Cellular Biology
Ca2ⴙ Channel Modulation by Recombinant Auxiliary ␤
Subunits Expressed in Young Adult Heart Cells
Shao-kui Wei, Henry M. Colecraft, Carla D. DeMaria, Blaise Z. Peterson, Rui Zhang,
Trudy A. Kohout, Terry B. Rogers, David T. Yue
Abstract—L-type Ca2⫹ channels contribute importantly to the normal excitation-contraction coupling of physiological
hearts, and to the functional derangement seen in heart failure. Although Ca2⫹ channel auxiliary ␤1– 4 subunits are among
the strongest modulators of channel properties, little is known about their role in regulating channel behavior in actual
heart cells. Current understanding draws almost exclusively from heterologous expression of recombinant subunits in
model systems, which may differ from cardiocytes. To study ␤-subunit effects in the cardiac setting, we here used an
adenoviral-component gene-delivery strategy to express recombinant ␤ subunits in young adult ventricular myocytes
cultured from 4- to 6-week-old rats. The main results were the following. (1) A component system of replicationdeficient adenovirus, poly-L-lysine, and expression plasmids encoding ␤ subunits could be optimized to transfect young
adult myocytes with 1% to 10% efficiency. (2) A reporter gene strategy based on green fluorescent protein (GFP) could
be used to identify successfully transfected cells. Because fusion of GFP to ␤ subunits altered intrinsic ␤-subunit
properties, we favored the use of a bicistronic expression plasmid encoding both GFP and a ␤ subunit. (3) Despite the
heteromultimeric composition of L-type channels (composed of ␣1C, ␤, and ␣2␦), expression of recombinant ␤ subunits
alone enhanced Ca2⫹ channel current density up to 3- to 4-fold, which argues that ␤ subunits are “rate limiting” for
expression of current in heart. (4) Overexpression of the putative “cardiac” ␤2a subunit more than halved the rate of
voltage-dependent inactivation at ⫹10 mV. This result demonstrates that ␤ subunits can tune inactivation in the
myocardium and suggests that other ␤ subunits may be functionally dominant in the heart. Overall, this study points to
the possible therapeutic potential of ␤ subunits to ameliorate contractile dysfunction and excitability in heart failure.
(Circ Res. 2000;86:175-184.)
Key Words: Ca2⫹ channel 䡲 ␤ subunit 䡲 adenovirus 䡲 gene delivery
oltage-gated L-type Ca2⫹ channels provide the essential
trigger Ca2⫹ that initiates excitation-contraction coupling in heart.1 Not only do these channels figure prominently
in the normal functioning of the heart, there are tantalizing
hints that L-type channels contribute importantly to the
functional derangement of heart failure2,3 that includes prolonged action-potential durations (APDs)4 – 6 and depressed
contractility.4,7 These dysfunctional properties can contribute
to arrhythmogenesis and pump failure.8 For example, in
pacing-induced canine heart failure, a major causative factor
in APD prolongation appears to be blunted L-type channel
inactivation, perhaps secondary to altered intracellular Ca2⫹
dynamics playing through Ca2⫹-dependent inactivation.9,10 In
human heart failure, single-channel work raises the possibility of spatial heterogeneity in channel open probability (Po),
with readily opened channels located superficially, and
V
low-Po channels situated deep in t-tubules.11 Such spatial
heterogeneity could explain the decline of excitationcontraction coupling gain12,13 that may underlie the contractile depression in heart failure.
However, fundamental deficits in our basic understanding
of L-type channels hinder definitive evaluation of how these
channels contribute to the (patho-) physiology of the heart.
Among the more salient deficiencies is the lack of information about the role of Ca2⫹ channel auxiliary ␤ subunits in
actual heart cells. Although L-type channels are heteromultimers of at least 3 different subunits (␣1C, ␤, and ␣2␦), and the
pore-forming ␣1C subunit specifies basic channel characteristics, the auxiliary ␤ subunits are arguably the most powerful
modulators of expression, open probability, activation, and
inactivation.14 –16 So far, 4 genes encoding ␤1– 4 subunits have
been identified, along with multiple splice variants.17 Differ-
Received September 15, 1999; accepted October 18, 1999.
From the Program in Molecular and Cellular Systems Physiology (S.-k.W., H.M.C., C.D.D., B.Z.P., R.Z., D.T.Y.), Departments of Biomedical
Engineering and Neuroscience, Johns Hopkins University School of Medicine, Baltimore, Md; Department of Medicine (T.A.K.), Howard Hughes
Medical Institute, Duke University, Durham, NC; and Department of Biochemistry and Molecular Biology (T.B.R.), University of Maryland School of
Medicine, Baltimore, Md.
This manuscript was sent to Michael R. Rosen, Consulting Editor, for review by expert referees, editorial decision, and final disposition.
Correspondence to David T. Yue, MD, PhD, Ross Building, Room 713, Johns Hopkins University School of Medicine, 720 Rutland Ave, Baltimore,
MD 21205. E-mail dyue@bme.jhu.edu
© 2000 American Heart Association, Inc.
Circulation Research is available at http://www.circresaha.org
175
176
Circulation Research
February 4, 2000
ent ␤ subunits impart distinctive patterns of channel expression and function,18 and therefore possess enormous potential
for in vivo tuning of channel behavior. A major shortcoming
in understanding the biological role of ␤ subunits is that
current knowledge draws almost exclusively from heterologous expression of recombinant subunits in model systems.
Such systems may differ from cardiocytes, given the possible
existence of as-yet-unknown regulatory molecules,19 anchoring proteins,20 and post-translational modification in native
heart.21 For example, in presynaptic termini, Ca2⫹ channel
inactivation may be different from that in heterologous
systems, as interactions with SNARE complex proteins22
(present at terminals) alters inactivation.23
Here, we therefore investigated the effects of expressing
recombinant ␤ subunits in ventricular myocytes cultured
from young adult rats. To our knowledge, these experiments
are the first to transfect foreign genes in young adult
myocytes using an adenoviral-component gene-delivery
method24 and to characterize ␤-subunit modulation in native
heart cells. Although gene delivery proved more difficult in
young adult rather than neonatal heart cells, we emphasized
the older myocyte platform as a prelude to future experiments
concerned with adult heart failure models.9,25 Neonatal heart
cells have immature variants of L-type Ca2⫹ channels,26 –28
excitation-contraction coupling,29 and sarcomeric structure.30
After optimization of the adenoviral-component method, we
observed that expression of ␤ subunits alone induced a large
increase in L-type current density, despite the heteromultimeric composition of Ca2⫹ channels. ␤ subunits could also
strongly modulate inactivation rate in the native setting.
These findings raise the possibility that gene delivery of ␤
subunits could counter contractile depression and excitability
disorders in diseased hearts.
Materials and Methods
Adult Rat Heart Cell Isolation and Culture
The methods for cell isolation and culture have been described
previously.31 Briefly, hearts was excised from young adult (4 to 6
weeks old) Sprague-Dawley rats, and ventricular heart cells were
dispersed enzymatically. After centrifugation through a discontinuous Percoll gradient, ⬇80% rod-shaped cells were usually obtained.
Myocytes were cultured relatively sparsely at a density of 50 000 to
80 000 cells per mL on laminin-coated coverslips, in medium 199
(containing, in mmol/L, sodium bicarbonate 26 and HEPES 25 as
buffers, glucose 5.6, acetate 0.6, and amino acids as metabolic
substrates), which was supplemented with (in mmol/L) carnitine 5,
creatine 5, and taurine 5, and (in ␮g/mL) penicillin 100, streptomycin 100, and amphotericin 0.25. Cultures were equilibrated with 5%
CO2/95% air at 37°C. As reported previously by others,32 using
similar culture conditions, we observed little change in L-type
channels over 4 to 5 days in culture.
Vectors for Transfection
Transfection of green fluorescent protein (GFP) alone was accomplished with an expression plasmid containing a cytomegalovirus
(CMV) promoter driving “enhanced GFP,” pEGFP (Clontech). The
rat ␤2a-N-GFP construct (Figure 3B) was created by polymerase
chain reaction (PCR) amplification of approximately the first one
third of the coding region of rat ␤2a,33 so as to place a BglII site
immediately before the second amino acid codon of rat ␤2a. The
upstream and downstream primers for PCR amplification were,
respectively, AAGATCTCAGTGCTGCGGGCTGGTA and GACCTCATACCCCTTCAG. This PCR fragment was ligated into rat
␤2a/pGW33 by BglII and ApaI sites. The entire resulting coding
region was then transferred into pEGFP-C1 (Clontech) by BglII and
EcoRI sites. The rat ␤2a-C-GFP construct (Figure 3C) was created by
ligating the PCR-amplified coding region of rat ␤2a33 into BglII and
PstI sites of pEGFP-N3 (Clonetech). The upstream and downstream
primers for PCR amplification were, respectively, AAGATCTATGGACAGTGGCCGTGAC and TCTGCAGATTGGCGGATGTATACATCCCT. The rat ␤3-N-GFP construct (Figure 3D) was
created by PCR amplification of approximately the first one half of
the coding region of rat ␤3,35 so as to place a BglII site immediately
before the second amino acid codon of rat ␤3. The upstream and
downstream primers for PCR amplification were, respectively,
AAGATCTTATGACGACTCCTACGTG and GCCAGTGAGGTCTTGGCT. This PCR fragment was ligated into rat ␤3/pGW35 by
BglII and NheI sites. The entire resulting coding region was then
transferred into pEGFP-C1 (Clontech) by BglII and EcoRI sites. Pfu
polymerase (Stratagene) was used in PCR reactions to increase
fidelity, and the region between cloning sites in final products was
verified by thermocycle sequencing.
The mammalian expression vector pCGI(GFP-IR) (provided by
Drs David Johns and Eduardo Marbán, Johns Hopkins University,
Baltimore, Md) was used as the base for the biscistronic vector, rat
␤2a-IR-GFP (Figure 4A). The vector contains a CMV promotor,
followed by a gene encoding enhanced GFP (EGFP), then an internal
ribosomal entry site (IRES) from encephalomyocarditis virus, a
multiple cloning site, and poly A region. The rat ␤2a-IR-GFP
construct was created by nondirectional ligation of cDNA encoding
the rat ␤2a subunit33 into the EcoR1 site of pCGI(GFP-IR), which
was just downstream from the IRES. The final product was verified
by diagnostic restriction enzyme digests.
For transfection with the adenoviral-component system, all cDNA
constructs were purified by CsCl centrifugation. Transfection rates
were considerably lower for cDNAs purified by anion-exchange
resins (Qiagen), possibly because supercoiled plasmid DNA is
required for proper complexation of component elements.
Adenovirus Preparation and Storage
High-quality, replication-deficient human adenovirus (type 5 mutant
Ad5dl312) was critical to transfection efficiency by the adenoviralcomponent system. We propagated adenovirus in complementing
cells (HEK 293) cells and then purified virus as previously described.24 Briefly, we infected confluent HEK 293 cells grown in
15-cm plates with ⬇5 ␮L adenoviral stock solution (1012 to 1013 viral
particles per mL in 10 mmol/L Tris-HCl buffer as described below).
About 20 plates were processed per preparation. After ⬇48 hours,
cells from all plates were harvested as a pellet and resuspended in 20
mL of buffer containing (in mmol/L) Tris-HCl 10, MgCl2 1, and
CaCl2 1 (pH 8.0). Cells were lysed by 5 freeze-thaw cycles, and then
cellular debris was pelleted by centrifugation. The virus-laden
supernatant was then subjected to 1-hour density-gradient ultracentrifugation with CsCl step gradients of 1.25, 1.33, and 1.45 g/mL.
The viral band was collected and subjected to overnight ultracentrifugation in 1.33 g/mL CsCl. The viral band was again collected and
subjected to a further 4-hour ultracentrifugation in 1.33 g/mL CsCl.
The now-pure viral band was collected and dialyzed against the
Tris-HCl buffer described above. After dialysis, glycerol was added
to a final concentration of 10% (vol/vol), and the viral stock solution
was stored at ⫺80°C. Resulting adenoviral stock solutions contained
1012 to 1013 particles per mL with a ⬇30:1 particle/plaque-forming
unit ratio. Stocks were stored for 4 to 6 months at ⫺80°C without
degradation of transfection efficiency. With increasing storage time,
the transfection efficiency declined appreciably.
Transfection of Heart Cells Using
Adenoviral-Component System
Transfections were performed on cells that had been cultured for 1
day. An adenoviral-component mixture was used, which was composed of replication-deficient adenovirus (prepared as above), polyL-lysine (molecular weight 34 000 to 48 000, Sigma), and expression
plasmids. The transfection procedure was similar to that described
Wei et al
previously,24 with modifications as noted below. Briefly, ⬇2 to 20
␮L of Ad5dl312 virus stock (1012 to 1013 viral particles per mL in
10 mmol/L Tris-HCl stock solution described above) was combined
with 14 ␮L poly-L-lysine stock (33 ␮g/mL) and diluted in medium
199 to a final volume of ⬇267 ␮L, resulting in final concentrations
of ⬇8⫻1010 viral particles per mL and ⬇1.7 ␮g/mL poly-L-lysine.
After a 30-minute incubation at room temperature, 0.7 ␮L of plasmid
DNA stock (1 ␮g/␮L in water) was added to the mixture, yielding a
final DNA concentration of ⬇2.5 ␮g/mL. This mixture was then
incubated for another 30 minutes. Another aliquot of poly-L-lysine
stock solution (⬇10 ␮L) was added, resulting in a final poly-L-lysine
concentration of ⬇2.5 ␮g/mL. This mixture was subsequently
incubated for another 10 minutes. Medium 199 (275 ␮L) was then
added, resulting in a total volume of 550 ␮L, with final component
concentrations of ⬇4⫻1010 viral particles per mL, ⬇1.25 ␮g/mL
poly-L-lysine, and ⬇1.25 ␮g/mL plasmid DNA. Transfection was
then initiated by replacing the culture medium with 250 ␮L of this
transfection mixture per 17-mm-diameter well. After a 3-hour
incubation at 37°C, the reaction was slowed by addition of 3 times
volume of medium. This dilution prevents the damage sometimes
observed with prolonged exposure to full-strength component mixture. Cells were cultured in medium, as described above, for ⬇72
hours before further analysis.
Transfection of HEK 293 Cells
HEK 293 cells were cultured and transfected by Ca2⫹ phosphate
precipitation as previously described.37 CMV expression plasmids
encoding ␣1C, ␣2␦, and various ␤-subunit constructs (10 ␮g each)
were used per 10-cm plate.
Electrophysiology
Whole-cell recordings were obtained at 20 to 22°C using standard
patch-clamp techniques. The external solution contained
(in mmol/L) N-methyl-D-glucamine (NMG) aspartate 155, HEPES
10, 4-aminopyride 10, EGTA 0.1 (pH 7.4 with NMG), with Ba2⫹ 10
as charge carrier. The internal solution contained (in mmol/L)
cesium methanesulfonate 150, CsCl 5, HEPES 10, EGTA 10, MgCl2
1, MgATP 4 (pH 7.2 with CsOH), and 0.5 ␮mol/L ryanodine
(Calbiochem). Internal and external solutions described above were
adjusted to 280 to 300 mOsm as required. The use of Ba2⫹ as charge
carrier, together with ryanodine in the internal solution, ensures that
L-type current kinetics reflected voltage-dependent gating properties
of the sarcolemmal channels themselves, with no contribution from
current-dependent inactivation by divalent cation release from sarcoplasmic reticulum.38 – 40 Cells were initially bathed in Tyrode’s
solution containing (in mmol/L) NaCl 138, KCl 4, CaCl2 2, MgCl2 1,
NaH2PO4 0.33, HEPES 10 (pH 7.35 with NaOH), and glucose 10.
Pipet current was nulled in this solution before sealing and breaking
into cells. Measurements were started after ⬎10 minutes of dialysis
with the internal solution, during which time the external bath was
switched to the NMG-based solution. A junction potential of ⫺8.6
mV41 (pipet solution potential⫺external solution potential) was not
corrected for in displays and analysis. A value of ⫹8.6 mV should be
added to all reported voltages to obtain true membrane potentials.
Series resistance was typically ⬍2 M⍀ and compensated 60% to
80%. Voltage pulses (leak and test pulses) were delivered every 60
seconds, and data were typically filtered at 2 KHz and then sampled
at 10 KHz. Data are displayed and analyzed after P/8 leak subtraction. Pooled data are given as mean⫾SEM. P⬍0.05 is recorded as
significantly different. Effects of recombinant ␤ subunits in myocytes were compared with those in contemporaneous GFP
control cells.
Results
Delivery of Foreign Genes to Cultured Heart Cells
by an Adenoviral-Component System
A prerequisite step in this study was the introduction of genes
encoding Ca2⫹ channel ␤ subunits into young adult heart
cells. Delivery of plasmid DNA to adult myocytes by con-
Ca2ⴙ Channel ␤ Subunits Expressed in Heart
177
Figure 1. Time course and proposed mechanism for experiments using adenoviral-component gene transfection of cultured cardiac myocytes. A, Overall timetable of experiments. On
day 0, rat ventricular myocytes are isolated enzymatically and
placed into culture. On day 1, cultured cells are transfected with
a trinary complex of replication-deficient adenovirus, poly-Llysine, and expression plasmids encoding the genes of interest.
On days 3 to 5, expression of recombinant genes is sufficient to
perform electrophysiological experiments. Day 4 is considered
optimal in that expression is robust while heart cells remain relatively differentiated. B, Postulated mechanism of adenoviralcomponent gene-delivery system, as previously proposed.24
Replication-deficient adenovirus, poly-L-lysine, and expression
plasmid form a trinary complex, stabilized by electrostatic interactions. Virus enables receptor-mediated endocytosis of the
entire complex into myocytes, with plasmid cDNA taking a “piggyback” ride. The endolytic capabilities of the virus further facilitates eventual translocation of plasmid cDNA to the nucleus,
thereby resulting in expression of foreign genes.
ventional means, such as Ca2⫹ phosphate precipitation42 and
lipofection,43 has proven challenging,44 although there are
instances of highly successful variations of these techniques
in cultured neonatal cells.45 By contrast, recombinant adenoviral constructs can transfect adult rat and neonatal myocytes
with nearly 100% efficiency,46 but considerable time and
effort are required to produce new recombinant constructs,
and genes of interest are size-limited (⬍7 kilobases). Recently, a hybrid strategy has been introduced that combines
some of the efficiency of adenovirus-mediated transfection
with the convenience of plasmid-based strategies.24 In this
approach, cultured neonatal heart cells could be transfected
with ⬇70% efficiency, simply by application of a trinary
complex containing replication-deficient adenovirus, poly-Llysine, and expression plasmids encoding a gene of interest.
Here, we adapted the adenoviral-component gene-delivery
method to ventricular myocytes cultured from young adult
rats. Figure 1 diagrams the overall time course of the
experiments in this study, along with the proposed mechanisms underlying the transfection strategy.
Figure 2 illustrates the characteristic efficiency of gene
transfection by the adenoviral-component method in young
adult ventricular myocytes, using GFP as a reporter gene.
For baseline comparison, the top row displays brightfield
(Figures 2A and 2B) and fluorescence (Figure 2C) micrographs of ventricular myocytes that have not been transfected by the compound system. The cells were isolated
from 4-week-old rats and are shown after 4 days in culture
178
Circulation Research
February 4, 2000
1.5 to 3 hours) to full-strength component mixture. The age
of the rats used also proved to be an important parameter.
Whereas cultured rat neonatal heart cells could be transfected with high efficiency as previously reported, the
transfection efficiency appeared to decrease with increasing age of the rats, with no successful transfection in cells
from 10-week-old rats. The 4- to 6-week-old rats used here
permitted a reasonable transfection efficiency, while at the
same time demonstrating an adult-like phenotype.
Variations in the Use of GFP as Reporter of
Successful ␤-Subunit Transfection
Figure 2. Green fluorescence detection of gene delivery to cultured ventricular myocytes by the adenoviral-component system. Top row (A through C) shows photomicrographs for
untransfected myocytes, as a baseline. Bottom row (D through
F) displays photomicrographs for myocytes transfected with
GFP. A, Brightfield view (⫻400) of rat ventricular myocytes, after
4 days in culture. B, Low-power (⫻100), brightfield view of
young adult ventricular myocytes, shown after 4 days in culture
after isolation from a 4-week-old rat. C, Fluorescence image of
the same view as in panel B, using a B2A Nikon fluorescence
cube. The lack of appreciable green fluorescence indicates the
absence of confounding, endogenous fluorophore. D, Lowpower (⫻100), fluorescence image of a parallel set of cells (from
4-week-old rat), transfected with an expression plasmid encoding GFP. The image is analogous to that in panel C, but now
numerous cells manifest green fluorescence. E, High-power
(⫻400), brightfield view of different set of cells (from a 4-weekold rat) transfected with GFP. F, Same cells as in panel E, but
now under fluorescence illumination.
using previously established methods.31 The regular striations in the brightfield view, seen more clearly at higher
magnification (Figure 2A), are characteristic of the adult
phenotype. Under fluorescence illumination by blue light,
the same field of view as in Figure 2B is now dark (Figure
2C), indicating that GFP could serve as a selective reporter
gene. The bottom row shows the corresponding result in a
parallel set of cells transfected with the adenoviral compound system, using plasmids encoding GFP. Under fluorescence illumination (Figure 2D), some of the cells are
now bright green, indicating successful transfection of
GFP. Figures 2E and 2F show brightfield and fluorescence
views of a transfected cell at higher magnification. Overall, the percentage of striated cells showing green fluorescence ranged between 1% and 10%, after optimization of
transfection parameters from those used with neonatal
cells.24 The main changes in methodology involved the
ratios of component ingredients (optimized ratio, 4⫻1010
viral particles per mL:1.25 ␮g/mL polylysine:1.25 ␮g/mL
plasmid DNA) and the time of exposure (increased from
The results from the previous section indicated that a component adenoviral system could transfect foreign genes into
cultured adult heart cells, albeit with a lower efficiency (1%
to 10%) than previously found with neonatal cells (⬇70%).
Such a gene-delivery strategy would still prove useful for
patch-clamp studies if there were a convenient method for
detecting successfully transfected myocytes.
A first approach was to engineer plasmids encoding fusion
proteins of GFP to various ␤ subunits, as schematized at the
top of Figure 3. To test whether these novel constructs were
functionally active as channel ␤ subunits, and to determine
whether their properties were unchanged from those of native
subunits, we examined the characteristics of recombinant
L-type Ca2⫹ channels expressed in HEK 293 cells from
cDNAs encoding the main ␣1C subunit, the auxiliary ␣2␦
subunit, and various fusions of GFP to ␤ subunits. Figure 3A
shows the characteristic properties of L-type channels containing wild-type rat ␤2a subunits, which have been proposed
as a dominant “cardiac” isoform.33 To focus the analysis on
voltage-dependent channel gating behavior, Ba2⫹ serves as
the charge carrier, here and throughout, so as to minimize
Ca2⫹-dependent inactivation47 that would otherwise be present with Ca2⫹ as charge carrier.48,49 The exemplar current
trace (Figure 3A1) illustrates 2 important features imparted to
channels containing the rat ␤2a subunit. First, the currents are
comparatively large, because ␤ subunits help chaperone
and/or stabilize the main ␣1C subunit at the surface membrane,
as well as to enhance open probability.50 Recombinant Ca2⫹
channel currents expressed without a ␤ subunit are typically
⬎10-fold smaller than shown here.18,51 Second, voltagedependent inactivation is quite slow during the 1000-ms
depolarizing pulse. Of all the known ␤1– 4 subunits, the rat ␤2a
subunit results in the slowest inactivation.36 The population
data shown below (Figures 3A2 and 3A3, Table) entirely
confirm the two exemplar trends. Plots of average peak (F)
and residual (䡬) current as a function of voltage-step potential (Figure 3A2) corroborate the robust expression of functional channels. Moreover, the average fraction of current
remaining at the end of 1000-ms depolarizations (Figure 3A3,
r1000) is large, consistent with slow inactivation.
Figures 3B and 3C show the properties of L-type channels
containing GFP-rat ␤2a fusions, following the identical format
of Figure 3A. In both cases, the expression of current is
robust, and the overall voltage dependence of activation is
undetectably changed compared with native rat ␤2a (compare
Figures 3A2, 3B2, and 3C2). However, exemplar traces
clearly suggest that the fusion of GFP to the rat ␤2a subunit
Wei et al
Ca2ⴙ Channel ␤ Subunits Expressed in Heart
179
Figure 3. Gating properties of recombinant L-type channels expressed in HEK 293 cells from ␣1C, ␣2␦, and various ␤ subunit constructs. Top, Schematic diagrams of rat ␤2a and ␤3, along with different fusions of GFP to these ␤ subunits. A, Electrophysiological data
from HEK 293 cells transfected with ␣1C, rat ␤2a, and ␣2␦ subunits. A1, Specimen Ba2⫹ current elicited by a 1-second depolarizing pulse
to ⫹10 mV, from a holding potential of ⫺80 mV. Symbols indicate points at which peak (F) and residual (䡬) currents are measured for
plots of average behavior shown below. A2, Peak (F) and residual (䡬) currents averaged from the indicated number of cells. A3, Plots
of residual fraction of peak current after 1-second depolarization (r1000), averaged from the same cells as in panel A2. This plot provides
a measure of inactivation properties, in which faster inactivation rate corresponds to a small r1000 value. B, Electrophysiological data for
channels expressed from ␣1C, rat ␤2a-N-GFP, and ␣2␦ subunits. Format analogous to that in panel A. Dashed curve in panel B3 reproduces r1000 curve from panel A3. C, Electrophysiological data for channels expressed from ␣1C, rat ␤2a-C-GFP, and ␣2␦ subunits. Format
analogous to that in panel A. Dashed curve in panel C3 reproduces r1000 curve from panel A3. D, Electrophysiological data for channels
expressed from ␣1C, rat ␤3-N-GFP, and ␣2␦ subunits. Format analogous to that in panel A. Dashed curve in panel D3 shows average
r1000 curve averaged from n⫽5 cells expressing ␣1C, rat ␤3, and ␣2␦ subunits.
results in enhanced inactivation (compare Figures 3A1, 3B1,
and 3C1). Averaged r1000 data confirm the faster inactivation
(Figures 3B3 and 3C3, see also Table), which is obvious by
comparison with the wild-type rat ␤2a data reproduced as a
dashed curve. When GFP is fused to the N terminus of rat ␤2a
(Figure 3B), the acceleration of inactivation is greatest.
However, even with GFP fusion to the C terminus of rat ␤2a,
the enhancement of inactivation is still present (Figure 3C3).
Summary of Peak Current Density and Remaining Fraction of
Current After 300-ms Depolarization (r300) From HEK 293 Cells
Transfected With ␣1C, ␣2␦, and Various ␤-Subunit Constructs
␤-Subunit Construct
Cells, n
Peak Current Density,
pA/pF
r300
Rat ␤2a
7
⫺37.8⫾9.1
0.82⫾0.03
Rat ␤2a-N-GFP
7
⫺109.1⫾22.4*
0.58⫾0.05
Rat ␤2a-C-GFP
8
⫺58.6⫾13.6
0.76⫾0.04
Rat ␤2a-IR-GFP
Rat ␤2a-IR-GFP
(one-fifth amount)
7
⫺52.6⫾14.8
0.84⫾0.02
11
⫺59.1⫾15.9
0.79⫾0.03
Rat ␤3
5
⫺48.8⫾20.5
0.57⫾0.04
Rat ␤3-N-GFP
8
⫺19.8⫾6.2
0.68⫾0.02
Holding potential was ⫺80 mV. Test potential was ⫹10 mV.
*P⬍0.05 vs rat ␤2a.
By contrast, when GFP was fused to the N-terminus of the rat
␤3 subunit (Figure 3D, Table), inactivation was similar, or
slightly slowed compared with unfused ␤3 (Figure 3D3,
dashed curve). The faster inactivation observed with ␤3
constructs (Figure 3D) compared with the ␤2a construct
(Figure 3A) fits with prior reports that ␤3 imparts the fastest
inactivation to ␣1 subunits.36 In short, although direct fusion
of GFP and ␤ subunits would provide an efficient strategy for
identifying cells transfected with recombinant ␤ subunits, the
properties of such ␤ subunits would be somewhat different
than those of parental subunits.
To circumvent these complexities, we undertook a second
reporter gene approach using a bicistronic expression plasmid
encoding both GFP and rat ␤2a subunits (Figure 4A). Here, in the
rat ␤2a-IR-GFP construct, the CMV promoter drives transcription of a single mRNA species that encodes both GFP and rat
␤2a, punctuated by an IRES derived from encephalomyocarditis
virus.52 Although the GFP sequence is terminated by a stop
codon, the IRES nevertheless induces attachment and initiation
of a ribosomal complex just upstream of the ␤2a sequence.
Hence, the single mRNA species supports translation of separate
GFP and rat ␤2a proteins. In principle, such a construct should
give rise to an extremely tight correlation between green fluorescence and recombinant ␤ subunit expression, while at the
same time preserving native ␤-subunit properties.
180
Circulation Research
February 4, 2000
Figure 4. Functional characterization of
bicistronic expression plasmid encoding GFP
and rat ␤2a subunits in HEK 293 cells. A,
Schematic diagram showing mechanism
whereby rat ␤2a-IR-GFP plasmid gives rise to
separate GFP and rat ␤2a proteins from a single
mRNA species. CMV indicates CMV promoter;
Neo/Kan, drug-resistance genes for neomycin
and kanamycin. Poly A region is derived from
SV40 virus. B, Exemplar Ba2⫹ current (B1) and
average gating behavior (B2 and B3) for recombinant L-type channels expressed from ␣1C, rat
␤2a-IR-GFP, and ␣2␦ subunits. Format analogous to that in Figure 3B. Dashed curve in panel
C3 reproduces r1000 curve from panel A3, corresponding to channels with unfused rat ␤2a subunits. C, Data for channels expressed from ␣1C,
rat ␤2a-IR-GFP, and ␣2␦ subunits, with the
amount of transfected rat ␤2a-IR-GFP cDNA
reduced 5-fold from the usual amount (as in
panel B). Format identical to that in panel B.
Figure 4B shows the properties of recombinant L-type
channels expressed in HEK 293 cells transfected with ␣1C,
␣2␦, and rat ␤2a-IR-GFP constructs. For ease of comparison,
the format is identical to that in Figure 3. The expression of
current is robust (Figure 4B1 and 4B2), and the exemplar
trace suggests that inactivation properties are identical to
those observed with the conventional rat ␤2a construct (compare Figures 4B1 and 3A1). Detailed examination of averaged r1000 data (Figure 4B3, Table) confirms that inactivation
is no different than that observed with native rat ␤2a subunits;
the dashed curve reproduces the native subunit data from
Figure 3A3.
One final check on the rat ␤2a-IR-GFP construct concerned
the possibility that differential expression levels of ␤ subunits
could lead to different overall inactivation rates. For example,
if more than one ␤ subunit could associate with a single ␣1C
subunit, then channels with variable numbers of associated ␤
subunits could manifest different inactivation properties. In
this scenario, the spectrum of inactivation rates observed
across different rat ␤2a constructs in Figure 3A through 3C
could simply reflect variable levels of ␤ subunit expression,
rather than intrinsically distinct properties of the different
constructs. Likewise, the similar inactivation rates observed
between rat ␤2a and rat ␤2a-IR-GFP might simply reflect
matched expression levels. To exclude this possibility, we
examined the properties of recombinant L-type channels
when only one fifth the usual amount of plasmid encoding
␤2a-IR-GFP was transfected (Figure 4C). Relative reduction
of ␤2a-IR-GFP did not change channel inactivation properties,
as explicitly confirmed by the average r1000 data (Figure 4C3,
Table). Here, the averaged data from Figure 4B3 have been
reproduced as the dashed curve. These findings agree with
earlier biochemical evidence favoring a 1:1 stoichiometry of
␣1 and ␤ subunits for L-type channels15 and suggest that
different ␤-subunit constructs impart distinct inactivation
properties to L-type channels, in a manner that is insensitive
to the level of ␤-subunit expression. Even in the case of
R-type (␣1E) and P/Q-type (␣1A) channels, where there is
relatively clear biochemical evidence for multiple ␤-subunit
binding sites on the ␣1 subunit,53,54 it remains unclear whether
⬎1 ␤ binding site is functionally important.18,54 Overall, the
use of the bicistronic expression vector encoding GFP and a
␤ subunit appeared to be the reporter gene strategy that would
provide the most faithful assessment of the physiological
impact of a particular subunit in myocytes.
Ca2ⴙ Channel Modulation by Recombinant ␤
Subunits in Cultured Heart Cells
We next tested whether the various constructs encoding GFP
and ␤ subunits could actually direct recombinant ␤-subunit
expression in heart cells. The first indication that these
constructs were functionally active came from the detection
of green-fluorescent cells after adenoviral compound transfection of the various constructs, observed with an efficiency
comparable to that observed with transfection of GFP alone.
Figure 5 shows fluorescence views of heart cells transfected
with GFP alone as control (A), ␤2a-N-GFP (B), ␤3-N-GFP
(C), and ␤2a-IR-GFP (D).
Figure 5. High-power (⫻400) fluorescence micrographs of rat
ventricular myocytes expressing GFP alone as control (A), ␤2aN-GFP (B), ␤3-N-GFP (C), and ␤2a-IR-GFP (D). Cells are shown
after 4 days in culture.
Wei et al
Ca2ⴙ Channel ␤ Subunits Expressed in Heart
181
Figure 6. Increased current density for L-type
channels in ventricular myocytes overexpressing
recombinant ␤ subunits. A, Current-density waveforms averaged from multiple cells expressing
GFP alone, or various ␤-subunit constructs. Solid
curve plots the mean, and dashed curves indicate
bracketing SEM confidence range. ␤-subunit
expression clearly augments expression of functional Ba2⫹ current through L-type channels, compared with control (GFP expressed alone). B, Statistical analysis of observed increases in peak
current density (at ⫹10 mV) produced by expression of recombinant ␤ subunits. C, Averaged plots
of peak current density as a function of step
potential, for cells expressing GFP alone (䡬) or rat
␤2a-IR-GFP (F). Averages were drawn from the
indicated number of cells. These data demonstrate
that the ␤-subunit enhancement of functional Ba2⫹
current was present over a broad range of
voltages.
More telling was the strong enhancement of L-type channel current density observed in such green-fluorescent cells
(Figure 6). Compared with expression of GFP alone as
control, recombinant ␤ subunits caused pronounced amplification of current waveforms, averaged from multiple cells
(Figure 6A). The enhancement was confirmed statistically by
explicit measurements of peak current density (Figure 6B).
The effect appeared strongest for the rat ␤2a-IR-GFP construct
but was still present for every ␤-subunit construct. The
increased current density was manifest over a wide range of
step potentials, as demonstrated in multiple cells with the rat
␤2a-IR-GFP construct (Figure 6C). These findings not only
demonstrate that recombinant ␤ subunits were functionally
active, they also suggest a surprising result that can only be
posed in native heart: ␤ subunits appear to be “rate limiting”
for expression of functional Ca2⫹ channel current in native
heart cells, even though channels are composed of at least 3
subunits (␣1C, ␤, and ␣2␦). Here, we use the term rate limiting
in a functional sense, referring to a limitation either in the Po
of channels or in the number of active channels in the surface
membrane (as detailed in the Discussion).
Another important question was whether recombinant ␤
subunits would affect Ca2⫹ channel inactivation in a manner
similar to that observed in HEK 293 cells (Figures 3 and 4).
Figure 7A shows normalized current waveforms elicited by
1-second depolarizations to ⫹10 mV, after averaging across
multiple heart cells. It is evident that different constructs
produced markedly different inactivation characteristics, according to a rank order that accords with the results from
HEK 293 cells (Figures 3 and 4). The effects were statistically resolved, as shown in the bar graph summary of r1000
data from multiple cells (Figure 7B). A similar rank order of
effects was observed with analysis of the residual fraction of
current measured after 300 ms of depolarization (r300), confirming that various ␤-subunit constructs impart a generally
uniform slowing or acceleration of inactivation over the
course of 1-second depolarizations. In comparison with
control cells expressing GFP alone, it is remarkable how
slowly currents inactivated in cells overexpressing any of the
recombinant ␤ subunits: the slowing was detectable even
with the rat ␤3-N-GFP construct, but was most marked with
the putative “cardiac” isoform of the ␤ subunit (rat ␤2a-IRGFP) (Figure 7C). Given that rates of voltage-dependent
inactivation were insensitive to variable levels of ␤ subunit
expression in HEK 293 cells (Figure 4B and 4C), it is
reasonable to expect that the functionally dominant ␤ subunit
in heart is not the rat ␤2a isoform. Whatever the molecular
identity of the actual cardiac ␤ subunit turns out to be, it is
interesting that this subunit imparts an inactivation rate (GFP
control cells) that exceeds that observed with overexpression
of rat ␤3-N-GFP. In HEK 293 cells, the latter construct gives
rise to an inactivation rate similar to that of unfused ␤3, which
Figure 7. Tuning of voltage-dependent inactivation by expression of various recombinant ␤ subunits in ventricular heart cells.
A, Normalized Ba2⫹ current waveforms, averaged from multiple
cells after peak currents were rescaled to unity. Means are
shown as solid curves, and bracketing SEM confidence ranges
are indicated by dashed curves. All ␤ subunits tested produced
a slowing of inactivation rate compared with control cells
expressing GFP alone. The most striking effects were observed
with rat ␤2a-IR-GFP. B, Statistical summary of the residual fraction of peak current remaining at the end of 300-ms depolarization (r300) and at the end of 1000-ms depolarization (r1000). Data
are from step depolarizations to ⫹10 mV. The faster the inactivation rate, the smaller the value of r300 or r1000. Numbers of cells
from which averages are drawn are shown in parentheses. C,
Rat ␤2a-IR-GFP slows inactivation over a broad range of voltages, as indicated by plots of average r1000 as a function of step
potential.
182
Circulation Research
February 4, 2000
yields the fastest rate observed with the known ␤1– 4
subunits.36
Discussion
This report describes the first application of an adenoviralcomponent gene-delivery method to transfect young adult
ventricular myocytes. In addition, we established parameters
for the use of GFP to detect expression of foreign Ca2⫹
channel ␤ subunits. Fusion of GFP to ␤ subunits spared
overall subunit function, but resulted in quantitative alterations in inactivation properties. Pairing GFP with ␤ subunits
in a bicistronic gene cassette fully conserved the functional
attributes of ␤ subunits. Using these approaches, this study
provides the first observations of the effects of expressing
recombinant Ca2⫹ channel ␤ subunits in cardiac ventricular
myocytes, culture from 4- to 6-week-old rats. Previous
studies have focused on heterologous expression in model
systems. These experiments identified ␤-subunit modulatory
effects with special relevance to the native setting. In particular, the overall density of L-type channel current was
markedly enhanced by ␤-subunit expression, and voltagedependent inactivation was highly sensitive to the type of ␤
subunit that was transfected. Here we elaborate on the
implications of various ␤-subunit effects, as observed in the
actual cardiac environment.
␤ Subunits Are Rate Limiting for Expression of
Functional Ca2ⴙ Channel Current
Expression of recombinant ␤ subunits alone enhanced Ca2⫹
channel current density up to 3- to 4-fold, arguing that ␤
subunits are rate limiting for expression of L-type current in
heart. This finding is rather surprising, given the wellestablished heteromultimeric composition of L-type channels.
Although the ␣1C subunit forms the pore of the channel and
specifies overall characteristics of the channel, at least 3
subunits (␣1C, ␤, and ␣2␦) are believed to comprise native
channels,14 –16 with other as-yet-unknown subunits still possible as additional elements of the channel complex (eg,
Reference 19). One might therefore expect that coexpression
of multiple Ca2⫹ channel subunits would be required to
enhance the overall level of L-type current.
The large increase in Ca2⫹ channel currents arising from
expression of recombinant ␤ subunits alone raises several
possible scenarios for the heart, none of which are mutually
exclusive. First, recombinant ␤ subunits could associate with
␣1C subunits that are already in the surface membrane, thereby
increasing open probability of the pore via allosteric interactions favoring the open state.50 Second, new ␤ subunits may
help to translocate excess, preexisting ␣1C subunits waiting in
the Golgi complex to the surface membrane or to stabilize
such channel complexes in the cell membrane.50,55–57 Either
or both of these actions would lead to an increase in the
number of functional channels in the sarcolemma. Finally, it
is possible that gene expression of ␣1C and other subunits may
be under feedback control that senses ␤-subunit expression.
Regardless of the mechanism, the functional result that
expression of ␤ subunits alone can increase L-type current
may prove to be an important simplification for potential
gene therapy to reverse the decline in overall current density
seen in some forms of heart failure.7,58 – 62 In particular, in
failing cardiac allografts with diastolic dysfunction, downregulation of ␤ subunits has been correlated with hemodynamic defects.63 On the other hand, ␤-subunit supplementation would not be relevant to many forms of heart failure in
which there is little decline in Ca2⫹ channel current density.5,64 Compared with genes encoding ␣1C subunits (⬇7
kilobases), ␤-subunit transcripts are relatively small (1 to 3
kilobases), thereby facilitating gene delivery. Furthermore,
expression of a single foreign gene considerably simplifies
the technical challenge.
Voltage Inactivation of L-Type Channels Is Highly
Sensitive to the Type of ␤ Subunit
Another important finding is that expression of different ␤
subunits produces strikingly different rates of voltagedependent inactivation of L-type channels, as observed over
the course of 1-second depolarizations. Using heterologous
expression in HEK 293 cells, we have previously demonstrated that different ␤ subunits produce remarkably small
differences in the steady-state inactivation of L-type channels
by voltage.18 In apparent agreement, different ␤ subunits (␤1b
versus ␤2a) produce very similar rates of voltage-dependent
inactivation of recombinant L-type channels expressed in
Xenopus oocytes during several-hundred–millisecond depolarizations.65 Here, we found that ␤3 and ␤2a subunits produced very different voltage-dependent inactivation rates
during 1-second depolarization of recombinant L-type channels expressed in HEK 293 cells. Importantly, these differences in voltage-dependent inactivation were recapitulated in
heart cells transfected with different recombinant ␤ subunits.
The distinct inactivation rates observed over the span of 100
to 1000 ms are particularly relevant to specifying the APD of
heart.66 In fact, the observed variation of inactivation rates
with different ␤ subunits could be even more striking in the
native setting, if we consider that both voltage-dependent and
Ca2⫹-dependent mechanisms of inactivation are present when
Ca2⫹ serves as charge carrier.48,49 Previous studies hint that
different ␤ subunits would produce larger distinctions in the
rate of Ca2⫹-dependent versus voltage-dependent inactivation,65,67 although further work may be necessary to fully
establish these intriguing observations.
These findings hold particular pathophysiological relevance, because one of the hallmarks of heart failure is
prolongation of the action potential,4 – 6 perhaps secondary to
depressed intracellular [Ca2⫹], resulting in decreased Ca2⫹dependent inactivation of L-type channels.9,10 Alternatively, a
relative shift in the prevalence of certain ␤-subunit isoforms
could also account for altered Ca2⫹-dependent inactivation in
heart failure. In either case, this study raises the possibility
that gene expression of an appropriate ␤ subunit could rectify
the prolongation of APD attendant to some forms of heart
failure.
Identity of Genuine Cardiac-Specific ␤ Subunits
The remarkably slow inactivation rate observed on expression of the putative “cardiac” isoform of the ␤ subunit33 (rat
␤2a) suggested that other types of ␤ subunits are functionally
dominant in native rat heart. Historically, although the rat ␤2a
Wei et al
was cloned from a rat brain library, Northern blot analysis
suggested that it was also quite prevalent in heart.33 This,
however, only indicates that something quite homologous to
the rat brain ␤2a subunit is present in heart. Nonetheless, a
highly similar rabbit ␤2a subunit was cloned directly from
rabbit heart.68 Because the main differences between the rat
and rabbit ␤2a subunits were restricted to the extreme amino
terminal region, it seemed reasonable that both of these ␤2a
subunits might be found in heart. However, recent PCR
analysis, using isoform-specific primers at the amino terminus, confirmed the presence of only the rabbit ␤2a species in
rabbit myocardium but failed to detect a transcript similar to
the rat brain ␤2a in the same tissue.69
Overall, there is considerable indeterminacy in regard to
legitimate, cardiac-“specific” isoforms of ␤ subunits. Beyond
confirmation of the rabbit ␤2a species in rabbit heart, Collin et
al70 cloned ␤1 splice variants in human heart and showed
them to be dominant by Northern blot and reverse transcriptase–PCR. No ␤2 was detected. Expression of novel ␤ subunits
in heart cells will prove useful in establishing the veracity of
purported cardiac specificity.
Acknowledgments
This work was supported by the National Institutes of Health and by
fellowship support from the Maryland American Heart Association
and Falk Foundation (to S.-k.W.). We thank David C. Johns and
Eduardo Marbán for the gift of the pCGI(GFP-IR) vector, from
which rat ␤2a-IR-GFP was constructed.
References
1. Fabiato A, Fabiato F. Calcium and cardiac excitation-contraction
coupling. Annu Rev Physiol. 1979;41:473– 484.
2. Hullin R, Asmus F, Berger HJ, Boekstegers P. Differential expression of
the subunits of the human cardiac L-type calcium channel in diastolic
failure of the transplanted heart. Circulation. 1997;96(suppl I):I-55.
3. Mukherjee R, Spinale FG. L-type calcium channel abundance and
function with cardiac hypertrophy and failure: a review. J Mol Cell
Cardiol. 1998;30:1899 –1916.
4. Beuckelmann DJ, Nabauer M, Erdmann E. Intracellular calcium handling
in isolated ventricular myocytes from patients with terminal heart failure.
Circulation. 1992;85:1046 –1055.
5. Kaab S, Nuss HB, Chiamvimonvat N, O’Rourke B, Pak PH, Kass DA,
Marbán E, Tomaselli GF. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart
failure. Circ Res. 1996;78:262–273.
6. Beuckelmann DJ, Nabauer M, Erdmann E. Alterations of K⫹ currents in
isolated human ventricular myocytes from patients with terminal heart
failure. Circ Res. 1993;73:379 –385.
7. Mukherjee R, Hewett KW, Walker JD, Basler CG, Spinale FG. Changes
in L-type calcium channel abundance and function during the transition to
pacing-induced congestive heart failure. Cardiovasc Res. 1998;37:
432– 444.
8. Tomaselli GF, Beuckelmann DJ, Calkins HG, Berger RD, Kessler PD,
Lawrence JH, Kass D, Feldman AM, Marbán E. Sudden cardiac death in
heart failure: the role of abnormal repolarization. Circulation. 1994;90:
2534 –2539.
9. O’Rourke B, Kass DA, Tomaselli GF, Kaab S, Tunin R, Marbán E.
Mechanisms of altered excitation-contraction coupling in canine
tachycardia-induced heart failure, I: experimental study. Circ Res. 1999;
84:562–570.
10. Winslow R, Rice J, Jafri S, Marbán E, O’Rourke B. Mechanisms of
altered excitation-contraction coupling in canine tachycardia-induced
heart failure, II: model study. Circ Res. 1999;84:571–586.
11. Schroder F, Handrock R, Beuckelmann DJ, Hirt S, Hullin R, Priebe L,
Schwinger RHG, Weil J, Herzig S. Increased availability and open probability of single L-type calcium channels from failing compared with
nonfailing human ventricle. Circulation. 1998;98:969 –976.
Ca2ⴙ Channel ␤ Subunits Expressed in Heart
183
12. Gomez AM, Valdivia HH, Cheng H, Lederer MR, Santana LF, Cannell
MB, McCune SA, Altschuld RA, Lederer WJ. Defective excitationcontraction coupling in experimental cardiac hypertrophy and heart
failure. Science. 1997;276:800 – 806.
13. Yue DT. Quenching the spark in the heart. Science. 1997;276:755–756.
14. Perez-Reyes E, Schneider T. Calcium channels: structure, function, and
classification. Drug Dev Res. 1994;33:295–318.
15. De Waard M, Gurnett CA, Campbell KP. Structural and functional
diversity of voltage-activated calcium channels. In: Narahashi T, ed. Ion
Channels. New York, NY: Plenum Press; 1996:41– 87.
16. Walker D, De Waard M. Subunit interaction sites in voltage-dependent
Ca2⫹ channels: role in channel function. Trends Neurosci. 1998;21:
148 –154.
17. Dunlap K, Luebke JI, Turner TJ. Exocytotic Ca2⫹ channels in mammalian
central neurons. Trends Neurosci. 1995;18:89 –98.
18. Jones LP, Wei SK, Yue DT. Mechanism of auxiliary subunit modulation
of neuronal ␣1E calcium channels. J Gen Physiol. 1998;112:125–143.
19. Letts VA, Felix R, Biddlecome GH, Arikkath J, Mahaffey CL,
Valenzuela A, Bartlett FS 2nd, Mori Y, Campbell KP, Frankel WN. The
mouse stargazer gene encodes a neuronal Ca2⫹-channel gamma subunit.
Nat Genet. 1998;19:340 –347.
20. Gao T, Yatani A, Dell’Acqua ML, Sako H, Green SA, Dascal N, Scott
JD, Hosey MM. cAMP-dependent regulation of cardiac L-type Ca2⫹
channels requires membrane targeting of PKA and phosphorylation of
channel subunits. Neuron. 1997;19:185–196.
21. Beam KG, Adams BA, Niidome T, Numa S, Tanabe T. Function of a
truncated dihydropyridine receptor as both voltage sensor and calcium
channel. Nature. 1992;360:169 –171.
22. Mochida S, Yokoyama CT, Kim DK, Itoh K, Catterall WA. Evidence for
a voltage-dependent enhancement of neurotransmitter release mediated
via the synaptic protein interaction site of N-type Ca2⫹ channels. Proc
Natl Acad Sci U S A. 1998;95:14523–14528.
23. Bezprozvanny I, Scheller RH, Tsien RW. Functional impact of syntaxin
on gating of N-type and Q-type calcium channels. Nature. 1995;378:
623– 626.
24. Kohout TA, O’Brian JJ, Gaa ST, Lederer WJ, Rogers TB. Novel adenovirus component system that transfects cultured cardiac cells with high
efficiency. Circ Res. 1996;78:971–977.
25. Wolff MR, de Tombe PP, Harasawa Y, Burkhoff D, Bier S, Hunter WC,
Gerstenblith G, Kass DA. Alterations in left ventricular mechanics, energetics, and contractile reserve in experimental heart failure. Circ Res.
1992;70:516 –529.
26. Gidh-Jain M, Huang B, Jain P, Battula V, El-Sherif N. Reemergence of
the fetal pattern of L-type calcium channel gene expression in non
infarcted myocardium during left ventricular remodeling. Biochem
Biophys Res Commun. 1995;216:892– 897.
27. Diebold RJ, Koch WJ, Ellinor PT, Wang JJ, Muthuchamy M, Wieczorek
DF, Schwartz A. Mutually exclusive exon splicing of the cardiac calcium
channel ␣1 subunit gene generates developmentally regulated isoforms in
the rat heart. Proc Natl Acad Sci U S A. 1992;89:1497–1501.
28. Tohse N, Masuda H, Sperelakis N. Novel isoform of Ca2⫹ channel in rat
fetal cardiomyocytes. J Physiol. 1992;451:295–306.
29. Gomez JP, Potreau D. Effects of thapsigargin and cyclopiazonic acid on
intracellular calcium activity in newborn rat cardiomyocytes during their
development in primary culture. J Cardiovasc Pharmacol. 1996;27:
335–346.
30. Atherton BT, Meyer DM, Simpson DG. Assembly and remodelling of
myofibrils and intercalated discs in cultured neonatal rat heart cells. J Cell
Sci. 1986;86:233–248.
31. Silverman HS, Wei S, Haigney MC, Ocampo CJ, Stern MD. Myocyte
adaptation to chronic hypoxia and development of tolerance to subsequent acute severe hypoxia. Circ Res. 1997;80:699 –707.
32. Mitcheson JS, Hancox JC, Levi AJ. Cultured adult rabbit myocytes: effect
of adding supplements to the medium, and response to isoprenaline.
J Cardiovasc Electrophysiol. 1997;8:1020 –1030.
33. Perez-Reyes E, Castellano A, Kim HS, Bertrand P, Baggstrom E, Lacerda
AE, Wei XY, Birnbaumer L. Cloning and expression of a cardiac/brain ␤
subunit of the L-type calcium channel. J Biol Chem. 1992;267:
1792–1797.
34. de Leon M, Wang Y, Jones L, Perez-Reyes E, Wei X, Soong TW, Snutch
TP, Yue DT. Essential Ca2⫹-binding motif for Ca2⫹-sensitive inactivation
of L-type Ca2⫹ channels. Science. 1995;270:1502–1506.
35. Castellano A, Wei X, Birnbaumer L, Perez-Reyes E. Cloning and
expression of a third calcium channel ␤ subunit. J Biol Chem. 1993;268:
3450 –3455.
184
Circulation Research
February 4, 2000
36. Patil PG, Brody DL, Yue DT. Preferential closed-state inactivation of
neuronal calcium channels. Neuron. 1998;20:1027–1038.
37. Brody DL, Patil PG, Mulle JG, Snutch TP, Yue DT. Bursts of action
potential waveforms relieve G-protein inhibition of recombinant P/Q-type
Ca2⫹ channels in HEK 293 cells. J Physiol. 1997;499:637– 644.
38. Imredy JP, Yue DT. Mechanism of Ca2⫹-sensitive inactivation of L-type
Ca2⫹ channels. Neuron. 1994;12:1301–1318.
39. Sham JS, Cleemann L, Morad M. Functional coupling of Ca2⫹ channels
and ryanodine receptors in cardiac myocytes. Proc Natl Acad Sci U S A.
1995;92:121–125.
40. Sipido KR, Callewaert G, Carmeliet E. Inhibition and rapid recovery of
Ca2⫹ current during Ca2⫹ release from sarcoplasmic reticulum in guinea
pig ventricular myocytes. Circ Res. 1995;76:102–109.
41. Neher E. Correction for liquid junction potentials in patch clamp experiments. Methods Enzymol. 1992;207:123–131.
42. Chen CA, Okayama H. Calcium phosphate-mediated gene transfer: a
highly efficient transfection system for stably transforming cells with
plasmid DNA. Biotechniques. 1988;6:632– 638.
43. Felgner PL, Gadek TR, Holm M, Roman R, Chan HW, Wenz M,
Northrop JP, Ringold GM, Danielsen M. Lipofection: a highly efficient,
lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci U S A.
1987;84:7413–7417.
44. Antin PB, Mar JH, Ordahl CP. Single cell analysis of transfected gene
expression in primary heart cultures containing multiple cell types. Biotechniques. 1988;6:640 –2, 645–9.
45. Xu H, Miller J, Liang BT. High-efficiency gene transfer into cardiac
myocytes. Nucleic Acids Res. 1992;20:6425– 6426.
46. Johns DC, Nuss HB, Chiamvimonvat N, Ramza BM, Marbán E,
Lawrence JH. Adenovirus-mediated expression of a voltage-gated
potassium channel in vitro (rat cardiac myocytes) and in vivo (rat liver):
a novel strategy for modifying excitability. J Clin Invest. 1995;96:
1152–1158.
47. Brehm P, Eckert R. Calcium entry leads to inactivation of calcium
channel in Paramecium. Science. 1978;202:1203–1206.
48. Kass RS, Sanguinetti M. Inactivation of calcium channel current in the
calf cardiac Purkinje fiber: evidence for voltage- and calcium-mediated
mechanisms. J Gen Physiol. 1984;84:705–726.
49. Lee K, Marbán E, Tsien RW. Inactivation of calcium channels in mammalian heart cells: joint dependence on membrane potential and intracellular calcium. J Physiol. 1985;364:395– 411.
50. Yamaguchi H, Hara M, Strobeck M, Fukasawa K, Schwartz A, Varadi G.
Multiple modulation pathways of calcium channel activity by a ␤ subunit:
direct evidence of ␤ subunit participation in membrane trafficking of the
␣1C subunit. J Biol Chem. 1998;273:19348 –19356.
51. Kamp TJ, Perez-Garcia MT, Marbán E. Enhancement of ionic current and
charge movement by coexpression of calcium channel ␤1A subunit with
␣1C subunit in a human embryonic kidney cell line. J Physiol. 1996;492:
89 –96.
52. Trouet D, Nilius B, Voets T, Droogmans G, Eggermont J. Use of a
bicistronic GFP-expression vector to characterise ion channels after transfection in mammalian cells. Pflugers Arch. 1997;434:632– 638.
53. Tareilus E, Roux M, Qin N, Olcese R, Zhou J, Stefani E. A Xenopus
oocyte ␤ subunit: evidence for a role in the assembly/expression of
voltage-gated calcium channels that is separate from its role as a regulatory subunit. Proc Natl Acad Sci U S A. 1997;94:1703–1708.
54. Walker D, Bichet D, Campbell KP, De Waard M. A ␤4 isoform-specific
interaction site in the carboxyl-terminal region of the voltage-dependent
Ca2⫹ channel ␣1A subunit. J Biol Chem. 1998;273:2361–2367.
55. Chien AJ, Zhao X, Shirokov RE, Puri TS, Chang CF, Sun S, Rios E,
Hosey M. Roles of a membrane-localized ␤ subunit in the formation and
targeting of functional L-type Ca2⫹ channels. J Biol Chem. 1995;270:
30036 –30044.
56. Chien AJ, Gao T, Perez-Reyes E, Hosey MM. Membrane targeting of
L-type calcium channels: role of palmitoylation in the subcellular localization of the ␤2a subunit. J Biol Chem. 1998;273:23590 –23597.
57. Brice NL, Berrow NS, Campbell V, Page KM, Brickley K, Tedder I,
Dolphin AC. Importance of the different ␤ subunits in the membrane
expression of the ␣1A and ␣2 calcium channel subunits: studies using
a depolarization-sensitive ␣1A antibody. Eur J Neurosci. 1997;9:
749 –759.
58. Ouadid H, Albat B, Nargeot J. Calcium currents in diseased human
cardiac cells. J Cardiovasc Pharmacol. 1995;25:282–291.
59. Mukherjee R, Hewett KW, Spinale FG. Myocyte electrophysiological
properties following the development of supraventricular
tachycardia-induced cardiomyopathy. J Mol Cell Cardiol. 1995;27:
1333–1348.
60. Wang DW, Kiyosue T, Shigematsu S, Arita M. Abnormalities of K⫹ and
Ca2⫹ currents in ventricular myocytes from rats with chronic diabetes.
Am J Physiol. 1995;269:H1288 –H1296.
61. Santos PE, Barcellos LC, Mill JG, Masuda MO. Ventricular action
potential and L-type calcium channel in infarct-induced hypertrophy in
rats. J Cardiovasc Electrophysiol. 1995;6:1004 –1014.
62. Thuringer D, Deroubaix E, Coulombe A, Coraboeuf E, Mercadier JJ.
Ionic basis of the action potential prolongation in ventricular myocytes
from Syrian hamsters with dilated cardiomyopathy. Cardiovasc Res.
1996;31:747–757.
63. Hullin R, Asmus F, Ludwig A, Hersel J, Boekstegers P. Subunit
expression of the cardiac L-type calcium channel is differentially regulated in diastolic heart failure of the cardiac allograft. Circulation.
1999;100:155–163.
64. Beuckelmann DJ, Nabauer M, Erdmann E. Characteristics of calciumcurrent in isolated human ventricular myocytes from patients with
terminal heart failure. J Mol Cell Cardiol. 1991;23:929 –937.
65. Cens T, Restituito S, Galas S, Charnet P. Voltage and calcium use the
same molecular determinants to inactivate calcium channels. J Biol
Chem. 1999;274:5483–5490.
66. Linz KW, Meyer R. Control of L-type calcium current during the action
potential of guinea-pig ventricular myocytes. J Physiol. 1998;513:
425– 442.
67. Cens T, Restituito S, Charnet P. Regulation of Ca-sensitive inactivation of
a L-type Ca2⫹ channel by specific domains of ␤ subunits. FEBS Lett.
1999;450:17–22.
68. Hullin R, Singer-Lahat D, Freichel M, Biel M, Dascal N, Hofmann F,
Flockerzi V. Calcium channel ␤ subunit heterogeneity: functional
expression of cloned cDNA from heart, aorta and brain. EMBO J. 1992;
11:885– 890.
69. Qin N, Platano D, Olcese R, Costantin JL, Stefani E, Birnbaumer L.
Unique regulatory properties of the type 2a Ca2⫹ channel ␤ subunit
caused by palmitoylation. Proc Natl Acad Sci U S A. 1998;95:
4690 – 4695.
70. Collin T, Wang JJ, Nargeot J, Schwartz A. Molecular cloning of three
isoforms of the L-type voltage-dependent calcium channel ␤ subunit from
normal human heart. Circ Res. 1993;72:1337–1344.