTN line), and telephone number of the person to
receive shipment.
• Invoice information – Name, email address, physical address, and
telephone number of the purchasing agent or person to receive invoice
details.
Note: To prevent delays, include all information in the message.
4. Add the submission file as an attachment to the order message.
Note: Do not drag and drop submission files into the message.
5. Send the message.
Custom TaqMan® Assays Design and Ordering Guide
81
C
Appendix C Using File Builder Software
Send the sequence information to Applied Biosystems
Send a copy of the file by regular or express mail
Note: Only predesigned assays can be ordered through the mail service.
1. Prepare an order document containing:
• Order information – The submission file name and the part number listed in
the header line of the submission file.
Note: If you are sending more than one submission file, provide the
submission file name and the corresponding part number for each file.
• Purchase order number or Credit card information – Name as it appears on
the card, the card number, and the expiration date.
• Contact information – Name, email address, telephone number, and address
of the person to contact if problems occur.
• Shipping information – Name, address (including room number, building,
department, and the ATTN line), and telephone number of the person to
receive shipment.
• Invoice information – Name, email address, physical address, and
telephone number of the purchasing agent or person to receive invoice
details.
Note: To prevent delays, include all information in the message.
2. Save a copy of the order document to a CD-ROM.
3. Send the CD containing your order document to the appropriate address:
Location
82
Address
Telephone number
North
America
Applied Biosystems
Attn: Genomic Assays (Order Administration)
850 Lincoln Centre Drive
Foster City, CA 94404
+1.800.327.3002
Europe
Applied Biosystems-UK
Attn: Genomic Assays (Order Administration)
Lingley House
120 Birchwood Boulevard
Warrington, Cheshire WA3 7QH
United Kingdom
Within UK:
Japan
Applied Biosystems-Japan
Attn: Genomic Assays (Order Administration)
4-5-4 Hacchobori
Chuo-ku, Tokyo
Japan, 104-0032
+81.03.5566.6100
Other
regions
Contact your local Applied Biosystems office or visit
www.appliedbiosystems.com/support/contact
0.1925.825650
Outside UK:
+44.1925.825650
Custom TaqMan® Assays Design and Ordering Guide
APPENDIX D
Troubleshooting
D
This appendix gives detailed instructions for determining the reason that an assay
failed design or manufacturing.
Assay failed design
Gene Expression and SNP Genotyping Assays can fail design for two reasons:
• An input sequence is too short
• An input sequence is overmasked
Short sequence
The input sequence is too short for the software to place primers and probes for a good
assay design. Low-complexity sequences are short input sequences (example:
CCTCCACTCCTCTCCACCTCTCC).
Solution
Extend the length of your input sequence to 150 bp both upstream and downstream of
the target site if possible. The total sequence length should be approximately 300 bp.
Overmasking
The input sequence is overmasked and does not provide sufficient unmasked
sequence for the software to place primers and probes for a good assay design.
Solution
If your input sequence has too many Ns because of masking with the RepeatMasker,
extend the length of your input sequence or unmask those regions with less homology.
Custom TaqMan® Assays Design and Ordering Guide
83
D
Appendix D Troubleshooting
Assay failed manufacturing
Assay failed manufacturing
SNP genotyping assays
If an SNP Genotyping Assay failed manufacturing, choose another nearby SNP.
Search the dbSNP
database
To choose alternate SNPs for assays, select an SNP close in proximity to your original
SNP. You can search the National Center for Biotechnology Information (NCBI) dbSNP
database by chromosome and position to retrieve SNPs upstream and downstream
from your original SNP.
1. Go to: www.ncbi.nlm.nih.gov/sites/entrez?db=snp
2. Click the Limits tab on the dbSNP search page.
3. Select the species and desired chromosome.
4. Enter the range of desired base positions in the search field.
84
Custom TaqMan® Assays Design and Ordering Guide
Appendix D Troubleshooting
Assay failed manufacturing
Use SNPbrowser™
software
D
Before you submit your sequence to Applied Biosystems for a custom design, use the
alternate SNP IDs for your human or mouse targets to search the Applied Biosystems
website for available predesigned TaqMan® SNP Genotyping Assays.
Use SNPbrowser™ Software for human assays
Select human assays with the free SNPbrowser™ software:
marketing.appliedbiosystems.com/mk/get/
snpb_landing?isource=fr_E_RD_www_allsnps_com_snpbrowser
• Search by chromosome and base range.
• Visualize existing SNP assays in the target region.
• Search by SNP or gene ID.
Figure 6 Search for SNPs by chromosome and base position in SNPbrowser™ Software
For an introduction to the SNPbrowser™ software, refer to the Applied Biosystems
product bulletin SNPbrowser™ Software v3.5: A Free Software Tool for the KnowledgeDriven Selection of SNP Genotyping Assays (Stock #127PB10-03).
Use Mouse SNPbrowser™ Software for mouse assays
Select mouse assays with the free Mouse SNPbrowser™ software:
marketing.appliedbiosystems.com/mk/get/
MOUSESNPBROWSER_LANDING?isource=fr_E_www.allsnps.com/
mousesnpbrowser_041107
Custom TaqMan® Assays Design and Ordering Guide
85
D
Appendix D Troubleshooting
Assay failed manufacturing
Gene expression assays
If a gene expression assay failed manufacturing, select a different target site or
multiple target sites.
Available species
If you are working with one of the following species, check the Applied Biosystems
website to find out if an assay of interest is available:
Note: Visit the Applied Biosystems website for a current list of species
(www.appliedbiosystems.com).
• Arabidopsis thaliana (Arabidopsis)
• Bos taurus (Cow)
• Caenorhabditis elegans (C. elegans)
• Canis familiaris (Dog, canine)
• Cavia porcellus (Guinea Pig)
• Danio rerio (Zebrafish)
• Drosophila melanogaster (Fruit Fly)
• Equus caballus (Horse)
• Gallus gallus (Chicken)
• Glycine max (Soybean)
• Homo sapiens (Human)
• Macaca mulatta (Macaque, rhesus)
• Mus musculus (Mouse)
• Oryctolagus cuniculus (Rabbit)
• Oryza sativa (Rice)
• Rattus norvegicus (Rat)
• Schizosaccharomyces pombe (Fission Yeast)
• Sus scrofa (Pig)
• Xenopus tropicalis (Frog)
For more
information
86
For more information on ordering TaqMan® Gene Expression Assays, refer to the
Online Ordering Guide for TaqMan® Gene Expression Assays (Stock #127MI07-05) or the
Online Selection Guide for TaqMan® Gene Expression Assays (Stock #127GU08-01).
Custom TaqMan® Assays Design and Ordering Guide
Documentation and Support
Related documentation
The following related documents are shipped with the system:
Document
Part number
TaqMan® Gene Expression Assays Protocol
4333458
TaqMan®
4401212
Gene Expression Assays Quick Reference Card
Note: For additional documentation, see “Obtaining support” below.
Obtaining support
For the latest services and support information for all locations, go to:
www.appliedbiosystems.com
At the Applied Biosystems web site, you can:
• Access worldwide telephone and fax numbers to contact Applied Biosystems
Technical Support and Sales facilities.
• Search through frequently asked questions (FAQs).
• Submit a question directly to Technical Support.
• Order Applied Biosystems user documents, SDSs, certificates of analysis, and
other related documents.
• Download PDF documents.
• Obtain information about customer training.
• Download software updates and patches.
Custom TaqMan® Assays Design and Ordering Guide
87
Part Number 4367671 Rev. F 07/2010
Applied Biosystems
850 Lincoln Centre Drive | Foster City, CA 94404 USA
Phone 650.638.5800 | Toll Free 800.345.5224
www.appliedbiosystems.com
Technical Resources and Support
For the latest technical resources and support information
for all locations, please refer to our Web site at
www.appliedbiosystems.com/support