Office of Academics and
Transformation
Department of Science
THE SCHOOL BOARD OF MIAMI-DADE COUNTY, FLORIDA
Perla Tabares Hantman, Chair
Dr. Lawrence S. Feldman, Vice Chair
Dr. Dorothy Bendross-Mindingall
Susie V. Castillo
Dr. Wilbert “Tee” Holloway
Dr. Martin Karp
Lubby Navarro
Dr. Marta Pérez
Raquel A. Regalado
Julian Lafaurie
Student Advisor
Alberto M. Carvalho
Superintendent of Schools
Maria Izquierdo
Chief Academic Officer
Office of Academics and Transformation
Dr. Maria P. de Armas
Assistant Superintendent
Division of Academics
Mr. Cristian Carranza
Administrative Director
Division of Academics
Dr. Ava D. Rosales
Executive Director
Department of Mathematics and Science
Table of Contents
Introduction ...............................................................................................................................3
 Next Generation Sunshine State Standards ..................................................................4
Resources
 Materials ......................................................................................................................14
 Laboratory Safety and Contract...................................................................................20
 Lab Roles and Descriptions ........................................................................................21
 Writing in Science........................................................................................................22
Hands-on Activities
First Nine Weeks
1. Seed Germination (Topic 1) .....................................................................................25
2. Limiting Factors (Topic 3) .........................................................................................36
3. Energy and Ecosystems (Topic 4) ............................................................................48
4. Human Impact – Effects of Acid Rain (Topic 5) ........................................................70
5. Human Impact Stations (Topic 5) .............................................................................76
6. Origin of Life-The Puzzle Theory: Law vs. Theory (Topic 6) .....................................90
7. Evidence for the Theory of Evolution (Topic 7) .........................................................99
8. Natural Selection (Topic 8) ....................................................................................111
9. Hominid Evolution Station Lab (Topic 8) ................................................................118
Second Nine Weeks
1. Classification of Fruits (Topic 9) ............................................................................164
2. Kingdom Comparison Challenge(Topic 9) .............................................................174
3. Cladistics (Topic 9) .................................................................................................188
4. Plant Structure and Function (Topic 10) .................................................................197
5. Exploring Flower Structure (Topic 10) ...................................................................209
6. Properties of Water (Topic 10) ...............................................................................219
7. Investigating the Effect of Light Intensity on Photosynthesis (Topic 11) ................225
8. Cellular Respiration (Topic 12) ..............................................................................230
9. Factors affecting Blood Flow (Topic 13) ................................................................235
10. Take a Heart Hike (Topic 13)..................................................................................245
11. The Deadly Fuchsia Disease (Topic 14) ................................................................258
Biology HSL
Department of Science
Page 1
Third Nine Weeks
1. Human Development stages Lab (Topic 15) .........................................................263
2. Comparing Cells Lab (Topic 16) ............................................................................281
3. Diffusion and Osmosis (Topic 16) ..........................................................................289
4. Investigating Inherited Traits: Reebop Genetics (Topic 19) ...................................296
5. Pedigree Studies (Topic 19) ..................................................................................309
Fourth Nine Weeks
1. DNA Extraction Lab (Topic 21) ..............................................................................318
2. Candy DNA Replication (Topic 21) ........................................................................323
3. Making Protein Sense (Topic 22) ..........................................................................327
4. Building Macromolecules (Topic 23) ......................................................................338
5. Factors Affecting Enzyme Activity (Topic 24) ........................................................349
6. Classification – Fishing for Protists (Topic 26) .......................................................357
7. Genetic Disorders: Informational Poster and Presentation (Topic 28) ...................361
Additional Hands-on Activities
1. Fun with Bubbles (Topic 1and 10) .........................................................................367
2. Study of Abiotic and Biotic factors (Topic 2) ..........................................................374
3. Stimuli Effects on Heart Rate: Sympathetic Stimuli and Coughing (Topic 13) .......380
4. Stimuli Effects on Heart Rate: Exercise and Baroreceptor Stimuli (Topic 13) ........389
5. Investigating Bacterial Growth (Topic 9 and 17) ....................................................398
6. Differences in Similar Phenotypes (Topic 19) ........................................................405
7. Making Karyotypes (Topic 19) ...............................................................................413
8. Building a DNA Model Project (Topic 21) ..............................................................422
9. DNA Electrophoresis Simulation (Topic 21) ...........................................................429
10. Identifying Organic Compounds (Topic 23) ............................................................434
11. Protein Synthesis: Transcription and Translation (Topic 22) .................................443
12. Examining the Fossil Record (Topic 7) ...................................................................451
13. Circulation Lab (Topic 16).......................................................................................458
14. Cell Model Project (Topic 19) .................................................................................462
15. Investigating Inherited Traits (Topic 22)..................................................................469
16. Enzyme Catalyst Lab (Topic 26) .............................................................................479
17. Animal-Vertebrate Fish “Perch” Dissection(Topic 14) .............................................483
Biology HSL
Department of Science
Page 2
Introduction
The purpose of this document is to provide Biology teachers with a list of basic laboratories and
hands-on activities that students in a Biology class should experience. Each activity is aligned
with the Biology Curriculum Pacing Guide and the Next Generation Sunshine State Standards
(NGSSS).
All the information within this document provides the teacher an essential method of integrating
the Science NGSSS with the instructional requirements delineated by the Course Description
published by the Florida Department of Education (FLDOE) and the Biology End of Course Test
(EOC). The information is distributed in three parts:
(1) A list of the course specific benchmarks as described by the FLDOE and that may be
tested in the Biology EOC. The Nature of Science Body of Knowledge and related
standards are infused throughout the activities. Specific Nature of Science, Language
Arts, and Mathematics benchmarks may have been explicitly cited in each activity;
however, it is expected that teachers infuse them frequently in every laboratory activity.
(2) Basic resources to assist with laboratory safety, organization of groups during lab
activities, and scientific writing of reports.
(3) Hands-on activities that include a teacher-friendly introduction and a student handout.
The teacher introduction in each activity is designed to provide guidelines to facilitate the
overall connection of the activity with course specific benchmarks through the integration
of the scientific process and/or inquiry with appropriate questioning strategies addressing
Norman Webb’s Depth of Knowledge Levels in Science.
All the hands-on activities included in this packet were designed to address important concepts
found in the Biology course that will be assessed in the Biology EOC and to provide the teacher
with sufficient resources to help the student develop critical thinking skills in order to reach a
comprehensive understanding of the course objectives. In some cases, more than one lab was
included for a specific standard, benchmark, or concept. In most cases, the activities were
designed to be simple and without the use of advanced technological equipment to make it
possible for all teachers to use. However, it is highly recommended that technology, such as
Explorelearning Gizmos and hand-held data collection equipment from Vernier, Texas
Instruments, and Pasco, is implemented in the science classrooms.
This document is intended to bring uniformity among the science teachers that are teaching this
course so that all can work together, plan together, and rotate lab materials among classrooms.
Through this practice, all students and teachers will have the same opportunities to participate in
these experiences and promote discourse among learners, which are the building blocks of
authentic learning communities.
Acknowledgement
M-DCPS Curriculum and Instruction Division of Mathematics, Science, and Advanced Academic
Programs would like to acknowledge the efforts of the teachers who worked arduously and
diligently on the preparation of this document.
Biology HSL
Curriculum and Instruction
Page 3
Biology 1 course Next Generation Sunshine State Standards (NGSSS)
SC.912.N.1.1: Define a problem based on a specific body of knowledge, for example: biology, chemistry, physics, and
earth/space science, and do the following: (1) Pose questions about the natural world, (Articulate the purpose of
the investigation and identify the relevant scientific concepts); (2) Conduct systematic observations, (Write
procedures that are clear and replicable. Identify observables and examine relationships between test (independent)
variable and outcome (dependent) variable. Employ appropriate methods for accurate and consistent observations;
conduct and record measurements at appropriate levels of precision. Follow safety guidelines); (3) Examine books
and other sources of information to see what is already known; (4) Review what is known in light of empirical
evidence, (Examine whether available empirical evidence can be interpreted in terms of existing knowledge and
models, and if not, modify or develop new models); (5) Plan investigations, (Design and evaluate a scientific
investigation); (6) Use tools to gather, analyze, and interpret data (this includes the use of measurement in
metric and other systems, and also the generation and interpretation of graphical representations of data,
including data tables and graphs), (Collect data or evidence in an organized way. Properly use instruments,
equipment, and materials (e.g., scales, probeware, meter sticks, microscopes, computers) including set-up, calibration,
technique, maintenance, and storage); (7) Pose answers, explanations, or descriptions of events; (8) Generate
explanations that explicate or describe natural phenomena (inferences); (9) Use appropriate evidence and
reasoning to justify these explanations to others; (10) Communicate results of scientific investigations; and
(11) Evaluate the merits of the explanations produced by others.
Common Core State Standards (CCSS) Connections for 6-12 Literacy in Science For Students in Grades 9-10:
LAFS.910.RST.1.1 Cite specific textual evidence to support analysis of science and technical texts, attending to the
precise details of explanations or descriptions.
LAFS.910.RST.1.3 Follow precisely a complex multistep procedure when carrying out experiments, taking
measurements, or performing technical tasks attending to special cases or exceptions defined in the text.
LAFS.910.RST.3.7 Translate quantitative or technical information expressed in words in a text into visual form (e.g., a
table or chart) and translate information expressed visually or mathematically (e.g., in an equation) into words.
LAFS.910.WHST.1.2 Write informative/explanatory texts, including the narration of historical events, scientific
procedures/ experiments, or technical processes.
LAFS.910.WHST.3.9 Draw evidence from informational texts to support analysis, reflection, and research.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.N.1.3: Recognize that the strength or usefulness of a scientific claim is evaluated through scientific
argumentation, which depends on critical and logical thinking, and the active consideration of alternative scientific
explanations to explain the data presented. Remarks/Examples: Assess the reliability of data and identify reasons for
inconsistent results, such as sources of error or uncontrolled conditions. CCSS Connections: MAFS.K12.MP.2: Reason
abstractly and quantitatively MAFS.K12.MP.3: Construct viable arguments and critique the reasoning of others
Cognitive Complexity: Level 1: Recall
SC.912.N.1.4: Identify sources of information and assess their reliability according to the strict standards of scientific
investigation. Remarks/Examples: Read, interpret, and examine the credibility and validity of scientific claims in
different sources of information, such as scientific articles, advertisements, or media stories. Strict standards of science
include controlled variables, sufficient sample size, replication of results, empirical and measurable evidence, and the
concept of falsification. CCSS Connections: LAFS.910.RST.1.1 / LAFS.1112.RST.1.1.
Cognitive Complexity: Level 3: Strategic Thinking & Complex
SC.912.N.1.6: Describe how scientific inferences are drawn from scientific observations and provide examples from the
content being studied. Remarks/Examples: Collect data/evidence and use tables/graphs to draw conclusions and
make inferences based on patterns or trends in the data. CCSS Connections: MAFS.K12.MP.1: Make sense of
problems and persevere in solving them.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
Biology HSL
Curriculum and Instruction
Page 4
SC.912.N.2.1: Identify what is science, what clearly is not science, and what superficially resembles science (but fails
to meet the criteria for science). Remarks/Examples: Science is the systematic and organized inquiry that is derived
from observations and experimentation that can be verified or tested by further investigation to explain natural
phenomena (e.g. Science is testable, pseudo-science is not science seeks falsifications, pseudo-science seeks
confirmations.)
Cognitive Complexity: Level 3: Strategic Thinking & Complex
SC.912.N.2.2: Identify which questions can be answered through science and which questions are outside the
boundaries of scientific investigation, such as questions addressed by other ways of knowing, such as art, philosophy,
and religion. Remarks/Examples: Identify scientific questions that can be disproved by experimentation/testing.
Recognize that pseudoscience is a claim, belief, or practice which is presented as scientific, but does not adhere to
strict standards of science (e.g. controlled variables, sample size, replicability, empirical and measurable evidence, and
the concept of falsification).CCSS Connections: MAFS.K12.MP.3: Construct viable arguments and critique the
reasoning of others.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.N.3.1: Explain that a scientific theory is the culmination of many scientific investigations drawing together all
the current evidence concerning a substantial range of phenomena; thus, a scientific theory represents the most
powerful explanation scientists have to offer. Remarks/Examples: Explain that a scientific theory is a well-tested
hypothesis supported by a preponderance of empirical evidence. CCSS Connections: MAFS.K12.MP.1: Make sense of
problems and persevere in solving them and, MAFS.K12.MP.3: Construct viable arguments and critique the reasoning
of others.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.N.3.4: Recognize that theories do not become laws, nor do laws become theories; theories are well supported
explanations and laws are well supported descriptions. Remarks/Examples: Recognize that theories do not become
laws, theories explain laws. Recognize that not all scientific laws have accompanying explanatory theories.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.E.7.1: Analyze the movement of matter and energy through the different biogeochemical cycles, including
water and carbon. Remarks/Examples: Describe that the Earth system contains fixed amounts of each stable
chemical element and that each element moves among reservoirs in the solid earth, oceans, atmosphere and living
organisms as part of biogeochemical cycles (i.e., nitrogen, water, carbon, oxygen and phosphorus), which are driven
by energy from within the Earth and from the Sun.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.14.1: Describe the scientific theory of cells (cell theory) and relate the history of its discovery to the process
of science. Remarks/Examples: Describe how continuous investigations and/or new scientific information influenced
the development of the cell theory. Recognize the contributions of scientists in the development of the cell theory.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.14.2: Relate structure to function for the components of plant and animal cells. Explain the role of cell
membranes as a highly selective barrier (passive and active transport).
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.14.3: Compare and contrast the general structures of plant and animal cells. Compare and contrast the
general structures of prokaryotic and eukaryotic cells. Remarks/Examples: Annually Assessed on Biology EOC. Also
assesses SC.912.L.14.2.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
Biology HSL
Curriculum and Instruction
Page 5
SC.912.L.14.4: Compare and contrast structure and function of various types of microscopes.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.14.6: Explain the significance of genetic factors, environmental factors, and pathogenic agents to health from
the perspectives of both individual and public health.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.14.7: Relate the structure of each of the major plant organs and tissues to physiological processes.
Remarks/Examples: Annually Assessed on Biology EOC.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.14.26: Identify the major parts of the brain on diagrams or models. Remarks/Examples: Annually Assessed
on Biology EOC. CCSS Connections: MAFS.K12.MP.4: Model with mathematics.
Cognitive Complexity: Level 1: Recall
SC.912.L.14.36: Describe the factors affecting blood flow through the cardiovascular system.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.14.52: Explain the basic functions of the human immune system, including specific and nonspecific immune
response, vaccines, and antibiotics. Remarks/Examples: Annually Assessed on Biology EOC. Also assesses
SC.912.L.14.6 HE.912.C.1.7 and HE.912.C.1.5.
Cognitive Complexity: Level 1: Recall
SC.912.L.15.1: Explain how the scientific theory of evolution is supported by the fossil record, comparative anatomy,
comparative embryology, biogeography, molecular biology, and observed evolutionary change. Remarks/Examples:
Annually Assessed on Biology EOC. Also assesses SC.912.L.15.10 SC.912.N.1.3 SC.912.N.1.4 SC.912.N.1.6
SC.912.N.2.1 SC.912.N.3.1 and SC.912.N.3.4.
Cognitive Complexity: Level 3: Strategic Thinking & Complex
SC.912.L.15.4: Describe how and why organisms are hierarchically classified and based on evolutionary relationships.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.15.5: Explain the reasons for changes in how organisms are classified.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.15.6: Discuss distinguishing characteristics of the domains and kingdoms of living organisms.
Remarks/Examples: Annually Assessed on Biology EOC. Also assesses SC.912.L.15.4 SC.912.L.15.5 SC.912.N.1.3
and SC.912.N.1.6.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.15.8: Describe the scientific explanations of the origin of life on Earth. Remarks/Examples: Annually
assessed on Biology EOC. Also assesses SC.912.N.1.3, SC.912.N.1.4, and SC.912.N.2.1.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.15.10: Identify basic trends in hominid evolution from early ancestors six million years ago to modern
humans, including brain size, jaw size, language, and manufacture of tools.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
Biology HSL
Curriculum and Instruction
Page 6
SC.912.L.15.13: Describe the conditions required for natural selection, including: overproduction of offspring, inherited
variation, and the struggle to survive, which result in differential reproductive success. Remarks/Examples: Annually
assessed on Biology EOC. Also assesses SC.912.L.15.14, SC.912.L.15.15, and SC.912.N.1.3.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.15.14: Discuss mechanisms of evolutionary change other than natural selection such as genetic drift and
gene flow.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.15.15: Describe how mutation and genetic recombination increase genetic variation.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.16.1: Use Mendel's laws of segregation and independent assortment to analyze patterns of inheritance.
Remarks/Examples: Annually assessed on Biology EOC. Also assesses SC.912.L.16.2.
Cognitive Complexity: Level 3: Strategic Thinking &Complex Reasoning
SC.912.L.16.2: Discuss observed inheritance patterns caused by various modes of inheritance, including dominant,
recessive, codominant, sex-linked, polygenic, and multiple alleles.
Cognitive Complexity: Level 3: Strategic Thinking &Complex Reasoning
SC.912.L.16.3: Describe the basic process of DNA replication and how it relates to the transmission and conservation
of the genetic information. Remarks/Examples: Integrate HE.912.C.1.7. Analyze how heredity and family history can
impact personal health. Annually assessed on Biology EOC. Also assesses SC.912.L.16.4 SC.912.L.16.5
SC.912.L.16.9.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.16.4: Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how
mutations in gametes may result in phenotypic changes in offspring.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of
genes.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.16.8: Explain the relationship between mutation, cell cycle, and uncontrolled cell growth potentially resulting
in cancer. Remarks/Examples: Integrate HE.912.C.1.7. Analyze how heredity and family history can impact personal
health.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.16.9: Explain how and why the genetic code is universal and is common to almost all organisms.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.16.10: Evaluate the impact of biotechnology on the individual, society and the environment, including medical
and ethical issues. Remarks/Examples: Annually assessed on Biology EOC.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
Biology HSL
Curriculum and Instruction
Page 7
SC.912.L.16.13: Describe the basic anatomy and physiology of the human reproductive system. Describe the process
of human development from fertilization to birth and major changes that occur in each trimester of pregnancy.
Remarks/Examples: Annually assessed on Biology EOC.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.16.14: Describe the cell cycle, including the process of mitosis. Explain the role of mitosis in the formation of
new cells and its importance in maintaining chromosome number during asexual reproduction.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.16.16: Describe the process of meiosis, including independent assortment and crossing over. Explain how
reduction division results in the formation of haploid gametes or spores.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.16.17: Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual
reproduction and their consequences for genetic variation. Remarks/Examples: Annually assessed on Biology EOC.
Also assesses SC.912.L.16.8 SC.912.L.16.14 SC.912.L.16.16.
Cognitive Complexity: Level 3: Strategic Thinking &Complex Reasoning
SC.912.L.17.2: Explain the general distribution of life in aquatic systems as a function of chemistry, geography, light,
depth, salinity, and temperature.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.17.4: Describe changes in ecosystems resulting from seasonal variations, climate change and succession.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.17.5: Analyze how population size is determined by births, deaths, immigration, emigration, and limiting
factors (biotic and abiotic) that determine carrying capacity. Remarks/Examples: Annually assessed on Biology EOC.
Also assesses SC.912.L.17.2 SC.912.L.17.4 SC.912.L.17.8 SC.912.N.1.4.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.17.8: Recognize the consequences of the losses of biodiversity due to catastrophic events, climate changes,
human activity, and the introduction of invasive, non-native species.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.17.9: Use a food web to identify and distinguish producers, consumers, and decomposers. Explain the
pathway of energy transfer through trophic levels and the reduction of available energy at successive trophic levels.
Remarks/Examples: Annually assessed on Biology EOC. Also assesses SC.912.E.7.1.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.17.11: Evaluate the costs and benefits of renewable and nonrenewable resources, such as water, energy,
fossil fuels, wildlife, and forests.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.17.13: Discuss the need for adequate monitoring of environmental parameters when making policy
decisions.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
Biology HSL
Curriculum and Instruction
Page 8
SC.912.L.17.20: Predict the impact of individuals on environmental systems and examine how human lifestyles affect
sustainability. Remarks/Examples: Annually assessed on Biology EOC. Also assesses SC.912.L.17.11,
SC.912.L.17.13, SC.912.N.1.3.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.18.1: Describe the basic molecular structures and primary functions of the four major categories of biological
macromolecules. Remarks/Examples: Annually assessed on Biology EOC. Also assesses SC.912.L.18.11.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.18.7: Identify the reactants, products, and basic functions of photosynthesis.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.18.8: Identify the reactants, products, and basic functions of aerobic and anaerobic cellular respiration.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.18.9: Explain the interrelated nature of photosynthesis and cellular respiration. Remarks/Examples:
Annually assessed on Biology EOC. Also assesses SC.912.L.18.7 SC.912.L.18.8 SC.912.L.18.10.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.18.10: Connect the role of adenosine triphosphate (ATP) to energy transfers within a cell.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
SC.912.L.18.11: Explain the role of enzymes as catalysts that lower the activation energy of biochemical reactions.
Identify factors, such as pH and temperature, and their effect on enzyme activity.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
SC.912.L.18.12: Discuss the special properties of water that contribute to Earth's suitability as an environment for life:
cohesive behavior, ability to moderate temperature, expansion upon freezing, and versatility as a solvent.
Remarks/Examples: Annually assessed on Biology EOC.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
MAFS.912.N-Q.1.1: Use units as a way to understand problems and to guide the solution of multi-step problems;
choose and interpret units consistently in formulas; choose and interpret the scale and the origin in graphs and data
displays. Remarks/Examples: Algebra 1, Unit 1: Working with quantities and the relationships between them provides
grounding for work with expressions, equations, and functions.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
MAFS.912.N-Q.1.3: Choose a level of accuracy appropriate to limitations on measurement when reporting quantities.
Remarks/Examples: Algebra 1, Unit 1: Working with quantities and the relationships between them provides
grounding for work with expressions, equations, and functions.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
Biology HSL
Curriculum and Instruction
Page 9
LAFS.910.SL.1.1: Initiate and participate effectively in a range of collaborative discussions (one-on-one, in groups, and
teacher-led) with diverse partners on grades 9–10 topics, texts, and issues, building on others’ ideas and expressing
their own clearly and persuasively. (a) Come to discussions prepared, having read and researched material under
study; explicitly draw on that preparation by referring to evidence from texts and other research on the topic or issue to
stimulate a thoughtful, well-reasoned exchange of ideas. (b) Work with peers to set rules for collegial discussions and
decision-making (e.g., informal consensus, taking votes on key issues, presentation of alternate views), clear goals and
deadlines, and individual roles as needed. (c) Propel conversations by posing and responding to questions that relate
the current discussion to broader themes or larger ideas; actively incorporate others into the discussion; and clarify,
verify, or challenge ideas and conclusions. (d) Respond thoughtfully to diverse perspectives, summarize points of
agreement and disagreement, and, when warranted, qualify or justify their own views and understanding and make
new connections in light of the evidence and reasoning presented.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.SL.1.2: Integrate multiple sources of information presented in diverse media or formats (e.g., visually,
quantitatively, orally) evaluating the credibility and accuracy of each source.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.SL.1.3: Evaluate a speaker’s point of view, reasoning, and use of evidence and rhetoric, identifying any
fallacious reasoning or exaggerated or distorted evidence.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.SL.2.4: Present information, findings, and supporting evidence clearly, concisely, and logically such that
listeners can follow the line of reasoning and the organization, development, substance, and style are appropriate to
purpose, audience, and task.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.SL.2.5: Make strategic use of digital media (e.g., textual, graphical, audio, visual, and interactive elements)
in presentations to enhance understanding of findings, reasoning, and evidence and to add interest.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.RST.1.1: Cite specific textual evidence to support analysis of science and technical texts, attending to the
precise details of explanations or descriptions.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.1.2: Determine the central ideas or conclusions of a text; trace the text’s explanation or depiction of a
complex process, phenomenon, or concept; provide an accurate summary of the text.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.1.3: Follow precisely a complex multistep procedure when carrying out experiments, taking
measurements, or performing technical tasks, attending to special cases or exceptions defined in the text.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.2.4: Determine the meaning of symbols, key terms, and other domain-specific words and phrases as
they are used in a specific scientific or technical context relevant to grades 9–10 texts and topics.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.2.5: Analyze the structure of the relationships among concepts in a text, including relationships among
key terms (e.g., force, friction, reaction force, energy).
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
Biology HSL
Curriculum and Instruction
Page 10
LAFS.910.RST.2.6: Analyze the author’s purpose in providing an explanation, describing a procedure, or discussing an
experiment in a text, defining the question the author seeks to address.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.3.7: Translate quantitative or technical information expressed in words in a text into visual form (e.g., a
table or chart) and translate information expressed visually or mathematically (e.g., in an equation) into words.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.3.8: Assess the extent to which the reasoning and evidence in a text support the author’s claim or a
recommendation for solving a scientific or technical problem.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.3.9: Compare and contrast findings presented in a text to those from other sources (including their own
experiments), noting when the findings support or contradict previous explanations or accounts.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.RST.4.10: By the end of grade 10, read and comprehend science/technical texts in the grades 9–10 text
complexity band independently and proficiently.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.WHST.1.1: Write arguments focused on discipline-specific content. (a) Introduce precise claim(s),
distinguish the claim(s) from alternate or opposing claims, and create an organization that establishes clear
relationships among the claim(s), counterclaims, reasons, and evidence. (b) Develop claim(s) and counterclaims fairly,
supplying data and evidence for each while pointing out the strengths and limitations of both claim(s) and
counterclaims in a discipline-appropriate form and in a manner that anticipates the audience’s knowledge level and
concerns. (c) Use words, phrases, and clauses to link the major sections of the text, create cohesion, and clarify the
relationships between claim(s) and reasons, between reasons and evidence, and between claim(s) and counterclaims.
(d) Establish and maintain a formal style and objective tone while attending to the norms and conventions of the
discipline in which they are writing. (e) Provide a concluding statement or section that follows from or supports the
argument presented.
Cognitive Complexity: Level 4: Extended Thinking &Complex Reasoning
LAFS.910.WHST.1.2: Write informative/explanatory texts, including the narration of historical events, scientific
procedures/ experiments, or technical processes. (a) Introduce a topic and organize ideas, concepts, and information
to make important connections and distinctions; include formatting (e.g., headings), graphics (e.g., figures, tables), and
multimedia when useful to aiding comprehension. (b) Develop the topic with well-chosen, relevant, and sufficient facts,
extended definitions, concrete details, quotations, or other information and examples appropriate to the audience’s
knowledge of the topic. (c) Use varied transitions and sentence structures to link the major sections of the text, create
cohesion, and clarify the relationships among ideas and concepts. (d) Use precise language and domain-specific
vocabulary to manage the complexity of the topic and convey a style appropriate to the discipline and context as well
as to the expertise of likely readers. (e) Establish and maintain a formal style and objective tone while attending to the
norms and conventions of the discipline in which they are writing. (f) Provide a concluding statement or section that
follows from and supports the information or explanation presented (e.g., articulating implications or the significance of
the topic).
Cognitive Complexity: Level 4: Extended Thinking &Complex Reasoning
LAFS.910.WHST.2.4: Produce clear and coherent writing in which the development, organization, and style are
appropriate to task, purpose, and audience.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
Biology HSL
Curriculum and Instruction
Page 11
LAFS.910.WHST.2.5: Develop and strengthen writing as needed by planning, revising, editing, rewriting, or trying a
new approach, focusing on addressing what is most significant for a specific purpose and audience.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.WHST.2.6: Use technology, including the Internet, to produce, publish, and update individual or shared
writing products, taking advantage of technology’s capacity to link to other information and to display information
flexibly and dynamically.
Cognitive Complexity: Level 2: Basic Application of Skills & Concepts
LAFS.910.WHST.3.7: Conduct short as well as more sustained research projects to answer a question (including a
self-generated question) or solve a problem; narrow or broaden the inquiry when appropriate; synthesize multiple
sources on the subject, demonstrating understanding of the subject under investigation.
Cognitive Complexity: Level 4: Extended Thinking &Complex Reasoning
LAFS.910.WHST.3.8: Gather relevant information from multiple authoritative print and digital sources, using advanced
searches effectively; assess the usefulness of each source in answering the research question; integrate information
into the text selectively to maintain the flow of ideas, avoiding plagiarism and following a standard format for citation.
Cognitive Complexity: Level 4: Extended Thinking &Complex Reasoning
LAFS.910.WHST.3.9: Draw evidence from informational texts to support analysis, reflection, and research.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
LAFS.910.WHST.4.10: Write routinely over extended time frames (time for reflection and revision) and shorter time
frames (a single sitting or a day or two) for a range of discipline-specific tasks, purposes, and audiences.
Cognitive Complexity: Level 3: Strategic Thinking & Complex Reasoning
HE.912.C.1.3: Evaluate how environment and personal health are interrelated. Remarks/Examples: Food options
within a community; prenatal-care services; availability of recreational facilities; air quality; weather-safety awareness;
and weather, air, and water conditions.
HE.912.C.1.5: Analyze strategies for prevention, detection, and treatment of communicable and chronic diseases.
Remarks/Examples: Health prevention, detection, and treatment of: breast and testicular cancer, suicide, obesity, and
industrial-related chronic disease.
HE.912.C.1.7: Analyze how heredity and family history can impact personal health. Remarks/Examples: Drug use,
family obesity, heart disease, mental health, and non-communicable illness or disease.
Biology HSL
Curriculum and Instruction
Page 12
Resources
Materials Hands-on Activities
1. Seed Germination Lab
 Paper Towels
 Ruler
 Radish seeds
 Petri dish or potting cups
 Soil (different kinds*)
 Water





Light source
Box *
Salt*
Hot Plates *
Pollutants (e.g. detergent, soap)*




5 Petri dishes
water
vinegar (acetic acid)
25 radish seeds
2. Limiting Factors
 open space
3. Energy and Ecosystems (Marine Food web)
 butcher paper or poster paper
 markers
4. Human Impact – Effects of Acid Rain
 beakers (50 mL)
 graduated cylinder
 filter paper
 medicine droppers
 pH meter
5. Human Impact Stations
6. Origin of Life: Puzzle Theory
 1,000 piece puzzle with a picture of
nature having many factors and
colors. Try to stay away from
repeated patterned pictures
 6-8 envelopes
 6-8 Large newsprint or poster paper
 Copies of the student handout
7. Evidence for the Theory of Evolution
 Replica fossilized bone “casts”
 Scissors
 Paper
 Tape or glue
8. Natural Selection
 Plastic spoon, knife, or fork
 Self-sealing plastic sandwich bag
 Food pieces (candies, unshelled nuts,
beans, etc.)
 Plastic container for nest (optional)
9. Hominid Evolution Lab
10. Classification of Fruits
 Fruit pictures (may be substituted for real fruit)
Biology HSL
Department of Science
Page 14
11. Survey of Domains and Kingdoms
12. Cladistics
 Organism Cards and Linnaean Table
(in student packet)
 Clear (see-through) plastic bags – 7
per group
 3 x 5 cards or sticky notes
13. Plant Structure and Function
Teacher Section
 Tea leaves or tea bag (Leaf
 One fruit (any kind) (Flower)
 Celery plant (Stem and Leaf)
 Carrot or onion (Root)
 Live green plant (in a pot)
Student Section
 Student handout
Part 2A
 Plant leaves
 Clear fingernail polish
 Scissors
 Printer paper
 Color pencils or markers
 Clear cellophane tape (clear package
sealing tape)
 Microscope
 Microscope slides
Part B
 Plant roots (monocot and dicot)
 Microscope
 Microscope slides
Part C
 Plant stems (monocot and dicot)
 Microscope
 Microscope slides
14. Exploring Flower Structure
Stereo and compound microscopes
Brassica rapa or similar type of
flowers
Forceps
Scissors
index cards (4” x 6” or bigger)
pencil
15. Properties of Water
 glass of water
 paperclip
 penny
 soda straw
 glass slide
tape
microscope slides
cover slips
water
disposable pipettes
rubber stopper




glass test tube
a strip of jeans
paper strip with a marker dot
wax paper
16. Investigating the Effects of Light Intensity on Photosynthesis
 Test tube
 Plastic gloves
 Source of bright light
 Sprig
of
evergreen
or
Elodea/Anacharis
(Fresh
Water
 Sodium bicarbonate solution (Baking
Aquarium Plant)
Soda)
 Hand lens
 Watch or clock with second indicator
 Forceps
 400-mL beaker
Biology HSL
Department of Science
Page 15
17. Cellular Respiration
 Distilled water
 Straw
 Heat-resistant gloves
 Hot Plate
 Cotton ball
 Beakers 500-mL (two)
 Test tubes (4)
18. Blood Flow Learning Stations
 Stethoscope
 Rubbing alcohol
 Purple
cabbage
Bromothymol blue
 Test tube rack
 Slotted spoon (large)
 Stoppers
 Radish seedlings (10)
 Forceps
 Aluminum foil
leaves
or
 Cotton balls
 Stopwatch
19. Take a Heart Hike
 3-inch-wide masking tape, blue and red
 Large magic marker to write on tape
 Two small bowls or pans
 20 quarter-sized red circles and 20 quarter-sized blue circles
20. The Deadly Fuchsia Disease
 test tube racks
 test tube
 distilled water
 NaOH (0.1 M)
 phenolphthalein
21. Human Development Stages Lab
22. Comparing Cells Lab
23. Diffusion and Osmosis
 Ziploc bag
 liquid starch
 forceps
 beaker (500 mL)
 water
 Iodine (Lugol’s solution)
 razor
 potato








24. Investigating Inherited Traits
 3 textbooks
 2 pennies
ruler
balance
graduated cylinder
distilled water
sucrose solution
dissecting needle
beaker
aluminum foil
25. Pedigree Lab
 Colored printer (optional; if available)
Biology HSL
Department of Science
Page 16
26. DNA Extraction Lab
 Ziploc baggies
 Small (10 mL) graduated cylinders
 Beakers or cups for straining
 Cheesecloth
 Test tubes and containers or racks to
hold them
 Wood
splints
or
disposable
inoculation loops
 Strawberries
 Extraction solution (10% shampoo
and a dash of salt)
 Ice cold ethanol (70% pharmacy
ethanol will work)
27. Candy DNA Replication Lab
 Red licorice chunks (red and black) - 24 piece each color
 Gum drops or colored marshmallows (4 different colors) - 6 of each color
 Wooden toothpick halves – about 70
28. Making Protein Sense
29. Building Macromolecules
Use different household or food items to represent the different elements
 Blueberries= Hydrogen
 Radish= Nitrogen
 Red Grapes= Oxygen
 Bonds= wooden toothpicks or dry
spaghetti pieces
 Green grapes= Carbon
30. Enzyme Catalyst Lab
31. Classification- Fishing for Protists
32. Genetic Disorders: Informational Poster and Presentation
 Construction paper
 Glue
 Poster board
 Stapler
33. Enzyme Catalyst Lab
 Yeast solution
 Hydrogen peroxide
 Filter paper disks
 Forceps
 Eight 50 ml beakers




Distilled water
Marking pencil
Paper towels
Graph paper
34. Classification – Fishing for Protists
 Microscopes
 Microscope slides
 Protist identification key
 Protist cultures (Euglena, Paramecium, Amoeba, and Stentor).
Biology HSL
Department of Science
Page 17
35. Genetic Disorders: Informational Poster and Presentation
 Construction paper
 Poster board
 Glue
 Stapler
Materials Modified Hands-on Activities
36. Fun with Bubbles
 3 different kinds of clear dishwashing
liquids
 commercial bubble solution
37. Study of Abiotic and Biotic Factors
 4 stakes
 hammer
 measuring rope (10 m) marked in
meters
 soil pH test kit
 rulers
 straws
 water
 glycerin




thermometer
wind vane
anemometer
trowel or hand shovel
 plastic trash bags to cover tables
38. Stimuli Effects on Heart Rate: Sympathetic Stimuli and Coughing
CBL2 with TI 83 calculator
Vernier Hand-Grip Heart Rate
Monitor or Vernier Exercise Heart
ice water bath
Rate Monitor
towel
DataMate App
saline solution in dropper bottle for
Vernier Respiration Rate Monitor
the exercise heart rate monitor
39. Stimuli Effects on Heart Rate: Exercise and Baroreceptor Stimuli
CBL2 with TI 83 calculator
DataMate App
Vernier Respiration Rate Monitor
Vernier Hand-Grip Heart Rate Monitor or Vernier Exercise Heart Rate Monitor
saline solution in dropper bottle for the exercise heart rate monitor
40. Investigating Bacterial Growth
 1 agar plate
 Sample of bacteria
 Inoculating loop or cotton swab
 Forceps
 Tape
 1 wax pencil/Sharpie
 1 metric ruler
 Distilled water
 Blank paper disk
 3 disks immersed in either antibiotic,
antiseptic, or disinfectant solutions
 1 paper disk not immersed with any
fluid
 Penicillin or similar antibiotic
 Bleach
 Mouthwash
41. Examining the Fossil Record
 Chart paper
 Scissors
 Markers
 Glue or tape
Biology HSL
Department of Science
Page 18
42. Using a Dichotomous Key for Invertebrate Phyla
 Invertebrate handouts (pictures)
 Invertebrate specimen samples
 Dichotomous key
43. Cell Model Project
 recyclable household items
44. Making Karyotypes
 Scissors
 Glue or transparent tape
45. Differences in Similar Phenotypes
 Metric ruler
 Meter stick
46. Building a DNA Model Project
 2 strips of cardboard, 38 cm x 3 cm
 Metric ruler
 Toothpicks
 Crayons




47. DNA Electrophoresis Simulation
 Football, soccer or other large grass
field (It is important to use a grass
field in case students fall during the
activity.)
Tape
Colored gumdrops
Modeling clay
Digital camera (optional; if available)
 50 m or 100 m measuring tape
 Stopwatch or other timing device
48. Protein Synthesis: Transcription and Translation
 Pencils
 DNA strands worksheet
49. Identifying Organic Compounds
 10 test tubes
 Test-tube rack
 Test-tube holder
 Masking tape
 Glass-marking pencil
 10-mL graduated cylinder
 Bunsen burner or hot plate
 Iodine solution
 20 mL Honey solution
 20 mL Egg white and water mixture
 20 mL Corn oil
 20 mL Lettuce and water mixture
 20 mL Gelatin and water
Biology HSL
Department of Science












20 mL Melted butter
20 mL Potato and water
20 mL Apple juice and water mixture
20 mL Distilled water
20 mL Unknown substance
10 Dropper pipettes
Paper towels
600-mL Beaker
Brown paper bag
Sudan III stain
Biuret reagent
Benedict’s solution
Page 19
6-12 Student Laboratory Contract
I have been instructed in the necessary safety procedures required in this course. I agree to
abide by the following guidelines:















Safety apparel will be worn when specified by the instructor.
Long or loose hair will be tied back. Excessively loose clothing or jewelry will not be
worn.
All safety rules and regulations will be followed.
There will be no drinking or eating in the laboratory.
Experiments will be done in the specified order with the prescribed quantities of
chemicals.
Only the chemicals specified by the teacher will be used. No unauthorized
experimentation will be done.
The proper use of safety equipment and correct evacuation procedures will be
followed.
Wash hands thoroughly before beginning and after completing an experiment.
Contact lenses will not be worn during specified experiments.
Horseplay or other inappropriate behavior will not be tolerated during laboratory
experiments.
Never taste chemicals or smell them directly.
Never pick up broken glass with bare hands.
Report all accidents, no matter how minor, to the teacher.
Never work without teacher supervision in the lab.
Do not remove any chemicals or equipment from the lab without the teacher’s
permission.
Failure to follow these guidelines may result in reduction in grade, disciplinary action,
and/or exclusion from laboratory activities.
Student Signature _______________________________________
______________
Date
Parent Signature _________________________________________
______________
Date
Biology HSL
Office of Academics and Transformation
Page 20
Lab Roles and Descriptions
Cooperative learning activities are made up of four parts: group accountability, positive
interdependence, individual responsibility, and face-to-face interaction. The key to making
cooperative learning activities work successfully in the classroom is to have clearly defined
tasks for all members of the group. An individual science experiment can be transformed into a
cooperative learning activity by using these lab roles and responsibilities:
Project Director (PD)
The project director is responsible for the
group.
 Reads directions to the group
 Keeps group on task
 Is the only group member allowed
to talk to the teacher
 Assists with conducting lab
procedures Shares summary of
group work and results with the
class
Materials Manager (MM)
The materials manager is responsible for
obtaining all necessary materials and/or
equipment for the lab.
 Picks up needed materials
 Organizes
materials
and/or
equipment in the work space
 Facilitates the use of materials
during the investigation
 Assists with conducting lab
procedures
 Returns all materials at the end of
the lab to the designated area
Technical Manager (TM)
The technical manager is in charge of
recording all data.
 Records data in tables and/or
graphs
 Completes conclusions and final
summaries
 Assists with conducting the lab
procedures
 Assists with the cleanup
Safety Director (SD)
The safety director is responsible for
enforcing all safety rules and conducting
the lab.
 Assists the PD with keeping the
group on-task
 Conducts lab procedures
 Reports any accident to the
teacher
 Keeps track of time
 Assists the MM as needed.
When assigning lab groups, various factors need to be taken in consideration:
 Always assign the group members, preferably trying to combine in each group a variety of
skills. For example, you can place an “A” student with a “B”, “C”, and a “D” and or “F”
student.
 Evaluate the groups constantly and observe if they are on task and if the members of the
group support each other in a positive way. Once you realize that a group is dysfunctional,
re-assign the members to another group.
Biology HSL
Office of Academics and Transformation
Page 21
Writing in Science
A report is a recap of what a scientist investigated and may contain various sections and
information specific to the investigation. Below is a comprehensive guideline that students can
follow as they prepare their lab/activity reports. Additional writing templates can be found in the
District Science website.
Parts of a Lab Report: A Step-by-Step Checklist
Title (underlined and on the top center of the page)
Benchmarks:
 A summary of the main concepts that you will learn by carrying out the experiment.
Problem Statement:
 Identify the research question/problem and state it clearly.
Hypothesis(es):
 State the hypothesis carefully, logically, and, if appropriate, with a calculation.
1. Write your prediction as to how the independent variable will affect the dependent
variable using a complete statement that is testable or an IF-THEN-BECAUSE
statement:
a. (Introductory) If (state the independent variable) is (choose an action), then (state
the dependent variable) will (choose an action), because (describe reason for event).
Materials and activity set up:
 List and describe the equipment and the materials used. (e.g., A balance that measures with
an accuracy of +/- 0.001 g)
 Provide a diagram of the activity set up describing its components (as appropriate).
Procedures:
 Do not copy the procedures from the lab manual or handout.
 Summarize the procedures that you implemented. Be sure to include critical steps.
 Give accurate and concise details about the apparatus (diagram) and materials used.
Variables and Control Test:
 Identify the variables in the experiment. There are three types of variables:
1. Independent variable (manipulated variable): The factor that can be changed by the
investigator (the cause).
2. Dependent variable (responding variable): The observable factor of an investigation
resulting from the change in the independent variable.
3. Constant variable: The other identified independent variables in the investigation that are
kept or remain the same during the investigation.
 Identify the control test. A control test is the separate experiment that serves as the standard
for comparison and helps identify effects of the dependent variable
Data:
 Ensure that all observations and/or data are recorded.
1. Use a table and write your observations clearly. (e.g., color, solubility changes, etc.)
Biology HSL
Office of Academics and Transformation
Page 22
2. Pay particular attention to significant figures and make sure that all units are stated.
Data Analysis:
 Analyze data and specify method used.
 If graphing data to look for a common trend, be sure to properly format and label all aspects
of the graph (i.e., name of axes, numerical scales, etc.)
Results:
 Ensure that you have used your data correctly to produce the required result.
 Include any errors or uncertainties that may affect the validity of your result.
Conclusion and Evaluation:
 First Paragraph: Introduction
1. What was investigated?
a. Describe the problem.
2. Was the hypothesis supported by the data?
a. Compare your actual result to the expected (from the literature, or hypothesis) result.
b. Include a valid conclusion that relates to the initial problem or hypothesis.
3. What were your major findings?
a. Did the findings support (or not) the hypothesis as the solution to the problem?
b. Calculate the percentage error from the expected value.

Middle Paragraphs: Discuss the major findings of the experiment.
1. How did your findings compare with other researchers?
a. Compare your result to other students’ results in the class.
i. The body paragraphs support the introductory paragraph by elaborating on the
different pieces of information that were collected as data.
ii. Each finding needs its own sentence and relates back to supporting or not
supporting the hypothesis.
iii. The number of body paragraphs you have will depend on how many different
types of data were collected. They should always refer back to the findings in the
first paragraph.

Last Paragraph: Conclusion
1. What possible explanations can you offer for your findings?
a. Evaluate your method.
b. State any assumptions that were made which may affect the result.
2. What recommendations do you have for further study and for improving the experiment?
a. Comment on the limitations of the method chosen.
b. Suggest how the method chosen could be improved to obtain more accurate and
reliable results.
3. What are some possible applications of the experiment?
a. How can this experiment or the findings of this experiment be used in the real world
for the benefit of society?
Additional writing formats and
http://science.dadeschools.net
Biology HSL
Office of Academics and Transformation
resources
can
be
found
in
the
Science Website:
Page 23
Hands-on Activities
Biology HSL
Department of Science
Page 24
Teacher
Seed Germination Inquiry Lab
NGSSS:
SC.912.N.1.1 Define a problem based on a specific body of knowledge, for example: biology,
chemistry, physics, and earth/space science, and do the following: 1) pose questions about the
natural world, 2) conduct systematic observations, 3) examine books and other sources of
information to see what is already known, 4) review what is known in light of empirical evidence,
5) plan investigations, 6) use tools to gather, analyze, and interpret data (this includes the use of
measurement in metric and other systems, and also the generation and interpretation of
graphical representations of data, including data tables and graphs), 7) pose answers,
explanations, or descriptions of events, 8) generate explanations that explicate or describe
natural phenomena (inferences), 9) use appropriate evidence and reasoning to justify these
explanations to others, 10) communicate results of scientific investigations and,11) evaluate the
merits of the explanations produced by others. (AA)
Purpose of the Lab/Activity:
 Develop the steps of the scientific method by writing hypothesis and gathering data.
 To distinguish between qualitative and quantitative data.
 Utilize tools of measurements and emphasize importance of using the metric system.
 Practice making observations and inferences.
 Measure seed germination percentage and rate.
 Analyze the requirements for seed germination.
 Examine the effect of various treatments on seed germination.
Prerequisites:
 Students should know laboratory safety rules and proper use of laboratory equipment.
 Students should be assigned their lab roles prior to the beginning of the activity.
 Students should know the steps of the scientific method.
Materials (per group): *depends on problem statement selected by group
 Paper Towels
 Light source
 Ruler
 Box *
 Radish seeds
 Salt*
 Petri dish or potting cups
 Hot Plates *
 Soil (different kinds*)
 Pollutants (e.g. detergent, soap)*
 Water
Procedures: Day of Activity:
What the teacher will do:
a. Describe the objective of the activity and guide students in their thinking of
possible problem statements as they consider the given inquiry questions.
1. What is the problem statement? Have students synthesize their own
Before
problem statements and check for the testability. Answers will vary, see
activity:
suggested research question in student version. Examples may: What is
the effect of detergent as a pollutant on radish seed germination?
2. State the hypothesis. Again, allow time for the students to collaborate on
their own. Ensure the use of a COMPLETE statement or IF-THENBECAUSE statement. Answers will vary but should include both
Biology HSL
Department of Science
Page 25
Teacher
During
activity:
After
activity:
independent and dependent variable.
3. Identify the independent and dependent variable. Answers will vary.
Only the independent variable should be different. Make sure each
group is only identifying ONE independent variable to promote the
importance of a controlled experiment. Example: Independent: type of
soil, Dependent: seed germination. All groups should have the same
dependent variable which is seed germination.
4. Identify the variables held constant. Answers will vary. Example: type of
seeds, amount of soil and water provided.
5. Explain the tests conducted, identify both the experimental and control
test. Answers will vary.
Experimental Test: Example: varying concentration of pollutantsdetergent (1%, 2%, 5%, 10%) in soil
Control Test: 0% of pollutant-detergent in soil
6. List the number of trials per test. Answers will vary; but at least 3 trials
per test should be conducted.
b. Students’ misconceptions should be addressed. Some common
misconceptions are: There is no universal scientific method. If a hypothesis
proven to be false the experiment has failed. Quantitative data and
qualitative data are the same. If two events occur repeatedly, one event
causes the other. Scientific-sounding studies in tabloid magazines are true.
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
proper lab protocol.
b. Review and approve the individual problem statements and hypotheses
before the students begin their experiments.
c. Review the experimental design diagram by asking individual students in
groups to explain the different parts of the experiment.
d. Do NOT provide lab materials for groups until you have approved their
experimental design diagram.
e. Follow laboratory procedural plan; making sure to model proper laboratory
safety and use of equipment.
f. Emphasize importance of data collection by groups.
g. Ask the following questions:
1. Do you think the independent variable affected the hypothesis? Why do
you think? Explain your answer.
2. What factors caused differences in your data? What other variables
should be tested from the results you obtained?
3. Does the number of trials affect the results you collected? Explain why
or why not?
4. What other hypotheses could you have made from this problem
statement? List possible ones.
5. Would you change the problem statement you came up with? Why or
why not? What would have been an example of a better problem
statement?
What the teacher will do:
a. Have the students record their group data and hypothesis on class data
table, if the problem statements are the same across the groups.
Biology HSL
Department of Science
Page 26
Teacher
b. Analyze the different class data; making sure to note the importance of
multiple trials, and repeatability in scientific investigations.
c. Have students graph the data of their experiment; allow time to work with
individual groups on what way is best to represent their data. (Example:
the Dependent variable is the Responding variable that in a graph is
recorded on the Y-axis; the Manipulated variable is the Independent
variable and is graphed on the X-axis.
Extension:
 Interactive Scientific Method Investigation:
http://sunshine.chpc.utah.edu/labs/scientific_method/sci_method_main.html
 GIZMO: Growing Plants, Seed Germination, Germination
Biology HSL
Department of Science
Page 27
Student
Basic Components of Experimental Design
Knowledge of the basic concepts of experimental design and the ability to apply these concepts
represent two different levels of learning. Students may be able to define the terms or identify
examples in a classroom investigation yet fail to apply the concepts when designing an
experiment. Providing many opportunities for students to evaluate class experiments,
descriptions of experiments, as well as designing and conducting experiments can improve their
understanding of the fundamentals of experimental design.
Title:
An Experimental Design Diagram summarizes the problem statement,
hypothesis, manipulated variable(s), responding variable (s), constant
variables, number of tests and trials, control experiment and repeated
trials.
A problem statement is a question about possible relationships between
manipulated and responding variables in a situation that implies
something to do or try.
Problem
Statement:
Hypothesis:
A hypothesis is the investigator’s prediction of a possible specific
relationship between a manipulated variable (cause) and a responding
variable (effect) that provides a testable answer to the problem.
Independent
(Manipulated)
Variable:
Manipulated variables are the factors that can be changed by the
investigator (causes). Manipulated variables are also called the
independent variables.
Number of Tests:
The number of sets of tests that make up the whole experiment.
Number of Trials The trials are the number of experimental repetition, objects, or
per Test:
organisms tested during each test of a manipulated variable.
Dependent
(Responding)
Variable:
Responding variables are the observable factors of an investigation.
The result or happen (effects) when a manipulated variable is changed
by the investigator. Responding variables are also called the dependent
variables.
A control test is the separate test that serves as the standard for
comparison to identify experimental effects, changes of the responding
variable resulting from changes made on the manipulated variable.
Control Test:
Variables
Constant:
Held Constant variables are the other identified manipulated variables in the
situation that are kept or remain the same during the investigation.
Biology HSL
Department of Science
Page 28
Student
Seed Germination Inquiry Lab
NGSSS:
SC.912.N.1.1 Define a problem based on a specific body of knowledge, for example: biology,
chemistry, physics, and earth/space science, and do the following: 1) pose questions about the
natural world, 2) conduct systematic observations, 3) examine books and other sources of
information to see what is already known, 4) review what is known in light of empirical evidence,
5) plan investigations, 6) use tools to gather, analyze, and interpret data (this includes the use of
measurement in metric and other systems, and also the generation and interpretation of
graphical representations of data, including data tables and graphs), 7) pose answers,
explanations, or descriptions of events, 8) generate explanations that explicate or describe
natural phenomena (inferences), 9) use appropriate evidence and reasoning to justify these
explanations to others, 10) communicate results of scientific investigations and,11) evaluate the
merits of the explanations produced by others. (AA)
Background: A seed is essentially a baby in
a suitcase carrying its lunch. "Baby" refers to
the embryo, or immature plant, that will grow
and develop into the seedling and ultimately
the mature plant. The "suitcase" is the seed
coat that surrounds the seeds and "lunch"
refers to the nutritive source for the
germinating seedling.
The food for the
germinating seedling may be stored in part of
the embryo itself, such as the fleshy
cotyledons of a bean seed, or it may take
other forms including endosperm, which is a
special starch-rich storage tissue that
surrounds the embryo.
It’s not easy to tell if a seed is “dead.” Only if it fails to germinate when provided the proper
conditions and any dormancy mechanisms are broken can we consider a seed “dead.” Seed
companies typically test the germination of seeds before sale. The results of these tests, the
germination percentage, are typically provided on a seed packet.
Many different factors can affect the germination percentage of plants. Think about what
conditions are needed for seeds of the type you selected to germinate. The germination
percentage tells you what fractions of seeds germinate out of a population of seeds. The
equation to calculate germination percentage is:
GP = seeds germinated/total seeds x 100
The radish (Raphanus sativus) is an edible root vegetable of the Brassicaceae family that was
domesticated in Europe in pre-Roman times. They are grown and consumed throughout the
world. Radishes have numerous varieties, varying in size, color and duration of required
cultivation time. There are some radishes that are grown for their seeds; oilseed radishes are
grown, as the name implies, for oil production. Radish can sprout from seed to small plant in as
little as 3 days.
Biology HSL
Department of Science
Page 29
Student
Purpose: The purpose of this lab experience is to provide an opportunity to:
1. Synthesize an original problem statement and hypothesis
2. measure seed germination percentage and rate
3. learn the requirements for seed germination
4. study the effect of various treatments on seed germination
Instructions:
1. Choose problem statement.
2. Complete Experimental Design diagram.
3. Design experiment. Do not proceed until you receive approval from your teacher.
4. Obtain supplies needed.
5. Record data in provided data tables.
Problem Statement:
Identify the question (problem to investigate) and state it clearly. (See below for guidelines)
____________________________________________________________________________
Inquiry questions might be categorized according to the main factors affecting seed germination.
Choose only ONE question to research. (Feel free to choose an original problem statement.)
Water
o Is water essential for germination?
o If we used hot water, would the seeds
germinate?
o Does water salinity affect seed
germination?
o How do pollutants affect seed
germination?
Light
o Is light or darkness essential for seeds to
germinate?
o How does light intensity affect seed
germination?
Air
o Do seeds need air to germinate?
Soil
o Is soil necessary for seed germination?
o What type of soil is best for seed
germination?
Temperature
o How does temperature affect germination?
Seed Structure
o Is the seed coat necessary for germination?
o Can a seed germinate in soil if it is placed
upside down?
o How does the number of seeds affect
germination rates?
o What is the effect of radiation on seed
germination?
Experimental Design: Variables
Based on the problem statement selected identify the following variables that may affect
germination:
Independent Variable: __________________________________________________________
Dependent Variable: ___________________________________________________________
Controlled Variable(s): __________________________________________________________
Constant Variable(s): ___________________________________________________________
Biology HSL
Department of Science
Page 30
Student
Hypothesis(es):
Write your prediction as to how the independent variable will affect the dependent variable. You
may use an IF-THEN-BECAUSE statement to help you:
If (state the independent variable) is (choose an action), then (state the dependent variable) will
(choose an action), because (describe reason for event).
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
Materials: Identify any materials you might need to complete the experiment.
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
Procedures: Design an experiment to test your hypothesis.
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
Biology HSL
Department of Science
Page 31
Student
Data:
Part I. Species Selection and Research. Record as much data about the seeds as possible.
Common name: ___________________
Family Name:
Scientific name: _____________________
___________________
Part 2: Tables (Quantitative Data)
Table 1. Germination data for seeds in Control Group
Independent
Variable
Total Seeds in
Treatment
# Seeds Germinated
% Seeds Germinated
Table 2. Germination data for seeds in Experimental Group
Independent
Variable
Total Seeds in
Treatment
# Seeds Germinated
% Seeds Germinated
Part 3: Observations (Qualitative Data)
____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
Biology HSL
Department of Science
Page 32
Student
Part 4: Graph
Use the graph provided that is provided at the end. Remember the Dependent variable is the
Responding variable that in a graph is recorded on the Y-axis; the Manipulated variable is the
Independent variable and is graphed on the X-axis.
Analysis:
1. What was the final germination percent of your seeds for the Control and Experimental
groups? Were either/both of them what you expected? Explain.
2. On a separate sheet of graph paper, plot Percent Germination per Day for both the
Experimental and Control groups on the same graph. Be sure to include a key.
3. What did the graph you created in #2 above tell you about seed germination?
4. Write a summary of the experiment that explains what you did. In your summary,
address questions you had during the experiment, conclusions you made, and
opportunities for further research. Use additional paper if necessary.
Conclusion:
Write a conclusion using the “Power Writing Model 2009”. Make sure to answer the following
questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 33
Student
Graph Title: ___________________________________________________________
Biology HSL
Department of Science
Page 34
Student
Experimental Design Diagram
Directions: Fill out the experimental design diagram for the seed germination experiment. You
will not begin the experiment until it has been approved by the teacher.
Title:
Problem
Statement:
Hypothesis:
Independent
(Manipulated)
Variable:
Number of Tests
Number of
per Test:
Trials
Dependent
(Responding)
Variable:
Control Test:
Variables
Constant:
Held
Teacher Signature: ______________________________
Biology HSL
Department of Science
Page 35
Teacher
Limiting Factors
(Adapted from the “Oh Deer” activity)
NGSSS:
SC.912.L.17.5 Analyze how population size is determined by births, deaths, immigration,
emigration, and limiting factors (biotic and abiotic) that determine carrying capacity. (AA)
Purpose of the Lab/Activity:
 Identify and describe the essential components of habitat.
 Describe the importance of good habitat for animals.
 Define “limiting factors.”
 Recognize that some fluctuations in wildlife populations are natural as ecological systems
undergo constant change.
 Graphing the data collected to show how population size differs over time and with
changes in the environment.
Prerequisites:
 An understanding of the components of an ecosystem, organism’s role and interactions
that occur between them.
 The difference between abiotic and biotic factors.
 The resources necessary for an organism to survive.
Materials (per group):
 open space
Procedures: Day of Activity:
What the teacher will do:
a. Ask the following question in order to review the basic needs of animals:
1. Identify some of the basic needs of animals.
2. Define the concept of a “limiting factors” in your own words.
b. Before going outside, give directions on how to play. Impress upon the
students that being honest is the only way to obtain accurate scientific data
for the graphing activity. In nature, cheating is not an option!
Before
c. Explain that habitats provide: shelter, food, water, space, mates, etc. This
activity:
game simulates the search for three of these: shelter, food and water.
d. Once outside, students will count off in fours. 1s, 2s, and 3s are one side of
the field. 4s are on the other.
e. Space the two lines facing each other at least 20 yards apart. The width of
the activity area should be slightly wider than the habitat line.
f. The 4s will represent the deer.
g. The 1s, 2s, 3s will be the habitat components.
What the teacher will do:
a. Monitor students during the activity to make they are not cheating by
changing their sign after a round as begun. You may provide students with
During
limiting factors card instead of having them do signs.
activity:
b. Assist them at the end of each round to make sure they are following the
procedure. Emphasize step 7.
c. Occasionally the students representing habitat will conspire to all be the
Biology HSL
Department of Science
Page 36
Teacher
same component, thereby “killing” most, if not, all deer not seeking that
component. Don’t discourage this behavior; explain that the habitat may
have suffered a drought, famine or fire, which resulted in a lack of water,
food or shelter.
d. Remind students to collect data at the end of each round; each round
symbolizes a year.
Part B: Effects of a Flood or Drought
1. Repeat steps 1 – 8 from Part A.
2. On round two, the quietly tell all the resources to become water for
round two since there is a flood predicted for that year.
OR
On round two, quietly tell all the resources to be shelter for round two.
There is no food or water available due to a drought that is occurring in
year two.
3. Continue rounds 3-10 as normal, allowing the resources to choose to be
food, water, or shelter as they did in Game #1.
4. When the graph is constructed after round 10, note the effects of the
drought or the flood on the deer population. Use the graph to see how
long it took for the deer population to recover - if they did recover.
Part C: Predator Prey Simulation
1. Repeat steps 1 – 8 from Part A.
2. On round four, the teacher will introduce a predator such as a mountain
lion or a wolf into the situation.
3. The predator starts in a designated "predator den” area off to the side.
4. The predator has to skip or hop. This reduces the possibility of violent
collisions between deer and predators.
5. The predators can only tag deer when they are going towards the
habitat and are between the habitat and deer lines.
6. Once a deer is tagged, the predator escorts the deer back to the
predator den. This simulates the time it takes the predator to eat the
deer.
7. The "eaten” deer is now a predator.
8. Predators that fail to tag someone die and become a resource. That is,
in the next round, the predators that died join the habitat line. They will
become available to surviving deer as either food, water, or shelter.
9. During each round, keep track of the predators as well as the deer.
10. Incorporate the data into the graphs.
e. Ask the following questions:
1. What were the limiting factors for population growth in this simulated
ecosystem? Can these factors change over time?
2. Ecologists have found that no organism can experience indefinite
exponential growth, yet Homo sapiens have experienced exponential
growth for hundreds of years. How have humans modified the limiting
factors of our population growth?
Biology HSL
Department of Science
Page 37
Teacher
After
activity:
What the teacher will do:
a. Return to classroom, to work on analysis of lab.
b. Answer Key for Results/Conclusion:
1. List the basic needs of animals. food, water, shelter, and adequate
space
2. Describe the relationship between resource availability and population
growth or decline. When resources are available populations grow until
they reach their carrying capacity. If resources become limited then the
population will decline.
3. Define “limiting factors” and provide three examples. Limiting factors
prevent the continued growth of a population; Examples: predators,
drought, disease, habitat loss, pollution, hunting, reduced dietary items,
weather, parasites, etc.
4. What is the carrying capacity for the deer population according to your
graph? Answers will vary; must be determined using their group’s graph.
Carrying capacity is the maximum population size a certain environment
can support for an extended period of time.
5. Once the deer population goes significantly above carrying capacity,
describe what happens to the deer population in the years following.
The deer population naturally increases until it overshoots the carrying
capacity. At this point, the environment can no longer provide for the
species, due to the limiting factors which in this activity was food, water
and shelter. The deer population, due to lack of resources, will begin to
die out, allowing the environment to recover. As the environment
recovers, the species population is able to flourish once more.
c. Examine the graph.
1. What happened to the population size between years 1 and 2? declined
2. What happened to the population size between years 4 and 5?
increased
3. If the environmental conditions in year 9 are the same as occurred
between years 2 and 3, what can you expect to happen to the
population between years 8 and 9? Why? The environmental conditions
were favorable between years 2 and 3 and the population increased.
The population is on the rise from years 6 to 8, but the population in
year 8 is still at or below the population at year 2. With similar favorable
conditions as between years 2 to 3, the population should continue to
increase into year 9.
d. Have groups answer the following questions:
1. How did you determine the carrying capacity?
Biology HSL
Department of Science
Page 38
Teacher
2. Describe how the activity modeled the significance of limited resources
in regards to a species’ population.
3. List some possible sources of errors and how they could affect the lab
results.
4. Make suggestions for improving the lab to make the simulation more
accurate and effective.
Extension:
 Online Activity 35.2: Population Growth of Two Different Species www.biology.com
Students plot exponential growth of bacteria as they view a video. Then they plot and
analyze data showing changes in a hypothetical population of grizzly bears. Then they
compare exponential growth to population limited by environmental factors.
 Gizmo: Rabbit Population by Season
Biology HSL
Department of Science
Page 39
Student
Limiting Factors
(Adapted from the “Oh Deer” activity)
NGSSS:
SC.912.L.17.5 Analyze how population size is determined by births, deaths, immigration,
emigration, and limiting factors (biotic and abiotic) that determine carrying capacity. (AA)
Background:
A variety of factors affects the ability of wildlife to successfully reproduce and to maintain their
populations over time. Disease, predator/prey relationships, varying impacts of weather
conditions from season to season (e.g., early freezing, heavy snows, flooding, and drought),
accidents, environmental pollution, and habitat destruction and degradation are among these
factors.
Some naturally-caused as well as culturally-induced limiting factors serve to prevent wildlife
populations from reproducing in numbers greater than their habitat can support. An excess of
such limiting factors, however, leads to threatening, endangering, and eliminating whole species
of animals. The most fundamental of life’s necessities for any animal are food, water, shelter,
and space in a suitable arrangement. Without these essential components, animals cannot
survive.
Wildlife populations are not static. They continuously fluctuate in response to a variety of
stimulating and limiting factors. Natural limiting factors tend to maintain populations of species
at levels within predictable ranges. This kind of “balance in nature” is not static, but is more like
a teeter-totter than a balance. This cycle appears to be almost totally controlled by the habitat
components of food, water, shelter, and space, which are also limiting factors. Habitat
components are the most fundamental and thereby the most critical of limiting factors in most
natural settings.
Problem Statement:
 Part A: How will resource availability affect the population of a species in an ecosystem?
 Part B: How will a density-independent limiting factor (flood or drought) affects the
population of species in an ecosystem?
 Part C: How will a density-dependent limiting factor (predator) affect the population of
species in an ecosystem?
Vocabulary: reproduction, predator, prey, degradation, limiting factor, habitat, species,
population, resource, carrying capacity
Hypothesis:
Part A: ___________________________________________________________________
Part B: ___________________________________________________________________
Part C: ___________________________________________________________________
Biology HSL
Department of Science
Page 40
Student
Materials (per group):
 open space
Procedures:
Part A: Effects of Resource Availability
1. Make a hypothesis based on the problem statement above for the resources being
supplied.
2. Obtain a number (1 through 4) from your teachers.
a. Deer = 1
b. Resources = 2, 3, 4
3. Go outside. Deer will all stand on one side of the sidewalk and all the resources will stand
on the opposite side. Stand with backs toward other group.
4. Each student should choose a sign to make for the first round. Students 2 – 4 will decide
what resource they will be and all the deer will decide what resource they are looking for.
Resources will include food, water, and shelter. A deer can choose to look for any of its
needs in each round, but cannot change its mind after turning around to face the
"habitat".
5. Make the sign of the resource.
a. Food = Rub stomach with hand
b. Water = Raise hand to the mouth as if to drink from a cup
c. Shelter = Raise arms over head
6. When teacher says “GO,” turn around and face other group. Continue to hold sign.
Resources DO NOT move. They wait for a deer to come to get them. Resources or
habitat components stay in place on their line until a deer needs them. If no deer needs
a particular habitat component during a round, the habitat component just stays where it
is in the habitat. The resource person can change which component it is at the beginning
of each round.
7. When deer see a student in the habitat making the sign they need, they should walk
quickly, but calmly, to get that student and take them back to the deer side. This
represents the deer successfully meeting its needs and reproducing. Those deer who do
not meet their needs remain in the environment to provide habitat for the other deer in the
next round.
8. Record the number of deer in each round for graphing later.
9. Predict what will happen in the next round.
10. Repeat steps 3 – 8, ten more times.
Part B: Effects of a Flood or Drought
Purpose: Analyze the impact that a disaster has on an animal population.
1. Repeat steps 1 – 8 from Part A.
2. On round two, the teacher will make a modification.
3. Continue rounds 3-10 as normal, allowing the resources to choose to be food, water, or
shelter as they did in Game #1.
4. When the graph is constructed after round 10, note the effects of the drought or the flood
on the deer population. Use the graph to see how long it took for the deer population to
recover - if they did recover.
Biology HSL
Department of Science
Page 41
Student
Part C: Predator Prey Simulation
1. Repeat steps 1 – 8 from Part A.
2. On round four, the teacher will introduce a predator such as a mountain lion or a wolf into
the situation.
3. The predator starts in a designated "predator den” area off to the side.
4. The predator has to skip or hop. This reduces the possibility of violent collisions between
deer and predators.
5. The predators can only tag deer when they are going towards the habitat and are
between the habitat and deer lines.
6. Once a deer is tagged, the predator escorts the deer back to the predator den. This
simulates the time it takes the predator to eat the deer.
7. The "eaten” deer is now a predator.
8. Predators that fail to tag someone die and become a resource. That is, in the next round,
the predators that died join the habitat line. They will become available to surviving deer
as either food, water, or shelter.
9. During each round, keep track of the predators as well as the deer.
10. Incorporate the data into the graphs.
Observation/Data:
Table 1: Effects of Resources on Deer Population
Year (round)
Deer Population (#)
Observations
0
1
2
3
4
5
6
7
8
9
10
Biology HSL
Department of Science
Page 42
Student
Table 2: Effects of Drought or Floods on Deer Population
Year (round)
Deer Population (#)
Observations
0
1
Flood or Drought affect
resources
2
3
4
5
6
7
8
9
10
Table 3: Effects of Predator on Deer Population
Year (round)
Deer (#) at end
Predator (#) at end
0
1
2
3
4
5
6
7
8
9
10
Biology HSL
Department of Science
Page 43
Student
Data/Graphs:
Graph the results from your data tables to show the rise and fall of the deer population. Make
sure to label your axis(s) and include the units of measurements. Remember the Dependent
variable is the Responding variable that in a graph is recorded on the Y-axis; the Manipulated
variable is the Independent variable and is graphed on the X-axis.
Graph Title: Effects of Resources on Deer Population
Biology HSL
Department of Science
Page 44
Student
Graph Title: Effects of Drought or Floods on Deer Population
Biology HSL
Department of Science
Page 45
Student
Graph Title: Effects of Predator on Deer Population
Biology HSL
Department of Science
Page 46
Student
Analysis:
1. List the basic needs of animals.
2. Describe the relationship between resource availability and population growth or decline.
3. Describe reasons for the fluctuation of the population.
4. Define “limiting factors” and provide three examples.
5. What is the carrying capacity for the deer population according to your graph?
6. Once the deer population goes significantly above carrying capacity, describe what
happens to the deer population in the years following.
7. How did the introduction of a predator affect the deer population in terms of population
size and deer behavior?
8. What was the peak population for the deer population when there were no predators?
What happened after the peak? Why?
9. How might this “simulation” differ from the real relationship between deer and their
environment? Write at least two differences and explain.
10. How do you think this “simulation” game differs from real predator-prey relationships?
Explain.
Conclusion:
Write a conclusion using the “Power Writing Model 2009”. Make sure to answer the following
questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 47
Teacher
Energy and Ecosystems
NGSSS:
SC.912.L.17.9 Use a food web to identify and distinguish producers, consumers, and
decomposers. Explain the pathway of energy transfer through trophic levels and the reduction of
available energy at successive trophic levels. (AA)
Purpose of the Lab/Activity:
 Differentiate between a food chain and food web.
 Identify and distinguish the main components of an ecosystem.
 Explain the pathway of energy through trophic levels.
 Analyze the reduction of energy available at successive trophic levels.
Prerequisites:
 Understand the role of photosynthesis in ecosystems.
 A general sense of the major groups of organisms in order to help determine their role
and habitat.
 Know the law of conservation of energy.
Materials:
 yarn
 organism cards
 hole-puncher
 scissors
Procedures: Day of Activity:
What the teacher will do:
a. Gather materials for each group, print organism cards. Punch holes in each
card and attach a piece of string to hang the card around student’s neck.
b. Review the concept of ecosystems by asking students what they think of
when they hear the word “Florida Marine Ecosystem.” List their responses
as a flow chart. Ask students how the listed items (e.g. algae, plants
shrimp, manatee etc.) interact.
c. As students respond (e.g. the manatee lives in the oceans, the shrimp eats
the algae, etc.), draw connecting lines between the listed items.
d. Ask students what they think the diagram looks like (a spider web).
Before
e. Introduce the concept of food chains and food webs. Introduce and show
activity:
the Brain Pop free video. Following the video on food webs, ask for
comments from students. What was most memorable about the film?
f. Move the students to an open area. Without in-depth explanation, have
students stand in a large circle in an open area (preferable outdoors). The
teacher should stand in the center of the circle. Explain that students will be
transformed into a marine ecosystem.
g. Address some of the common misconceptions: Food chains and food webs
are the same. The top of a food chain has the most energy because it
accumulates up the chain. Organisms higher in the food-web eat everything
that is lower in the food web. Green plants are the only producers.
Biology HSL
Department of Science
Page 48
Teacher
During
activity:
After
activity:
What the teacher will do:
1. Distribute organism cards to the students.
2. Emphasize that the ultimate source of energy is the sun. The teacher will
represent the sun and stand in the middle of the circle.
3. Have individuals identify energy (or food) sources. As each one is
identified, pass a ball of yarn between the two people. For example: One
student is a manatee (primary consumer), and one is the seagrass
(producer). The manatee will take the ball of yarn, hold onto one end of the
string and pass the rest of the ball to the seagrass. The seagrass will hold
onto the yarn and pass the rest of the ball to “what it eats,” in this case, the
sun. Be sure that the sun is connected to all the plants. Once the string
gets to the sun, cut it off, and start again in another place.
4. Continue building the web, making the relationships as complex as time
and numbers of participants allow.
5. Define terms such as herbivore, carnivore, insectivore, decomposer, etc
and include them in your web. [Note that insectivores are specialized
carnivores.]
6. Students can be in as many chains as you have time for; they do not have
to be in all of the chains.
7. Discuss the nature and complexity of the food web that is formed. Note
that it is not as complete or complex as most natural food webs, but that it
illustrates how living things are dependent upon one another. Biologists
feel that more complex food webs are more stable than simple ones.
8. Ask the following questions:
1. Identify the following: producers, consumers, decomposers, scavenger,
detritivore.
2. What does a food chain have in common with a food web?
3. How is a food chain different from a food web?
4. How does energy flow through an ecosystem?
What the teacher will do:
a. After discussing the food web, the teacher could ask what would happen if
a species were removed from the web.
- Have a student pull on the strings they hold; anyone who feels a tug is
directly affected by that organism.
- Those “organisms” affected directly could then pull on their strings and
more organisms are affected.
- Have different students pull on their strings.
- When the “sun” pulls on its string, everyone should be affected.
b. Have some organisms drop their string (become extinct) and see who is
affected.
c. Have students tell you if certain populations will grow or decline.
- The teacher can represent nature and cause any type of problem to
occur; for example, excess nutrients could be introduced that caused
eutrophication, but some fish were able to swim away and some types
of plants survived.
- The teacher defines what happens and who is affected; the students
then reveal what would happen.
d. New species could also move into the area at any time disrupting the web.
Biology HSL
Department of Science
Page 49
Teacher
-
What impact will it have on the biodiversity of the ecosystem?
Discuss what would happen if all of the predators were removed.
- Some species might exhaust their food supply and starve, but others will
continue to reproduce only until the food supply becomes limiting or
their interactions limit population size.
f. If desired, discuss the simplified food webs that produce most foods used
by people. Remind the participants that such food webs are inherently
unstable and require large amounts of management (raising/slaughtering
cows, chickens, etc) to avoid problems.
g. Upon returning to the classroom, have students complete a food chain and
food web diagram based on the simulated classroom web.
- Have them present to the class.
- Remind them of the different interactions between plants and animals,
shared food sources, etc.
- Check for any possible errors in identifying the organisms’ role.
h. Discuss the following questions:
1. What does the suffix “troph” mean? nourish
2. What do you think a trophic level is? The position the organism occupies
on the food chain.
3. Compare food chains and food webs. Food webs show how organisms
are connected in many ways (via the transfer of energy and matter),
food chains follow just one path.
4. Provide an example of a food chain. Answers will vary. (Example:
grass frog  snake  hawk
i. Have students complete their individual assignment using their group’s food
web.
j. Answer Key for Results/Conclusion:
1. Explain what would happen if all of the primary consumers became
extinct. The population of secondary and tertiary consumers would
decrease since they would not have a food source, and the population
of the producers would increase since they would not have a predator.
2. Predict what would happen if a non-native species is introduced into the
food web. Introduction of a non-native species could affect the
population of the native species. If they could survive in their new
environment, they would have no natural predators therefore giving
them an advantage. For example the pythons introduced in the
Everglades are eating the Everglades endangered and threatened
species. Reference the video shown prior to beginning lab.
3. Explain why food webs with many species (biodiverse) are more
resilient than those with few species. If the food web only has a few
species, the loss of one species would have a greater impact on the
other parts of the food web.
4. Review your trophic pyramid, do you think there are more organisms at
the base and less organisms as you travel up the pyramid. Yes there
are more organisms in the base, since they must provide the food and
energy needed for the levels above.
5. In theory, the earth could support many more people if we ate at a lower
trophic level. List 2 benefits of doing this.
e.
Biology HSL
Department of Science
Page 50
Teacher
Answers may vary. Examples: fewer acres are needed to support a
single human, do not consume as many toxins as organisms that eat
higher up in the food chain, could support a larger population of
humans.
List 2 drawbacks of eating lower on the food chain.
Answers may vary. Examples: supporting a larger human population
leads to greater pollution, more areas being used for agriculture can
lead to loss of biodiversity
6. Large predatory fish usually are found at the 3 rd or 4th trophic level of an
energy pyramid. What does this mean in terms of energy loss? Due to
the general rule that 10% of the energy in one trophic level transfers to
the next trophic level. The further along the food chain you go, the less
food (and hence energy) remains available. For example, starting with
1000 units of energy at the producer level would be reduced to 100, 10,
1, and 0.1 units of available energy as one moves through trophic
levels.
7. Large predatory animals can also be problematic to eat because of
bioaccumulation and biomagnification of toxins such as lead or mercury
in their habitats. What do those two big words mean and why should this
be considered when discussing food chains and trophic levels.
Bioaccumulation: Chemicals such as mercury are not excreted by
animals or plants. When a plant takes up the mercury
(bioaccumulation), all of that mercury is transferred (biomagnification)
into the next trophic level (likely the zooplankton, such as krill). Krill
need to consume quite a lot of phytoplankton to sustain themselves, and
therefore eat a lot of mercury. In turn, the salmon eat the krill, and
therefore accumulate more mercury. Finally, we eat the fish, so the
mercury becomes a part of us which is an example of biomagnification.
Extension:
 Show the students the following video clip: http://videos.howstuffworks.com/planetgreen/37343-g-word-pet-pythons-gone-wild-video.htm Create a visual that connects the
feeding relationships shown.
 Gizmo: Food Chain
Biology HSL
Department of Science
Page 51
Teacher
Tertiary
consumer
Secondary Consumer
Primary Consumer
Producer
Trophic
Level
Organism
Consumes
Consumed By
Turtle grass
Eel grass
Shoal grass
Autotroph
Autotroph
Autotroph
Manatees
Not eaten
Manatees
Manatee grass
Wigeon grass
Diatoms
Dinoflagellates
Green algae
Brown algae
Autotroph
Autotroph
Autotroph
Autotroph
Autotroph
Autotroph
Manatees
Manatees
Scallops, crabs, shrimp
Zooplankton
Fish, crabs, zooplankton, sea urchins
Sea stars, crabs, sea urchins
Sargassum
Sea lettuce
Scallops
Zooplankton
Conch
Krill
Autotroph
Autotroph
Plankton
Algal cells (phytoplankton)
Seagrasses
Algal cells (phytoplankton)
Sea turtles
Conch, fish larvae
Starfish
Oyster, scallops, sea stars
Lemon sharks, sea turtles, octopi, crabs
Lanternfish
Oysters
Oithona
Fish larvae
Plankton
Algal cells (phytoplankton)
Seagrasses, algae
Crab
Seagrasses, algae, sea stars
Shrimp
Manatee
Emperor
angelfish
Squid
Octopus
Jellyfish
Moray eel
Seagrasses, algal cells
Seagrasses
Worms, sponges, coral animals,
shrimp
Fish, copepods, krill
Fish, copepods, krill
Small fish
Fish, squid, octopus
Starfish
Fish larvae, squids
Crabs. Lanternfish, sea stars
Octopi, squids, emperor angelfish, lemon
sharks
Lanternfish
None
Lanternfish
Dolphin
Tuna
Sea star
Sea anemone
Tiger shark
Shrimp, krill, copepods
Squid, fish
Fish
Scallops, oysters, coral, fish
Small fish, zooplankton
Invertebrates, fish, marine mammals
Fish, invertebrates, fish, marine
mammals
Fish, invertebrates
Lemon shark
Sea turtle
Killer whale
Sea urchins
Scavenger Sea
cucumbers
Marine fungi
Decomposer Marine
Bacteria
Biology HSL
Department of Science
Jellyfish, squids, octopi
Dolphins
Moray eels, dolphin
Crabs, sea turtle
Tiger sharks, lemon sharks
Killer whales, dolphin, tiger sharks
Killer whales
Killer whales, dolphin, tiger sharks
Fish, crabs
Sea stars
Killer whales, tiger sharks
Killer whales, tiger sharks
Lemon sharks, tiger sharks
Fish, invertebrates, marine mammals Top of food chain
Decaying plant and animal matter
Fish
Decaying plant and animal matter
Sea star, fish
Decaying plant and animal matter
Oysters
Decaying plant and animal matter
Oysters
Page 52
Teacher
TURTLE GRASS
TURTLE GRASS
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: manatees
EEL GRASS
EEL GRASS
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: not eaten
SHOAL GRASS
SHOAL GRASS
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: manatees
Biology HSL
Department of Science
Page 53
Teacher
MANATEE GRASS
MANATEE GRASS
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: manatees
WIDGEON GRASS
WIDGEON GRASS
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: manatees
DIATOMS
DIATOMS
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: Scallops, crabs,
shrimp
Biology HSL
Department of Science
Page 54
Teacher
DINOFLAGELLATES
DINOFLAGELLATES
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: zooplankton
GREEN ALGAE
GREEN ALGAE
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: sea turtles,
zooplankton
RED ALGAE
RED ALGAE
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: fish, crabs, sea
urchins, zooplankton
Biology HSL
Department of Science
Page 55
Teacher
BROWN ALGAE
BROWN ALGAE
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: sea stars, crabs, sea
urchins
SARGASSUM
SARGASSUM
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: sea turtles
SEA LETTUCE
SEA LETTUCE
TROPHIC LEVEL: producer
FEEDING TYPE: autotrophic
PREFERRED FOODS: make their
own food
PREDATORS: conch, fish, larvae
Biology HSL
Department of Science
Page 56
Teacher
SCALLOP
SCALLOP
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODS: algae, plant
plankton
PREDATORS: starfish
ZOOPLANKTON
ZOOPLANKTON
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODS: algal cells
PREDATORS: oysters, sea stars,
scallops
CONCH
CONCH
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODS: seagrasses
PREDATORS: lemon sharks, sea
turtles, octopi
Biology HSL
Department of Science
Page 57
Teacher
KRILL
KRILL
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODS: algal cells
PREDATORS: lanternfish
OYSTER
OYSTER
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODS: algal cells
PREDATORS: starfish
OITHONA
OITHONA
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODs: algal cells
PREDATORS: fish larvae, squids
Biology HSL
Department of Science
Page 58
Teacher
FISH LARVA
FISH LARVA
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODs: algae,
seagrasses
PREDATORS: crabs, sea stars,
lanternfish
CRAB
CRAB
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: omnivore
PREFERRED FOODs: algae,
seagrasses, sea stars
PREDATORS: octopi, squid, lemon
sharks
SHRIMP
SHRIMP
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODS: algal cells,
seagrasses
PREDATORS: lanternfish
Biology HSL
Department of Science
Page 59
Teacher
MANATEE
MANATEE
TROPHIC LEVEL: primary
consumer
FEEDING TYPE: herbivore
PREFERRED FOODs: seagrasses
PREDATORS: none
EMPEROR ANGELFISH
EMPEROR ANGELFISH
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODs: worms,
sponges, shrimp
PREDATORS: jellyfish, squid,
octopi
SQUID
SQUID
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODs: fish,
copepods, krill
PREDATORS: dolphins
Biology HSL
Department of Science
Page 60
Teacher
OCTOPUS
OCTOPUS
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish, krill,
copepods
PREDATORS: moray eels, dolphins
JELLYFISH
JELLYFISH
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: small fish
PREDATORS: crabs, sea turtles
MORAY EEL
MORAY EEL
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish, squid,
octopi
PREDATORS: tiger sharks, lemon
sharks
Biology HSL
Department of Science
Page 61
Teacher
LANTERNFISH
LANTERNFISH
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish,
copepods, krill
PREDATORS: killer whales,
dolphins, tiger sharks
DOLPHIN
DOLPHIN
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: squid, fish
PREDATORS: killer whales
TUNA
TUNA
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish
PREDATORS: killer whales,
dolphins, tiger sharks
Biology HSL
Department of Science
Page 62
Teacher
SEA STAR
SEA STAR
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: coral, fish,
scallops, oysters
PREDATORS: fish, crabs
SEA ANEMONE
SEA ANEMONE
TROPHIC LEVEL: secondary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: small fish,
zooplankton
PREDATORS: sea stars
TIGER SHARK
TIGER SHARK
TROPHIC LEVEL: tertiary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish,
invertebrates, marine mammals
PREDATORS: killer whales, tiger
sharks
Biology HSL
Department of Science
Page 63
Teacher
LEMON SHARK
LEMON SHARK
TROPHIC LEVEL: tertiary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish,
invertebrates, marine mammals
PREDATORS: killer whales, tiger
sharks
SEA TURTLE
SEA TURTLE
TROPHIC LEVEL: tertiary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish,
invertebrates,
PREDATORS: lemon sharks, tiger
sharks
KILLER WHALE
KILLER WHALE
TROPHIC LEVEL: tertiary
consumer
FEEDING TYPE: carnivore
PREFERRED FOODS: fish,
invertebrates, marine mammals
PREDATORS: top of food chain
Biology HSL
Department of Science
Page 64
Teacher
SEA URCHINS
SEA URCHINS
TROPHIC LEVEL: scavenger
FEEDING TYPE: omnivore
PREFERRED FOODS: decaying
plant and animal matter
PREDATORS: fish
SEA CUCUMBERS
SEA CUCUMBERS
TROPHIC LEVEL: scavenger
FEEDING TYPE: omnivore
PREFERRED FOODS: decaying
plant and animal matter
PREDATORS: sea stars, fish
MARINE FUNGI
MARINE FUNGI
TROPHIC LEVEL: decomposer
FEEDING TYPE: omnivore
PREFERRED FOODS: decaying
plant and animal matter
PREDATORS: oysters
Biology HSL
Department of Science
Page 65
Teacher
MARINE BACTERIA
MARINE BACTERIA
TROPHIC LEVEL: decomposer
FEEDING TYPE: omnivore
PREFERRED FOODS: decaying
plant and animal matter
PREDATORS: oysters
THE SUN
Biology HSL
Department of Science
The SUN
Page 66
Student
Energy and Ecosystems
NGSSS:
SC.912.L.17.9 Use a food web to identify and distinguish producers, consumers, and
decomposers. Explain the pathway of energy transfer through trophic levels and the reduction of
available energy at successive trophic levels. (AA)
Background: (Source: www.epa.gov)
All organisms in an ecosystem need energy to survive. This energy is obtained through food.
Producers obtain energy by making their own food whereas consumers must feed on other
organisms for energy. This dependence on other organisms for food leads to feeding
relationships that interconnect all living things in an ecosystem. A food chain illustrates the
simplest kind of feeding relationship. For example, in a forest ecosystem, a grasshopper feeds
on plants. The grasshopper is consumed by a spider and the spider is eaten by a bird. Finally,
that bird is hunted by a hawk. A food chain clearly shows this pathway of food consumption.
You could probably think of another food chain for a forest ecosystem. In fact, many different
food chains exist in ecosystems. Although there are many different kinds of food chains, each
food chain follows the same general pattern. A link in a food chain is called a trophic, or feeding
level. The trophic levels are numbered as the first, second, third, and fourth levels, starting with
the producers.
Each of the trophic levels is occupied by a certain kind of organism. Producers are always in the
first trophic level since they do not feed on another organism. Consumers occupy the rest of the
trophic levels. The second trophic level is the first consumer in the food chain and is called a
primary consumer. Primary consumers eat plants and are therefore herbivores or omnivores.
The next consumer in the food chain is the secondary consumer. The secondary consumer is in
the third trophic level. Since the secondary consumer feeds on another animal, it is a carnivore
or an omnivore. Similarly, the tertiary consumer occupies the fourth trophic level, and is a
carnivore. The last link in a food chain is also referred to as the top carnivore since it is at the
top of the food chain and is not hunted by other animals.
Problem Statement: Are food chains and food webs the same? How do organisms transfer
energy?
Biology HSL
Department of Science
Page 67
Student
Vocabulary: food chain, food web, producer, consumer, decomposer, energy transfer, trophic
level
Materials:
 yarn
 organism cards
 hole-puncher
 scissors
Procedures:
Part A: Food Webs and Energy Transfer
1. Read the assigned organism card. Review the characteristics of the organism; trophic level,
feeding type, preferred foods and predators.
2. Walk around the circle to identify other organisms and begin creating a food chain using the
yarn that was provided. For example: One student is a manatee (primary consumer), and
one is the seagrass (producer). The manatee will take the ball of yarn, hold onto one end of
the string and pass the rest of the ball to the seagrass. The seagrass will hold onto the yarn
and pass the rest of the ball to “what it eats,” in this case, the sun. Be sure that the sun is
connected to all the plants. Once the string gets to the sun, cut it off, and start again in
another place.
3. Continue building the web, making the relationships as complex as time and numbers of
participants allow.
4. Define terms such as herbivore, carnivore, insectivore, decomposer, etc and include them in
your web. [Note that insectivores are specialized carnivores.]
5. Students can be in as many chains as you have time for; they do not have to be in all of the
chains.
6. Answer the following questions:
a. Identify the following: producers, consumers, decomposers, scavenger, detrivore.
b. What does a food chain have in common with a food web?
c. How is a food chain different from a food web?
d. How does energy flow through an ecosystem?
Part B: Ecosystem Interactions
1. Listen to the following scenarios that will simulate the changes that ecosystem undergo.
a. A species was removed from the food web.
- The teacher will tap a student and they will pull on the strings they hold
- Anyone who feels a tug is directly affected by that organism.
- Those “organisms” affected directly could then pull on their strings and more
organisms are affected.
- When the “sun” pulls on its string, everyone should be affected.
b. A species becomes extinct.
- The teacher will have some organisms drop their string (become extinct).
- Who is affected?
c. Excess nutrients were introduced in the marine ecosystem.
- What happened to the environment?
- Who will be affected?
- Simulate the scenario.
Biology HSL
Department of Science
Page 68
Student
d. An invasive species, such as the Lion Fish in South Florida, was introduced in the marine
ecosystem.
- What impact will it have on the biodiversity of the ecosystem?
- How will the native species be affected?
Observation/Data Analysis:
Individual Assignment
1. Write a food chain and a food web from your classroom marine food web (minimum of 12
organisms).
2. The food chains must include a producer and three levels of consumers (primary,
secondary, tertiary). Label them.
3. Sketch a trophic pyramid using the food chains you created and place the names of your
organism at the proper level.
Analysis:
1. Explain what would happen if all of the primary consumers became extinct.
2. Predict what would happen if a non-native species is introduced into the food web.
3. Explain why food webs with many species (biodiverse) are more resilient than those with
few species.
4. Review your trophic pyramid, do you think there are more organisms at the base and less
organisms as you travel up the pyramid.
5. In theory, the earth could support many more people if we ate at a lower trophic level.
a. List 2 benefits of doing this.
b. List 2 drawbacks of eating lower on the food chain.
6. Large predatory fish usually are found at the 3rd or 4th trophic level of an energy pyramid.
What does this mean in terms of energy loss?
7. Large predatory animals can also be problematic to eat because of bioaccumulation and
biomagnifications of toxins such as lead or mercury in their habitats. What do those two
big words mean and why should this be considered when discussing food chains and
trophic levels.
Conclusion:
Write a conclusion using the “Power Writing Model 2009”. Make sure to answer the following
questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 69
Teacher
Human Impact – Effects of Acid Rain
NGSSS:
SC.912.L.17.20 Predict the impact of individuals on environmental systems and examine how
human lifestyles affect sustainability. (AA)
Purpose of the Lab/Activity:
 To determine the effects of acid rain on seed germination.
 To simulate the human impact on the environment.
Prerequisites:
 Students should be familiar with the pH scale.
 Students should be able to differentiate between an acid and a base.
 Students should be familiar with seed germination.
Materials (per group):
 graduated cylinder
 filter paper (paper towels)
 medicine droppers
 pH meter (pH paper)
 5 Petri dishes
 water
 vinegar (acetic acid)
 25 radish seeds
Procedures: Day of Activity:
What the teacher will do:
a. Gather materials and make sure that pH meters are calibrated. Instead of a
pH meter teacher can substitute with pH paper.
b. It is important for students to complete an experimental design diagram
prior to the investigation in order for them to understand all parts of the
activity.
1. What is the problem statement? How does the concentration of vinegar
affect the germination of radish seeds?
2. State the hypothesis. Answer will vary but should include both
independent and dependent variable. (Example: If 100% vinegar is
Before
applied to the radish seeds, they will not germinate.
activity:
3. Identify the independent and dependent variable. Independent:
concentration of vinegar (%) Dependent: seed germination
4. Identify the variables held constant. # seeds in each Petri dish, amount
of each solution, filter paper
5. Explain the tests conducted, identify both the experimental and control
test. Experimental Test: 10%, 5%, 2%, 1% Control Test: 0% vinegar
solution
6. List the number of trials per test. 1 trial (Remind students that multiple
trials are necessary in order to validate your conclusion. You could
gather group data and compile a classroom data table; each student
Biology HSL
Department of Science
Page 70
Teacher
During
activity:
After
activity:
group would be a trial. This is why is it exceptionally important that all
groups agree to follow the same procedure.
c. Student misconceptions should be addressed. Some common
misconceptions are: Acid rain is a result of global warming. Global warming
and ozone layer depletion are one and the same.
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
proper lab protocol.
b. Review the experimental design diagram by asking individual students in
groups to explain the different parts of the experiment.
c. Follow laboratory procedural plan; making sure to model proper laboratory
safety and use of equipment.
d. Emphasize importance of data collection by groups.
e. Ask groups to brainstorm the effect of human activities on ecosystems.
f. Ask the following questions:
1. Predict what would happen if I applied a basic solution instead of an
acid solution to seed germination.
2. What effect does the varying concentration have on seed germination?
What the teacher will do:
a. Analyze class data; making sure to note the importance of multiple trials,
and repeatability in scientific investigations.
b. Remind students that they will need to leave Petri dishes in the classroom
in order to observe their germination after 5 days.
c. Have students graph the data of their experiment; (Mr. DRY MIX: the
Dependent variable is the Responding variable that in a graph is recorded
on the Y-axis; the Manipulated variable is the Independent variable and is
graphed on the X-axis.
d. Give each student a post-it note. Ask students to list a human activity that
impacts ecosystems. These post-its will be the used to make sure all
students can engage in discussion.
e. Answer Key for Results:
1. Identify the relationship between pH and vinegar concentration. The
greater the concentration of vinegar the lower the pH. Vinegar’s (acetic
acid) has pH is roughly around 2.40 - 3.40.
2. Is vinegar an acid? Explain how that can be inferred from this activity.
Vinegar is acidic in nature as it is a solution of acetic acid. In can be
inferred since the higher the concentration of vinegar in the sample the
lower the pH.
3. Compare your results with the class; were there any differences in the
germination or pH by lab group? Is so, speculate on possible reasons
for these differences. Answers will vary. Some possible reasons for
error could be contamination of solutions; inaccurate dilution of vinegar.
4. Under which vinegar concentration did the seeds germinate best? Is this
consistent with your expectations?
5. Predict how the results of this experiment can be used to explain the
effects of acid rain on our environment. Acid rain; due to the low pH
value can stunt the growth of plants; it can also affect soil nutrients.
6. Explain how acidic water can harm aquatic plants and animals. Acid
Biology HSL
Department of Science
Page 71
Teacher
rain causes a cascade of effects that harm or kill individual fish, reduce
fish population numbers, completely eliminate fish species from a
waterbody, and decrease biodiversity. As acid rain flows through soils in
a watershed, aluminum is released from soils into the lakes and streams
located in that watershed. Some types of plants and animals are able to
tolerate acidic waters. Others, however, are acid-sensitive and will be
lost as the pH declines. Generally, the young of most species are more
sensitive to environmental conditions than adults. At pH 5, most fish
eggs cannot hatch. At lower pH levels, some adult fish die. Some acid
lakes have no fish.
Extension:
 Acid
Rain
Tutorial
(from
Environmental
Protection
http://www.epa.gov/acidrain/education/site_students/acid_anim.html
 Gizmo: Water Pollution
Biology HSL
Department of Science
Agency):
Page 72
Student
Human Impact – Effects of Acid Rain
NGSSS:
SC.912.L.17.20 Predict the impact of individuals on environmental systems and examine how
human lifestyles affect sustainability. AA
Background: (Source: www.epa.gov)
The burning of fossil fuels during the industrialization of the world has caused many negative
environmental impacts. Acid rain is a broad term used to describe several ways that acids fall
out of the atmosphere. A more precise term is acid deposition; which has two part wet and dry.
Wet deposition refers to acidic rain, fog, and snow. The strength of the effects depend on many
factors, including how acidic the water is, the chemistry and buffering capacity (the ability to
neutralize acidic compounds) of the soils involved, and the types of fish, trees, and other living
things that rely on the water. Dry deposition refers to acidic gases and particles. The wind blows
these acidic particles and gases onto buildings, cars, homes, and trees.
Scientists discovered, and have confirmed, that sulfur dioxide (SO 2) and nitrogen oxides (NOx)
are the primary causes of acid rain. In the U.S., about 2/3 of all SO 2 and 1/4 of all NOx comes
from electric power generation that relies on burning fossil fuels like coal. Acid rain occurs when
these gases react in the atmosphere with water, oxygen, and other chemicals to form various
acidic compounds. Sunlight increases the rate of most of these reactions. The result is a mild
solution of sulfuric acid (H2SO4) and nitric acid (HNO3).
Acid rain is measured using a scale called pH. The pH scale measures how acidic or basic a
substance is. It ranges from 0 to 14. A pH of 7 is neutral. A pH less than 7 is acidic, and a pH
greater than 7 is basic. Mixing acids and bases can cancel out their extreme effects; much like
mixing hot and cold water can even out the water temperature. Normal rain is slightly acidic
because carbon dioxide (CO2) dissolves in it, so it has a pH of about 5.5. In recent years, the
most acidic rain falling in the US has a pH of about 4.3.
Acid deposition has a variety of effects, including damage to forests and soils, fish and other
living things, materials, and human health. Acid rain also reduces how far and how clearly we
can see through the air, an effect called visibility reduction.
Problem Statement: How does the concentration of vinegar affect the germination of radish
seeds?
Safety: Handle solutions carefully to avoid spills. The simulated “acid rain” solution may cause
irritation and should be rinsed off promptly if it comes into contact with the sun. Wear goggles
at all times. If any of the solutions get into your eye, flush the eye with water for 15 minutes and
seek medical attention.
Vocabulary: pH, acid, base, germination, concentration, acid rain, fossil fuels, environment
Materials (per group):
 graduated cylinder
 filter paper
 medicine droppers
Biology HSL
Department of Science
Page 73
Student





pH meter
5 Petri dishes
water
vinegar (acetic acid)
25 radish seeds
Procedures:
1. Label one Petri dish for each of the following treatments: 100%, 75%, 50%, 25%, and
0%.
2. Place two pieces of filter paper into each dish.
3. Create the acid vinegar solutions. Use the following measurements:
4. Add 5 ml of acid solution to the appropriate Petri dish.
5. Place 5 seeds in each treatment.
6. Place the Petri dishes in the box in front of the room.
7. Uses the pH meter to measure the acidity of each of the 5 solutions provided for the
testing, and record each reading in the chart.
8. After 5 days, remove the Petri dishes and check to see how many seeds have
germinated (sprouted).
9. Record your data in the chart. Note any changes in the appearance of the seeds.
Observations/Data:
Percentage of
Vinegar
pH
# of Radish Seeds
Germinated
Changes in
Appearance
10%
5%
2%
1%
0%
Data Analysis:
Create a line graph using the data from the table above; make sure to label your axis(s) and
include the units of measurements.
Biology HSL
Department of Science
Page 74
Student
Effects of pH on the Germination of Radish Seeds
Results:
1. Identify the relationship between pH and vinegar concentration.
2. Is vinegar an acid? Explain how that can be inferred from this activity.
3. Compare your results with the class; were there any differences in the germination or pH
by lab group? Is so, speculate on possible reasons for these differences.
4. Under which vinegar concentration did the seeds germinate best? Is this consistent with
your expectations?
5. Predict how the results of this experiment can be used to explain the effects of acid rain
on our environment.
6. Explain how acidic water can harm aquatic plants and animals.
Conclusion:
Write a lab report using the “Power Writing Model 2009” answering the following questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 75
Teacher
Human Impact on the Environment & Sustainability
NGSSS:
SC.912.L.17.20 Predict the impact of individuals on environmental systems and examine how
human lifestyles affect sustainability. (AA)
Purpose of the Lab/Activity:
 Evaluate the environmental impact caused by coal mining and coal consumption.
 Discuss the difference between the total amount of coal available and the amount that
can be practically obtained.
 Explore the difference between nonrenewable and renewable energy sources.
 Predict the role of renewable energy sources in the future.
Prerequisites:
 Students should be familiar with the ecosystems interactions and energy transfer.
 Students should be able to use laboratory equipment to measure liquids.
Materials (per group):
 Biodiversity Cards
 1000 mL graduated cylinder (or
beaker)
 100 mL graduated cylinder
 10 mL graduated cylinder
 50 mL beaker
 10 mL vegetable oil





Chocolate
chip
cookie
(large
chocolate chip type)
Paper clip or toothpick
Paper plate or napkin
Small paper cup
Chocolate Chip Reserves Chart
Procedures: Day of Activity:
What the teacher will do:
a. It is important for activate student’s prior knowledge on human impact,
positive and negative, on ecosystems before beginning the investigation.
b. Read Dr. Seuss children’s book The Lorax aloud to your students and/or
have them watch the animated cartoon The Lorax (Time: 25 minutes)
c. Dr. Seuss’ The Lorax presents an opportunity to have a conversation about
the inherent value of forests and importance of sustainable management.
Given the many threats to America’s private and public forests due to
climate change, pests and pathogens, and land conversion, the story of Dr.
Before
Seuss’ The Lorax can start a dialogue about what is being done in America
activity:
to protect the health and productivity of our forests now and for the future.
d. Ask students “WHAT IS CHANGING?” in the story. Give them some
thinking time, and then choose two or three volunteers to say one answer
each. They will probably suggest elements such as “truffula trees,” or
“thneeds.” Urge them to be specific, asking follow-up questions if necessary
or saying “tell more about that element of the story.”
- Example: If a student says “thneeds “ changed during the story, do they
mean “total thneeds produced,” or “thneeds produced per month?”
Using precise, descriptive language is an important skill to practice.
- Most of the story lines in literature are based on changing elements over
Biology HSL
Department of Science
Page 76
Teacher
During
activity:
After
activity:
time that create conflict. Students should be able to see the points of
conflict clearly in The Lorax.
e. Guide a discussion that will enable students to discover a definition of
sustainability by verbalizing how the economy, society, and the
environment are connected.
1. In the story, how did the industry affect the physical environment?
2. How did these environmental conditions affect local plants and animals?
3. How did thneed production affect Once-lers and people (employees,
neighbors, etc.)
4. Based on your observations from this story, was this method of
manufacturing thneeds sustainable?
5. How would you define the phrase “sustainable development?”
6. How could the Once-ler have manufactured thneeds in a more
sustainable manner?
7. Whose responsibility is it to protect the environment and ensure
sustainable practices?
8. What federal, state, and local agencies exist to protect the environment?
f. Tell the students that although The Lorax is a story, there are places in the
world today that face some of the same environmental problems. Ask the
students to share any experiences or information they may have about the
topics and themes highlighted in this book.
g. Gather materials, set up the stations and assign students to groups.
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
proper lab protocol.
b. Review the lab stations to ensure students are following laboratory
procedural plan.
 Station 1: Biodiversity – Why is it important
 Station 2: Biological Magnification in the Great Lakes
 Station 3: Nonrenewable Energy – Cookie Mining
c. Emphasize importance of data collection by groups.
d. Ask groups to brainstorm the effect of human activities on ecosystems
during each of the lab stations.
What the teacher will do:
a. Watch United Streaming video about human interaction. Exploring the
Diversity of Life: Don't Be Part of the Problem.
http://www.unitedstreaming.com
b. Give each student a post-it note. Ask students to list a detail from the film.
These post-its will be the used to make sure all students can engage in
discussion.
Extension:
 Ecology Issues Project: http://www.biologycorner.com/projects/ecoproject/index.html
 Smog City: http://www.biologycorner.com/worksheets/smogcity.html
 Recycle City: http://www.biologycorner.com/worksheets/recyclecity.html
 Environmental Action:
http://www.biologycorner.com/worksheets/environmentalaction.html#.Ud78DVTD-2w
Biology HSL
Department of Science
Page 77
Student
Human Impact on the Environment & Sustainability
NGSSS:
SC.912.L.17.20 Predict the impact of individuals on environmental systems and examine how
human lifestyles affect sustainability. AA
Station 1: Biodiversity – Why is it important
Background:
When scientists speak of the variety of organisms (and their genes) in an ecosystem, they refer
to it as biodiversity. A biologically diverse ecosystem, such as an old growth forest or tropical
rain forest, is healthy, complex and stable. Nature tends to increase diversity through the
process of succession.
The opposite of biodiversity is referred to as monoculture, or the growing of one species of
organism, such as a lawn, a wheat field or corn field. Because all of the species are identical,
there are few complex food webs and disease can spread quickly. Monoculture is like a banquet
table for disease organisms. Monoculture often requires extensive use of pesticides and
herbicides (to fight nature's tendency to diversify communities) and is very labor and energy
intensive (fighting nature is tough). Humans often try to reduce diversity because it is easier to
harvest a crop (whether it is wheat, corn, a lawn or a secondary forest) if it all contains the same
species, but this obviously creates serious problems.
When a habitat is very diverse with a variety of different species, it is much healthier and more
stable. One of the reasons for this is that disease doesn’t spread as easily in a diverse
community. If one species gets a disease, others of its kind are far enough away (due to the
variety of other organisms) that disease is often stopped at the one or two individuals.
“Biodiversity, the planet’s most valuable resource, is on loan to us from our children.”
- Edward O. Wilson
Problem Statement:
 How does biodiversity affect a population exposed to disease?
Materials (per group):
 Biodiversity cards
Procedures:
Simulation #1: Low Biodiversity
1. Each student receives a card marked with D to represent Douglas Firs.
2. Each person is to meet three other people and write their names on the card.
3. All are to remain standing after they write down the names.
4. The teacher symbolizes the disease and will touch one of the students. That person will
sit down (because he or she is “dead”) and read the names on his/her card. As the
names are read, those students sit as well because they have been “touched” by the
disease.
5. Ask another one of those sitting (dead) to read the names on their card, and all those
students named will sit. Continue until all those sitting have read the names on their
cards.
Biology HSL
Department of Science
Page 78
Student
Simulation #2: High Biodiversity
1. Each student will receive a card that is marked with a letter that represents a particular
species of tree: 2 with D for Douglas Firs, the rest with other letters: N for Noble Fir, C for
Western Red Cedar, M for Vine Maples, H for Western Hemlocks, W for White Fir, L for
Lodge Pole Pine, WP for Western White Pine, B for Bigleaf Maple, WD for Western
Dogwood.
2. Repeat steps 2-6 as for Simulation 1. This time, only those students that are the same
variety as the diseased tree that touched them will sit. Different variety trees don't sit
(don't die) even if they are touched by a diseased tree.
Data:
Simulation #1
Simulation #2
Number of Students
Left Standing
Analysis:
1. What does biological diversity mean?
2. Why didn't all the different trees get the disease?
3. Why didn't the disease spread as fast among the Douglas Firs in Simulation #2 as it did
in Simulation #1?
4. In which forest would you need to use more chemicals to control disease: the Douglas Fir
forest of the more diversified, old growth forest? Why?
5. Summarize what this simulation symbolized.
6. Which forest would have more diversity of wildlife? Why?
7. If you cut down the variety in a piece of forest you owned and replanted with one type of
tree, what will happen to much of the wildlife that was adapted to the forest? (Hint: they
cannot just move elsewhere. If other habitats are good, they will probably be near
carrying capacity already.)
8. Will this fate happen to all the wildlife? Explain.
9. Many species can only live/reproduce in one type of forest. The spotted owl is an
example: it can only live and successfully reproduce in old growth forests (big, old
cedars, hemlocks, etc.). If these old growth forests are cut down, it’s unlikely this owl will
survive. Environmentalists call it an “indicator species.” What does this mean?
10. Why be concerned about one species?
11. Growing one plant, as is the case of growing only Douglas Fir, is called monoculture.
Give examples of monocultures a) in your home and b) in agriculture.
12. Why would you need to use more insecticides in monoculture? Is this good or bad?
13. If you wanted to help wildlife, what would you do with regards to the landscaping of your
own home?
Biology HSL
Department of Science
Page 79
Student
SIMULATION #1: BIODIVERSITY CARDS
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
DOUGLAS FIR
Biology HSL
Department of Science
Page 80
Student
SIMULATION #2: BIODIVERSITY CARDS
DOUGLAS FIR
DOUGLAS FIR
NOBLE FIR
WESTERN RED
CEDAR
VINE MAPLE
WESTERN
HEMLOCKS
WHITE FIR
LODGE POLE PINE
WESTERN WHITE
PINE
BIGLEAF MAPLE
WESTERN
DOGWOOD
Biology HSL
Department of Science
Page 81
Student
Station 2: Biological Magnification in the Great Lakes
Background Information:
We will examine the impact humans have had on the overall health
of the Great Lakes ecosystem. What types of pollutants can enter
the Great Lakes? What happens when the toxic chemicals and
pollutants we use get into the Great Lakes? How do these
pollutants impact organisms in the freshwater food web?
There are two types of pollutants that can enter an ecosystem:
persistent (nonpolar) pollutants, which accumulate in an organism’s
fatty tissues, and non-persistent (polar) pollutants, which are water soluble and pass through
an organism’s body when it excretes urine, sweat, or feces. When a producer comes in
contact with a persistent pollutant, it accumulates in the tissue of the organism; when
animals eat organisms (plants or other animals) that have persistent pollutants in their tissue
it accumulates in the tissue of the consumer by a process called bioaccumulation. The
higher an animal is on the food chain (e.g. 3rd order consumer such as seals), the greater the
concentration of pollutant in their body as a result of a process called biomagnification.
In this station, we are going to focus on the introduction of the pesticide DDT
(dichlorodiphenyltrichloroethane) into an aquatic ecosystem
and the impact it can have on the food web. DDT was used
for many years as an effective method for controlling mosquito
populations, and therefore the spread of diseases like malaria.
DDT is a persistent organic pollutant that is extremely
hydrophobic, colorless, and a crystalline solid. It is nearly
insoluble in water but has a good solubility in most organic
solvents, fats, and oils and is also strongly absorbed by soil.
When introduced to aquatic ecosystems (mostly through runoff), it is quickly absorbed by
organisms and by soil or it evaporates, leaving little DDT dissolved in the water itself.
We will be using volumes of water and vegetable oil to model how biomagnification of
persistent toxins and pollutants (like DDT) can occur in an ecosystem. You will examine
which organisms in a food web might be most affected by the introduction of a toxic chemical
to their habitat.
Problem Statement:
 Which organisms in the food chain accumulate the greatest concentration of chemicals in
their tissues?
Materials (per group):
 1000 mL graduated cylinder (or beaker)
 100 mL graduated cylinder
 10 mL graduated cylinder
 50 mL beaker
 10 mL vegetable oil
Biology HSL
Department of Science
Page 82
Student
Procedures:
1. Select one 3 trophic level food chain from the food web diagram of Lake Michigan. For
your selected food chain and using colored pencils or markers, circle the.....
a. Producer in green
b. Primary consumer in blue
c. Secondary consumer in red
2. Prediction! Rank what you think the relative concentration of DDT in each plant/animal of
your food chain using the following scale: 1 = lowest concentration to 3 = highest
concentration.
1 = ___________________ 2 = ___________________ 3 = ___________________
3. The 1000 mL graduated cylinder will represent the first trophic level, the producers, of
your food chain.
What would be an example producer in the Great Lakes food web? _________________
4. Fill the 1000 mL graduated cylinder with 990 mL of tap water (if using a 1000 mL beaker
use the 100 mL graduated cylinder to measure the last 90 mL). Remember to measure
liquids from the bottom of the meniscus at eye level. The water represents the normal
tissue of the organism.
5. Then use the 50 mL beaker to get 10 mL of vegetable oil. Slowly and carefully add the oil
to the 990 mL of water by pouring it gently down the side of the graduated cylinder. Let
the oil sit until all of the droplets have coalesced into a film on the surface.
6. The oil represents the persistent pollutant DDT that the producers have absorbed from
the soil or water. Its insolubility with water represents its resistance to biological
degradation and metabolism by the producer.
7. Record the volume of water and the volume of oil in the 1000 mL graduated cylinder in
the data table below. Then calculate the % concentration of oil in the first trophic level of
our food web.
8. The 100 mL graduated cylinder represents the second trophic level, the 1 st order
consumers, in our food web.
What would be a 1st order consumer in the Great Lakes food web? ________________
9. Slowly and carefully pour 100 mL of the oil/water mixture from the 1000 mL graduated
cylinder into the 100 mL graduated cylinder. NOTE: Accurately pouring this mixture of oil
and water can be difficult, so pour slowly! Let the mixture settle so that all of the oil
droplets have coalesced into one layer at the surface.
10. Record the volume of water and the volume of oil in the 100 mL graduated cylinder in the
data table below. Then calculate the % concentration of oil in the second trophic level of
our food web.
Biology HSL
Department of Science
Page 83
Student
11. The 10 mL graduated cylinder represents the third trophic level, the 2 nd order consumers,
in our food web.
What would be a 2nd order consumer in the Great Lakes food web? ________________
12. Slowly and carefully pour 10 mL of the oil/water mixture from the 100 mL graduated
cylinder into the 10 mL graduated cylinder, using the same care as before.
13. Record the volume of water and the volume of oil in the 10 mL graduated cylinder in the
data table below. Then calculate the % concentration oil in the third trophic level of our
food web.
14. When you have finished, check in with your instructor before cleaning up. To clean the
oily glassware you will need to use hot water, SOAP and cleaning brushes! Everyone on
the team should help clean the glassware and table top of oil before leaving the lab.
Data:
The percent concentration of one substance in a mixture of two or more substances is equal to
the volume of that substance divided by the total volume of the mixture, times one hundred.
Example: 1 mL of chocolate syrup mixed with 9 mL of milk makes 10 mL of chocolate milk.
Therefore, the concentration of chocolate syrup in the chocolate milk is 1/10*100 or 10%.
trophic
level
device
producers
1000 mL
1st
order
100 mL
consumers
2nd
order
10 mL
consumers
volume
tissue
(water)
of
volume of
DDT (oil)
%
total volume
Concentration
of organism
of DDT (oil)
= 1000 mL
= 100 mL
= 10 mL
Analysis:
1. How did the % concentration of DDT (oil) change as we went from the bottom of the food
chain to the higher trophic levels? Did that match your predictions? Why or why not?
2. If the oil represents DDT (a persistent pollutant) first absorbed by the producers, which of
the following groups are most susceptible to problems from DDT: primary producer,
primary consumer, secondary consumer, 3rd order consumer, or 4th order consumer?
Why?
3. Challenge: The sea lamprey is considered an apex predator in most Great Lakes food
chains because it has no natural predators, however it is NOT affected by the DDT as
other apex predators would be. Why? Think about the diet of the sea lamprey!
4. Consider the two following food chains:
Food chain 1: flagellates  opossum shrimp  rainbow trout
Food chain 2: flagellates  opossum shrimp  alewife  rainbow trout
Biology HSL
Department of Science
Page 84
Student
How might the differences in these food chains result in exposure to different amounts of
DDT?
5. DDT has been banned in the United States since the 1970s, yet the Center for Disease
Control has found concentrations in nearly ALL human blood sampled in 2005. How can
this be? Use the terms bioaccumulation, biomagnification, and nutrient cycles in your
response. What implications does this have on the long-term health of humans and other
organisms that come in contact with this chemical?
Food Web Diagram – Lake Michigan
Biology HSL
Department of Science
Page 85
Student
Station 3: Nonrenewable Energy – Cookie Mining
As recently as 200-300 years ago humans met most of their energy needs using renewable
energy sources such as wood for heat, watermills for grinding crops or wind to propel sailing
vessels. Fossil fuels such as oil, gas and coal now provide the majority of the energy we use to
fuel our modern technological and industrial based societies.
In the past coal has been used to power steamships and railroad engines, to heat homes and
provide heat for steel production. Today the primary use for coal is in the generation of electrical
power. More than half the electricity generated in the United States comes from combusting coal
and Missouri gets more than eighty percent of its electricity by burning coal.
Coal generates more environmental impacts than any other energy source. Coal mining disturbs
large areas of land creating surface water quality problems and ecosystem impacts. Burning
coal produces large amounts of air pollutants that have been linked to mercury contamination,
smog, global warming and other environmental problems. High sulfur coals are especially
problematic, creating greater levels of air pollution and problems with acid rain. Although
Missouri has deposits of coal, the high sulfur content prevents its use as an energy source.
Of all the fossil fuels by far the most abundant is coal. North American coal beds are widely
distributed (see map) with significant variation in the quality of the coal and its accessibility.
Estimating the exact amount of coal available and how long such reserves will last is difficult.
Factors such as the current rates of consumption, the expense of mining in remote areas along
with increasing environmental costs must all be considered. The United States is estimated to
have enough low sulfur coal to last at least 100-200 years.
The world will not only require energy in the future, but those energy needs are predicted to
grow. We will most certainly eventually run out of fossil fuels and the development of renewable
energy systems such as hydroelectric, geothermal, wind and solar will only become more
critical.
Biology HSL
Department of Science
Page 86
Student
Problem Statement:
 Which organisms in the food chain accumulate the greatest concentration of chemicals in
their tissues?
Materials (per group):
 Chocolate chip cookie (large chocolate chip type)
 Paper clip or toothpick
 Paper plate or napkin
 Small paper cup
 Chocolate Chip Reserves Chart
Procedures:
1. Use the Student Results section on the Reserves Chart to predict how much space you
think will be filled with mined chocolate chips. Draw a line to mark your estimate.
2. All mining must be done on the paper plate. This is to contain the “mining wastes.”
3. Remove all chocolate chips from the cookie and place them in the cup. Only mining
“tools” (paper clip or toothpick) may be used. Do not use your hands or fingers.
4. After the mining process is completed, calculate mining income and costs, use the tables
provided below.
5. Instruct the students to “clean up” their mining site by using their digestive systems to bioremediate the mining wastes and extracted ore deposits. In other words eat the cookie
remains along with the chocolate chips.
Data:
Reserves Chart: Chocolate Chips Mined
When you get done mining your cookie pour out the chocolate chips collected and mark how
much of the space is covered. This actual mining yield will then be compared to the
estimated yield.
Biology HSL
Department of Science
Page 87
Student
Income
Number of
Chips mined
Money earned from
mining chips
Cost
Money earned
Number of chips
times $200
MINUS
-
Number of crumbs
on plate
Money spent on fixing land
damaged in mining
Cost to repair land
Number of crumbs
times $100
EQUALS
Total Money
Earned Mining
=
Analysis:
1. Think about how your cookie looked after you finished mining. How does this relate to
environmental impacts associated with real coal mining?
2. Were you able to remove all the chips from the cookie? If no, why not?
3. Compare this activity with the real impact when mining coal. What happens to plants and
animals?
4. In real mining, why are some deposits of coal more expensive to mine than others?
5. Why is it difficult to predict exactly how long the fossil fuels in the earth will last?
Conclusion:
Biology HSL
Department of Science
Page 88
Student
Write a lab report using the “Power Writing Model 2009” answering the following questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 89
Teacher
The Puzzle Theory: Difference between Law vs. Theory
(Adapted from pbs.org “Evolution” series)
NGSSS:
SC.912.L.15.8 Describe the scientific explanations of the origin of life on Earth. (AA)
SC.912.L.15.1: Explain how the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
SC.912.N.1.3: Recognize that the strength or usefulness of a scientific claim is evaluated
through scientific argumentation, which depends on critical and logical thinking, and the active
consideration of alternative scientific explanations to explain the data presented.
SC.912.N.1.6: Describe how scientific inferences are drawn from scientific observations and
provide examples from the content being studied.
SC.912.N.3.1: Explain that a scientific theory is the culmination of many scientific investigations
drawing together all the current evidence concerning a substantial range of phenomena; thus, a
scientific theory represents the most powerful explanation scientists have to offer.
SC.912.N.3.4: Recognize that theories do not become laws, nor do laws become theories;
theories are well supported explanations and laws are well supported descriptions.
Purpose of the Lab/Activity:
 Modeling how a theory is developed over time
 Follow the procedure to model “discoveries through time” and how they change.
 Model the way these theories are based on evidence found and are subject to change
according to new discoveries and increases in technology.
Prerequisites:
 Understand the role of observations in science.
 A general sense of what a hypothesis or theory is
 Give students practice using evidence to make inferences.
 A general sense of the difference between a theory and a law
Materials:
 1,000 piece puzzle with a picture of
nature having many factors and
colors. Try to stay away from
repeated patterned pictures



6-8 envelopes
6-8 Large newsprint or poster paper
Copies of the student handout
Procedures: Day of Activity: (per group)
What the teacher will do:
1. Preparation: Remove all edge pieces from the puzzle. Divide the remaining
pieces of the jigsaw puzzle evenly into the six or eight envelopes. Be sure
to put the puzzle box with the picture out of students’ sight
2. Group students into six to eight teams.
Before
activity:
ENGAGE:
3. Have a class discussion using a KWL or other pre-assessment strategies to
determine what the students know about the scientific process. Examples of
questions include:
a. What is a hypothesis? (Answers will vary. Guide the discussion so
Biology HSL
Department of Science
Page 90
Teacher
that it includes the steps any person takes to answer a question.)
b. What ideas do we come up with when a car does not start? How do
we try to solve the problem? (Answers will vary, but guide them
towards different questions about why the car won’t start and what
things can be done to test why it won’t start.)
c. What is the difference between a theory and a law? (Answers will
vary, but DO NOT give the students the answer. Write some of the
responses on the board to review and discuss after the completion of
the activity.)
4. Introduce the activity by telling students they will explore the nature of
science, using evidence (jigsaw puzzle pieces) to develop a series of
tentative hypotheses to explain the scene represented by the puzzle pieces.
5. Give each group an envelope containing the puzzle pieces and piece of
large newsprint or poster paper.
6. Remind them to NOT look at the puzzle pieces inside the envelope until you
tell them what to do. Give out the student handouts, AFTER the discussion.
What the teacher will do:
EXPLORE:
Describe these scenarios to the students and guide them through the process
of developing their theories and hypotheses in each of their groups based on
their “evidence”. The puzzle pieces represent the evidence found by scientists
over time and the amount of pieces represent the amount collected because of
available technology during the time period defined. Make sure to give enough
time in between each scenario to develop the hypotheses and/or draw their
“theory” picture.
During
activity:
Use these descriptions below loosely as your script to guide the students:
1. First discovery in the 1600’s: Remove one piece of the puzzle from
the envelope. Write a hypothesis that best describes what your group
thinks the picture on the puzzle will look like.
2. Second discovery early 1800’s: Each team should now remove 10
pieces of the puzzle from the envelope. After examining the pieces,
develop a second hypothesis about the complete scene or picture
shown represented by the puzzle. Identify the key evidence used to
support the hypothesis.
3. Third discovery early 1900’s: Remove another 15 pieces of the puzzle
from the envelope and either retain or revise your 1st and 2nd hypotheses
or develop a 3rd hypothesis. Again cite the key evidence should be
identified.
4. Fourth discovery late 1900’s with better technology: Now remove an
additional 20 puzzle pieces from the envelope and proceed as in step 3.
Collective evidence seen and develop a final hypothesis. State your
hypothesis and the evidence you’ve accumulated to support it. NOW
DRAW WHAT YOU THINK THE PICTURE WILL LOOK LIKE. Unused
puzzle pieces should remain in the envelope.
Biology HSL
Department of Science
Page 91
Teacher
EXPLAIN:
Closing: Show the students the picture from the box. It is suggested that the
picture be scanned and put up on a projector to increase interest in the reveal
moment. Be flexible at this stage of the activity. Rather than each group
answering each question individually, the entire class could be engaged in a
discussion based on their answers.
5. Have the groups each share their hypotheses and pictures for their
“puzzle theories”. As a class, discuss the similarities and differences
between the groups and the actual picture.
6. Discuss again the difference between a theory and a law. Refer and
compare to the answers that were written on the board before the
activity. (A scientific theory summarizes a hypothesis or group of
hypotheses that have been supported with repeated testing. A theory is
valid as long as there is no evidence to dispute it. Therefore, theories
can be disproven. Basically, if evidence accumulates to support a
hypothesis, then the hypothesis can become accepted as a good
explanation of a phenomenon. One definition of a theory is to say it's an
accepted hypothesis. A law generalizes a body of observations. At the
time it is made, no exceptions have been found to a law. Scientific laws
explain things, but they do not describe them. One way to tell a law and
a theory apart is to ask if the description gives you a means to explain
'why'. Example: Consider Newton's Law of Gravity. Newton could use
this law to predict the behavior of a dropped object, but he couldn't
explain why it happened.)
What the teacher will do:
ELABORATE:
After discussing the different theories, the teacher should ask these questions
and facilitate a closing review of the activity and discussion: (Answers will vary.
Students can write some of the responses in their journals in order to give them
information to use on their evaluation piece.)

After
activity:
What kinds of information from the pieces were valuable to your team in
formulating a hypothesis? Answers will vary.
 How did the personal biases of people in your group affect your
hypotheses? Answers will vary.
 How did your initial hypothesis compare to your final hypothesis and
how did collaboration with other teams affect your final hypothesis?
Answers will vary.
 Did different groups have different hypotheses based on similar
evidence? How is this possible? Answers will vary.
 Is your final hypothesis “correct”? Explain. What degree of certainty do
you have about your hypothesis? Answers will vary.
 How does this simulation compare to the process of science in the real
world? Answers will vary.
 How does not having the “edges” of the puzzle relate to the nature of
science? Answers will vary.
Biology HSL
Department of Science
Page 92
Teacher
EVALUATE:
Assign these questions to the students to answer individually in their journals/
handout/ paper. Can be assigned as a home learning grade or quiz grade
during class the next day. It is suggested that a rubric be created.
Answer Key for Results/Conclusion:
1. Teams should share their hypotheses. Is there a consensus regarding the
hypothesis that best fits the evidence? Explain why or why not. Answers
will vary. Most likely it will be no and the students will describe the
discussions that took place.
2. What evidence was most useful in developing and evaluating your hypotheses?
(Students should discuss specific puzzle pieces that guided their ideas.)
3. Was any information misleading and result in the development of a hypothesis
that had to be rejected as new evidence was found? (Students should discuss
specific puzzle pieces that guided their ideas.)
4. Did any personal biases within your group influence the development and
evaluation of one or more of your hypotheses? (Students should discuss
specific ideas from group members.)
5. How did your final hypothesis compare with your 1st hypothesis? (Most likely it
will be different. Make sure they explain why.)
6. How did collaboration with other teams affect your final hypothesis? (Students
should discuss how hearing the similarities and differences with other groups
guided their ideas.)
7. Did similar evidence used by more than one team result in different
hypotheses? (Answers will vary.)
8. Did different evidence used by more than one team result in identical or very
similar hypotheses? (Answers will vary.)
9. What degree of certainty did you have about your final hypothesis? Why?
(Answers will vary, but students should be clear on why they were so sure of the
hypothesis.)
10. Did the absence of the “edges” of the puzzle influence the level of difficulty in
developing your hypotheses? (Answers will vary, but students should discuss
how if they had the edges they would have developed their hypothesis or theory
more quickly.)
11. If you only had “edges” to use would you have any advantages or limitations?
(Edges help to finalize the picture faster because it is clear where the piece or
evidence belongs.)
12. Are there edges that limit or “pin in” scientists as they explore and investigate
various questions and problems? (Answers will vary, but students should
explain their ideas.)
13. How are the “edges” like a theory early in its development? (Answers will
vary, but students should explain their ideas.)
14. What scientific or medical advances have occurred during your lifetime
through the steady accumulation of evidence? (Answers will vary, but students
should explain their ideas.)
15. How did this activity model the process of science used as individuals seek
answers to question and problems? (Answers will vary, but students should
explain their ideas.)
Biology HSL
Department of Science
Page 93
Teacher
EXTEND: (to be answered in an assessment journal prompt)
Later in the study of evolution, discuss how Darwin and others have studied evidence from
various sources that led them to conclude that life has changed, or evolved, over time and that
organisms living today are descendants of those that have lived in the past. For example, as
Charles Darwin completed his voyage on the Beagle, the plants and animals he saw in various
locations that did not exist in England puzzled him. He also noted the variation in domestic
animals. He was puzzled by this variation. After studying much evidence, he wrote the
following:
When I visited during the voyage of the H.M.S. Beagle, the Galapagos
Archipelago, I fancied myself brought near to the very act of creation. I often
asked how these many peculiar animals and plants had been produced: the
simplest answer seemed to be that the inhabitants of the several islands have
descended from each other, undergoing modification in the course of their
descent; and that all the inhabitants of the archipelago were descended from
those of the nearest land, namely America.” (From Variation of Animals
published in 1868) (Quoted in Larson, Edward J. 2001. Evolution’s Workshop.
New York: Basic Books, p. 85)
Darwin’s challenge, or puzzle, was to explain the variation he saw in life. He studied evidence
from many sources, read widely, and thought through various hypotheses before he arrived at
his conclusion published in 1868. When he left England on the voyage of the Beagle, the
boundaries or “edge” of his puzzle was extended as he left the confines of England. However,
the boundaries or “edge” of the scientific process were such that he was required to support his
hypotheses with evidence. Other scientists who have attempted to explain the diversity of life
on Earth have had to deal with self-made and imposed boundaries, or “edges”, which restrained
their work and sometimes led them to hypotheses that could not be supported with evidence.
Exit Slip Question: (write this on a piece of paper and turn in before you leave)
“Are the edges important to the discoveries? Do they restrict science in its research? Explain an
example where this might occur and what can be done to allow for free scientific thought?”
Biology HSL
Department of Science
Page 94
Student
The Puzzle Theory: Difference between Law vs. Theory
NGSSS:
SC.912.L.15.8 Describe the scientific explanations of the origin of life on Earth. (AA)
SC.912.L.15.1: Explain how the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
SC.912.N.1.3: Recognize that the strength or usefulness of a scientific claim is evaluated
through scientific argumentation, which depends on critical and logical thinking, and the active
consideration of alternative scientific explanations to explain the data presented.
SC.912.N.1.6: Describe how scientific inferences are drawn from scientific observations and
provide examples from the content being studied.
SC.912.N.3.1: Explain that a scientific theory is the culmination of many scientific investigations
drawing together all the current evidence concerning a substantial range of phenomena; thus, a
scientific theory represents the most powerful explanation scientists have to offer.
SC.912.N.3.4: Recognize that theories do not become laws, nor do laws become theories;
theories are well supported explanations and laws are well supported descriptions.
Background: Words have precise meanings in science.
For example, 'theory', 'law', and 'hypothesis' don't all mean
the same thing. Outside of science, you might say
something is 'just a theory', meaning it's supposition that
may or may not be true. In science, a theory is an
explanation that generally is accepted to be true.
A hypothesis is a statement based on observation. Usually,
a hypothesis can be supported or refuted through
experimentation or more observation. A hypothesis can be
disproven, but not proven to be true. Example: If you see no
difference in the cleaning ability of various laundry
detergents, you might hypothesize that cleaning
effectiveness is not affected by which detergent you use.
A scientific theory summarizes a hypothesis or group of hypotheses that have been supported
with repeated testing. A theory is valid as long as there is no evidence to dispute it. Therefore,
theories can be disproven. Basically, if evidence accumulates to support a hypothesis, then the
hypothesis can become accepted as a good explanation of a phenomenon. One definition of a
theory is to say it's an accepted hypothesis. Example: It is known that on June 30, 1908 in
Tunguska, Siberia, there was an explosion equivalent to the detonation of about 15 million tons
of TNT. Many hypotheses have been proposed for what caused the explosion. It is theorized
that the explosion was caused by a natural extraterrestrial phenomenon, and was not caused by
man. Is this theory a fact? No. The event is a recorded fact. Is this this theory generally
accepted to be true, based on evidence to-date? Yes. Can this theory be shown to be false and
be discarded? Yes.
A law generalizes a body of observations. At the time it is made, no exceptions have been found
to a law. Scientific laws explain things, but they do not describe them. One way to tell a law and
a theory apart is to ask if the description gives you a means to explain 'why'. Example: Consider
Biology HSL
Department of Science
Page 95
Student
Newton's Law of Gravity. Newton could use this law to predict the behavior of a dropped object,
but he couldn't explain why it happened.
As you can see, there is no 'proof' or absolute 'truth' in science. The closest we get are facts,
which are indisputable observations. Note, however, if you define proof as arriving at a logical
conclusion, based on the evidence, then there is 'proof' in science. What is important is to
realize they don't all mean the same thing and cannot be used interchangeably.
(http://chemistry.about.com/od/chemistry101/a/lawtheory.htm)
Scientists formulate theories by observing nature and analyzing evidence—or using the
scientific process. In this activity, student teams use evidence (jigsaw puzzle pieces) revealed
over time to experience the nature of science and understand its limitations.
Purpose of the Lab/Activity:
 Modeling how a theory is developed over time
 Follow the procedure to model “discoveries through time” and how they change.
 Model the way these theories are based on evidence found and are subject to change
according to new discoveries and increases in technology.
Instructions:
1. Use evidence from a jigsaw puzzle to make inferences.
2. Use a jigsaw puzzle as a model of a scientific investigation.
3. Follow the directions from the instructor in order to model the way in which a scientific
investigation can occur.
Biology HSL
Department of Science
Page 96
Student
Puzzle Theory: Difference between Law vs. Theory (Time Line)
Fill these out with your group as your instructor guides you through the process.
1. First discovery in the 1600’s (first hypothesis):
_______________________________________________________________________
_______________________________________________________________________
Key evidence used to determine: ____________________________________________
Second discovery early 1800’s (second hypothesis)::
_______________________________________________________________________
_______________________________________________________________________
Key evidence used to determine: ____________________________________________
2. Third discovery early 1900’s (third hypothesis):
_______________________________________________________________________
_______________________________________________________________________
Key evidence used to determine: ____________________________________________
3. Fourth discovery late 1900’s with better technology (FINAL hypothesis):
_______________________________________________________________________
_______________________________________________________________________
Key evidence used to determine: ____________________________________________
Hypothetical Picture based on FINAL hypothesis- (This is a DRAFT. Draw a final on the larger
paper)
Biology HSL
Department of Science
Page 97
Student
Puzzle Theory
EVALUATION:
Questions to answer individually in your journals/ handout/ paper: (Choose 10 of the 15
to answer individually)
1. Teams should share their hypotheses. Is there a consensus regarding the hypothesis that
best fits the evidence?
2. What evidence was most useful in developing and evaluating your hypotheses?
3. Was any information misleading and result in the development of a hypothesis that had to be
rejected as new evidence was found?
4. Did any personal biases within your group influence the development and evaluation of one
or more of your hypotheses?
5. How did your final hypothesis compare with your 1st hypothesis?
6. How did collaboration with other teams affect your final hypothesis?
7. Did similar evidence used by more than one team result in different hypotheses?
8. Did different evidence used by more than one team result in identical or very similar
hypotheses?
9. What degree of certainty did you have about your final hypothesis? Why?
10. Did the absence of the “edges” of the puzzle influence the level of difficulty in developing your
hypotheses?
11. If you only had “edges” to use would you have any advantages or limitations?
12. Are there edges that limit or “pin in” scientists as they explore and investigate various questions
and problems?
13. How are the “edges” like a theory early in its development?
14. What scientific or medical advances have occurred during your lifetime through the steady
accumulation of evidence?
15. How did this activity model the process of science used as individuals seek answers to question
and problems?
Biology HSL
Department of Science
Page 98
Teacher
Evidence for the Theory of Evolution
(Adapted from: Prentice Hall Laboratory Manual)
NGSSS:
SC.912.L.15.1 Explain the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
Purpose of Lab/Activity:
 To examine and piece together part of skeleton from duplicate fossilized bones.
 To compare the partial skeleton to skeletons of modern day alligator and bird.
 To explore the evidence of evolution through comparative anatomy, embryology, and
molecular biology.
Prerequisites:
 Students should be familiar with Darwin’s Theory of Evolution by natural selection.
Students should be able to describe the process of adaptation and evolution using the
tenets of Darwin.
 Students should be able to identify factors that could influence natural selection and give
examples and explanations such as climate overpopulations, mutations, and pollution.
 Students understand the concepts of genetic drift, gene flow, mutation, and natural
selection.
 Students should be familiar with the evidences that support the Theory of Evolution:
through comparative anatomy: homologous structures, analogous structure, and vestigial
structures; comparative embryology, and molecular biology.
Safety: Pointed-tip scissors can cut or puncture your skin. Always direct a sharp object or edge
away from yourself and others. Use sharp instruments only as directed.
Materials (per group):
 Replica fossilized bone “casts”
 Scissors
 Paper
 Tape or glue
Procedures: Day of Activity:
What the teacher will do:
a. Make copies of the paper fossils and homologous structure worksheet.
b. Discuss the essential question: What are some evidences that support the
theory of evolution?
c. Have students read the background information about the fossil they are
Before
going to piece together and how fossils are obtained.
activity:
d. Have students answer pre-lab questions or discuss with the class the prelab questions given.
1. Describe the process by which paleontologists and their team remove
fossils from rock. Large earth-moving equipment is used to move rock.
Then smaller hand equipment is used to remove bits of rock and dirt
Biology HSL
Department of Science
Page 99
Teacher
During
activity:
After
activity:
from the fossils. The fossils are covered in plastic wrap or foil to protect
them. Then they are covered with plaster. A paleontologist works under
the fossils to remove them from the rock. The fossil block is then
removed from the earth, tipped over, and plaster is applied to the bottom
side. The fossils are now ready to transport to a laboratory for study.
2. Fossil skeletons are rarely complete. How do you think casts and
collaboration help paleontologists create more complex skeletal
models? If a scientist at one lab or museum is missing a key piece of a
skeleton, the scientist can request a cast of the missing bone from a
colleague.
3. What role do you think inferences play in the work of a paleontologist?
Answers may vary. When certain bones are not available for
observation, the paleontologist will have to infer what the bone may
have looked like based on other bone sample and the homologous bone
in similar species.
What the teacher will do:
a. To make the activity more realistic and challenging, cut out the bone pieces
and place them in envelopes. Randomly remove one bone from each
envelope and place it in a different envelope. Lab groups will then have to
collaborate to get all the pieces that they need.
b. Use comparative anatomy to help guide them in the placement of other
bones. Activity takes approximately 20 minutes for Part A.
c. Have students check off which features you observe in each skeleton.
Activity should take approximately 15 minutes.
d. Activity C: color the homologous structures the same color according to
each species. Approximately 15 minutes.
e. Activities D-G can be continued the next day. Covers analogous structures,
vestigial structures, and comparative embryology.
f. Expected results of piecing together Deinonychus bones with only one limb
of each.
What the teacher will do:
a. Discuss with the class how they think each contributes to the evidence to
the theory of evolution. Student answers should include that each branch
provides proof of each evolution of the species.
b. Discuss the molecular evidence that contributes also to the theory of
evolution. With the advancement of DNA technology, scientists now rely
Biology HSL
Department of Science
Page 100
Teacher
more upon comparisons of protein structure, amino acid sequences, and
DNA sequences to determine evolutionary relationships. The more closely
related the species, the more similar their genetic material will be.
c. Discuss how biogeography also contributes to the theory of evolution.
Biogeography is the study of the distribution of life forms over geographical
areas. Biogeography not only provides significant inferential evidence for
evolution and common descent, but it also provides what creationists like to
deny is possible in evolution: testable predictions. Biogeography is split into
two areas: ecological biogeography which is concerned with current
distribution patterns and historical biogeography which is concerned with
long-term and large-scale distributions.
Extension:
 Gizmo: Evolution – Natural Selection and Artificial Selection, Mutation and Selection
Biology HSL
Department of Science
Page 101
Student
Evidence for the Theory of Evolution
(Adapted from: Prentice Hall Laboratory Manual)
NGSSS:
SC.912.L.15.1 Explain the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
Background Information:
Evolution is not just a historical process; it is occurring at this moment. Populations constantly
adapt in response to changes in their environment and thereby accumulate changes in the
genes that are available to the species through its gene pool. In today's lab you will explore
some of the evidence for evolution and will examine a few of the mechanisms through which
evolution acts. In this laboratory you will review some of the classical examples used as
evidence for evolution. Keep in mind that the support goes far beyond these simplistic examples
and this selection is only intended as an introduction to the subject.
In 1964 scientist John Ostrom discovered the fossil skeleton that you will study in an area called
the Cloverly Formation in Bridger, Montana. The area that Ostrom and his team prospected that
field season had not yielded as many fossils as they had hoped. However, on the last day of the
season, Ostrom discovered some bones he could not identify. The next year he returned to
search for more of the skeleton. Eventually this newly discovered, extinct animal was named
Deinonychus.
Deinonychus lived during the early Cretaceous period, approximately 100 million years ago. It
belonged to a group of dinosaur species called theropods, relatively small meat-eating
dinosaurs that walked on 2 legs. The animal received its name, which means “terrible claw”,
because the second toe on each of its hind feet had a large, sharp claw that probably was used
to tear the flesh from prey. The claws were held up off the ground as the animal moved about,
possibly preventing the claws from wearing down. You will observe that the Deinonychus’s
skeleton shares many features of the skeletons of both modern alligators and birds. Many
researchers hypothesize that the ancestor of birds was a feathered theropod. However, other
researchers hypothesize that theropods and birds share common features because they had a
common ancestor from which both lineages evolved separately. Much further research is
needed to evaluate these 2 hypotheses. In this lab, you will model the work performed by
paleontologists as you examine Deinonychus and identify the reptilian characteristics its
skeleton retains as well as the bird like features it displays.
Problem Statement: What are some evidences that support the theory of evolution?
Safety: Pointed-tip scissors can cut or puncture your skin. Always direct a sharp object or edge
away from yourself and others. Use sharp instruments only as directed.
Vocabulary: evolution, fossil, homologous structures, molecular biology, vestigial organ,
comparative biology
Biology HSL
Department of Science
Page 102
Student
Preparing Fossils
Removing fossils from rock is a long process that requires both skill and a lot of patience. First,
the rock surrounding the top and bottom of the fossils is removed with large earth-moving
equipment. Scientists use smaller equipment such as shovels, picks, and brushes when working
close to a fossil. Before removing a fossil from the ground, workers must encase it in a plaster
“jacket” to prevent it from crumbling during transport to the lab. After treating a fossil with glue to
harden it, paleontologists cover the top of the fossil with tissue paper or foil to protect it from the
plaster. The plaster is allowed to harden on the top and sides of the fossil. Then the
paleontologist climbs under the fossil and frees it from the ground. The fossil is removed from
the rock and flipped over so that plaster can be applied to the bottom side.
In the lab, a person called a “preparatory” begins that long process of removing the plaster
jacket and the small bits of rock still surrounding the fossil. The preparatory may use a
microscope and tools as fine as needles to clean the fossils literally one grain of sand at a time.
Once the bones are free from the rock, paleontologists may make casts of the bones to send to
other paleontologists so they can collaborate in studying them.
Pre-Lab Questions:
1. Describe the process by which paleontologists and their team remove fossils from rock.
2. Fossil skeletons are rarely complete. How do you think casts and collaboration help
paleontologists create more complex skeletal models?
3. What role do you think inferences play in the work of a paleontologist?
Materials (per group):
 Replica fossilized bone “casts”
 Scissors
 Paper
 Tape or glue
 Color pencils
Procedures:
Part A: Deinonychus Fossil Evidence
1. Cut out the Deinonychus’ “casts” and spread them out on a flat surface. Note that this is
only a partial skeleton. Very seldom does a fossil dig produce a complete skeleton. In this
fossil dig, for example, paleontologists were only able to obtain the limbs from the left
side of the animal’s body. Try to fit the bones together. First, locate recognizable bones
such as the skull and backbone.
2. Use the reference skeletons in Part B below to guide you in the placement of the other
bones. Collaborate with other groups if you cannot decide where to place a bone.
3. Once you have decided how the bones should be connected, tape or glue them in place
on a piece of paper.
Biology HSL
Department of Science
Page 103
Student
Deinonychus Fossil Evidence Casts
Biology HSL
Department of Science
Page 104
Student
Part B: Comparative Anatomy
1. Look closely at the scapula, sternum, tail, and feet of all 3 skeletons (Figure 1 and the
Deinonychus’ casts). Note that both the Deinonychus and the bird have an extra toe that
points backward.
2. Fill in data in Table 1 by checking off which features you observe in each skeleton.
Part C: Homologous Structures
1. Carefully examine the drawings of the bones shown in Figure 2. Look for similarities
among the various animals.
2. Color each part of the human arm a different color. (Note: All bones of the wrist should be
a single color; all the bones of the hand should be a different single color, etc.). Then
color the corresponding bone in each of the other animals the same color as the human
bone.
3. Complete the Data Analysis/Results section of laboratory.
+
Part D: Analogous Structures
1. Examine the butterfly wing and the bird wing shown in Figure 3.
2. Complete Data Analysis/Results section of laboratory.
Part E: Vestigial Structures
1. Gradual changes have occurred through time that have in some cases reduced or
removed the function of some of the body structures and organs. The penguin's wings
and the leg bones of snakes are examples of this phenomenon.
2. Examine the cavefish and minnow shown in Figure 4. They are related, but the cavefish
is blind.
3. Complete the Data Analysis/Results section of laboratory.
Part F: Human Vestigial Structures
1. Read the list of human vestigial structures shown in Table 3. Suggest a possible function
for each structure and explain why it became vestigial. Record your answers in the table.
2. Complete the Data Analysis/Results section of laboratory.
Part G: Comparative Embryology
1. Examine the embryos in Figure 5 and list the similarities of each embryo in Table 4.
2. Complete the Data Analysis/Results section of laboratory.
Data Analysis/Results:
Part B: Comparative Anatomy
Biology HSL
Department of Science
Page 105
Student
Figure 1
Table 1
Characteristic
Alligator
Bird
Deinonychus
Narrow scapula (shoulder blade)
Wide scapula (shoulder blade)
Prominent sternum (breastbone)
3 primary toes on hind feet
4 primary toes on hind feet
Extra toe that points backward
Hind legs underneath the body
rather than to the sides
Long tail
Short tail
Claws on front feet
Claws only on hind feet
Bipedal (walks on 2 legs)
Quadrupedal (walks on 4 legs)
Teeth
Biology HSL
Department of Science
Page 106
Student
Part C: Homologous Structures
These structures are formed in similar ways during embryonic development and share like
arrangements; however they have somewhat different forms and functions. They are called
homologous structures.
Figure 2
Biology HSL
Department of Science
Page 107
Student
1. Describe the function of each structure from Figure 2 in Table 2.
Table 2
Animal
Function of Structure
Human
Whale
Cat
Bat
Bird
Crocodile
2. Are the bones arranged in a similar way in each animal?
Part D: Analogous Structures
Some apparently unrelated animals have organs with similar functions, yet are very different
in structure and form. These structures are called analogous structures.
Figure 3
1. What function do these structures share?
2. How are these structures different?
3. Do birds and insects share any structural (elements inside the wing) similarities that
would suggest they are closely related taxonomically?
Part E: Vestigial Structures
Figure 4
Biology HSL
Department of Science
Page 108
Student
1. Explain why eyesight is not an important adaptation to life in a cave.
2. What do you think has become the most important adaptation of the cave fish (think
about senses)? (Explain your answer)
3. What about the internal structure of the cavefish and minnow suggest common ancestry?
Part F: Human Vestigial Structures
Table 3
Structure
Possible Function
Why vestigial?
appendix (digests leaves
in koala bears)
coccyx (tail bones)
muscles that move ears
muscles that make hair
stand up
Part G: Comparative Embryology
Figure 5
Table 4
Species
List similarities of each embryo to others
Fish
Turtle
Salamander
Human
Biology HSL
Department of Science
Page 109
Student
Conclusions: Explain in paragraph form, how each of the following provides evidence for
evolution:
 fossil evidence,
 comparative anatomy (homologous structures, analogous structures, and vestigial
structures), comparative embryology.
Biology HSL
Department of Science
Page 110
Teacher
Natural Selection
(Adapted from: District Adopted – Prentice Hall Laboratory Manual)
NGSSS:
SC.912.L.15.13 Describe the conditions required for natural selection, including: overproduction
of offspring, inherited variation, and the struggle to survive, which result in differential
reproductive success. (AA)
Purpose of Lab/Activity:
 To explore how the frequencies of three beak phenotypes change over several
generations in a population of birds on an island.
 To explore how environmental changes can affect animal populations.
Prerequisites:
 Students should be familiar with Darwin’s Theory of Evolution by natural selection.
 Students should be able to describe the process of adaptation and evolution using the
tenets of Darwin.
 Students should be able to identify factors that could influence natural selection and give
examples and explanations such as climate overpopulations, mutations, and pollution.
 Students understand the concepts of genetic drift, gene flow, mutation, and natural
selection.
Safety:
 Be sure students inform you of allergies to nuts or other foods if you will be using that
particular food item.
 Take care that students do not injure themselves or others while moving around or using
their utensil “beaks”.
 Do not consume any food items being used in activity.
Materials (per group):
 Plastic spoon, knife, or fork
 Self-sealing plastic sandwich bag
 Food pieces (candies, unshelled nuts,

beans, etc.)
Plastic container for nest (optional)
Procedures: Day of Activity:
What the teacher will do:
ENGAGE:
Have a water bottle with water ready. Randomly spray different areas of the
room. Explain to the students that they represent insects and the water
represents a pesticide. Begin to ask them questions.
Before
1. Did all of the insects die? Why or why not?.
activity:
2. What traits or characteristics helped to keep the insects alive? Will these
now be able to reproduce?
3. Do they have to die to be prevented from adding their genetics to the
population?
4. What would happen to this population over time? Would it change?
Biology HSL
Department of Science
Page 111
Teacher
a. Review the rules of the island and survival criteria table or print it out.
b. Discuss the essential question: Can natural selection change the frequency
of traits in a population in only a few generations?
c. Set up a particular area for the “food” items and another area for “nest”
area.
d. Have students complete the pre-lab activity and answer the following
questions.
e. Study the graph below showing the average beak depth found in the
medium ground finch population over a period of 8 years. In which years
did the medium ground finch population have the largest average beak
depth? Were these wet years or dry years? 1977, 1980, 1982. All three
years were dry years.
1. Depending the types of tools and “food” items being used, have
students form a hypothesis to identify the tools they think would be the
best in picking up the “food” items.
What the teacher will do:
During
activity:
EXPLORATION:
a. Not every student will participate in the simulation for each round. If the
student is not participating in the simulation for a round, they must still
collect the data and share it with those who did participate.
b. Do a trial run of 1 minute for the first round to get an idea of how long the
class takes to get their food to the nest. Adjust according depending on
class times. Start round 1 with one student per beak type.
c. If using soft food items, the students are allowed to stab the food items with
their utensil “beaks”.
d. Have students who are not participating keep records of survival and
reproduction.
e. Round 2-3 should include the students who “survived” in round 1 and add
more students depending on how much food they got from the first round.
For example, 6 = 1 offspring; 12 = 3 offspring; 18 = 4 offspring.
f. To calculate frequency of variation, use formula provided.
g. Before you begin rounds 4-6, switch the food items to correlate with hard
dry season foods. Perform the procedures the same way for the first 3
rounds.
h. Have students record and calculate data from the tables given.
Biology HSL
Department of Science
Page 112
Teacher
What the teacher will do:
EXPLANATION:
a. Discuss student results. Expected results were as follows: In the wet
season when softer foods are used, the students using forks and knives will
“survive.” However, in the dry season, when they cannot stab the foods,
they do not fare as well.
After
activity:
ELABORATION:
b. Review the following questions:
1. Was there one beak phenotype that was more successful than another
in round 1-3? If so, which one? Answers vary depending what kind of
food items was being used. However, they will mostly like answer that
the knife or fork variations were the most successful since they were
able to stab the several food items with the tools “beaks”.
2. On the same x- and y-axes, plot three line graphs representing the
success of each beak variation throughout the six rounds. Plot rounds
1–6 on the x-axis. Plot the percent frequency of each variation on the yaxis. Be sure to title your graph and label the axes and the three graph
lines. Check graphs for correct labeling of axes and title. Graphs should
represent their data.
3. Describe the pattern of change for each beak type as displayed in your
graph. Identify the most successful beak type or types and suggest
reasons for success. Discuss how the beak shapes enabled them to
efficiently capture the different types of food.
4. Did the frequency of the different beak variations change when the food
supply changed? Relate this to what you learned about the finches on
Daphne Major. Yes, when the food supply changed, the knife variation
was especially affected. While the forks and spoons could scoop up the
food, the knives could barely carry back one piece at a time. On Daphne
Major during dry years, many of the finches with small beaks did not
survive because they were unable to crack open harder seeds and
expand their food supply.
5. How do you think the results of the Grants’ research might have been
different if the beak-depth variations were not genetically based traits
(were not passed on from the generation to generation)? If beak depth
were not a genetic trait, then the percent frequencies of the variations in
depth would not change after a dry year.
6. Competition and variation are two factors that play key roles in the
natural selection in the population of ground finches on Daphne Major
during the drought years. There are variations in the depth of beaks
among medium ground finches. During drought years, finches with
deeper beaks have more access to food. These finches are more apt to
survive and reproduce than finches with less deep beaks.
EVALUATION:
Have the students create a graph from their results and retest according to
their new ideas and compare and analyze their results.
Biology HSL
Department of Science
Page 113
Teacher
Additional instructions/Handouts:
Rules of the Island
1. You may not use your hands except to hold the plastic utensil (your “beak”) and open the
plastic bag (the “nest”).
2. You may not push other “birds,” deliberately knock the food out of the other “birds’ beaks,” or
steal food from the other “birds’ nests.”
3. You must put your nest in the same general area as the other birds’ nests.
4. When your teacher says that time is up, stop where you are. If you have food held securely
in your beak, you may bring it to your nest.
5. Do not eat any of the food.
Survival Criteria
Food Pieces Collected
Outcome
Fewer than 6
Does not survive
6 – 11
Survive but does not reproduce
12 – 17
Survives and produces 1 offspring
18 – 23
Survives and produces 2 offspring
24 – 29
Survives and produces 3 offspring
Extension:
 Gizmo: Natural Selection
 Have students work in pairs to make a list of ways that the model in this activity simulated
natural conditions and ways that the model differed from natural conditions. Suggest one
change to the model that could control for an additional variable or more closely simulate
the natural world.
Biology HSL
Department of Science
Page 114
Student
Natural Selection
(Adapted from: District Adopted – Prentice Hall Laboratory Manual)
NGSSS:
SC.912.L.15.13 Describe the conditions required for natural selection, including: overproduction
of offspring, inherited variation, and the struggle to survive, which result in differential
reproductive success. (AA)
Background Information:
To start your investigation you will learn about a population of birds called medium ground
finches on Daphne Major, one of the Galápagos Islands. Then you and your classmates will
simulate the fitness of birds of a fictional species called Saccharae utensilus. This bird species
has three possible variations in beak phenotype. Each “bird’s” ability to acquire food will
determine whether it dies, or whether it survives and reproduces. The number of offspring
produced depends on the amount of food each bird acquires, which can vary greatly under
changing environmental conditions. After simulating changes in the bird population for six
generations, you will analyze data to discover how the frequency of each beak phenotype in the
population changed over the generations.
Medium ground finches typically feed on small, soft fruit and seeds. The birds prefer soft seeds
because they are easier to crack. However, during periods of drought, food becomes scarce.
The birds are forced to eat more hard seeds that are difficult to break open. Scientists Peter and
Rosemary Grant and their team studied the island’s population of medium ground finches and
discovered that there are significant variations in the beak depths of individual birds. Birds with
deeper beaks are better able to crack open hard seeds than birds with shallower beaks. These
variations in beak depth made it possible for some of the medium ground finches to get enough
food to survive and reproduce during long droughts.
Problem Statement:
Can natural selection change the frequency of traits in a population in only a few generations?
Safety:
 Be sure to inform your teacher of allergies to nuts or other foods if they are going be
using that particular food item.
 Take care that you do not injure yourselves or others while moving around or using their
utensil “beaks”.
 Do not consume any food items being used in activity.
Vocabulary:
Evolution, natural selection, adaptation, decent with modification, phenotype
Materials (per group):
 Plastic spoon, knife, or fork
 Self-sealing plastic sandwich bag
 Food pieces (candies, unshelled nuts, beans, etc.)
 Plastic container for nest (optional)
Biology HSL
Department of Science
Page 115
Student
Procedures:
1. Holding your “beak” in your hand, gather food and return to your nest to deposit it. Go to
the food source to get more food as many times as possible until time is up.
2. When your teacher tells you the round is over, follow the table below to determine if you
collected enough food to survive to the next round and reproduce.
Food Pieces Collected
Fewer than 6
6 – 11
12 – 17
18 – 23
24 – 29
Outcome
Does not survive
Survive but does not reproduce
Survives and produces 1 offspring
Survives and produces 2 offspring
Survives and produces 3 offspring
3. In Data Table 1, record the initial population size for each beak variation in Round 1 as
well as the total population size. (You will need to collect data from your classmates to
record these numbers.)
4. Next, use the following formula to calculate the frequency of each variation as a
percentage. Enter your results in Data Table 1. Total population size.
5. After rounds 2 and 3 are complete, fill in the rest of Data Table 1
6. Fill in Data Table 2 to calculate the change in frequency of each beak variation over
rounds 1-3.
7. Now suppose that your island is experiencing a drought. The type of food available for
the island’s birds to eat has changed. Perform rounds 4-6 in the same way you
performed rounds 1-3. Record the results in Data Table 3.
8. Fill in Data Table 4 to calculate the change in frequency of each beak variation over
rounds 4-6.
Observations/Data:
Data Table 1
Round 1
Beak
variation
Pop.
Size
%
Frequency
Round 2
Pop.
Size
%
Frequency
Round 3
Pop.
Size
%
Frequency
Spoon
Fork
Knife
Total
Biology HSL
Department of Science
Page 116
Student
Data Table 2
Beak
Variation
% Frequency in
Round 3 (A)
% Frequency in
Round 1 (A)
Change in %
Frequency (A – B)
Spoon
Fork
Knife
Data Table 3
Round 4
Beak
variation
Pop.
Size
%
Frequency
Round 5
Pop.
Size
%
Frequency
Round 6
Pop.
Size
%
Frequency
Spoon
Fork
Knife
Total
Data Table 4
Beak
Variation
% Frequency in
Round 6 (A)
% Frequency in
Round 4 (A)
Change in %
Frequency (A – B)
Spoon
Fork
Knife
Data Analysis/Results:
1. Was there one beak phenotype that was more successful than another in rounds 1-3? If
so, which one?
2. One the same x- and y-axes, plot three line graphs representing the success of each
beak variation throughout the six rounds. Plot rounds 1 - 6 on the x-axis. Plot the percent
frequency of each variation on the y-axis. Be sure to title your graph and label the axes
and the three graph lines.
Conclusions:
1. Describe the pattern of change for each beak type as displayed in your graph. Identify the
most successful beak type or types and suggest reasons for the success.
2. Did the frequency of the different beak variations change when the food supply changed?
Relate this to what you learned about the finches on Daphne major.
3. How do you think the results of the Grants’ research might have been different if the
beak-depth variations were not genetically-based traits (were not passed on from
generation to generation)?
Biology HSL
Department of Science
Page 117
Teacher
Hominid Evolution Station Lab
(Adapted from ETO science resources)
NGSSS:
SC.912.L.15.1 Explain how the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
SC.912.L.15.10 Identify basic trends in hominid evolution from early ancestors six million years
ago to modern humans, including brain size, jaw size, language, and manufacture of tools.
Purpose of the Lab/Activity:
 Analyze important structural features and to determine their importance in determining
evolutionary relationships.
 Collect data by measuring and observing primate skulls and use that data to describe
evolutionary trends between fossil and living specimens of hominoids.
Materials:
 7 hominid skulls
 protractors
 rulers
 calipers
Procedures: Day of Activity:
What the teacher will do:
Before
activity:
During
activity:
a. Show students a physical or virtual model of a human skull. Point out some of the
major anatomical features, including the eye orbits, foramen magnum, mandible,
nasal opening, and zygomatic processes. In addition, have students examine the
teeth, including the canines. Make sure students understand where soft tissue
features, such as the brain, eyes, nose, lips, and spinal cord, would be found in
relation to the bones of the skull.
b. Review the structure of the human brain. Be sure students can identify the
following parts on a diagram: cerebrum, cerebellum, brain stem, pons, medulla
oblongata, frontal lobe, parietal lobe, occipital lobe, temporal lobe
c. If budget permits hominid skull models can be purchased to obtain data, if not
diagrams and pictures of hominid skulls were provided. Make sure to make copies
for each group or use a projector to display images.
d. Set-up hominid evolution stations using the signs provided. Signs include the
guiding questions to assist students in completing the data chart.
What the teacher will do:
a. Monitor students during the activity to make they are using morphological
characteristics to examine the evolutionary relationships and collecting data
and observations needed to complete the "Human Evolution Data Chart".
b. Set a timer for student groups to take approximately 5 – 7 minutes at each
station to complete the data chart, which includes 10 traits for each skull.
c. Remind them that the "Hominid Skull Comparison Checklist" should be
consulted for an explanation of the possible variations in each of the 10
traits. The description of the data in each group should be arrived at by
consensus, with everyone in the group agreeing on the final description.
d. As students are working or just after they are done, discuss the following
Biology HSL
Department of Science
Page 118
Teacher
After
activity:
questions:
1. Which skulls seem most human-like? Homo sapiens, Homo
neanderthalensis, and Homo erectus Which seem most chimp-like?
Pan troglodytes, Australopithecus boisei and Australopithecus afarensis
2. How do you think the invention of tool use affected the evolution of
human jaws?
Chimps use their mouths to tear apart and chew on uncooked food.
Humans first cut up their food with tools. They often then cook their
food, causing it to soften, before eating it. Therefore, humans need
smaller mouths and teeth than chimps do. With stone tools to cut up
food and fire to cook it with, large and powerful teeth and jaws became
unnecessary.
3. Like chimpanzees, early hominids walked on their knuckles and lived in
the trees. What environmental change could cause bipedalism to evolve
in early hominins?
As hominins evolved, their posture became more upright over time. This
likely indicates that the first bipedal hominins still spent some time living
in trees, but progressive hominin species eventually moved out of trees,
using walking as their primary method of locomotion.
What the teacher will do:
e. Allow students to analyze their data and describe the trends of the evolution
of humans through time. Make sure to emphasize the following trends in
hominid evolution: brain size, jaw size, language, manufacture of tools.
f. Answer to analysis questions
1. Why do you think the canine tooth reduced in size so much from
earlier to later hominids? Grasping function of long canines replaced
by easy use of hands, associated with bipedalism.)
2. Why do you think the face flattens over time in hominids? Same as
above.
3. How does the position of the foramen magnum relate to the body
posture and locomotion of the animal? More forward and under the
skull, associated with erect posture of bipedalism; skull balances on
top of spinal column. With semi-erect posture of apes, foramen
magnum is located more to the rear of the skull.
4. Many people assume that modern humans no longer have a
browridge. Have we really lost the browridge? Why do you think many
people think that? Not really; forehead rises directly above the
browridge, enclosing the much-enlarged frontal lobes.
g. Distribute copies of the article, “Skulls Found in Africa and in Europe
Challenge Theories of Human Origins” written by John Noble Wilford, for
the New York Times, August 7, 2002.http://www.nytimes.com/learning.
1. Assign a paragraph to each group to read and discuss among
themselves.
2. They should select a spokesperson from the group to report to the
whole class.
3. When the article has been read and discussed, instruct students to add
information to their K-W-L charts. They may have more questions or
they may have found answers to questions they have already written.
Biology HSL
Department of Science
Page 119
Teacher
The three columns of the chart should be complete at this time.
Extension:
 Gizmo: Human Evolution – Skull Analysis




Interactive images of skulls: http://australianmuseum.net.au/Human-Evolution
Fossilized hominids: http://talkorigins.org/faqs/homs/species.html
Human evolution: http://www.becominghuman.org/, http://www.pbs.org/wgbh/aso/tryit/evolution/
Hominoid taxonomy: http://cogweb.ucla.edu/ep/Hominoids.html
Biology HSL
Department of Science
Page 120
Teacher
HOMINID EVOLUTION
STATION SIGNS
Use these signs to place on lab rotations
to assist students in completing the data
table.
Biology HSL
Department of Science
Page 121
Teacher
 What is the volume of the cranium in each
hominid species?
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 122
t rotcartorp dna relur a esU :epols laicaF .5
nob a roTeacher
f kooL :egdirworb latibroarpuS .6
eht fo epahs ro ,hcra ehT :edacra latneD .7
, de pa hs- " V " ,)sedis cilobarap(
orf htoot driht eht si eninac ehT :seninaC .8
d ro , prahs ;?trohs ro , g n o l yeht
?)seninac dna srosicni
epo egral eht si sihT :mungam nemaroF .9
fer eloh siht fo noitisop ehT .sessap
ungam nemarof eht sI .dionimoh a
t tnuoC :mottoB/poT--hteet fo rebmuN .01
alom :sralomerp :eninac :srosicni fo
waj rewol eht fo flah-eno rof tnuoc
lainarc eht gnitaluclaC :eludoM lainarC .11
e l mumixam eht erusaeM .muinarc
dna daeherof eht fo tniop gnitcejorp
eted si h t d i w mumixam ehT .lluks
e h mumixUse
am ehTa
.tniprotractor
op tsediw eht to measure the angle
tniopdim eht no srepilac eht fo dne
tigas dna laface
noroc ehas
t fo show
noitcesretnin
i the diagram below.
of the
EPOLS LAICAF
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 123
Teacher
Examine the skull for the existence of a
snout.
 Does the part below the eyes extend out?
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 124
Teacher
This is the bony ridge along the top of the
skull to which large chewing muscles attach?
 Is there a sagittal crest along the top of
the skull?
 How pronounced is it?
Biology HSL
Department of Science
Page 125
Teacher
The canine is the third tooth from the center
of the top and bottom jaw.
 Are they long or short?
 Are they sharp or dull?
 Do you observe any trends in your
data?
Biology HSL
Department of Science
Page 126
Teacher
Count the number of teeth in the upper and
lower jaw
 How many teeth are there in the entire
mouth?
 Does the number of teeth remain the
same in every species?
 What observations can you make about
their size?
Biology HSL
Department of Science
Page 127
Teacher
This is the bony ridge along the top of the
skull to which large chewing muscles attach?
 Is there a sagittal crest along the top of
the skull?
 How pronounced is it?
Biology HSL
Department of Science
Page 128
Teacher
The canine is the third tooth from the center
of the top and bottom jaw.
 Are they long or short?
 Are they sharp or dull?
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 129
Teacher
Count the number of teeth in the upper and
lower jaw
 How many teeth are there in the entire
mouth?
 Does the number of teeth remain the same
in every species?
 What observations can you make about
their size?
Biology HSL
Department of Science
Page 130
Teacher
Look for the bony ridge protruding above the
eyes.
 Is it large, small, or medium?
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 131
Teacher
 Does the skull extend above the eyes?
 Is the forehead large, small, or medium?
 Do you observe any trends in your data?
 Do you see a correlation between the
change in size of the browridge and the
forehead?
Biology HSL
Department of Science
Page 132
Teacher
 Is the foramen magnum located toward the
rear or more forward?
 How is the location of this opening an
indication of how an organism walks: two
legs or four legs?
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 133
Teacher
 Does the jaw look U-shaped or V-shaped?
 Do you observe any trends in your data?
Biology HSL
Department of Science
Page 134
Teacher
HOMINID EVOLUTION
SKULL DRAWINGS &
PICTURES
Use these drawings for student groups to
analyze hominid trends and to assist them
in completing the data table.
Biology HSL
Department of Science
Page 135
Teacher
Biology HSL
Department of Science
Page 136
Teacher
Biology HSL
Department of Science
Page 137
Teacher
Biology HSL
Department of Science
Page 138
Teacher
Biology HSL
Department of Science
Page 139
Teacher
Biology HSL
Department of Science
Page 140
Teacher
Biology HSL
Department of Science
Page 141
Teacher
Biology HSL
Department of Science
Page 142
Teacher
Australopithecus africanus
Biology HSL
Department of Science
Page 143
Teacher
Australopithecus africanus
Biology HSL
Department of Science
Page 144
Teacher
Australopithecus boisei
Biology HSL
Department of Science
Page 145
Teacher
Australopithecus boisei
Biology HSL
Department of Science
Page 146
Teacher
Homo erectus
Biology HSL
Department of Science
Page 147
Teacher
Homo erectus
Biology HSL
Department of Science
Page 148
Teacher
Homo neanderthalensis
Biology HSL
Department of Science
Page 149
Teacher
Homo neanderthalensis
Biology HSL
Department of Science
Page 150
Teacher
Homo sapiens
Biology HSL
Department of Science
Page 151
Teacher
Homo sapiens
Biology HSL
Department of Science
Page 152
Teacher
Pan troglodytes
Biology HSL
Department of Science
Page 153
Teacher
Pan troglodytes
*
*To be used for station 6
Biology HSL
Department of Science
Page 154
Teacher
Homo sapiens
Homo erectus
*To be used for station 6
Biology HSL
Department of Science
Page 155
Teacher
Australopithecus boisei
Australopithecus afarensis
*To be used for station 6
Biology HSL
Department of Science
Page 156
Teacher
Homo neanderthalensis
Biology HSL
Department of Science
Pan troglodytes
Page 157
Student
Human Evolution
NGSSS:
SC.912.L.15.1 Explain how the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
SC.912.L.15.10 Identify basic trends in hominid evolution from early ancestors six million years ago
to modern humans, including brain size, jaw size, language, and manufacture of tools.
Background: Scientists have unearthed sufficient fossil evidence to conclude
that a variety of humanlike species lived on Earth within the past 10 million
years. However, scientists continue to investigate and debate hypotheses
about the evolutionary relationships among all known hominids. Even the
species name of some fossils is a matter of debate. As scientists continue to
find new hominid fossils, it is clear human evolution did not proceed as a
single lineage of increasingly humanlike forms. Rather, several hominid forms
arose, thrived, and became extinct over the past 7 million years. Furthermore,
different species of hominids may have coexisted in time and possibly interacted. Human evolution is
marked by a mosaic pattern. This means that different parts of the body, and different adaptations,
evolved at different times and different rates. In this lab, we will investigate and evaluate evolutionary
relationships by examining skulls of living and extinct human relatives. It is a direct, hands-on way of
studying human evolution. Working and presenting interpretations in groups will simulate the process
of paleo-archeology study that characterizes this scientific field and will tie into a discussion of the
various competing theories of human evolution that are currently debated.
Purpose:
1. Analyze important structural features and to determine their importance in determining
evolutionary relationships.
2. Collect data by measuring and observing primate skulls and use that data to describe
evolutionary trends between fossil and living specimens of hominoids.
Problem Statement:
 What can an anthropologist tell from looking at an organism’s skull?
Materials:
 7 hominid skulls (models or
diagrams/pictures provided can be
used)
 protractors


rulers
calipers
Procedure:
a. Review the morphological characteristics that will be used to examine the evolutionary
relationships among primates that can be learned from a study of their skulls.
b. Work in groups of 3 – 4 to collect data and observations needed to complete the "Human
Evolution Data Chart". Take approximately 5 – 7 minutes at each station to complete the data
chart, which includes 10 traits for each skull.
c. The "Hominid Skull Comparison Checklist" should be consulted for an explanation of the
possible variations in each of the 10 traits. The description of the data in each group should be
Biology HSL
Department of Science
Page 158
HOMINOID SKULL COMPARISON CHECKLIST
First fill in the name of each skull on your data chart. Then follow the checklist below to fill in the
Student characteristics of each skull on the data chart. Record all measurements in millimeters.
arrived
at by consensus,
withextend
everyone
theeyes?
group
on large,
the finalsmall,
description.
1. Forehead
: Does the skull
aboveinthe
Is agreeing
the forehead
or medium?
Chin: How
pronounced isCHECKLIST:
the chin? Does it stick out like yours or slope back?
HOMINID2.SKULL
COMPARISON
 Use the descriptions below to help you fill in the characteristics of each skull on your data
3. Sagittal crest: This is the bony ridge along the top of the skull to which large chewing muscles attach. Is
chart.
there a saggital crest? How pronounced is it? Is it large, small, or medium?
 Record all measurements in millimeters.
4. Prognathism: Examine the skull for existence of a "muzzle" or snout - a protrusion of parts of the face
1. Forehead:
Doesthe
the
skull
extend(and
above
thehave
eyes?
Is the forehead
large,Humans
small, or
below
eyes.
Gorillas
dogs)
pronounced
prognathism.
domedium?
not.
2. Sagittal
Crest:
the bony
ridge along
the top of
skulloftothe
which
chewing
muscles
5. Facial
slopeThis
: Use is
a ruler
and protractor
to measure
thethe
angle
face large
as shown
in diagram
below.
attach. Is there a sagittal crest? How pronounced is it? Is it large, small, or medium?
6. Supraorbital browridge: Look for a bony ridge protruding above the eyes. Large, small, or medium?
3. Prognathism: Examine the skull for existence of a "muzzle" or snout - a protrusion of parts of
the7.face
below
the: The
eyes.
Gorillas
(and
pronounced
prognathism.
Humans"U"-shaped
do not.
Dental
arcade
arch,
or shape
of dogs)
the jawhave
will be
either boxshaped
(sides parallel),
(parabolic sides), " V " -shaped, or intermediate.
4. Facial slope: Use a ruler and protractor to measure the angle of the face as shown in diagram
below.
8. Canines: The canine is the third tooth from the center of the top and bottom jaw. Describe them. Are
they long, or short?; sharp, or dull? Is there a diastema present (a gap between the upper
5. Browridge:
Lookand
for canines)?
a bony ridge protruding above the eyes. Large, small, or medium?
incisors
6. Dental
arcade:
The arch,
of the
jaw will
bebase
either
box-shaped
(sides
parallel),
"U"9. Foramen
magnum
: Thisorisshape
the large
opening
in the
of the
skull through
which
the spinal
cord
shaped (parabolic
"V"
or intermediate.
passes. Thesides),
position
of-shaped,
this hole reflects
the body posture (and indirectly the locomotor pattern) of
a hominoid. Is the foramen magnum located toward the rear or more forward ?
7. Canines: The canine is the third tooth from the center of the top and bottom jaw. Describe
them.
Are theyoflong,
short?; sharp,
dull?
10. Number
teeth-or
-Top/Bottom
: Countorthe
number of teeth in the upper and lower jaw. Record number
of incisors: canine: premolars: molars in one-half of the upper jaw as the numerator and the same
8. Foramen magnum: This is the large opening in the base of the skull through which the spinal
count for one-half of the lower jaw as the denominator.
cord passes. The position of this hole reflects the body posture (and indirectly the locomotor
pattern)
of a hominid.
Is the foramen
magnum
located
toward
the numerical
rear or more
11. Cranial
Module: Calculating
the cranial
module
provides
a rough
valueforward?
for the size of the
cranium. Measure the maximum length by placing one end of a caliper on the most forward
9. Number of
teeth (Top/Bottom):
Countand
thethe
number
of teeth
the upper
and
lower
jaw.back of the
projecting
point of the forehead
other end
on theinmost
posterior
point
at the
skull. The maximum width is determined with the calipers on the sides (temples) of the skull at
10. Cranial Module: Calculating the cranial module provides a rough numerical value for the size
the widest point. The maximum height is measured by putting the skull on its side; then hold one
of the cranium,
indirectly
an estimate
of theof
brain
size. Observe
and
in your
end of which
the calipers
on thegives
midpoint
of the anterior
the foramen
magnum
andrecord
the other
end at the
data chartintersection
the volumeofoftheeach
cranium
by reading
each
graduated
cylinder.
coronal
and sagittal
sutures
on top,
in the midline.
Add these and divide by 3:
FACIAL SLOPE
Biology HSL
Department of Science
CRANIAL MODULE
Page 159
Student
Data: Hominid Evolution Chart
FACE
Facial Slope
Hominid Scientific
Name
(Genus, Species) What is the angle
of the facial slope?
Prognathism
Browridge
Dental Arcade
Canines
Number of Teeth
Does the part
below the eyes
extend out?
Is there a bony
ridge above the
eyes?
Does the jaw look
U-shaped or Vshaped?
Are they long or
short? Are they
sharp or dull?
How many teeth
are there in the
entire mouth?
Pan
troglodytes
Pronounced
Slight existence
None
Large
Medium
Small
U-shaped
Intermediate
V-shape
Homo
sapiens
Pronounced
Slight existence
None
Large
Medium
Small
U-shaped
Intermediate
V-shape
Homo
neanderthalensis
Pronounced
Slight existence
None
Large
Medium
Small
U-shaped
Intermediate
V-shape
Homo
erectus
Pronounced
Slight existence
None
Large
Medium
Small
U-shaped
Intermediate
V-shape
Australopithecus
boisei
Pronounced
Slight existence
None
Large
Medium
Small
U-shaped
Intermediate
V-shape
Austalopithecus
afarensis
Pronounced
Slight existence
None
Large
Medium
Small
U-shaped
Intermediate
V-shape
Biology HSL
Department of Science
Long
Dull
Short
Sharp
Long
Dull
Short
Sharp
Long
Dull
Short
Sharp
Long
Dull
Short
Sharp
Long
Dull
Short
Sharp
Long
Dull
Short
Sharp
Page 160
Student
Hominid Evolution Chart (cont.)
BRAINCASE
Hominid
Scientific Name
(Genus, Species)
Cranial Module
Forehead
Sagittal Crest
Foramen Magnum
What is the volume of brain
case in each hominid
species?
Does the skull extend
above the eyes? How big is
the forehead?
Is there a bony ridge along
the top of the skull? How
pronounced is it?
Where is the large opening
in the base of the skull
located?
Pan
troglodytes
Large
Medium
Small
Homo
sapiens
Large
Medium
Small
Homo
neanderthalensis
Large
Medium
Small
Homo
erectus
Large
Medium
Small
Australopithecus
boisei
Large
Medium
Small
Austalopithecus
afarensis
Large
Medium
Small
Biology HSL
Department of Science
Large
Medium
Small
None
Large
Medium
Small
None
Large
Medium
Small
None
Large
Medium
Small
None
Large
Medium
Small
None
Large
Medium
Small
None
Toward the rear
More forward
Toward the rear
More forward
Toward the rear
More forward
Toward the rear
More forward
Toward the rear
More forward
Toward the rear
More forward
Page 161
Student
Analysis/Conclusion:
II. Analyze the Data: After you have compared and described the different specimens,
describe the patterns represented by the data.
1. List those features that all of the specimens have in common.
_____________________________________________________________________
_____________________________________________________________________
2. Identify those features which are most useful for distinguishing between the specimens.
_____________________________________________________________________
_____________________________________________________________________
3. Describe the changes that occur in the hominid cranium over time.
_____________________________________________________________________
_____________________________________________________________________
4. Describe the changes that occur to the hominid jaw over time.
_____________________________________________________________________
_____________________________________________________________________
III. Results: Describe the trends that you have observed in hominid evolution as you completed
this lab, especially those trends relating to brain size and jaw size.
1. Circle the hominid species we discussed in the lab in the chronological graph below.
(A. afarensis, A. boisei, H. erectus, H. neaderthalensis, and H. sapiens)
Biology HSL
Department of Science
Page 162
Student
2. Place these hominid species in chronological order.
________________
________________
________________
________________
________________
________________
3. What conclusion can you make about the coexistence of (or possible competition
between) these hominid species by analyzing your Chronology Graph? Explain your
answer.
_____________________________________________________________________
_____________________________________________________________________
IV. Conclusion: Analyze important structural features to determine their importance in
determining evolutionary relationships.
1. Why do you think the canine tooth reduced in size so much from earlier to later
hominids? Think about the grasping function of long canines and why it might have
been replaced.
_____________________________________________________________________
_____________________________________________________________________
2. Why do you think the face flattens over time in hominids? Think about the changes that
occur in jaw size.
_____________________________________________________________________
____________________________________________________________________
3. How does the position of the foramen magnum relate to the body posture and
locomotion of the animal?
_____________________________________________________________________
_____________________________________________________________________
4. Many people assume that modern humans no longer have a browridge. Have we really
lost the browridge? Why do you think many people think that?
_____________________________________________________________________
_____________________________________________________________________
Biology HSL
Department of Science
Page 163
Teacher
Classification of Fruits
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
SC.912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Purpose of Lab/Activity:
 Students will review the concept of classification
 Students will be able to relate their observations to different ways of classifying
organisms
Prerequisite: Prior to this activity, the student should be able to
 Make accurate and detailed observations
 Have a basic understanding of classifying organisms based on their characteristics
Materials (individual or per group):
 Fruit pictures (may be substituted for real fruit)
Procedures: Day of Activity:
What the teacher will do:
a. Prepare cards of fruits to hand out to each group
Before
b. Pre-assess student understanding of classification.
activity:
c. Review with students what each fruit is and answer any questions about
color or texture. You may also allow opportunities to research the types of
fruits online to determine any characteristics that are not easily seen.
What the teacher will do:
a. As students perform the lab activity, allow students to observe the different
pictures of fruit and help guide them in terms of classifying them based on
their similarities. Also allow the use additional resources such as the
textbook and the Internet to answer questions:.
1. Example: What are the different textures of the fruit? Which fruits have
During
big seeds or small seeds?
activity:
2. Which fruit comes from a tree? Which one comes from a vine or
herbaceous plant?
b. When students prepare to tape or glue the pictures of the fruit to the chart
paper, make sure they wait until all discussion is final before sticking the
pictures to the chart paper.
c. Ensure discussions from students stay productive when disagreements
arise on how to classify the fruits.
What the teacher will do:
a. Assess student understanding of how to classify different organisms based
on observations by having them present their charts to the rest of the class.
After
b. Engage students into a discussion on the importance of making many
activity:
observations about an organism before deciding on its classification and
the importance of having a classification system in place. Some questions
to use:
Biology HSL
Department of Science
Page 164
Teacher
1. Can classification help show possible evolutionary relationships?
2. Do common characteristics always imply shared ancestors?
3. Is there more than one way to classify the fruit? What does this mean
for the study of science?
Extension:

Ask students to redo the activity using different items, such as different leaves, different
types of buttons, etc.
o Advanced students can create their own groups of living organisms that could
possibly exist in the future and classify them into groups.
Biology HSL
Department of Science
Page 165
Teacher
Part 1: List of Fruits
Blackberry
Almond Fruit
Nectarine
Mulberry
Avocado
Raspberry
Cherries
Grapes
Apple
Tomato
Lime
Peach
Pear
Plum
Biology HSL
Department of Science
Orange
Pepper
Page 166
Teacher
Strawberry
Cucumber
Banana
Fig
Eggplant
Osage Orange
Cantaloupe
Coconut
Watermelon
Pumpkin
Squash
Pineapple
Biology HSL
Department of Science
Page 167
Teacher
Part 2: List of Fruits
Almond Fruit
Nectarine
Cherries
Grapes
Plum
Avocado
Raspberry
Tomato
Lime
Blackberry
Apple
Orange
Pepper
Peach
Pear
Biology HSL
Department of Science
Page 168
Teacher
Strawberry
Cucumber
Banana
Fig
Eggplant
Cantaloupe
Coconut
Osage Orange
Watermelon
Pineapple
Pumpkin
Biology HSL
Department of Science
Squash
Page 169
Teacher
Group
Subgroup
Pomes
Develops from an ovary with a single compartment. Edible
exocarp and mesocarp with an inedible, hard endocarp (pit).
Drupes
True
Berries
Grouping Rules
A fleshy fruit composed of the mature ovary along with other
flower parts. Edible exocarp and mesocarp. Seeds are located
within the endocarp.
Pepo
Hesperidia
Aggregates
Multiples
Develop from ovaries with multiple compartments. When cut
open these fruits show separate seed containing compartments.
Same as a true berry except these have a comparatively thick
exocarp.
A berry with a leathery skin containing oils, such as citrus.
Fruits that develop from multiple adjacent ovaries that each
develop tiny fruits.
Are the result of several flowers clustered on one stem. Ovaries
develop individually, but the individual fruits combine into a
single larger fruit.
Classifications of Fruit
Pome
Drupe
True
Berry
Pepo
Berry
Hesperidia
Berry
Aggregate
Multiple
Grouping
Rule
Grouping
Rule
Grouping
Rule
Grouping
Rule
Grouping
Rule
Grouping
Rule
Grouping
Rule
Apple
Pear
Cherry,
Peach, Plum,
Almond
Coconut
Tomato,
Pepper,
Eggplant,
Grape
Cantaloupe,
Squash,
Pumpkin,
Cucumber,
Watermelon
Orange, Lime,
Raspberry,
Blackberry,
Strawberry
Pineapple,
Mulberry, Fig,
Osage
Orange,
Biology HSL
Department of Science
Page 170
Student
Classification of Fruits
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Background: Fruits are developed from flowering plants. Fruits are the ovaries of flowers. After
fertilization, the ovary expands as the seed ripens. Some fruits are the result of ovaries with a
single compartment while other fruits may have ovaries with multiple compartments. Most fruits
are composed of three basic layers; an exocarp (outer), mesocarp (middle) and endocarp
(inner).
The botanical way of classifying a fruit is done by observing various characteristics of the flower
and the fruit. One of these characteristics requires counting the number of ovaries in the flower;
another, deals with the number of chambers in each ovary; and a third, describes the number of
flower ovaries that grow together into one fruit.
Purpose or Problem Statement:
 Relate observations to different ways of classifying organisms
 Develop rules for categorizing the fruits used in the activity
Safety:
If using real fruit:
 Handle fruit with care, it may stain your clothes and some fruit juices may be irritating to
the eye.
 Tell your teacher if you are allergic to any of the fruits used in the experiment.
Vocabulary: flower, fruit, characteristic, seed, ovary, fertilization, classification
Materials (individual or per group):
 Fruit pictures (may be substituted for real fruit)
Part 1
Procedures:
1. As a team discuss ways to group fruit into different categories.
2. Create rules for categorizing each fruit
3. Make sure each fruit meets the required rule for the category it is placed.
4. Name each group
Observations/Data:
Note: Additional tables may be needed to accommodate more groups
Biology HSL
Department of Science
Page 171
Student
Group 1:
Group 2:
Group 3:
Rule:
Types
of fruit
Data Analysis/Results
1. How many different groups did your team make to organize the given fruits?
2. What steps did your team make in order to group the given fruits?
3. How many different ways did your team group the fruits before deciding on your final
grouping rules?
4. Describe the rules your team created and briefly explain what brought about the decision to
make these rules.
Part 2
Procedures:
1. Organize the fruit cards into seven (7) groups.
2. As a team discuss possible rules for each category and write them in the table below.
Biology HSL
Department of Science
Page 172
Student
Classifications of Fruit
Grouping Rule
Grouping Rule
Grouping Rule
Grouping Rule
Grouping Rule
Grouping Rule
Grouping Rule
Observations and Conclusion
1. How did you go about grouping your fruits?
2. How many different ways did your team group the fruits before deciding on your final
grouping rules?
3. How did your final groupings compare to Part 1 of this activity?
Biology HSL
Department of Science
Page 173
Teacher
Kingdom Comparison Challenge
(Adapted from ETO science Resources)
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. AA
Background Information: There is a great diversity of living things in the world. So far,
scientists have identified more than 1.5 million species and there is still estimation between 2
and 100 million more not yet discovered. Therefore, the systems of classification need to adapt
to new discoveries, technologies, ideas or theories. Biologists, throughout the time, come with
different ideas about the classification. The most recent studies using the latest techniques
recognized by many scientists elaborate three domain categories: Bacteria, Archaea and
Eukarya and six different kingdoms: Eubacteria, Archaebacteria, Protista, Fungi, Plantae, and
Animalia.
Purpose:
You will explore the characteristics of the major 6 kingdoms of life.
Problem Statement:
What makes certain living things belong to one type of kingdom?
Materials and preparation:
 Poster board (5 to 8)
 Scissors to separate the tasks cards (to be prepared by the teacher, not the students)
 Kingdom task cards (60)
 Kingdom comparison chart
Procedures:
Before
activity:
During
activity:
What the teacher will do:
a. Print and laminate the Kingdom task cards for future utilization and reuse.
b. Gather materials for each group, create a set of task cards per student
group (60) and comparison chart.
c. Introduce the system of classification. Show the following video on the
Domains of Life to review their distinguishing characteristics.
 Bozeman Science: Classification of Life
 Bozeman Science: Three Domains of Life:
What the teacher will do:
a. Distribute Kingdom task cards and comparison chart to the students.
b. Review with students the six major kingdoms and their characteristics. Use
the comparison chart to guide your review.
c. Have students design their own display on poster board or newsprint, with
room for each piece of the chart and an accompanying illustration and label
(provided).
d. Have students look over the “Kingdom task cards”. Let them ask questions
about the characteristics they don’t understand.
e. Ask students to sort the pieces into the six major kingdoms based on the
characteristics of the living things in each Kingdom.
Biology HSL
Department of Science
Page 174
Teacher
f. Have students rotate and view the sorting pieces of the other groups as a
gallery hall without discussing.
After
activity:
What the teacher will do:
a. Each group places the pieces on the display chart they have designed. For
each characteristic (chart piece), have students draw a sketch and list an
example of another particular organism that has these characteristics. The
resulting display will have illustrations and names of organisms as well as
chart pieces.
b. When all groups are finished, have students defend their placement
decisions in a class discussion. This should help to reconcile any conflicting
decisions.
c. Review the analysis questions.
1. What are the two major characteristics for the kingdom according to
Linnaeus?
2. Look around in your classroom; identify any items such as book bags or
shoes or pens, or pencils or notebooks, and on your own, create some
characteristics of a system of classification.
3. Write a paragraph for each kingdom by describing the characteristics of
each Kingdom.
Extension:
 Virtual Lab: How are living things classified into groups?
http://www.glencoe.com/sites/common_assets/science/virtual_labs/E07/E07.html
 Three Domains of Life http://www.ucmp.berkeley.edu/alllife/threedomains.html
 Six Kingdoms of Life: http://www.ric.edu/faculty/ptiskus/Six_Kingdoms/Index.htm
 Classifying Life Interactive: http://www.pbs.org/wgbh/nova/nature/classifying-life.html
Biology HSL
Department of Science
Page 175
Teacher
Kingdom Kingdom
Eubacteria
Archaebacteria
Kingdom Kingdom
Protista
Fungi
Kingdom Kingdom
Plantae
Biology HSL
Department of Science
Animalia
Page 176
Teacher
Cell Type
Cell Type
Prokaryotic
Prokaryotic
Unicellular
Unicellular
Cell Type
Cell Type
Eukaryotic
Eukaryotic
Multicellular
Multicellular
Cell Type
Cell Type
Eukaryotic
Eukaryotic
Most Unicellular; Most Multicellular;
some
some Unicellular
Multicellular
Biology HSL
Department of Science
Page 177
Teacher
Nuclear
Envelope
Nuclear
Envelope
Absent
Absent
Nuclear
Envelope
Nuclear
Envelope
Present
Present
Nuclear
Envelope
Nuclear
Envelope
Present
Present
Biology HSL
Department of Science
Page 178
Teacher
Mitochondria Mitochondria
Present
Present
Mitochondria Mitochondria
Present or
absent
Present or
absent
Mitochondria Mitochondria
Absent
Biology HSL
Department of Science
Absent
Page 179
Teacher
Chloroplast Chloroplast
None
None
(photosynthetic (photosynthetic
membranes in
membranes in
some types)
some types)
Chloroplast Chloroplast
Present
(some forms)
Absent
Chloroplast Chloroplast
Absent
Biology HSL
Department of Science
Present
Page 180
Teacher
Cell Wall
Cell Wall
Cell walls
with
peptidoglycan
Cell walls
without
peptidoglycan
Cell Wall
Cell Wall
Present in some Chitin and other
forms, various
noncellulose
types
polysaccharides
Cell Wall
Cell Wall
Cellulose and
other
polysaccharides
Absent
Biology HSL
Department of Science
Page 181
Teacher
Mode of
Nutrition
Mode of
Nutrition
Autotroph or
Heterotroph
Autotroph or
Heterotroph
Mode of
Nutrition
Mode of
Nutrition
Autotroph or
Heterotroph
Heterotroph
Mode of
Nutrition
Mode of
Nutrition
Heterotroph
Autotroph
Biology HSL
Department of Science
Page 182
Teacher
Examples
Examples
Streptococcus
Methanogens
Examples
Examples
Amoeba
Mushrooms
Examples
Examples
Mosses
Sponges
Biology HSL
Department of Science
Page 183
Teacher
Examples
Examples
Escherichia Coli
Halophiles
Examples
Examples
Paramecium
Yeasts
Examples
Examples
Slime molds
Giant kelp
Biology HSL
Department of Science
Page 184
Teacher
Examples
Examples
Ferns
Worms
Examples
Examples
Flowering plants
Insects
Examples
Examples
Mammals
Fishes
Biology HSL
Department of Science
Page 185
Teacher
Kingdom Comparison Chart
Kingdom
Cell Type
Eubacteria
Prokaryotic
Nuclear
Envelope
Absent
Mitochondria
Chloroplasts
Cell Wall
Absent
None
Absent
Absent
(photosynthetic
membranes in
some types)
None
Cell walls
With peptidoglycan
Unicellular
Archaebacteria Prokaryotic
Unicellular
Cell walls
Without peptidoglycan
(photosynthetic membranes in
some types)
Present
Present in some
(some forms)
various types
Mode of
Nutrition
Autotroph or
heterotroph
Examples
Autotroph or
heterotroph
Methanogens,
Halophiles
forms,
Autotroph or
heterotroph
Amoeba, Para
mecium, slime
molds, giant
kelp
Mushrooms,
yeasts
Strreptococcus,
Escherichia Coli
Protista
Eukaryotic
Present
Fungi
Most Unicellular;
Some multicellular
Eukaryotic
Present
or absent
Present
Absent
Plantae
Most multicellular;
Some unicellular
Eukaryotic
Present
or absent
Present
Present
Present
Cellulose and
Autotroph
Other polysaccharides
Mosses, Ferns,
Flowering plants
Animalia
Multicellular
Eukaryotic
Present
Present
Absent
Absent
Sponges, worms
Insects, fishes,
mammals
Multicellular
Biology HSL
Department of Science
Chitin and other
Noncellulose
polysaccharides
Heterotroph
Heterotroph
Page 186
Student
Kingdom Comparison Challenge
(Adapted from ETO science Resources)
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. AA
Background Information: There is a great diversity of living things in the world. So far,
scientists have identified more than 1.5 million species and there is still estimation between 2
and 100 million more not yet discovered. Therefore, the systems of classification need to adapt
to new discoveries, technologies, ideas or theories. Biologists, throughout the time, come with
different ideas about the classification. The most recent studies using the latest techniques
recognized by many scientists elaborate three domain categories: Bacteria, Archaea and
Eukarya and six different kingdoms: Eubacteria, Archaebacteria, Protista, Fungi, Plantae, and
Animalia.
Purpose: You will explore the characteristics of the major 6 kingdoms of life.
Problem Statement: How are living things classified into groups?
Materials:
 Poster board
 Kingdom task cards (60)
 Kingdom comparison chart
Procedures:
1. Highlight the characteristics that are included in the chart. Note that some characteristics
are found in more than one kingdom.
2. Review the six major kingdoms and their characteristics.
3. Design a display on poster board or newsprint, with room for each piece of the chart and
an accompanying illustration and label (provided).
4. Review the “Kingdom task cards”. Ask questions about the characteristics you don’t
understand.
5. Sort the pieces into the six major kingdoms based on the characteristics of the living
things in each Kingdom.
6. Rotate and view the sorting pieces of the other groups as a Gallery Walk without
discussing.
7. Each group places the pieces on the display chart they have designed. For each
characteristic (chart piece), have students draw a sketch and list an example of another
particular organism that has these characteristics. The resulting display will have
illustrations and names of organisms as well as chart pieces.
8. When all groups are finished, you will defend their placement in a class discussion.
Conclusion:
1. What are the two major characteristics for the kingdom according to Linnaeus?
2. Look around in your classroom; identify any items such as book bags or shoes or pens,
or pencils or notebooks, and on your own, create some characteristics of a system of
classification.
3. Write a paragraph for each kingdom by describing the characteristics of each Kingdom.
Biology HSL
Department of Science
Page 187
Teacher
Cladistics
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Purpose of Lab/Activity:
 Construct a cladogram.
 Properly interpret and analyze cladogram in terms of recognizing the concepts of
common ancestry and degrees of evolutionary relationship.
Prerequisite: Prior to this activity, the student should be able to
 Identify characteristics of organisms
Materials (individual or per group):
 Organism Cards and Linnaean Table (in student packet)
 Clear (see-through) plastic bags – 7 per group
 3 x 5 cards or sticky notes
 Scissors
 Printer paper
 Color pencils or markers
Procedures: Day of Activity:
What the teacher will do:
a. Gather together a set of 7 plastic bags for each group.
b. Provide each student with a handout of the reading passage “The De-riving
Force of Cladogenesis”
Before
1. Have students read the passage (incorporate jump-in reading, one
activity:
sentence summaries or any other favorite reading strategy to engage
and discover student prior knowledge).
2. Review vocabulary words during the reading.
c. Discuss the concept of Cladogenesis.
d. Handout the Organisms Cards to each group.
What the teacher will do:
a. As students perform the lab activity, allow students to observe the different
pictures of animals and help guide them in terms of following the steps in
creating a cladogram from the cards.
During
b. Ensure discussions from students stay productive when disagreements
activity:
arise on how to place the organism into the bags and the bags into each
other. As students perform the lab activity, allow students to use additional
resources to answer the introductory questions, such as the textbook and
the Internet.
What the teacher will do:
c. Assess student understanding of cladograms by discussing the group work.
After
1. Review Observation/Conclusion questions:
activity:
i. Why do organisms resemble one another? They are related to each
other.
ii. What does it mean when two organisms are very similar? The more
Biology HSL
Department of Science
Page 188
Teacher
similar, the closer related they are and the more recent the common
ancestor is.
iii. List and describe at least two ways that similarity between organisms
can be determined. Comparing anatomy, Comparing DNA,
Comparing embryology (development before birth).
iv. Compare and contrast a cladogram (branching tree diagram) with a
pedigree (family tree). Both show relatives & ancestors. Cladograms
include more distant relatives over a longer period of time and can
thus be used to predict the characteristics of common ancestors.
Extension:
 Introduction to classification, phylogenetic trees, and cladistics by UCMP: "What did T.
rex taste like?" http://www.ucmp.berkeley.edu/education/explorations/tours/Trex/index.html
 Cladistics is a Zip—Indiana EDU: http://www.indiana.edu/~ensiweb/lessons/clad.bag.html
 Go to the following website http://www.pbs.org/wgbh/evolution/change/family/index.html
and do the activity from PBS called, All in the Family. Questions on this activity are found
in the activity itself. When tree is completed check for correctness.
o Click on each organism that you think are the two closest relatives. The pictures will
appear on an evolutionary tree.
o The remaining species will move into position on the remaining branch and you will
find out if your first guess was correct.
o Use the tools to compare anatomical, developmental, and molecular traits.
o Figure out which traits are primitive (they are the ones held by the out-groups).
o Assume that traits that aren’t primitive must be derived.
o Find the two organisms that share the most derived traits.
o Drag organisms to put this pair in the top two branches of the tree.
o When you think the tree is correct check the answers.
Additional Resources:
In this lesson, classification can (and should) be used to illustrate more than a mere hierarchical
grouping of organisms. This lesson introduces students to the building of cladograms as
evolutionary trees, showing how "shared derived characters" can be used to reveal degrees of
relations. Students are introduced to the process of illustrating evolutionary relationships with
branching diagrams called cladograms. Students learn that once a cladogram has been
constructed for a group of organisms, it can be used to answer all kinds of interesting questions
based on the shared inherited features of those organisms.
The concepts are as follows:
 All living things are related by common ancestry.
 Branching diagrams, called cladograms, are used to illustrate evolutionary relationships.
 Cladograms are based on shared, inherited features.
 Cladograms refine our ability to understand and interpret evolutionary history.
Biology HSL
Department of Science
Page 189
Teacher
Example Cladograms:
Biology HSL
Department of Science
Page 190
Teacher
Organism Cards
Name:
Date Palm
Phoenix dactylifera
Energy
Source:
Autotroph
Vertebrae
(backbones): n/a
Body Temperature:
n/a
Limbs: n/a
Eyes: n/a
Retractable Claws: n/a
Other: Does not move.
Name:
Sea Lion
Energy Source:
Heterotroph
Vertebrae
(backbones):
yes
Body Temperature:
constantly warm
Limbs: 4 flippers with
claws
Teeth: Pointed teeth
Eyes: eyeballs on side of head:
Retractable Claws: no
Name:
Leopard Frog
Rana pipiens
Energy Source:
Heterotroph
Vertebrae
(backbones):
yes
Body Temperature: varies
with environment
Limbs: 4 legs
Eyes: eyeballs on top/side of head
Retractable Claws: n/a
Other: Tongue attached to front of
jaw.
Name:
Honey Bee
Apis mellifera
Energy Source:
Heterotroph
Vertebrae
(backbones): no
Body Temperature: varies
with environment
Limbs: 6 legs
Eyes: on side of head
Retractable Claws: n/a
Other: Compound eyes.
Name:
House Cat
Felis silvestris
Energy Source:
Heterotroph
Vertebrae
(backbones):
yes
Body Temperature: constantly
warm
Limbs: 4 legs with clawed feet
Teeth: Pointed teeth
Eyes: front of head
Retractable Claws: yes
Other: Purrs,but cannot roar.
Name:
Bactrian Camel
Camelus
bactrianus
Energy Source:
Heterotroph
Vertebrae
(backbones): yes
Body Temperature:
constantly warm
Limbs: 4 legs with hooves
Teeth: Square, flat teeth
Eyes: eyeballs on side of head
Retractable Claws: n/a
Biology HSL
Department of Science
Name: African
Lion
Panthera leo
Energy
Source:
Heterotroph
Vertebrae
(backbones): yes
Body Temperature: constantly
warm
Limbs: 4 legs with clawed feet
Teeth: Pointed teeth
Eyes: front of head
Retractable Claws: no
Other: Roars, social animal, males
have manes.
Name:
Siberian
Tiger
Panthera
tigris
Energy
Source: Heterotroph
Vertebrae (backbones): yes
Body Temperature: constantly
warm
Limbs: 4 legs with clawed feet
Teeth: Pointed teeth
Eyes: front of head
Retractable Claws: no
Other: Roars, stripes, solitary
animal.
Page 191
Teacher
Linnaean table
Common
Name
Date Palm
Honey Bee
Leopard
Frog
Bactrian
Camel
House Cat
African Lion
Siberian
Tiger
California
Sea lion
Kingdom
Plantae
Animalia
Animalia
Animalia
Animalia
Animalia
Animalia
Animalia
Phylum
Magnoliophyta
Artropoda
Chordata
Chordata
Chordata
Chordata
Chordata
Chordata
Class
Liliopsida
Insecta
Amphibia
Mammalia
Mammalia
Mammalia
Mammalia
Mammalia
Order
Arecales
Hymenoptera
Anura
Artiodactyla
Carnivora
Carnivora
Carnivora
Carnivora
Family
Arecaceae
Apidea
Ranidae
Camelidae
Felidae
Felidae
Felidae
Otariidae
Genus
Pheonix
Apis
Rana
Camelus
Felis
Panthera
Panthera
Zalophus
Species
dactylifera
mellifera
pipiens
bactrianus
silvestris
leo
tigris
Californianus
Biology HSL
Department of Science
Page 192
Teacher
The De-riving Force of Cladogenesis
Andrew J Petto University of Wisconsin, Milwaukee, and Editor, National Center for Science
Education
Cladogenesis is the term used to describe the branching off of new taxa. These branches - or
clades - are based on several criteria that make the descendants along a particular branch
different from their ancestors and from related taxa on other branches. Each new branch
exhibits a combination of novel characteristics that are unique to that branch mixed with some
"familial" characteristics, which this branch shares with its evolutionary ancestors. Although
certain novel traits may be diagnostic for members of an evolving lineage, it is often the
combination of unique and shared characteristics that defines new branches.
The basis of constructing a valid cladogram is the ability to identify the characteristics of the
ancestral population and those of the descendants. Characteristics found among the ancestors
and shared by most or all members of related taxa are referred to as primitive. In cladistic
studies this word is understood as "original" or "primal" and not as "crude" or "simple".
A cladogram is constructed on these combinations of ancestral and derived characteristics in
related taxa by organizing and diagramming the pattern and sequence in which they could have
arisen. Ideally, we want a cladogram based on branches defined by uniquely derived characters
that emerge once in an evolving lineage and are shared by all subsequent descendants. This
helps us to test our hypotheses about common descent in evolving lineages. A branch that
includes all the organisms descended from the same ancestral population is said to be
monophyletic.
Two fundamental principles used in evaluating cladograms are parsimony and robusticity. First,
when there is more than one way to draw a cladogram, and when there are no other data that
suggest one of these is more likely than the others, we tend to choose the one in which derived
traits are re-invented in different branches the fewest number of times. Second, we prefer trees
that maintain their basic form; even when different options are applied to the sequence of
changes in one or more of their branches. However, when more data are available about the
history or the origin of a particular feature, these data are more important tools in determining
which of the alternative trees is better. In contrast to exercises in mere classification, we want to
base our taxonomy on the cladogram. The guiding principle is that our taxa should be
monophyletic. Each evolutionary branch must contain all descendants of a common ancestor.
Fossil data help to refine cladistic analysis by providing information about the sequence or order
in which certain derived traits emerged. Cladistic analysis helps to resolve the "problem" of the
so-called "missing links" or the intermediate specimens, because it does not require that fossil
species evolve into any related species, which emerge later. Instead, it represents the
evolutionary history of an evolving lineage in terms of a collection of characteristics that can be
passed along to descendant populations - or not!
Biology HSL
Department of Science
Page 193
Student
Cladistics
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Background: When scientist do studies in comparative anatomy, and find different numbers of
shared derived characteristics between different groups, they can draw a diagram of branching
lines which connect those groups, showing their different degrees of relationship. These
diagrams look like trees and are called "phylogenetic trees" or "cladograms" (CLAY-doe-grams).
The organisms are at the tips of the stems. The shared derived features of the homologous
structures are shown on the cladogram by solid square boxes along the branches, and common
ancestors are shown by open circles. The more derived structures two organisms share, the
closer is their evolutionary relationship -- that is, the more recently their common ancestor lived.
On the cladogram, close relationships are shown by a recent fork from the supporting branch.
The closer the fork in the branch between two organisms, the closer is their relationship.
In this activity a series of plastic bags will be used to create a three dimensional Venn Diagram
to illustrate the hierarchical grouping of organisms based on their shared derived features, thus
forming the basis of a cladogram.
Purpose or Problem Statement:
 Construct a cladogram.
 Properly interpret and analyze cladogram in terms of recognizing the concepts of
common ancestry and degrees of evolutionary relationship.
Safety: Be careful with scissors, do not point, swing, or play with scissors.
Vocabulary: Phylogeny, Cladogram, Taxonomy, Classification, Binomial Nomenclature
Materials (individual or per group):
 Organism Cards and Linnaean Table (in student packet)
 Clear (see-through) plastic bags – 7 per group
 3 x 5 cards or sticky notes
 Scissors
 Printer paper
 Color pencils or markers
Procedures:
1. Create a set of Name Cards by cutting 3x5 cards into 3 pieces until you have 8 pieces
(sticky notes may be used instead).
2. Name each cut piece using the names on the Organism Cards provided
3. Examine the descriptions on the Organism Cards and the Linnaean table in order to
select the two most similar organisms.
4. Put their name cards together in plastic bag 1.
5. Select the organism which is most like the ones you chose in step #3 and place this
name card in bag 2.
6. Place bag 1, with its two name cards into bag 2.
Biology HSL
Department of Science
Page 194
Student
7. Select the next most similar organism to the organisms in bag 2 and place its name card
in bag 3.
8. Then add bag 2 (containing all the previous cards) into bag 3.
9. Repeat step 7 and 8 until all the name cards have been bagged.
10. Final “nested” bags should look like this:
11. Place the 3-D Venn diagram on top of a piece of paper.
12. Record your data: Consider what characteristic is common to all the organisms in the
bags. Write this characteristic at the end of a line connecting to the outermost organism.
(Characteristic 1 in picture)
13. Consider the remaining bags of organism cards. What do all these organisms have in
common? Write down that characteristic on another line connecting to the second largest
Venn region.
14. Continue to examine the organisms in your bags and describe a common characteristic
of the remaining organisms.
Biology HSL
Department of Science
Page 195
Student
15. When you are done, you will have a branching tree diagram that looks a bit like a bonsai
tree.
16. Remove the Name Cards from the bags and place in the appropriate line.
Observations/Conclusions:
1. Why do organisms resemble one another?
2. What does it mean when two organisms are very similar?
3. List and describe at least two ways that similarity between organisms can be determined.
4. Compare and contrast a cladogram (branching tree diagram) with a pedigree (family
tree).
Biology HSL
Department of Science
Page 196
Teacher
Plant Structure and Function
NGSSS:
SC.912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Purpose of Lab/Activity:
 Students will identify the parts of a plant
 Students will be able to relate the structure of plant parts to their function
Prerequisite: Prior to this activity, the student should be able to
 Identify parts of a plant and their functions
Materials (individual or per group):
 Tea leaves or tea bag (Leaf
 One fruit (any kind) (Flower)
 Celery plant (Stem and Leaf)
 Carrot or onion (Root)
 Live green plant (in a pot)
 If possible, a leaf sample from an “Oyster” plant (Tradescantia discolor)
Procedures: Day of Activity:
What the teacher will do:
a. Prepare materials and display them to the whole class.
b. Engage student prior knowledge and understanding by asking the following
Before
questions:
activity:
1. What do all these items have in common?
2. What are the basic parts of a plant?
3. Where do plants come from?
What the teacher will do:
a. Display the green plant
1. Ask students to identify parts of the plant.
2. After identifying the parts of the plant ask students to describe the order
in which the plant will grow starting with the seeds.
During
3. As students describe the growth of a plant, draw or show pictures of
activity:
each part.
b. Engage students in a discussion on the function of each of the following
parts of the plant: Roots, Stems, Leaves, and Flowers.
c. Have students make a table on the structure and function of each part
discussed, providing sufficient examples and descriptions.
What the teacher will do:
a. Assess student understanding of plant structure and function by reviewing
After
its different parts.
activity:
b. For additional reinforcement on the concept of plant structure and function
provide students with the handouts on Major Plant Organs and Functions.
Extension:
 Plant Structure and Function Extension (Student handout)
Biology HSL
Department of Science
Page 197
Teacher
Biology HSL
Department of Science
Page 198
Student
Plant Structure and Function Extension
NGSSS:
SC.912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Part 1A: Leaves
The leaf of a plant serves two basic functions: photosynthesis and cellular respiration.
Photosynthesis is a chemical reaction in which plants convert radiant energy (light energy) into
chemical energy (food energy or more specifically, glucose). Cellular respiration is the chemical
reaction in which chemical energy (glucose) is converted into usable energy for the plant.
Can you list the reactants and products for the processes of photosynthesis and cell respiration?
Photosynthesis Equation: _______________________________________________________
Cell Respiration Equation: _______________________________________________________
Leaf Cross-Section
The leaf is the primary photosynthetic organ of the plant. It consists of a flattened portion, called
the blade that is attached to the plant by a structure called the petiole. Sometimes leaves are
divided into two or more sections called leaflets. Leaves with a single undivided blade are called
simple, those with two or more leaflets are called compound.
The outer surface of the leaf has a thin waxy covering called the cuticle (A), this layer's primary
function is to prevent water loss within the leaf. (Plants that leave entirely within water do not
have a cuticle). Directly underneath the cuticle is a layer of cells called the epidermis (B). The
vascular tissue, xylem and phloem are found within the veins of the leaf. Veins are actually
extensions that run from to tips of the roots all the way up to the edges of the leaves. The outer
layer of the vein is made of cells called bundle sheath cells (E), and they create a circle around
the xylem and the phloem. On the picture, xylem is the upper layer of cells (G) and is shaded a
little lighter than the lower layer of cells - phloem (H). Recall that xylem transports water and
phloem transports sugar (food).
Within the leaf, there is a layer of cells called the mesophyll. The word mesophyll is greek and
means "middle" (meso) "leaf" (phyllon). Mesophyll can then be divided into two layers, the
palisade layer (D) and the spongy layer (F). Palisade cells are more column-like, and lie just
under the epidermis, the spongy cells are more loosely packed and lie between the palisade
layer and the lower epidermis. The air spaces between the spongy cells allow for gas exchange.
Mesophyll cells (both palisade and spongy) are packed with chloroplasts, and this is where
photosynthesis actually occurs.
Epidermis also lines the lower area of the leaf (as does the cuticle). The leaf also has tiny holes
within the epidermis called stomata. Specialized cells, called guard cells (C) surround the
stomata and are shaped like two cupped hands. Changes within water pressure cause the
Biology HSL
Department of Science
Page 199
Student
stoma (singular of stomata) to open or close. If the guard cells are full of water, they swell up
and bend away from each other which opens the stoma. During dry times, the guard cells close.
Identify the structures:
Color the structures underlined above. Make sure that the entire picture is colored and that the
color matches the words. For simplicity only part of the picture is labeled.








Cuticle (light blue)
Epidermis (yellow)
Guard cells (pink)
Palisade Mesophyll (dark green)
Phloem (purple)
Xylem (orange)
Spongy Mesophyll (light green)
Bundle Sheath(dark blue)
Biology HSL
Department of Science
Page 200
Student
Answer the following questions:
1. What two tissues are found within a vein?
2. What does the word "mesophyll" mean?
3. What two layers of the plant contain chloroplasts?
4. The outermost layer of cells: _________________________
5. The waxy covering of the leaf.: _______________________
6. These cells function to open and close stomata. _____________________
7. Outer layer of the vein: ________________________
8. Column like cells that lie just under the epidermis. ___________________
9. Openings that allow for gas exchange. _________________________
10. The stalk that connects the leaf to the stem. ______________________
Extension:
1. Write a paragraph discussing how leaf structure contributes to the efficiency of the
process of photosynthesis.
2. Predict adaptations that would be found in leaves located in the following environments.
a. Desert
b. Tropical rain forest
c. Aquatic environment
Part 2A: Stomata and Guard Cells:
Materials:
 Plant leaves
 Clear fingernail polish
 Clear cellophane tape (clear package sealing tape)
 Microscope
 Microscope slides
 Oyster plant leaf
Procedure:
1. Obtain a leaf from a plant; generally any plant will work for this procedure.
2. Paint a thick patch of clear nail polish on the leaf surface being studied. Make a patch at
least one square centimeter.
3. Allow the nail polish to dry completely.
4. Tape a piece of clear cellophane tape to the dried nail polish patch. (The tape must be
clear. Do not use Scotch tape or any other opaque tape. Clear carton-sealing tape works
well.)
5. Gently peel the nail polish patch from the leaf by pulling on a corner of the tape and
peeling the fingernail polish off the leaf. This is the leaf impression you will examine.
(Only make one leaf impression on each side of the leaf, especially if the leaf is going to
be left on a live plant.)
6. Tape your peeled impression to a very clean microscope slide. Use scissors to trim away
any excess tape.
Biology HSL
Department of Science
Page 201
Student
7. Scan the slide until you find a good area where you can see the stomata. Each stoma is
bordered by two sausage-shaped cells that are usually smaller than surrounding
epidermal cells. These small cells are called guard cells and, unlike other cells in the
epidermis, contain chloroplasts.
8. Cut a small piece of the Oyster plant leaf. Observe directly under the microscope. A cross
section or slide is not needed. Observe the stomata and guard cells and compare them to
the ones previously observed.
Analysis:
1. Sketch and label the Stoma, Guard Cells, Epidermal Cells, and Chloroplasts
2. Estimate the number of stomata in both of your samples.
3. Where were most of the stomata found? Why do you think this is? Explain your answer in
evolutionary terms.
Extension:
1. Question: Will plants have more stoma open during the day than during the night?
2. Develop a hypothesis about the number of open stomata found in a plant kept in the dark
compared to a plant in the light.
3. Repeat the procedure above for preparing your slide. You will make two impressions, one
from a "Dark Plant" and one from a "Light Plant" You will compare the two impressions.
4. Write a short paragraph that answers the question; use your data to support your
conclusions.
5. Discuss the factors that cause the stomata to be open during the day and closed at night.
Under what circumstances the stomata might be closed during the day?
Biology HSL
Department of Science
Page 202
Student
Part B: Roots
Materials:
 Plant roots (monocot and dicot)
 Microscope
 Microscope slides
Cells in plants cells are organized into four main tissues—protective, vascular, meristematic,
and fundamental. Protective tissue surrounds the outside of a root and the rest of the plant. This
tissue is composed of epidermis and/or cork cells. Vascular tissue contains cells which conduct
materials such as water, minerals, and food to the organs of the plant. It also provides support.
Two of the major vascular tissues are xylem and phloem. Fundamental tissue includes storage
areas and cells where food is manufactured. This tissue also provides support. Meristematic
tissue is growth tissue. It produces new cells which develop into the other three types of tissues.
In this investigation, you are to observe and identify the various tissues in herbaceous monocot
and dicot roots, the area of lateral root origin, and onion root. You are to compare the relative
sizes of each cell type observed. You are also to observe and identify primary and secondary
roots from different types of root systems.
Herbaceous Monocot and Dicot Roots:
1. Observe the monocot and dicot root slides on low power, then on high power of your
microscope.
2. For each root, locate and identify the epidermis, cortex, endodermis, pith, xylem,
pericycle, and phloem (Figure 53-1). Determine whether each cell type is protective,
vascular, fundamental, or meristematic tissue.
3. Compare the relative size of each type of cell.
4. Make a sketch of each type of cell.
Biology HSL
Department of Science
Page 203
Student
Lateral Root Origin
1. Observe the slide of the area of lateral root origin on low power, then on high power.
2. Determine the tissue from which the lateral root is growing. (See Figure 53-2).
3. Make a sketch of your observations.
Onion Root Tip (Longitudinal Section)
1. Observe the onion root tip slide on low then medium power.
2. Label the apical meristem (the area where the cells are dividing). Note that the cells are
smaller and less developed closer to the meristem and that they elongate and mature as
they get older (farther up the root).
3. What is the function of the root cap at the very tip of the root? Sketch what you see.
Biology HSL
Department of Science
Page 204
Student
Root Systems
Using Figure 53-3, observe the different types of root systems.
1. The blue-stained material in the cortex of the dicot root is starch. Why is it found in the
root and how did it get there?
2. From what specific tissue does a lateral root originate? Is it meristematic? Why?
3. How do xylem patterns differ in monocot and dicot roots?
4. How do tap root systems differ from fibrous root systems?
5. Which root system, tap or fibrous, is more similar to an adventitious root system?
Explain?
6. What are four basic functions of roots?
Biology HSL
Department of Science
Page 205
Student
Part C: Stems
Materials:
 Plant stems (monocot and dicot)
 Microscope
 Microscope slides
As in roots, protective, vascular, fundamental, and meristematic tissues are found in stems. The
difference between roots and stems may be slight or significant.
In this investigation, you are to observe and identify the tissues in an herbaceous monocot stem,
and herbaceous dicot stem, and a woody stem. You are to compare the relative size of each cell
to the other cells and make sketches of each. You are to observe and identify the external parts
of a woody twig and determine the pattern of leaf arrangement.
Herbaceous Monocot and Dicot Stems:
1. Observe the monocot and dicot slides on low power, then on high power of your
microscope.
2. Make a sketch of each stem and label the epidermis, cortex, vascular bundles, xylem,
phloem, cambium, and pith (Figure 54-1).
3. List the functions of each cell type.
4. Determine whether each cell type is protective, vascular, fundamental, or meristematic
tissue.
5. Compare the relative size of each cell to the other cells.
Biology HSL
Department of Science
Page 206
Student
Tilia Stem (Woody growth):
1. Observe the Tilia stem slide on low power, then on high power of your microscope.
2. Sketch and label the epidermis, cork, cortex, phloem, cambium, spring wood, summer
wood, xylem, pith rays, and pith (Figure 54-2).
3. List the functions of each cell type.
4. Determine whether each cell type is that of protective, vascular, fundamental, or
meristematic tissue.
5. Compare the relative cell sizes.
Woody Twig:
1. Observe the woody twig.
2. Locate and identify the terminal bud, lateral bud, lenticels (small pores in the bark), bud
scale, bud scale scar, node, internode, and leaf scar (Figure 54-3).
3. List the functions of each part of a woody twig.
4. Determine whether the stem has an alternate or opposite leaf arrangement.
Biology HSL
Department of Science
Page 207
Student
5. The area between two bud scale scars is one year’s growth. Count the years of growth
on the twig.
Analysis Questions:
1. State the various functions of a stem.
2. How is woody xylem in Tilia different from xylem in herbaceous monocots and dicots?
3. What other major differences exist between woody stems and herbaceous stems?
4. How do monocot and dicot stems differ in location of cambium, xylem, and phloem?
5. Explain how you would tell if one growing season was more favorable for growth than
others.
6. What function do lenticels serve? What would happen to a woody twig with no lenticels?
7. How can you determine the past arrangement of leaves on a bare twig?
Biology HSL
Department of Science
Page 208
Teacher
Exploring Flower Structure
NGSSS:
SC.912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Purpose of Lab/Activity:
 Students will be able to list the parts of a flower
 Students will be able to relate the structure of the flower parts to their function
 Student will be able to learn the floral origin of the various structures of a fruit
 The students will see the macroscopic and microscopic structures of a flower using both
a compound and stereo microscope
Prerequisite: Prior to this activity, the student should be able to
 Identify parts of a plant and their function within the plant
Materials (individual or per group):
 Stereo or compound microscopes
 Brassica rapa or similar type of
flowers
 Forceps
 Scissors
 index cards
 pencil
 tape
 microscope slides







cover slips
water
disposable pipettes
rubber stopper
tomato
apple
knife
Procedures: Day of Activity:
What the teacher will do:
c. Begin with a brief introduction of terms associated with a flower.
d. Have students read through the first part of the lesson and answer
introductory questions.
Before
e. Ask students to describe the function of each part of the flower.
activity:
1. Why are some flowers colorful?
2. Why do some flowers produce scent?
3. What is the purpose of flowers?
f. Ask student to describe fruits, do all plants produce fruits?
What the teacher will do:
d. As students perform the lab activity, allow students to use additional
resources to answer the introductory questions, such as the textbook and
the Internet.
During
1. Example: What are the five main parts of a flower? Most flowers have
activity:
the same basic parts, though they are often arranged in different ways.
The five main parts of a flower are the sepals, petals, stamens, pistil,
and nectaries. (The sepals are the green leaf like structures at the base
of the petals that protect the developing flower. The petals are the
colored leaf-like structures within the sepals).
Biology HSL
Department of Science
Page 209
Teacher
After
activity:
2. What are the functions of the basic parts of a flower?
3. Why are some parts of the flower sticky?
4. Define fruit.
5. What are the three layers of the pericarp?
6. List four fruits where the seed is eaten and the fruit is discarded.
e. When students prepare to dissect the flower, make sure to show them how
to use the rubber stopper to secure and stabilize the flower.
f. Make sure students complete their index cards with the required flower
parts and their labels.
What the teacher will do:
c. Assess student understanding of flower functions by reviewing its different
parts.
d. Engage students into a discussion on the importance of pollination and its
relation to flower structure and function. Example topics:
1. Evolution of plant adaptations to attract pollinators.
2. How is our food supply impacted by pollination?
3. How do structures of flowers help with pollination and the spreading of
seeds?
4. Describe the formation of the fruit and seed in a simple fruit. List the
flower parts that are involved in the formation of each.
5. How can you distinguish between the fruit and other parts of the flower?
Extension:
 Activities and flower images at www.fastplants.org
 Gizmo: Flower Pollination, Pollination: Flower to Fruit
Biology HSL
Department of Science
Page 210
Student
Exploring Flower Structure
(Adapted from Flower Dissection – http://www.swiftoptical.com/EducationalResources.aspx)
NGSSS:
SC.912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Background:
Flowers are the reproductive structures of flowering plants (Angiosperms). Flowers can range
from being very colorful and conspicuous, such as a rose or orchid, to being very simple,
reduced and inconspicuous, such as those of grasses, oaks, and elms. The function of a flower
is to produce the reproductive cells of the plant (eggs and pollen) and then produce seeds, the
dormant young plant of the next generation.
Major parts of a flower can be identified in the diagram below:
Figure 1 - Drawing by Mariana Ruiz
The seeds of flowering plants are surrounded by a tissue called the fruit, which may be fleshy or
dry. The culinary designation of “vegetable” is based on the use of the plant part (eaten as part
of the main course in a meal). Vegetables are actually various plant parts; some are fruits (e.g.,
tomatoes and peppers), leaf stalks (celery), leaf blades (spinach), lateral buds (Brussels
sprouts), young shoot (asparagus), massive flowering structure in bud stage (broccoli), root
(sweet potato), underground storage stem (white potato).
Fruits come in all shapes and sizes, they all function in protecting the seeds inside and in aiding
seed dispersal. Protection may be afforded by hardening of the fruit to make accessing the
seeds more difficult, or by accumulation of acids or other toxins. Fleshy colored fruit attract birds
and animals; seeds pass through the gut unharmed.
Biology HSL
Department of Science
Page 211
Student
Some types of seeds cannot germinate unless they have first passed through the digestive tract
of an animal. Many fruits promote wind dispersal. Other fruits have hooks, spines, and bristles
that readily cling to fur and clothing— just walk your dog in an old field in autumn and see! Fruits
called pods dry out as they mature and rip open, flinging out the seeds.
Although the basic principles of sexual reproduction are the same in a plant, an insect, an
animal, and a human; observing the structure of flowers is necessary to create a full picture and
completely understand the reproductive process of pollination for a flower. Dissecting a variety
of flowers and identifying their parts will help visualize and relate the structure of flowers to their
function.
Purpose or Problem Statement:
 To list the parts of a flower
 To relate the structure of the flower parts to their function
 To learn the floral origin of the various structures of a fruit.
 To identify the macro and microscopic structures of a flower using both a dissecting and
compound microscope
Safety:
Students should take extreme care when handling dissecting equipment such as scissors
and forceps
Vocabulary:
Petals, stamen, pistil, pollen grains, stereo microscope, compound microscope, sepal,
nectarines, anther, filament, seed pod, nectar, ovary, ovules, pedicel, fruit, endocarp,
mesocarp, exocarp
Materials (individual or per group):
 Stereo and compound microscopes
 Brassica rapa or similar type of
flowers
 Forceps
 Scissors
 index cards (4” x 6” or bigger)
 pencil






tape
microscope slides
cover slips
water
disposable pipettes
rubber stopper
Procedures:
1. Begin with a brief introduction of terms associated with a flower.
2. Read the information provided (including additional information from the textbook,
Internet, or other source) and answer the introductory questions
3. Perform a flower dissection:
a. While dissecting the flower, identify each structure of the flower using the stereo
microscope
b. Place all flower parts onto an index card and label each part.
c. Save one stamen to examine pollen grains.
4. Using the collected stamen, create a wet mound of pollen grains and observe them under
a compound microscope.
5. Clean up: properly store the microscope and lab materials.
Biology HSL
Department of Science
Page 212
Student
Observations/Data:
Introduction
What is a flower? In human eyes it is something to enjoy, with color and fragrance. For many
plants, flowers are vital organs of reproduction containing both male and female gametes. For
bees and other nectar-feeding animals, flowers are a source of food.
1.
2.
3.
4.
5.
What is the purpose of a flower for a plant?
Do flowers help any other organisms? How do they help those organisms?
Why do you think flowers are brightly colored?
What are the five main parts of a flower?
What are the two leaf-like structures of a flower called?
The stamen has two parts, the anther and the filament. The anther contains the pollen grains,
which contain the male gametes. The pistil usually has three parts, the stigma (which receives
the pollen), the style (the neck below the stigma) and the carpel (or ovary).
Brassica flowers have two fused carpels, separated by a thin membrane. The carpels house the
ovules, which contain the female gametes. Sugar-rich nectar is secreted by the specialized
nectary tissues. These are strategically located in the flower to ensure that nectar-gathering
animals will receive pollen from anthers and transmit it to stigmas.
1. What is the male structure of the flower called? What are the two parts of this structure?
2. What is the female structure of the flower called? What are the three parts of this
structure?
3. Which part of the flower do you think become the seeds of a plant? (see Figure 1)
4. What part of the flower do you think becomes the seedpod? (see Figure 1)
5. On which part of the flower are pollen grains found?
Flower Dissection
1. Let’s start with stabilizing the flower. You all have a black rubber stopper that has an
incision in it. If you squeeze the stopper, the incision will widen. When the incision
widens, you can place your flower into the slot. Release the stopper, and the flower will
remain in place; watch your teacher for further instruction.
2. Before you begin to dissect the flower, look at the flower from above. Do this with your
stereo microscope. Adjust your stereo microscope so that you are examining the flower
under 10X.
a. If you look closely between the petals, near the receptacle, you will see the nectaries.
They look like droplets of water.
Note: Feel free to adjust the microscope power to 20X, 30X or 40X for a closer look;
the powers you use depend on the options on your stereo microscope. How many
nectaries do you see? Number of nectaries: _______
b. Examine the flower under 10X, 20X, 30X and/or 40X. Look closely at the petals,
stamen and pistil. The petals glisten in the light. Why might have plants evolved to
have brightly colored flowers?
c. Examine the pistil under 10X, 20X, 30X and/or 40X. The pistil looks slightly sticky.
Why do you suppose this structure is sticky? Is there anything stuck to the pistil?
Biology HSL
Department of Science
Page 213
Student
d. Look closely at the stamen under 10X, 20X, 30X and/or 40X. Do you see the clumps
of yellow fuzz? That is the pollen. We will be looking at the pollen later in this lesson.
3. It is now time for the dissection. Dissection may be easier if it is done under the
magnification of your microscope. Start by removing the sepals of the flower.
a. It may be easiest to do this if you hold the flower with your finger from below the
pedicel and begin to remove the sepals with a pair of tweezers.
b. Place the sepals on the index card, tape them in place, and label them.
4. Repeat the same procedure for the following flower parts in the following order: petals
and pistil. See Figure 2
Figure 2
5. You still have stamens remaining on your flower. Remove all but one of the stamens,
tape them onto your index card, and label them.
a. Place the last stamen to the side to be used to observe pollen grains.
6. On your finished index card, you should have sepals, petals, stamens and one pistil. All
structures should be labeled.
7. Please put your tape and tweezers back in their proper locations.
8. Write your name on your index card and hand it in to your teacher.
Compound Microscope Applications: Observation of Pollen Grains
1. Obtain your one remaining stamen from your Brassica rapa flower.
2. Place the stamen onto your microscope slide and tap the stamen a few times with your
tweezers. Pollen grains should fall from the stamen.
3. Remove the stamen, leaving pollen grains behind, add one drop of water, and cover it
with a cover slide.
4. Adjust your microscope. Start with the 10X objective. Locate small, yellowish, oval
shaped objects. Change your objective to 40X. These small, yellowish, oval shaped
objects are the pollen grains of the Brassica rapa flower. Draw the pollen grains in the
box below. Be sure you label the magnification correctly.
Biology HSL
Department of Science
Page 214
Student
5. Clean up your materials and hand this packet into your teacher or have all your
observations and conclusions in your journal.
Digital Microscopy Applications
Create a "virtual index card": Using your Swift Cam and Swift Imaging Software you can capture
images during the dissection process. Capture the image that you see when using the 10X
objective (label the image with the correct magnification - 100X). Capture the image that you
see when using the 40X objective (label the image with the correct magnification - 400X). Be
sure to save your images. Create annotated images with each part appropriately labeled. Be
sure to include measurements of each structure for each part you identify. Can you think of any
other annotations you may do using the software? Hint: You can measure and use the filter
options.
Fruit Development
After fertilization occurs in an angiosperm, the ovules develop into the seeds. The ovary that
surrounds the seed or seeds develops into the fruit. The wall of the ovary develops three
distinct layers. The outer layer--or exocarp--is made up of a single layer of epidermal cells. The
middle layer--or mesocarp--is where food is stored for the fruit. The mesocarp is usually many
cell layers thick. The inner layer--or endocarp--can vary in both thickness and texture. In some
of the fruits the endocarp is soft and fleshy while in others it is hard and dry.
Biology HSL
Department of Science
Page 215
Student
There are numerous kinds of fruit, ranging from small, dry, seed-like fruits to the larger, fleshy
types (Fig. 2a). The correct botanical classification of a fruit may at first be confusing. For
instance, a tomato is really a berry, while a raspberry is really an aggregate simple fruit formed
from drupelets. There can be no argument about what is a fruit and what is a vegetable,
however; if it is derived from the ovary of a flower, it is botanically a fruit.
1. Study the cross section of the fruit shown in a. Notice the role each part of the ovary wall
plays in the formation of the fruit. The thickness and texture of these parts will vary with
each fruit that you examine.
2. Label the exocarp, mesocarp, and endocarp in b and c.
Biology HSL
Department of Science
Page 216
Student
The tomato is type of fruit known as a berry. As such, it is fleshy at maturity and is derived
entirely from the ovary of a flower. The tomato has a “superior” ovary that develops above the
whorls of sepals and petals.
3. Carefully slice a tomato in half along its horizontal axis (equator).
Many flowers have compound carpels, single structures that were formed by the fusion of
several separate carpels. (Some texts use the general term pistil to describe a single carpel or
several fused carpels.)
a. Is there any evidence to suggest that the tomato flower has a compound carpel?
b. How many seeds (generally speaking) does the tomato contain?
c. How many ovules did the ovary of the tomato flower contain?
The apple, although fleshy like the tomato, is classified as an accessory fruit. Accessory fruits
develop from the ovary of the flower, but also include other floral parts as well. In the case of the
apple, the fleshy part of the fruit arises from the floral tube (receptacle)--only the “core” arises
from the original ovary. The "core line" marks the location of the outer portion of the ovary wall,
the exocarp. The leathery endocarp portion of the ovary wall is located closest to the seeds. In
contrast to berries, accessory fruits typically develop from epigenous flowers (those with an
“inferior” ovary--one that is situated below the whorls of sepals and petals.) In the apple flower,
the ovary is buried in the floral tube (receptacle) tissue.
Where on the apple do you find the remnants of sepals, stamens, and stigma?
Figure 2b illustrates changes in the floral parts that accompany the processes of pollination,
fertilization, and subsequent development of the apple fruit. Study the diagram carefully. Note in
particular that each ovule must be fertilized if that ovule is to develop into a mature seed.
Biology HSL
Department of Science
Page 217
Student
4. Carefully slice an apple in half along its horizontal axis (equator).
a. Does the apple have a compound carpel? If so, how many carpels fused to form the
ovary of the flower from which the apple fruit developed?
b. How many ovules were in each carpel?
Biology HSL
Department of Science
Page 218
Teacher
Properties of Water
NGSSS:
SC.912.L.18.12 Discuss the special properties of water that contribute to Earth's suitability as
an environment for life: cohesive behavior, ability to moderate temperature, expansion upon
freezing, and versatility as a solvent. (AA)
Purpose of the Lab/Activity:
 Determine the effect of the different substances on the properties of water.
 Investigate water’s properties and behaviors.
 Explain why water is a polar molecule and investigate the effects of that polarity.
Prerequisites:
 Students should understand chemical bonding.
 Students should be able to explain polarity.
 Students should understand the importance of water in living things.
 Students should be able to explain the states of matter.
Materials (per group):
 glass of water
 paperclip
 penny
 soda straw
 Hot plate (optional for new questions)
 Salt (optional for new questions)





glass slide
glass test tube
a strip of jeans
paper strip with a marker dot
wax paper
Procedures: Day of Activity:
What the teacher will do:
a. You can modify this lesson by providing the materials to the students and
allowing them to develop their own controlled experiment. Procedural plan
would have to be approved prior to experimentation.
b. Demonstration: Water Molecule Model and Physical States
1. On the front desk set up a large beaker on a hot plate.
2. Obtain ice cubes for the demo.
3. Construct a 3-D model of a water molecule. Use something round and
large for the oxygen atom (like an orange) and two smaller round
Before
objects (grapes) for the two hydrogen atoms. Use a toothpick to
activity:
connect the objects. Remember the hydrogen atoms make a 105 0
angle with the center of the oxygen atom.
4. At the start of the period, put some water and ice cubes in the beaker on
the hot plate at the front desk and turn the heat on high. Advise
students to keep an eye on what is happening as you continue.
c. Activate student’s prior knowledge by asking the following questions:
1. What is water? How would you best describe what water is in chemical
terms? Water is a molecule composed of two atoms of hydrogen
bonded to an oxygen atom.
2. Explain the physical phases of water. Water molecules exists as a
Biology HSL
Department of Science
Page 219
Teacher
During
activity:
After
activity:
solid, liquid or gas. As a solid (ice), water molecules are bonded to
each other in a solid, crystalline structure. As a liquid, some of the
molecules bond to each other with hydrogen bonds (bonds break and
reform continuously). As a gas, water vapor, the water molecules are
not bonded to each other (they float as single molecules).
3. Water is a polar molecule. What does that mean? It means that there is
an uneven distribution of electron density. Water has a partial negative
charge near the oxygen atom due to the unshared electrons, and partial
positive charges near the hydrogen atoms.
d. Have students write a hypothesis for each of the following water concepts:
To do this you need to pick a specific substance from the materials list to
test for each hypothesis.
e. Students should have eight hypotheses. For example, one hypothesis
might be: If the substance used is the penny then the water will group
together and show surface tension.
f. The group’s hypotheses must be approved prior to experimentation.
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
their procedural plan.
b. Review the experimental design diagram by asking individual students in
groups to explain the different parts of the experiment.
c. Follow laboratory procedural plan; making sure to model proper laboratory
safety and use of equipment.
d. Emphasize importance of data collection by groups.
e. Ask the following questions:
1. How many drops of water can you place on a penny? Why do you think
this?
2. Predict what would happen if you added soap to the water, would the
penny be able to hold more water. Explain why.
3. What will the drop of water look like on the wax paper? Why do you
think this?
4. Predict what will happen to the drop on the paper when it is placed in
the beaker? Why do you think this?
5. What will happen when the straw is placed in a beaker of water?
6. Describe the properties of water do you think are responsible for water’s
unique behaviors?
What the teacher will do:
a. Analyze class data; making sure to note the importance of multiple trials,
and repeatability in scientific investigations.
b. Answer Key for Results:
1. How did this investigation demonstrate cohesion, adhesion surface
tension and capillary action? Commercial bubble solution should create
the biggest bubble.
2. What implications do these concepts have for living things? Answers
will vary. Students show include data that explains the difference in
bubble size between the 4 solutions tested.
3. Have you ever done a belly flop? If so explain how it felt and what
property of water caused you to feel pain. If not, guess what property of
Biology HSL
Department of Science
Page 220
Teacher
4.
5.
6.
7.
water causes the pain felt from doing a belly flop. Answers will vary.
Doing a belly flop stings because of water’s surface tension.
Why is water important for keeping animals cool? How does sweating
cool us down? Water is the medium in which all chemical reactions in
the body take place. Water regulates animal’s body temperature. By
sweating, animals attempt to lose extra body heat via evaporative
cooling.
Why does ice float? Why is this important to the fish in a lake? Ice
floats because it is less dense than liquid water. If water did not act like
this any fish or other organisms that live in the lake would not be able to
survive during the winter.
What are the terms used to describe waters attraction to itself and other
things? What bonding allow for this? What does the charge of the
molecule have to do with its properties? Water is attracted to other
water. This is called cohesion. This is due to the polarity of the water
molecule and the hydrogen bonding involved. The hydrogen of one
molecule (positive charge) is attracted to the oxygen (negative charge)
of another molecule. Water can also be attracted to other molecules.
This is called adhesion.
What attraction is important to water striders? Surface tension
Extension:
 Web Tutorial: Properties of Water
 Gizmo: Element Builder
 This Extension is necessary to fulfill the annually assessed benchmark associated
with this unit:
1. Choose another factor to test. Develop a new problem statement and design a new
experiment to test for this factor. Record all parts of the lab (from the parts of a lab) in
your journal. Present your findings to the class.
2. Make sure to identify the test (independent) variable, responding (dependent)
variable, controls, and constants.
Biology HSL
Department of Science
Page 221
Student
Properties of Water
NGSSS:
SC.912.L.18.12 Discuss the special properties of water that contribute to Earth's suitability as
an environment for life: cohesive behavior, ability to moderate temperature, expansion upon
freezing, and versatility as a solvent. (AA)
Background:
Water is the most common substance on Earth. Nearly three-quarters (about 70 percent) of the
Earth’s surface is covered with water. Water is unique because it is the only substance that
occurs naturally on Earth in all three states—solid, liquid, and gas. About 2 percent of the
world’s water is solid, including snow, frost, glaciers, and the polar ice sheet. Less than onethousandth of a percent of the world’s water is gaseous, as water vapor. The rest of the world’s
water is liquid, and can be found in oceans, seas, lakes, rivers, streams, and groundwater.
Sometimes we call water H2O. That’s because water molecules have two hydrogen atoms and
one oxygen atom. While water molecules are neutral as a whole, one end of the water molecule
tends to have a positive charge while the other has a negative charge (polarity). Each end of a
water molecule is attracted to the opposite charged end of another water molecule.
This is called “hydrogen bonding.”
Cohesion is the attraction of water molecules to other molecules. It is the result of hydrogen
bonding – the attraction of the hydrogen atoms in water to the oxygen atoms in water. It is the
property that allows water droplets to form. Cohesion is responsible for surface tension. This
property allows some insects to walk across water.
Adhesion is the ability of water to stick to other surfaces. For example, water forms on mirrors in
a steamy bathroom. Adhesion is a property that causes water to be drawn up through soil and
into paper towel. When water is drawn up through small spaces, it is called capillary action.
Water is an amazing substance that is critical to life. It serves a purpose in various processes
such as cellular metabolism, heat transfer, and structural support. For these reasons and more,
the presence of water is a good indicator that life may be sustainable in certain environments,
such as the Jovian moon of Europa.
Problem Statement: What are the properties of water that contribute to living things? Or
develop your own problem statement and experiment based on the different properties of water
and its importance to sustaining life on earth (ability to moderate temperature, cohesion, etc.)
Safety: Make sure that the bubble solution is poured on top of trash bags on the tables, report
any spills immediately to the teacher. Use napkins routinely to clean up your lab area.
Vocabulary: polar, nonpolar, adhesion, cohesion, surface tension, capillary action, solvent
Biology HSL
Department of Science
Page 222
Student
Materials (per group):
 glass of water
 paperclip
 penny
 soda straw
 glass slide
 glass test tube





hot plate (optional)
salt (optional)
a strip of jeans
paper strip with a marker dot
wax paper
Procedures:
 Write a hypothesis for each of the following water concepts:
 To do this you need to pick a specific substance from the materials list to test for each
hypothesis. You should have eight hypotheses. For example, one hypothesis might be: If
the substance used is the penny then the water will group together and show surface
tension.
 After getting approval for all of your hypotheses you will need to write your procedures. It
may help you to look at the data table.
Observations/Data:
Check the appropriate box if the listed property occurred in your experiment. Polar or Non-Polar
must be selected for each investigation.
Properties of Water
Substance
Polar
Non-Polar
Adhesion
Cohesion
Surface
Tension
Capillary
Action
Putting paper clip in
water
Pouring water on
penny
Putting regular straw
in water
Putting jean strip in
water
Putting paper strip
with dot in water
Pouring water on
glass slide
Pouring water on
wax paper
Putting water in test
tube
Biology HSL
Department of Science
Page 223
Student
You should also collect qualitative data such as observations about each substance.
Results:
1. From the data collected, what happened in each of the 8 procedural plans.
2. How do you know those substances possess the qualities of the ones you checked?
Conclusion:
1. How did this investigation demonstrate cohesion, adhesion surface tension and capillary
action?
2. What implications do these concepts have for living things?
3. Have you ever done a belly flop? If so explain how it felt and what property of water
caused you to feel pain. If not, guess what property of water causes the pain felt from
doing a belly flop.
4. Why is water important for keeping animals cool? How does sweating cool us down?
5. Why does ice float? Why is this important to the fish in a lake?
6. What are the terms used to describe waters attraction to itself and other things? What
bonding allow for this? What does the charge of the molecule have to do with its
properties?
7. What attraction is important to water striders?
Extension:
 This Extension is necessary to fulfill the annually assessed benchmark associated
with this unit:
1. Choose another property of water to test. Develop a new problem statement and
design a new experiment to test for this property. Record all parts of the lab (from the
parts of a lab) in your journal. Present your findings to the class.
2. Make sure to identify the test (independent) variable, responding (dependent)
variable, controls, and constants.
Biology HSL
Department of Science
Page 224
Teacher
Investigating the Effect of Light Intensity on Photosynthesis
(Adapted from: State Adopted – Prentice Hall (Laboratory Manual B))
NGSSS:
SC.912.L18.9 Explain the interrelated nature of photosynthesis and cellular respiration. (AA)
SC. 912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Purpose of Lab/Activity:
 To observe how light affects photosynthesis.
 To understand how photosynthesis in important to life.
 To understand the consequences of what can happen when plants and trees are
destroyed.
Prerequisites: Students should be familiar with the generalized equation for photosynthesis
and be able to identify the reactants and products of photosynthesis. They should also be aware
of the current debates and discussions about global warming and how the destruction of plants
and trees contributes to such a problem.
Materials (per group):
 Test tube
 Source of bright light
 Sodium bicarbonate solution (Baking Soda)
 Watch or clock with second indicator
 400-mL beaker
 Plastic gloves
 Sprig of evergreen (Example; Florida Slash Pine) or Elodea/Anacharis (Fresh Water
Aquarium Plant)
 Hand lens
 Forceps
Procedures: Day of Activity:
What the teacher will do:
a. Prep Work: Prepare a saturated solution of 7 g sodium bicarbonate per 100
mL water. Pour off the solution, leaving any undissolved solid behind.
Provide sprigs that are as freshly cut as possible. If possible, cut stems
underwater and keep the cut ends in water until use. The time required for
this lab is 30 minutes.
b. Essential Question/Problem Statement:
Before
1. “How does the destruction of forests affect the rate of photosynthesis?”
activity:
2. “How does this change our living environment and what consequences
can a low level of photosynthesis cause to our atmosphere?”
c. Inform the students to read the entire investigation. Have them work with a
partner to answer the pre-lab questions. These questions should be in the
student’s hand-out. Once the students have completed the pre-lab
discussion questions, initiate a class discussion asking different students to
share their answers.
Biology HSL
Department of Science
Page 225
Teacher
During
activity:
After
activity:
What the teacher will do:
a. Use the following questions to engage student thinking during the activity:
1. What is the name of the gas inside the bubbles released by the sprig?
How do you know?
2. Why are these bubbles produced by the plant?
3. From what part of the plant do you observe the bubbles being emitted?
4. Which light intensity do you think most bubbles will be released? Why?
b. Ensure that students are recording their observations in the Data Table.
What the teacher will do:
a. Conduct a whole-class discussion to assess student understanding of the
activity. The following questions can be used to engage student thinking
and connect the concepts of this activity to the NGSSS.
1. How does the intensity of light affect the rate of photosynthesis?
2. Was your hypothesis correct or not? Explain what occurred.
3. How do your results compare with those of your classmates? Are they
similar? Different? How can you account for any differences in the
numbers of bubbles produced? Can you identify any trends even if the
actual numbers differ?
b. Have the students develop a Power Point presentation about the
importance of plants to our atmosphere, community, and future. Have them
include measures that they would implement to save our forest and stop
global warming.
Extension:
 Repeat this activity using different colors of light.
 Gizmo: Photosynthesis
Biology HSL
Department of Science
Page 226
Student
Investigating the Effect of Light Intensity on Photosynthesis
(Adapted from: State Adopted – Prentice Hall Laboratory Manual B)
NGSSS:
SC.912.L18.9 Explain the interrelated nature of photosynthesis and cellular respiration. (AA)
SC.912.L.14.7 Relate the structure of each of the major plant organs and tissues to
physiological processes. (AA)
Background Information:
In order to carry out photosynthesis, a plant must have light. How much light? Some plants need
a lot of light. Others seem to thrive in shade. Does more light lead to more photosynthesis? In
this investigation, you will examine how the intensity of light affects photosynthesis. You will also
analyze the importance of photosynthesis and its need for our environment to survive.
Purpose of Lab/Activity:
 To observe how light affects photosynthesis.
 To understand how photosynthesis is important to life.
 To understand the consequences when plants and trees are destroyed.
Problem Statement(s):
 Does the intensity of light affect the rate of photosynthesis?
 How does the destruction of forests affect the rate of photosynthesis?
 How does this change our living environment and what consequences can a low level of
photosynthesis cause to our atmosphere?
Pre-Lab Questions:
1. What are the products of photosynthesis? Which of these products is released from
leaves as a gas?
2. What can you tell about photosynthesis if a leaf begins to produce more gas bubbles?
Fewer gas bubbles?
3. What are the manipulated and responding variables in this experiment? Identify one
controlled variable.
Safety:
Safety goggles required
Vocabulary:
photosynthesis, carbon cycle, greenhouse effect, chlorophyll, chloroplast, stroma, thylakoid.
Materials (per group):
 Test tube
 Source of bright light
 Sodium bicarbonate solution (Baking
Soda)
 Watch or clock with second indicator
 400-mL beaker




Plastic gloves
Freshly cut sprig of evergreen or
Elodea/Anacharis
(Fresh
Water
Aquarium Plant)
Hand lens
Forceps
Procedures:
Biology HSL
Department of Science
Page 227
Student
1. Working with a partner, completely fill a test tube and a beaker with a sodium bicarbonate
solution. Sodium bicarbonate will provide a source of carbon dioxide.
2. Using forceps, place a sprig of evergreen about halfway down in the test tube. Be sure
that the cut end of the sprig points downward in the test tube (See Figure 1).
3. Cover the mouth of the test tube with your thumb and turn the test tube upside down. Try
not to trap any air bubbles in the test tube (See Figure 2).
4. Place the mouth of the test tube under the surface of the sodium bicarbonate solution in
the beaker. Remove your thumb from the mouth of the test tube.
5. Gently lower the test tube inside the beaker so that the test tube leans against the side of
the beaker (See Figure 4 and 5).
Biology HSL
Department of Science
Page 228
Student
6. Put the beaker in a place where it will receive normal room light. Using a hand lens, count
the number of bubbles produced by the sprig in the test tube for 5 minutes. Record the
number of bubbles on the Data Table below.
7. Darken the room and count the number of bubbles produced again for 5 minutes. Record
the number on the Data Table.
8. Turn up the lights in the room and shine a bright light on the sprig. Count the number of
bubbles produced in 5 minutes. Record the number on the Data Table.
Observations/Data:
Light Intensity
Number of Bubbles
Produced in 5 Minutes
Room light
Dim light
Bright light
Data Analysis/Results:
1. Observing: From what part of the sprig (stem or needle leaves) did the bubbles emerge?
2. Observing: When was the greatest number of bubbles produced?
3. Expository: Explain the data produced in the experiment in relation to the levels of
photosynthesis.
Results/Conclusions:
1. How does the intensity of light affect the rate of photosynthesis? Was your hypothesis
correct or not? Explain what occurred.
2. How do your results compare with those of your classmates? How are they similar?
How are they different? How can you account for any differences in the numbers of
bubbles produced? Can you identify any trends even if the actual numbers differ?
Biology HSL
Department of Science
Page 229
Teacher
Cellular Respiration
(Adapted from: State Adopted – Prentice Hall Laboratory Manual B)
NGSSS:
SC.912.L.18.9 Explain the interrelated nature of photosynthesis and cellular respiration. (AA)
SC.912.L.14.7 Relate the structure of the major plant organs and tissues to physiological
processes. (AA)
Purpose of Lab/Activity:
 To understand how photosynthesis and cellular respiration work hand-in-hand.
 To observe how cellular respiration occurs under aerobic conditions.
Prerequisites: Prior to doing this lab, students should have been taught about cellular
respiration including lactic acid fermentation, alcoholic fermentation, glycolysis, the Krebs cycle,
and the electron transport chain. Students should also be aware of how photosynthesis and
cellular respiration go hand-in-hand. The products of one process are the reactions of the other
and vice versa.
Materials (per group):
 Distilled water
 Straw
 Heat-resistant gloves
 Hot Plate
 Cotton ball
 Beakers 500-mL (two)
 Test tubes (4)







Purple
cabbage
Bromothymol blue
Test tube rack
Slotted spoon (large)
Stoppers
Radish seedlings (10)
Forceps
Aluminum foil
leaves
or
Procedure: Day of Activity:
What the teacher will do:
a. Prep work: Germinate radish seedlings at least one week before lab. Use 1
part Bromothymol blue to 10 parts of water as a substitution of the cabbage
indicator.
b. Essential question (or problem statement): “How do organisms release
energy from food?”
c. Procedures: Students should read the entire investigation. Then, work with
a partner to answer the “engagement” questions. These questions should
Before
be in the student’s hand-out.
activity:
d. Once the students have completed the questions, initiate a class discussion
asking different students to share their answers. Continue the discussion by
asking the following questions.
1. What is cellular respiration?
2. How are the processes of photosynthesis and cellular respiration
related?
3. What are the reactants and products of cellular respiration?
4. In this investigation, how are we going to find out if plants carry on
cellular respiration?
Biology HSL
Department of Science
Page 230
Student
During
activity:
After
activity:
What the teacher will do:
a. Questions to engage student thinking during activity:
1. What do you think is the reason for the color change when you used a
straw to blow into the uncovered test tube?
2. What is the purpose for covering one of the test tubes with aluminum
foil?
3. What do you think will happen to the test tube that contains the radish
seeds? Why?
b. Make sure that students are recording their results in the Data Table.
What the teacher will do:
a. Use the following questions to engage student thinking after the activity and
to connect concepts of this activity to the NGSSS.
1. Did the color of the cabbage indicator change when you exhaled into the
test tube? Explain why.
2. Did the color of the cabbage indicator change in the test tube that
contained the radish seedlings? Explain the reason
3. Compare the reaction that occurred in the test tube that contained the
radish seedlings with one that occurred in the test tube into which you
exhaled. How are they similar?
4. Did cellular respiration occur in this experiment? Explain.
5. Was your hypothesis correct or incorrect? Explain your answer in detail.
6. Why is the process of cellular respiration common to all forms of life?
7. Why do most living things take in oxygen?
8. Where in the cell does cellular respiration take place?
9. What is the interrelated nature of photosynthesis and cellular
respiration?
b. The students should complete a formal laboratory report.
Extension:
 Gizmo: Cell Energy Cycle
Biology HSL
Department of Science
Page 231
Student
Cellular Respiration
(Adapted from: State Adopted – Prentice Hall Laboratory Manual B)
NGSSS:
SC.912.L.18.9 Explain the interrelated nature of photosynthesis and cellular respiration. (AA)
SC.912.L.14.7 Relate the structure of the major plant organs and tissues to physiological
processes. (AA)
Background:
All living things undergo respiration. During this process, food molecules are broken down. As
part of this process, animals take in oxygen and release carbon dioxide by breathing, which is
easily observable. Plants do not “breathe” as animals do, so respiration in plants is not as
easily observable. How do we know that plants respire?
In this investigation, you will observe the release of carbon dioxide by humans. You also will
perform an experiment to determine whether plants release carbon dioxide as a product of
cellular respiration.
Problem Statement: How do organisms release energy from food?
Safety: Wear goggles at all times in the science laboratory. To avoid burns, exercise caution
when working with the hot plate and heated materials. Be careful not to inhale any of the
cabbage indicator.
Vocabulary: aerobic respiration, alcoholic fermentation, anaerobic respiration, cellular
respiration, electron transport chain, glycolysis, Krebs Cycle, lactic acid fermentation
Materials (per group):
 Distilled water
 Straw
 Heat-resistant gloves
 Hot Plate
 Cotton ball
 Beakers 500-mL (two)
 Test tubes (4)







Purple cabbage leaves or
Bromothymol blue
Test tube rack
Slotted spoon (large)
Stoppers
Radish seedlings (10)
Forceps
Aluminum foil
Pre-Lab Questions:
Read the entire investigation. Then, work with a partner to answer the following questions.
1. What hypothesis is Part A of this experiment testing?
2. What is an acid indicator?
3. When the cabbage is mixed with the boiling water, what color do you expect the water to
turn?
4. In Part B, why is nothing added to one of the test tubes containing cabbage indicator?
5. What special safety note should you observe when you blow through the straw.
Biology HSL
Department of Science
Page 232
Student
Procedures:
1. Write a hypothesis to the problem statement above.
2. Tear the purple cabbage into small pieces. Place the cabbage pieces into one of the
beakers.
3. Pour about 300 mL of distilled water into the other beaker. Using the hot plate, heat the
water until it boils. CAUTION: Put on safety goggles. Be careful when working with the
hot plate.
4. Put on heat-resistant gloves. Pour the hot distilled water into the bowl that contains the
cabbage. CAUTION: Be careful when working with heated materials to avoid burns.
Allow the water to cool. Remove the heat-resistant gloves. The water will turn purplishblue in color when mixed with the cabbage.
5. Using the slotted spoon, remove the cabbage pieces and discard them according to your
teacher’s directions. Save the liquid to use as an acid indicator. Its color will change from
purplish-blue to reddish-blue when it is mixed with an acid. When carbon dioxide
combines with water, it forms a weak acid called carbonic acid.
6. Pour some of the cabbage indicator into 2 test tubes so that each is half full. Cover one
test tube completely with aluminum foil.
7. Use a straw to blow a few times into the uncovered test tube, as shown in Figure 1.
CAUTION: Be sure not to inhale any of the cabbage indicator. Observe any changes in
the color of the cabbage indicator in both test tubes. Record your observations in the
Data Table.
8. Pour some of the cabbage indicator into 2 test tubes so that they are one-quarter full.
9. Place a cotton ball and 10 radish seedlings in one test tube. See Figure 2. Place a
stopper in both test tubes. Place the test tubes in a test-tube rack and set them aside for
24 hours.
Biology HSL
Department of Science
Page 233
Student
10. After 24 hours, observe the test tubes. Record your observations in the Data Table.
Observations/Data:
Test Tube
Description
Color of Cabbage Indicator
Data Analysis:
1. Observing: Did the color of the cabbage indicator (or bromothymol blue) change when
you exhaled into the test tube? Explain why.
2. Observing: Did the color of the cabbage indicator (or bromothymol blue) change in the
test tube that contained the radish seedlings? Explain the reason.
3. Comparing and Contrasting: Compare the reaction that occurred in the test tube that
contained the radish seedlings with the one that occurred in the test tube into which you
exhaled. How are they similar?
4. Inferring: Did respiration occur in this experiment? Explain your answer.
Results/Conclusions:
1. Was your hypothesis correct or incorrect? Explain your answer in detail.
2. Why is the process of cellular respiration common to all forms of life?
3. Why do most living things take in oxygen?
4. Each student will complete a formal lab report following the guidelines on the Parts of a
Lab Report: A Step-by-Step Checklist
Biology HSL
Department of Science
Page 234
Teacher
Factors Affecting Blood Flow
NGSSS:
SC.912.L.14.26 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Purpose of the Lab/Activity:
 Students will visit stations that demonstrate each of the factors that affect blood flow
through the cardiovascular system.
Objectives:
 Identify factors that affect blood flow through the cardiovascular system such as blood
pressure, blood volume, resistance, disease, and exercise.
 Investigate factors affecting blood flow and justify how these factors affect the
cardiovascular system.
Prerequisites:
 Students should be familiar with blood flow through the cardiovascular system.
Materials (per group):
Activity 1: Blood Pressure and Blood Flow
 dish soap squirt bottle filled with water
 beaker or graduated cylinder to catch expelled water
 funnel
Activity 2: Effect of Exercise on Blood Flow
 stop watch
Activity 3: Effect of Resistance on Blood Flow
 plastic tubing
 beaker of water
 funnel
 catch beaker or bowl
 dough, putty, or any constrictor
Activity 4: Effect of Blood Viscosity on Blood Flow
 plastic tubing or straws
 rubber stopper
 concentrated dark corn syrup
 diluted dark corn syrup
Activity 5: Effect of Blood Volume on Blood Flow
 Plastic tubing (two different diameter)
 Collection beakers
 2 2-liter bottles (cut out bottoms of bottle)
 Stopper for tubing
 Duct tape to attach tubing to bottle
 Stopwatch
 Stoppers or corks to plug opening of plastic tubing.
Biology HSL
Department of Science
Page 235
Teacher
Procedures: Day of Activity:
What the teacher will do:
a. The teacher will introduce the topic of the heart by sharing interesting facts
about the heart. They can be found at this site
http://www.pbs.org/wgbh/nova/eheart/facts.html.
b. It is important for review the flow of blood through the human body. Play
the following video http://www.mayoclinic.com/health/circulatorysystem/MM00636 and engage in class discussion.
- The video refers to de-oxygenated blood as "blue blood" and
oxygenated blood as "red blood," I assume that this is just for visual
Before
difference of the diagram shown on the video. I will leave it to teacher
activity:
discretion as whether to bring this up with students. It may need to be
stated that blood is all the same general color and differences in the
body are only due to wavelengths of light penetrating different tissues at
different depths and also the ability of oxygenated/de-oxygenated blood
to absorb more or less of certain wavelengths. If you want to know more
on this subject as to explain it to your students you may want to visit the
following link.
http://www.askabiologist.org.uk/answers/viewtopic.php?id=1289
c. Gather materials, set up the stations and assign students to groups.
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
proper lab protocol.
b. Review the lab stations to ensure students are following laboratory
procedural plan.
 Activity 1: Blood Pressure and Blood Flow
During
 Activity 2: Effect of Exercise on Blood Flow
activity:
 Activity 3: Effect of Resistance on Blood Flow
 Activity 4: Effect of Blood Viscosity on Blood Flow
 Activity 5: Effect of Blood Volume on Blood Flow
c. Emphasize importance of data collection by groups.
d. Ask groups to brainstorm the factors that can affect blood flow through the
cardiovascular system and answer analysis questions.
What the teacher will do:
a. Watch NOVA video The Silent Killer:
http://www.pbs.org/wnet/heart/educators/video-silent.html
This segment describes and illustrates the conditions of atherosclerosis and
coronary heart disease. It then introduces the Framingham Heart Study,
which was a revolutionary way to gather and analyze information about the
increasing problem of heart disease and heart attacks.
After
b. Bring the students’ focus to the science of the Framingham Heart Study.
activity:
How was it different from the controlled experiments that are normally
studies in science classes?
c. Discuss each of the following questions:
1. How does atherosclerosis affect the arteries?
2. What is the more common cause of heart attacks?
3. What are the different ways that doctors use to treat blocked arteries?
4. What was the Framingham Heart Study?
Biology HSL
Department of Science
Page 236
Teacher
5. What does the term degenerative disease mean?
6. What kind of information did the Framingham researchers gather?
7. What did the researchers want to find out from the information gathered
in the Framingham Heart Study?
8. Did the study begin with a hypothesis? Why or why not?
9. What were some of the challenges that the researchers faced?
10. What were the findings of the Framingham Heart Study?
11. How has this study proved useful?
Extension:
 Understanding Blood Pressure :
http://library.thinkquest.org/C003758/Structure/BloodPressure.htm
 Sickle Cell Anemia 3D Animation: http://www.dnalc.org/view/15532-Sickle-cell-anemia3D-animation-with-narration.html
 The Mysterious Human Heart: http://www.pbs.org/wnet/heart/index.html
 Tour of the Heart: http://www.pbs.org/wnet/heart/tour/index.html
Biology HSL
Department of Science
Page 237
Student
Factors Affecting Blood Flow
NGSSS:
SC.912.L.14.26 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Activity 1: Blood Pressure and Blood Flow
Background Information:
The body's circulatory system is a closed system of vessels operating under pressure created
by the pumping heart. The blood pressure, in a blood vessel, is defined to be the force with
which blood pushes against the vessel wall. It is this pressure caused by the pumping of the
heart that keeps your blood circulating. Blood flow through a blood vessel is determined by two
factors:
i. the force that pushes the blood through the vessel
ii. the resistance of the vessel to the blood flow
Problem Statement: How does blood pressure affect blood flow?
Vocabulary:
Blood pressure, blood volume
Materials:
 dish soap squirt bottle filled with water
 beaker or graduated cylinder to catch expelled water
 funnel
Biology HSL
Department of Science
Page 238
Student
Procedures:
1. Invert water-filled soap bottle over supplied beaker and observe how quickly water escapes
without applying pressure to bottle (DO NOT SQUEEZE).
2. Record your observations in the table below.
3. Begin to squeeze bottle and observe and analyze how the volume of the water stream
coming out of bottle is affected and how quickly water is now escaping. Make sure to catch
the water in the beaker supplied.
4. Record your observations in the table below.
5. Use funnel to pour water from beaker back into dish bottle for next group.
Data:
TIME
Flow
without
squeezing
10 sec
Flow with
squeezing
10 sec
VOLUME OF BLOOD
COLLECTED
(ml)
RATE OF BLOOD
FLOW
R = volume ÷ time
OBSERVATIONS
Analysis:
1. What cardiovascular process are you modeling when you squeeze the plastic bottle?
2. What happens to blood flow every time your heart contract?
3. If blood flow slows down, does your heart have to work more or less? Explain your
choice.
4. How are blood pressure and blood flow related?
5. What you know about any of your relative’s blood pressure and describe how blood
pressure has affected their lives.
Activity 2: Effect of Exercise on Blood Flow
Background Information:
While exercising, the body's need for oxygen significantly increases
because the muscles are doing more work. The surge of blood entering
the arteries during a ventricular contraction causes the elastic walls of the
arteries to swell (expand), but the pressure drops almost immediately as
the ventricle completes its contraction and the arterial walls recoil (shrink
back to normal size). This alternating expansion and recoil of an arterial
wall can be felt as a pulse in an artery that runs close to the surface of
the skin.
Problem Statement: How does exercise affect blood flow?
Vocabulary:
Pulse, heart rate
Biology HSL
Department of Science
Page 239
Student
Materials:
 stop watch
Procedures:
1. Take your heart rate by:
a. Placing two fingers on your wrist or your carotid artery, right behind the jawline in your
neck)
b. Count the number of beats that occur in 1 minute.
2. Record the information on your data sheet
3. Jog in place for 1 minute.
4. Repeat steps 1 and 2; record this as your Heart Rate After Exercise.
5. Wait five minutes and repeat steps 1 and 2, record this as your Heart Rate 5 min
After Exercise.
Data:
Resting Heart Rate
Trial 1: ____
Trial 2: ____
Heart Rate After Exercise: ______
Trial 3: ____
Average: ____ Heart Rate 5 min After Exercise: _____
Analysis:
1. Describe the changes that occurred to your heartbeat before, right after and after 5
minutes of exercise. Use specific numbers from the data table in your response?
2. If you compared the pulse rate of an athlete with the pulse rate of your grandmother,
would you expect them to be alike or different? Explain your reasoning.
3. Why might an athlete have a lower pulse rate than a person who does not exercise
regularly? How does exercise affect blood flow?
4. How does exercise affect blood flow?
5. If you had high blood pressure, what are the dangers of strenuous exercise?
Activity 3: Effect of Resistance on Blood Flow
Background Information:
Blood flow through a blood vessel is affected by the resistance of the vessel to the blood flow.
Because friction develops between moving blood and the stationary vessels walls, this fluid
movement has a given resistance, which is the measure of how difficult it is to move blood
through a vessel. Several factors may increase resistance in a blood vessel. Atherosclerosis,
blood clots, and sickle cell anemia increase resistance by blocking sections of a blood vessel.
Biology HSL
Department of Science
Page 240
Student
Problem Statement: How does blood resistance affect blood flow?
Vocabulary:
Resistance, atherosclerosis, sickle cell anemia
Materials:
 plastic tubing
 beaker of water
 funnel
 catch beaker or bowl
 dough, putty, or any constrictor
Procedures:
1. Pour beaker of water through UNOBSTRUCTED tubing and observe flow rate.
2. Pour beaker of water through OBSTRUCTED tubing and observe flow rate.
3. Record what you have observed.
Biology HSL
Department of Science
Page 241
Student
Data:
Unobstructed flow rate
Obstructed flow rate
Analysis:
1. Relate the observations you made to real examples in your circulatory system for
obstructed flow rate.
2. Do you know anyone that has suffered from any type of cardiovascular diseases and can
you describe how this affects their daily lives?
3. What lifestyle choices may lead to some of these cardiovascular diseases?
4. How does an obstructed blood vessel lead to, for example, a heart attack or stroke?
5. How does resistance affect blood flow?
Activity 4: Effect of Blood Viscosity on Blood Flow
Background Information:
Simply put, blood viscosity is the thickness and
stickiness of blood. It is a direct measure of the ability
of blood to flow through the vessels. Blood viscosity
determines how much friction the blood causes against
the vessels; how hard the heart has to work to pump
blood; and how much oxygen is delivered to organs
and tissues.
Problem Statement: How does blood viscosity affect blood flow?
Vocabulary:
 viscosity
Materials:
 plastic tubing or straws
 rubber stopper
 concentrated dark corn syrup
 diluted dark corn syrup
Procedures:
1. Take the clear rubber tubing labeled viscous corn syrup and tip it from side to side so that
you can see the syrup flow from one end to the next.
2. Record your observations below.
3. Take the clear rubber tubing labeled diluted corn syrup and tip it from side to side so that
you can see the syrup flow from one end to the next.
4. Record your observations below.
Biology HSL
Department of Science
Page 242
Student
Data:
Highly viscous (concentrated) blood flow rate
Highly runny (diluted) blood flow rate
Analysis:
12. Relate the observations you made to real examples in your circulatory system for
obstructed flow rate.
13. How does blood viscosity relate to concentration of a liquid?
14. What are some things that can cause your blood to become more viscous?
15. How does viscosity affect blood flow and blood pressure?
Activity 5: Effect of Blood Volume on Blood Flow
Background Information:
The total amount of blood in the body is your blood volume. The greater the blood volume is, the
higher the blood pressure will be. This is because there will be a greater volume of blood flowing
through the blood vessels which means that a greater pressure will be exerted on the walls of
the blood vessels.
Problem Statement: How does blood volume affect blood flow?
Vocabulary:
Volume, diameter
Biology HSL
Department of Science
Page 243
Student
Materials:
 plastic tubing (two different diameter)
 collection beakers
 2 2-liter bottles (cut out bottoms of bottle)
 Stopper for tubing
 duct tape to attach tubing to bottle
 stopwatch
 stoppers or corks to plug opening of plastic tubing
Procedures:
1. Place stopper at the end of large tubing
2. Fill bottle with 500 mL of water.
3. Remove cork/stopper and use stopwatch to measure the amount of time it takes for the
bottle to empty.
4. Record this on data sheet for specific tubing size (small or large).
5. Repeat steps 1-3 with other tubing size.
6. Explain how blood volume carried by different size blood vessels affects blood flow.
Data:
TIME
VOLUME OF BLOOD
(ml)
Small
Diameter
Vessel
500 mL
Large
Diameter
Vessel
500 mL
RATE OF BLOOD
FLOW
R = volume ÷ time
OBSERVATIONS
Analysis:
1. How does your body regulate your blood volume?
2. Blood volume increases during pregnancy. Explain what you think happens and why?
3. How does blood volume affect blood flow and blood pressure?
Conclusion:
Write a lab report using the “Power Writing Model 2009” answering the following questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 244
Teacher
Take a Heart Hike
NGSSS:
SC.912.L.14.26 Describe the factors affecting blood flow through the cardiovascular system.
Purpose of Lab/Activity:
Students will walk and talk through the systemic (heart/body) and pulmonary (heart/lung) blood
pathways in order to understand how the heart and lungs work together to transport oxygen and
carbon dioxide via the blood.
Prerequisites:
 Students have a working knowledge of the parts of the circulatory and respiratory systems.
 Students understand the concept of diffusion.
 Students understand the role of blood cells in carrying oxygen or carbon dioxide.
 Students have sequencing ability
Materials (individual or per group):
 3-inch-wide masking tape
 Large magic marker to write on tape
 Two small bowls or pans
 20 quarter-sized red circles and 20 quarter-sized blue circles (can substitute with balloons)
 Scenario Cards
 Go With the Flow: Factors Affecting Blood Flow handout
Procedures: Day of Activity:
What the teacher will do:
a. Set-up the activity:
1. Draw the diagram (Teacher Download, figure 1) with tape on the floor of your
classroom.
2. Label the chambers of the heart, the lungs, the body cells, and all blood
vessels according to the diagram (Teacher Download, figure 1).
3. Place a bowl of blue circle cut outs in the body cells and a bowl of red circle cut
Before
activity:
outs in the lungs. (you can also use balloons instead of circles)
b. Have students visit http://www.brainpop.com and pick the movie on the heart for a
good (and funny) overview.
c. Ask the following question in order to review the basic structure and flow of blood
of the heart:
1. Describe the structure of the human heart.
2. How does blood flow through the heart?
3. What factors can affect blood flow through the cardiovascular system?
What the teacher will do:
a. To begin the activity, position a student (or several) in a standing position at a
During
activity:
station along the route taped to the floor. Give him/her the appropriate color circle
for where they are standing. For example, a student standing in the right atrium of
the heart would be holding a blue circle.
b. Have students move along the route and describe to the group what they are
Biology HSL
Department of Science
Page 245
Teacher
doing at each stop — explaining to the group what route (blood vessel) they must
take to reach the next stop. For instance, have students exchange red blood cells
for blue blood cells at the body cells station and exchange blue blood cells for red
blood cells at the lung station. The color change illustrates the diffusion of oxygen
into or out of the blood (blood cells carrying oxygen appear red and blood cells
carrying carbon dioxide appear blue). Point out that blood vessels carrying blood
away from the heart (arteries) usually carry red blood and blood vessels carrying
blood towards the heart (veins) usually carry blue blood. The only exceptions to
this color-coding are the pulmonary arteries and veins (see figure 1). Point out that
the right side of the heart handles blue blood and the left side of the heart handles
red blood.
c. After all students have had a chance to do the activity, assess their knowledge of
blood flow structures and patterns. Write the steps of blood flow on the board and
have students write them down in the proper order after the activity is complete.
What the teacher will do:
Go With the Flow: Factors Affecting Blood Flow
a. To begin the activity, distribute students into the following groups based on the
After
activity:
following scenarios and distribute the corresponding scenario cards:
 Scenario 1: Atherosclerosis
 Scenario 2: Blood Clot
 Scenario 3: Sickle Cell Anemia
 Scenario 4: Blood Viscosity
 Scenario 5: Blood Volume
 Scenario 6: Exercise
b. Each group will review the background information provided in each scenario card
and complete the assigned task. They are to simulate the factors that affect blood
flow using the blood flow diagram that was simulated in the beginning that
illustrated normal blood flow.
c. Allow each group to discuss how they will demonstrate their factor using the
supplies provided in class and their assigned scenario.
d. After each group has presented their scenario, have students complete the “Go
With the Flow: Factors Affecting Blood Flow” handout.
Extension:
 Gizmo: Circulatory System
Biology HSL
Department of Science
Page 246
Teacher
Figure 1: Two Dimensional Blood Flow Diagram
Biology HSL
Department of Science
Page 247
Teacher
Go With the Flow: Factors Affecting Blood
Flow
SCENARIO CARDS
Biology HSL
Department of Science
Page 248
Teacher
Scenario #1: Atherosclerosis
Atherosclerosis is a condition
in which fatty deposits called
plaques build up in artery
walls. Over time, plaques often
bulge into the center of a
vessel.
SHOW HOW THE FORMATION OF PLAQUE CAN
AFFECT RESISTANCE, BLOOD FLOW, AND BLOOD
PRESSURE THROUGH THE CIRCULATORY SYSTEM.
Biology HSL
Department of Science
Page 249
Teacher
Scenario #2: Blood Clot
Most heart attacks and strokes result
from the sudden formation of a blood
clot on a cholesterol plaque inside an
artery in the heart or brain. When
the
plaque
ruptures
suddenly, it
triggers the blood clotting process.
Blood clots may also form when
blood fails to flow properly.
SHOW HOW THE FORMATION OF A BLOOD CLOT CAN
AFFECT RESISTANCE, BLOOD FLOW, AND BLOOD
PRESSURE THROUGH THE CIRCULATORY SYSTEM.
Biology HSL
Department of Science
Page 250
Teacher
Scenario #3: Sickle Cell Anemia
Sickle cell anemia is a disease passed down
through families in which red blood cells form
an abnormal sickle or crescent shape. Red
blood cells carry oxygen to the body and are
normally shaped like a disc. The fragile, sickleshaped cells deliver less oxygen to the body's
tissues. They can also get stuck more easily in
small blood vessels, as well as break into
pieces.
SHOW HOW ABNORMAL RED BLOOD CELLS CAN
AFFECT RESISTANCE, BLOOD FLOW, AND BLOOD
PRESSURE THROUGH THE CIRCULATORY SYSTEM.
Biology HSL
Department of Science
Page 251
Teacher
Scenario #4: Blood Viscosity
Simply put, blood viscosity is the
thickness and stickiness of blood.
It is a direct measure of the ability
of
blood
to
flow
through
the
vessels. Blood viscosity determines
how
much
friction
the
blood
causes against the vessels; how
hard the heart has to work to pump blood; and how much oxygen
is delivered to organs and tissues.
SHOW HOW AN INCREASE IN BLOOD VISCOSITY CAN
AFFECT RESISTANCE, BLOOD FLOW, AND BLOOD
PRESSURE THROUGH THE CIRCULATORY SYSTEM.
Biology HSL
Department of Science
Page 252
Teacher
Scenario #5: Blood Volume
Blood volume is determined by the
amount
of
water
and
sodium
ingested, excreted by the kidneys
into the urine, and lost through the
gastrointestinal
tract,
lungs
and
skin. To maintain blood volume within a normal range, the
kidneys regulate the amount of water and sodium lost into the
urine. For example, if excessive water and sodium are ingested,
the kidneys normally respond by excreting more water and
sodium into the urine.
SHOW HOW AN INCREASE IN BLOOD VOLUME CAN
AFFECT RESISTANCE, BLOOD FLOW AND BLOOD
PRESSURE THROUGH THE CIRCULATORY SYSTEM.
Biology HSL
Department of Science
Page 253
Teacher
Scenario #6: Exercise
While exercising, the body's need for
blood and oxygen significantly increases
because the muscles are doing more work.
To meet the growing demands of the
muscles, the heart must pump faster to
get more oxygen from the lungs to the
muscles. Since the pulse is a direct
measure of heartbeats per minute, the
pulse rate naturally increases during
exercise.
SHOW HOW EXERCISE CAN AFFECT RESISTANCE,
BLOOD FLOW, AND BLOOD PRESSURE THROUGH
THE CIRCULATORY SYSTEM.
Biology HSL
Department of Science
Page 254
Teacher
Name: _________________________________
Period: ____
Date: ___________
Go With the Flow: Factors Affecting Blood Flow
Scenario #
Description
Effect on Resistance, Blood Flow
and/or Blood Pressure
Scenario #1
Atherosclerosis
Scenario #2
Blood Clot
Scenario #3
Sickle Cell Anemia
Scenario #4
Viscosity
Scenario #5
Blood Volume
Scenario #6
Exercise
Biology HSL
Department of Science
Page 255
Student
Take a Heart Hike
NGSSS:
SC.912.L.14.26 Describe the factors affecting blood flow through the cardiovascular system.
Background Information:
Tracing the flow of blood through the heart isn't as simple as it may seem. The heart is a
complex organ, using four chambers, four valves and multiple blood vessels to provide blood to
the body. The flow through the heart is equally complex, with blood moving through the heart,
then the lungs, before returning again to the heart.
Blood returns to the heart from the body via two large blood vessels, called the superior vena
cava and the inferior vena cava. This blood carries little oxygen, as it is returning from the body
where oxygen is used. The blood first enters the right atrium. It then flows through the tricuspid
valve into the right ventricle. When the heart beats, the ventricle pushes the blood through the
pulmonic valve into the pulmonic artery. This artery is unique: It is the only artery in the human
body that carries oxygen-poor blood.
The pulmonic artery carries blood to the lungs where it “picks up” oxygen, and leaves the lungs
and returns to the heart through the pulmonic vein. The blood enters the left atrium, and then
descends through the mitral valve into the left ventricle. The left ventricle then pumps blood
through the aortic valve, and into the aorta, the blood vessel that leads to the rest of the body.
Blood flow is determined by a number of factors, including blood pressure, blood volume,
resistance, disease and exercise. The structure of the heart plays an important role in
determining how blood will flow throughout the body. For example, the walls of the left ventricle
are thicker than those of the right ventricle. This is because the left ventricle is pumping blood
out to the entire body while the right ventricle only has to pump to the lungs.
Problem Statement:
 How does blood flow through the cardiovascular system?
 What factors affect the blood flow through the cardiovascular system?
Vocabulary: blood, cardiovascular system, heart, lung, artery, vein, oxygen, atherosclerosis,
clot, viscosity, sickle cell anemia, blood volume, blood pressure, resistance
Materials:
 3-inch-wide masking tape
 Large magic marker to write on tape
 Two small bowls or pans
 20 quarter-sized red circles and 20 quarter-sized blue circles (can substitute with
balloons)
 Scenario Cards
 Go With the Flow: Factors Affecting Blood Flow handout
Procedures:
Part A: Heart Hike - Normal Blood Flow
1. The teacher will assign you a standing position at a station along the route taped to the
floor.
Biology HSL
Department of Science
Page 256
Student
2. You will receive a colored circle appropriate to where you are standing. For example, if
you are standing in the right atrium of the heart would be holding a blue circle.
3. Move along the route and describe to the group what you are doing at each stop —
explaining to the group what route (blood vessel) you must take to reach the next stop.
4. Make sure to exchange red blood cells for blue blood cells at the body cells station and
exchange blue blood cells for red blood cells at the lung station. The color change
illustrates the diffusion of oxygen into or out of the blood (blood cells carrying oxygen
appear red and blood cells carrying carbon dioxide appear blue).
5. The teacher will point out that blood vessels carrying blood away from the heart (arteries)
usually carry red blood and blood vessels carrying blood towards the heart (veins) usually
carry blue blood. The only exceptions to this color-coding are the pulmonary arteries and
veins (see figure 1). The right side of the heart handles blue blood and the left side of the
heart handles red blood.
6. After the activity, use the steps of blood flow written on the board to write them in their
proper order.
Part B: Go With the Flow- Factors Affecting Blood Flow
1. The teacher will assign you one of the following scenario groups:
 Scenario 1: Atherosclerosis
 Scenario 2: Blood Clot
 Scenario 3: Sickle Cell Anemia
 Scenario 4: Blood Viscosity
 Scenario 5: Blood Volume
 Scenario 6: Exercise
2. As a group read the background information provided on your scenario card and discuss
how you will simulate the assigned factor that affects blood flow using the blood flow
diagram that was simulated in part A.
Analysis Questions:
1. What is the consequence of decreased blood flow to the brain?
2. How are uncoordinated contractions of the heart related to blood flow?
3. One of the effects of aspirin is an interference with the clotting of blood. Relate aspirin
therapy to blood flow.
4. Water pills are useful in control of hypertension; however, overdose of water pills can be
dangerous, why?
5. How does good nutrition and exercise help your heart?
Conclusion:
 Students will complete the “Go With the Flow: Factors Affecting Blood Flow” handout in
order to summarize the factors that affect blood flow through the cardiovascular system.
Biology HSL
Department of Science
Page 257
Teacher
The Deadly Fuchsia Disease
(Adapted from Epidemic – The Deadly Fuchsia Disease – www.vcu.edu/lifesci)
NGSSS:
SC.912.L.14.52 Explain the basic functions of the human immune system, including specific and
nonspecific immune response, vaccines, and antibiotics. (AA)
Purpose of Lab/Activity: To demonstrate that one infected person in a population can, over a
period of time, infect a large number of individuals
Prerequisite: Prior to this activity, the student should be able to:
 define a specific and non-specific immune disease response
 understand the purpose and function of a vaccine
Materials (per station or per group):
 test tube racks
 test tube
 distilled water
 NaOH (0.1 M)
 phenolphthalein
Procedures: Day of Activity:
a. Prepare NaOH solution
b. Prepare test tubes with distilled water and select one test tube with NaOH
Before
solution (this will be the infected student).
activity:
c. Evaluate student prior knowledge by discussing their understanding of an
“Epidemic” and how diseases can be transmitted.
a. Monitor the students that they only exchange “fluids” for the amount of
times specified in the lab.
During
b. Ensure that when you put drops of phenolphthalein, that you do not
activity:
contaminate the pipette.
c. Discuss the reasons for a false positive, if it occurs.
What the teacher will do:
a. Share results with other students and have a class discussion about data,
graphs, and conclusions.
After
activity:
b. An asterisk (*) is placed next to each name in the Class Data Table who
was found positive for the simulated disease. The Data Table above shows
Biology HSL
Department of Science
Page 258
Teacher
that Bob exchanged with Beth, Mary, and Janet. This shows that in round 1,
Bob did not have the disease when he exchanged fluids with Beth (because
she tested negative), but received it in Round 2.
c. The Class Data Table is then used to devise a flow chart and to trace the
route of transmission. In Round 1, Dave and Mary, have tested positive for
the disease. This indicates that these two people were involved in the
original exchange.
d. In Round 2, Mary and Dave exchanged “Simulated Bodily Fluids” with Bob
and Andrew. The flow chart now shows two rounds of exchanges and a
total of four infected people.
e. For Round 3, the names of the individuals that exchanged with Bob,
Andrew, Mary, and Dave are filled in. They were janet, Jennifer, Karen, and
john, respectively. This completed flow chart shows that in Round 2, four
people had the disease, but in Round 3, the number of infected people has
doubled to a total of eight people. Thus, the disease has passed from an
original exchange of two people, to a total of eight people.
Example Route of Transmission Flow Chart
The chart above shows that in Round 1, Mary and Dave exchanged fluids.
Since they are both positive in Round 1, they pass on the disease to Bob and
Andrew in Round 2, and to Karen and Jennifer in Round 3. Then Bob and
Andrew pass it onto Janet and John, respectively. In an actual epidemic
situation, one cannot trace a disease as easily as in this simulation. In an open
system, it is almost impossible to trace a disease back to an original carrier.
Because the class is a closed system, we can trace back to an original
exchange. If you had completed another round of “Simulated Bodily Fluid”
exchange, then 16 people would be infected; with each round of transmission
the number of infected people doubles.
Extension:
 Gizmo: Disease Spread
Biology HSL
Department of Science
Page 259
Student
The Deadly Fuchsia Disease
(Adapted from Epidemic – The Deadly Fuchsia Disease – www.vcu.edu/lifesci)
NGSSS:
SC.912.L.14.52 Explain the basic functions of the human immune system, including specific and
nonspecific immune response, vaccines, and antibiotics. (AA)
Background:
A disease can be caused by a virus, or microorganisms such as bacteria, fungi, and parasites.
The human body becomes ‘sick” when it is unable to fend off a disease-causing organism or a
pathogen. A pathogen is an invader such as a virus or bacteria that resists internal defenses
and begins to grow and harms the host.
Most diseases will eventually be eradicated from the body by the body’s immune system. Some
diseases are resistant to the immune system and are able to thrive in the body and cause harm
including death to the host. Certain viruses, such as “Colds”, can be easily detected by
symptoms such as a fever or a runny nose, but some viruses do not cause any symptoms till a
later date. An example of this is HIV which causes AIDS. An HIV positive person can walk
around for years transmitting it to others without knowing he/she has the virus.
In this lab, you will be given an unknown “Simulated Bodily Fluid”. This fluid is clear, and can
represent the aerosol droplets from a cough or sneeze, the bodily fluids exchanged in the
transmission of HIV, or in any other disease. You will simulate the exchange of bodily fluid with
three other students. After three exchanges have taken place, you will then test your sample for
the disease. Once the testing is complete, you will find out which student’s samples, in your
entire class, turn out to be positive. Using this information you will then trace the route of
transmission by using a flow chart to find the original carrier.
Purpose or Problem Statement:
To demonstrate that one infected person in a population can, over a period of time, infect a
large number of individuals
Safety:
 Wear safety goggles
 NaOH is a skin irritant. In case of skin contact flush with large amounts of water. In case
of ingestion do not induce vomiting and give large amounts of water followed by fruit
juice.
Vocabulary:
Disease, endemic, epidemic, immunization, infection, quarantine, vaccine
Materials:
 test tube racks
 test tube
 distilled water
 NaOH (0.1 M)
 phenolphthalein
Biology HSL
Department of Science
Page 260
Student
Procedures:
Before testing
1. You need to obtain your body fluids. In order to do this, I will come around and give you
one test tube filled with distilled water. This will represent your bodily fluids. However,
ONE of you will be give a test tube that contains a few drop of Sodium Hydroxide. This
represents the virus and so you will already be infected with the disease and have the
potential to infect those people you swap bodily fluids with. You will not know if you
already have the disease or not!
2. Next, you will need to swap bodily fluids with three people in your community.
a. Choose a partner (male or female does not matter)
b. One of you needs to pour your liquid into the other’s test tube.
c. Now your fluids have mixed.
d. Pour half of the liquid back into the empty cup. You should both now have an equal
amount of bodily fluids.
e. Record your partner’s name in the data table below.
f. You need to do this THREE times ONLY!
Student Data:
Trial #
Name of Partner
1
2
3
Make a Hypothesis:
1. (Problem Statement)How many people do you think will become infected by the end of
the lab? ___________
(Remember only one person will be infected with the virus in the beginning)
Or
Create your own problem statement (research question) and hypothesis. Example: Does
disease transmission depend on human patterns?
_______________________________________________________________________
_______________________________________________________________________
Time to Get Tested:
1. Now that you have swapped bodily fluids with others, you are at-risk for an infection. You
have now decided to go to the doctor.
2. One at a time, make a doctor’s visit. I can be found in my white lab coat in the area
labeled “Doctor Aycart”
3. I will place a few drops of phenolphthalein indicator into your cup. If pink, you tested
positive (+) for the virus. You must then report to Quarantine area in the back of the
classroom. If clear, you tested negative (-) for the virus. You may return to your seat.
Write your test results below:
Test results: ______________
4. Now, record your name and results on the class data sheet.
Biology HSL
Department of Science
Page 261
Student
Class Results:
1. Fill in the names of infected people in your class as well as their contacts. Place an
asterisk (*) next to each name who is found to be positive for the disease.
Class Data Table:
Infected Persons
Contacts of Infected Persons
Round 1
Round 2
Round 3
Route of Transmission Flow Chart:
Round 1
Round 2
Round 3
Original Carrier:
1. Looking at the class data, who was originally infected with the virus?
2. Was there a pattern in the pathway that the virus was transmitted?
NOTE: Because your class is a closed system, you can only trace the disease back to an
original exchange (Round 1), but cannot determine which one of the two individuals involved in
the original exchange had the disease. The only way that this can be accomplished is to test the
two individuals involved in the original exchange, prior to beginning the exchange.
Analysis/Conclusion:
1. How is disease caused?
2. In the end, how many people were infected with the virus?
3. What percentage of the population does this represent?
4. Were you surprised by the number of people who acquired the disease? Explain your
answer.
5. Why would it be important to find out where/who the virus came from?
6. What preventative measures could have been taken to avoid exposure to the virus?
7. Draw a bar chart that represents the percentage of people that were exposed/unexposed
in the beginning and by the end of the lab (so you should have three bars total). Label
your axes.
Biology HSL
Department of Science
Page 262
Teacher
Human Development Stages
(Adapted from New York Times Lesson Plan Oh, Baby!
Taking a Closer Look at Prenatal Development)
NGSSS:
SC.912.L.16.13 Describe the basic anatomy and physiology of the human reproductive system.
Describe the process of human development from fertilization to birth and major changes that
occur in each trimester of pregnancy. (AA)
Purpose of Lab/Activity:
 Students will be able to measure the length of five diagrams of a human fetus.
 Students will be able to match events taking place during development with the proper
age of the fetus.
 Students will be able to explore the stages of embryological development.
 Students will be able to identify the major events in the stages of human embryonic and
fetal development.
Prerequisite: Prior to this activity, the student should be able to
 Describe the basic anatomy and physiology of the male and female reproductive
systems.
Materials (individual or per group):
 ruler (metric)
 computer with internet access
 article


embryo and fetal development images
(16)
“When’s That” handout
Procedures: Day of Activity:
What the teacher will do:
a. Select 16 images, so students will be able to see the changes in embryonic
and fetal development. The following time periods should be included.
Germinal Stage:
Before
activity:
Week 1: Zygote
Week 1: Cells divide to
form a morula
End of week 1 to week
2: Formation and
implantation of the
blastocyst
Embryonic
development:
Week 3 of gestation
Fetal development:
Week 12
Weeks 4 to 5
Week 16
Week 6
Week 20
Week 7
Week 8
Week 24
Weeks 25-28
Weeks 29–32
Week 36–37
Week 38–40
b. Images might be found in textbooks, pregnancy pamphlets or magazines, or
online at the Web sites suggested below.
Biology HSL
Department of Science
Page 263
Teacher
 Prenatal Image Gallery by The Endowment for Human Development
 Prenatal Development
 Medline Plus Fetal Development Illustrations
 University of New South Wales Embryology site
 WebMD Fetal Development Slideshow
c. In class, hand out one image to every student or student pair. Extra students
may act as organizers by helping their classmates move into the proper
order. Holding the images in front of them, have students arrange
themselves in a line, in order, from conception to a full term baby. You may
wish to make a game out of this by timing the class, counting the number of
"hints" needed, or making rules such as "no talking" or "no pointing."
d. When the class is in the correct order, ask them to reveal the labels
indicating the development in weeks. Invite students to reflect on the
developmental timeline by asking, "What do you notice about how the
embryo develops? When do the most dramatic changes happen? Does the
development of arms, lungs, a heart, eyes, etc. always happen in the same
order?"
e. Explain that fetal development progresses along a well-observed and
predictable path. Scientists can determine the age of an embryo or fetus by
its size and the appearance of different organs of the body.
f. Distribute materials to all groups.
What the teacher will do:
a. As students perform the lab activity, review the process of human
development from fertilization to birth. Use the following questions as a
guide:
1. What changes are occurring to the embryo/fetus during each trimester of
development?
b. Make sure students are completing the data and observations from both
parts of the lab.
c. Part A Data and Observations Answer Key
Table 2
During
activity:
A
9 weeks old
sex cannot be
determined
eyes closed
B
16 weeks old
sex cannot be
determined
Mother feels
movement
C
D
24 weeks old 32 weeks old
all organs well body “chubby”
developed
looking
Body covered
eyes open
with hair
E
38 weeks old
body hair
gone
can grasp
with hand
Table 3
Fetus
A
B
C
D
E
Biology HSL
Department of Science
Length in (mm)
18 mm
51 mm,
84 mm
110 mm
131 mm
X 2.75
X 2.75
X 2.75
X 2.75
X 2.75
X 2.75
Actual Length
50 mm
140 mm
230 mm
300 mm
360 mm
Page 264
Teacher
d. Part B Data Answer Key
Time Period
1 week
4 weeks
6 weeks
8 weeks
3 months
4 months
7 months
9 months
Features
Amnion and placenta form
Digestive system organs
forming
Heart begins to beat
Lungs are forming
Nervous system begins to
form
Bones and muscles begin to
form
Brain increases in size
Major internal organs take
shape
Circulatory system fully
formed
Genitalia are forming
Period of rapid fetal growth
and development
Period of rapid fetal growth
and development
If born now fetus has strong
chance for survival
Fetus is full term and ready to
be born
Heartbeat
Can’t detect
Can’t detect
Weight in grams
0.5 g
0.8 g
Can’t detect
2g
15 g
125 g
350 g
1500 g
3500 g
e. The diagrams below represent the images the students will view while
completing virtual lab.
Time Period
1 week
Biology HSL
Department of Science
Page 265
Teacher
4 weeks
6 weeks
8 weeks
Biology HSL
Department of Science
Page 266
Teacher
3 months
4 months
7 months
Biology HSL
Department of Science
Page 267
Teacher
9 months
After
activity:
What the teacher will do:
a. When students complete collecting data have them complete analysis and
conclusion, assess student understanding of human development by
reviewing the analysis questions from the lab.
b. Part A Analysis Answer Key:
1. a. At 24 weeks, the fetus is covered with hair. At 38 weeks, the hair is
gone; b. Before 32 weeks, the eyes are closed; c. Sex cannot be
determined until the 16th week.
2. 28 weeks
3. Sex could be determined at 20 weeks, but not at nine weeks.
c. Use the handout "When's That?" to build on the initial exercise. Tell students
that they will be exploring the gestational and growth milestones that
happen during the 9 months (40 weeks) of pregnancy.
- There are two options to using the handout. Students may work on the
handout in pairs or you may use the handout to play a game with the
whole class. Each option is described below.
For Student Pairs:
- Have students post the 16 images, in order, on a classroom wall or
bulletin board. Give each pair of students the handout "When's That?"
Have students work together to match the gestational age to the
descriptions on the handout. Students can write their answers, in weeks,
next to each number.
For the Whole Class:
- Have students continue to hold the development images in order. They
may continue standing or you may wish to have them sit with their
pictures. Use scissors to cut the handout "When's That?" apart so that
each description is on its own slip of paper. Put all the slips into a bag or
hat. One by one, pull out the descriptions and read them aloud to the
class. Instruct students to work together to figure out which image goes
with each description. You may want to provide an incentive to the class.
For example, you might award the class one point for each correct
answer and take away one point for each mistake. Then award bonus
Biology HSL
Department of Science
Page 268
Teacher
d.
e.
f.
g.
h.
i.
points or a prize to the entire class if they accumulate a total of 10 points
by the end of the activity.
Answers to “When’s That” Worksheet:
1. Week 8
2. End of week 1 to week 2: Formation and implantation of the
blastocyst
3. Week 24
4. Week 3
5. Week 16
6. Week 29 - 32
7. Week 1: Zygote
8. Weeks 36 - 37
9. Week 7
10. Week 25 - 29
11. Weeks 4-5
12. Week 20
13. Weeks 38 - 40
14. Week 1: Cells divide to form a morula
15. Week 12
16. Week 6
Following the activity, review and discuss the answers provided with the
handout. What did students find surprising or new? What might affect the
growth and development of the fetus? What additional questions do they
have about prenatal development?
Then say, "Scientists and developmental biologists have a detailed
understanding of WHEN these changes take place in the growing fetus. But,
what do they know about HOW this happens? HOW does the transformation
from a few cells to a fully functioning baby take place? What genes and
chemical signals direct these changes?"
Explain that the article they will read today focuses on the question of how
fetal development works, revealing what biologists know and what remains
to be discovered.
As a class, read and discuss the article "From Developing Limbs, Insights
That May Explain Much Else", focusing on the following:
- Why is limb development the most prevalent area of study by biologists
and why are chicken embryos most commonly used?
- What were scientists able to learn by "slicing and dicing?"
- Diagram the relationship between the apical ectoderm ridge, the zone of
polarizing activity, fibroblast growth factor, sonic hedgehog, gremlin and
BMP4 as they relate to limb growth.
- The article states that "all the crucial genes for the development of the
limb shut one another off." Use your diagram to explain what this means.
- What insights into the development and formation of other parts can be
gleaned from the studies on limb growth?
For homework or in future classes, students might use what they have
learned in class to reflect on the ethical questions that arise around
embryonic research, such as "How might research into embryonic
development be applied in the future? How do the potential treatments for
Biology HSL
Department of Science
Page 269
Teacher
injuries and birth defects stack up against the objections by groups that
oppose the use of stem cells and human embryos for research? In your
opinion, should scientists attempt to grow "full-blown arms and legs" in a
laboratory setting? Why or why not? What limits, if any, should be placed on
the study and manipulation of human embryos?"
Extension:
 McGraw-Hill Embryonic and Fetal Development.
http://www.mhhe.com/biosci/esp/2002_general/Esp/folder_structure/re/m2/s3/
 Fertilization and Implantation
http://nortonbooks.com/college/biology/animations/ch29p01.htm
 McGraw-Hill Fertilization
http://www.mhhe.com/biosci/esp/2002_general/Esp/folder_structure/re/m2/s1/
 The Visible Embryo http://www.visembryo.com/baby/12_weeks.html
Biology HSL
Department of Science
Page 270
Student
Human Development Stages
(Adapted from New York Times Lesson Plan Oh, Baby!
Taking a Closer Look at Prenatal Development)
NGSSS:
SC.912.L.16.13 Describe the basic anatomy and physiology of the human reproductive system.
Describe the process of human development from fertilization to birth and major changes that
occur in each trimester of pregnancy. (AA)
Background:
A human body usually develops inside its mother for 38 weeks. Different organs and systems
develop at different times during these 38 weeks. The age of a developing baby can be
determined by its length. During that time the change from a single-celled zygote to a baby
occurs. Fertilization of the egg occurs in the fallopian tube, forming a zygote that divides rapidly
by cleavage as it travels to the uterus. The zygote enters the uterus 3 days after fertilization.
During the first eight weeks it is called an embryo. In humans, the embryo stage extends from
fertilization until the embryo measures approximately 3 cm (crown to rump). This period of
embryonic development is characterized by rapid cell division and is the most critical time in the
development of an individual. The embryos of placental mammals appear very similar to each
other and the patterns of development are similar. During this early embryo stage all organ
systems are being developed and are highly vulnerable to damage by environmental agents
such as viruses, drugs, radiation or infection. Agents producing developmental defects are
referred to as teratogens. They may cause embryo malformations based on premature cell
death or they may destroy cell function by interrupting biochemical reactions. Many of the
important events in early embryonic development occur before a woman even knows that she is
pregnant.
After about 12 weeks of development the embryo is considered a fetus. At this point it has the
characteristics which establish it as unquestionably human. The fetus is less susceptible to
teratogens; however, these noxious agents may interrupt the normal functional development of
organs, especially the central nervous system throughout pregnancy. A fetus at less than 24
weeks is unable to live outside the womb. At 26 weeks it may be sustained alive in an incubator,
but the brain is not yet sufficiently developed and the respiratory and temperature-regulating
centers do not function well enough to support life independently. A fetus born at this time is in
danger of respiratory failure, poor temperature control, or both. The last trimester is
characterized by a sharp increase in mass due to subcutaneous fat deposition after week 32.
The final tissues to be completely developed are those of the respiratory system (especially the
lungs) and the nervous system (especially the brain). The important message of this lab is that a
woman must take care of herself from the moment of conception (and even before conception)
on to ensure having a healthy baby.
Biology HSL
Department of Science
Page 271
Student
Purpose or Problem Statement:
 Measure the length of five diagrams of a human fetus.
 Match events taking place during development with the proper age of the fetus.
 Explore the stages of embryological development.
 Identify the major events in the stages of human embryonic and fetal development.
Materials (individual or per group):
 ruler (metric)
 computer with internet access
 article
 embryo and fetal development images (16)
 “When’s That” handout
Part A: Fetal Development
Procedures:
1. Measure the length of each fetus from crown to rump. Record in Table 3.
2. To determine actual length, multiply each measurement by 2.75. Record in Table 3.
3. Record the events occurring to each fetus in Table 2. Events are listed in Table 1.
Biology HSL
Department of Science
Page 272
Student
Data and Observations:
Table 1
Event
24 weeks old
sex can be determined
eyes closed
all organs well developed
9 weeks old
16 weeks old
body covered with hair
38 weeks old
eyes open
32 weeks old
mother feel movement
body “chubby” looking
body hair is gone
can grasp with hand
sex cannot be determined
Table 2
A
Length
230 mm
140 mm
50 mm
230 mm
50 mm
140 mm
230 mm
360 mm
300 mm
300 mm
140 mm
300 mm
360 mm
360 mm
50 mm
B
C
D
Length in
(mm)
X 2.75
Actual Length
E
Table 3
Fetus
A
X 2.75
B
X 2.75
C
X 2.75
D
X 2.75
E
X 2.75
Biology HSL
Department of Science
Page 273
Student
Analysis:
1. Explain the changes that take place in a fetus between week 9 and week 38.
a. body hair
b. the eyes
c. sex determination
2. A fetus born with a crown to rump length of 270 mm will have a difficult time of survival.
About how old is a fetus of this length?
3. It is possible to “see” a fetus using ultrasound equipment. How might ultrasounds taken at
9 and 20 weeks of age differ?
Part B: Virtual Lab: Stages of Development
Website: What are the stages of development after birth?
Procedure:
1. Click the Video button. Watch the video about human embryonic and fetal development.
2. Choose a time period of development to explore. Click the button that corresponds to the
time period.
3. Click the Show Features button to receive information about what happens to the embryo
or fetus internally and to view developmental features labeled on the embryo or fetus.
These are features that are present during the selected time period of development.
Record the distinguishing features in the Table.
4. Click the fetal heart monitor to hear the heartbeat of the embryo or fetus during the
selected time period of development. Record the heartbeat in the Table
5. Click the scale to check the weight of the embryo or fetus during the selected time period
of development. Record the weight in the Table.
6. Repeat the procedure for each time period of development.
Data:
Time Period
1 week
Development of the Human Embryo and Fetus
Features
Heartbeat
Weight in grams
4 weeks
6 weeks
8 weeks
3 months
4 months
7 months
9 months
Biology HSL
Department of Science
Page 274
Student
Analysis:
1. Use the graph to determine in which time period the developing embryo or fetus grows
the most.
2. At what point in the development of the embryo do you think a pregnant woman must
begin to increase the number of calories she consumes? Explain your answer.
3. Use your knowledge of human development before birth to explain why activities such as
smoking, drinking alcohol, and taking drugs during pregnancy could be extremely harmful
to a fetus.
4. Sequence the stages of human embryological and fetal development.
Conclusion:
1. What changes are occurring to the embryo/fetus during the first trimester of
development?
2. During the last trimester of development the brain and other important nervous system
changes are occurring. What other changes are visible in the photos?
3. How does the rate at which the fetus changes in length compare to the changes in
weight?
4. Many women don’t realize that they are pregnant until they are eight weeks along. Why is
it especially dangerous to the embryo for a woman to take drugs early in pregnancy?
5. Most women do not begin to “show” until the fourth or fifth month; in addition, they do not
experience “quickening” (feeling the fetus kick or move) until this time. Use the lab
information to explain this.
6. Twins are typically born smaller than singles. Explain this.
7. What are two other potential causes for limits on fetal size?
8. Think about newborn mice, gerbils, horses, guinea pigs and humans. Are all placental
mammals at the same developmental stage when born? Include some specific animals in
your answer.
Biology HSL
Department of Science
Page 275
Student
From Developing Limbs, Insights That May Explain Much Else
By CARL ZIMMER
Published in the Science Times on April 7, 2009.
For its first four weeks, a human embryo looks like a crumpled tube. But around its twentyseventh day of development, four buds bulge from its sides. Over the next few days, the buds
grow like tulips, stretching out into flattened stalks and blooming into crowns of fingers and toes.
Inside these developing limbs, bones condense. Muscle cells, tendons, blood vessels and
nerves all find their respective places. The embryo now has hands with thumbs to suck, legs
ready to deliver a kick.
For developmental biologists, the development of limbs captures all that is marvelous about
embryos: how a few cells can give rise to complicated anatomy. In fact, biologists understand
the development of the limb much better than any other part of the body.
They have been experimenting on developing limbs for almost a century, and today they are
figuring out how limb-building genes are organized into a network that almost always manages
to build the same structures with the same shape.
In studying limb development, biologists are learning how the diversity of limbs — from bird
wings to whale flippers — evolved. They are also getting clues that may someday make it
possible to regenerate tendons or even entire limbs. But for many experts on limb development,
their most important discoveries are how the rules for limb-building also apply to other parts of
the embryo.
“The lessons learned in the limb give you insights into how you build a face, or how you build a
heart,” said Clifford Tabin, a developmental biologist at Harvard Medical School.
For centuries doctors and naturalists observed how embryos developed, but it was not until the
early 1900s that developmental biologists ran experiments to understand the forces at work.
“This was an era of slice and dice,” wrote Neil Shubin, a University of Chicago biologist, in his
2008 book “Your Inner Fish.” Developmental biologists would snip out pieces of embryos or
graft parts together and watch how the development of the embryo was altered.
Limbs proved to be the easiest part of an embryo to study. “The limb is totally external, it’s easy
to work with, and it’s totally expendable,” Dr. Tabin said. “No matter what you do to it, the
embryo is going to be fine. Having a heart matters a lot to an embryo. But having a limb
doesn’t.”
Chickens became a favorite animal for developmental biologists who studied limbs. “You
actually break the eggshell and make a window, and you can cover it with tape afterwards,” said
Cheryll Tickle of the University of Bath. “The embryo will continue to develop, and you can find
out what happens later on.”
In the 1940s, a Johns Hopkins University biologist, John Saunders, discovered through some
slicing and dicing that there were two parts of the limb bud that had mysterious powers over the
entire limb’s fate.
Biology HSL
Department of Science
Page 276
Student
One of those parts was a translucent ridge that formed along the outer edge, where the fingers
eventually form. If Dr. Saunders clipped off the ridge, the entire limb stopped developing. If he
grafted a second ridge onto a limb bud, it grew into two arms.
That patch of tissue was called the apical ectoderm ridge.
Dr. Saunders also discovered a zone on the lower edge of the limb bud, around the place where
the pinky would later develop. It somehow sent signals across the limb bud, telling the cells
where they were along the pinky-to-thumb axis of the hand and thus which digit to become, and
it became known as the zone of polarizing activity.
When Dr. Saunders grafted an extra zone to the thumb side of a limb bud, he produced a
second set of digits, arranged in a mirror image to the normal ones.
Five decades later, biologists began to pinpoint the signals that these special parts of the limb
bud send out.
In 1993, for example, Dr. Tickle and her colleagues discovered that the ridge produces a
growth-stimulating molecule called, descriptively, fibroblast growth factor. A limb bud could still
grow without its ridge, they found, if they implanted in it a microscopic bead soaked with this
growth factor.
In 1993, Dr. Tabin and his colleagues discovered another signaling chemical of major
importance in the limb. Geneticists had a little more fun naming the protein, calling it sonic
hedgehog, after a video game character.
Over the past 16 years, Dr. Tabin, Dr. Tickle and other researchers have identified more of the
crucial limb-building proteins and the genes that carry the instructions to make them.
“We know most of the genes now, so it’s really a system where we can look at more complex
things,” said Rolf Zeller of the University of Basel in Switzerland. “We’re trying to understand
how these different genes work together.”
Limb development researchers have found that the first steps take place while an embryo is still
a crumpled tube. Along the length of an embryo’s flanks, a series of segments forms. Each
segment produces chemical signals. And at the places where the shoulders and the hips will be,
the signals tell the outer cells to grow rapidly and form little pockets, into which other cells
stream.
As the pocket grows, it forms the necessary ridge, which sends out other signals telling the cells
just underneath it to multiply. As the limb bud grows, the ridge moves away from the cells at its
base, which receive fewer growth factors. Without that stimulation, the cells grow more slowly
and begin to develop into cells that produce cartilage. They form clumps that will eventually turn
into limb bones.
Meanwhile, cells near what will become the pinky start making sonic hedgehog. That molecule
spreads across about half the limb bud, to where the middle finger will later form.
Biology HSL
Department of Science
Page 277
Student
Cells that produce sonic hedgehog are exposed to the protein the longest. The neighboring cells
become separated as the limb bud grows, and so they are only briefly bathed in it.
Some experiments suggest that being exposed for a long time turns limb bud cells into pinkies.
No time exposed to sonic hedgehog turns them into thumbs.
Each part of the limb knows what it should develop into thanks to sets of genes, each laying
down the coordinates in one of three dimensions, and all working together. It turns out, for
example, that the cells in the ridge can function only if the limb bud can make sonic hedgehog.
Dr. Zeller and his colleagues have discovered why: sonic hedgehog switches on a gene in
nearby cells called gremlin. Gremlin, in turn, inhibits a protein called BMP4 (for bone
morphogenetic protein). At high enough levels, BMP4, can shut down the production of the
growth factor in the ridge. So by keeping BMP4 levels low, sonic hedgehog lets the ridge
continue to function.
Once the limb has reached the right proportions, it must quickly stop growing. Experiments
carried out by Dr. Tabin and his colleagues point to the brake on limb development. The limb
bud gets so big that the gremlin-producing cells drift farther and farther away from the cells that
make sonic hedgehog. As their supply of sonic hedgehog drops, the cells cannot make gremlin
proteins. The level of BMP4 rises, and it shuts down the ridge. Without the ridge’s help, the limb
bud can no longer make sonic hedgehog. In other words, all the crucial genes for the
development of the limb shut one another off.
Today, researchers still have much left to learn about the development of limbs. “Your knuckle
and your humerus are the same size when they first form,” Dr. Tabin said. “Why does the
humerus grow so much bigger than the knuckle? We don’t know.”
Dr. Tickle and other researchers are screening all the genes that are active in limb bud cells to
find those that are essential for the development of limbs. She is optimistic that before long
scientists will chart the entire path by which limb buds develop into fully formed limbs. “It’s just a
question of having enough people plugging away at it,” she said.
Dr. Tabin shares that optimism. “It’s definitely clear that we’re going to get there,” he said.
“We’re going to understand it from beginning to end.”
But Dr. Tabin argues that long before scientists find the complete pattern of limb growth, they
will discover many important insights. It is now clear, for example, that genes involved in making
limbs (like BMP4) are important for building other parts of the body as well.
“Within an embryo the same molecules are used over and over again,” Dr. Tabin said. “No one
would have expected there would have been so few signals used to form an embryo. If you
have a signal that says make a heart, you wouldn’t expect it to make a limb. But that’s exactly
what you find.”
Deciphering the development of limbs may also lead to treatments for injuries and birth defects.
In the near term, scientists are searching for the signals that cause tendons to develop and
Biology HSL
Department of Science
Page 278
Student
attach to bones. The signals might be able to cause cells in a dish to form extra tendon tissue,
as well, which could be surgically implanted in arms or legs.
Eventually, it may even be possible to apply the right signals that can turn stem cells into limb
buds and, ultimately, full-blown arms and legs.
“I’m optimistic it’s going to happen,” Dr. Tabin said. “If you can get the initial conditions right and
the cells know what they’re supposed to do, you can turn them loose. It’s a self-organizing
system. You don’t have to come back in and say you’ve got to split the muscle in two here. That
will happen by itself.”
Biology HSL
Department of Science
Page 279
Student
When’s That
Directions: Match the 16 descriptions below to the images of prenatal development posted in the
classroom. Write the number of weeks on the line next to each answer. There is one description
for each image.
Period Of
Development
Description
1. This week marks the end of the “embryonic period.” Facial features, like
eyelids and ears, take shape.
2. An inner group and outer group of cells form. Around Day 6, this ball
implants itself in the mother’s uterine wall.
3. Eyes, brows and lashes are well formed by this week. Fingerprints begin to
take shape. Internally, the lungs start to form air sacs.
4. The cells of the embryo continue to multiply and begin to differentiate, or
take on specific functions. For example, in this week, certain cells begin to
develop into a brain, while others grow into a spinal cord and others into a
heart.
5. By this week, fine hair called lanugo is on the head. Muscle tissue and
bones develop. Active movements begin to happen, but the mother cannot
feel them yet.
6. In this period, the fetus increases in size and adds a large amount of body
fat. Breathing movements happen, but lungs are still not fully mature.
7. A sperm cell penetrates the mother’s egg cell, resulting in the zygote. It
contains all of the genetic material (DNA) necessary to grow into a child.
8. By this week, body fat continues to increase. Lanugo starts to disappear.
Although not quite full term, a baby born now can usually survive with
minimal medical intervention.
9. By this week, all essential organs have begun to form. Elbows and toes also
become visible.
10. During these weeks, the brain is rapidly developing. The immature
respiratory system continues to develop to a point where the exchange of
oxygen and carbon dioxide is possible.
11. Arm and leg buds appear. The developing heart now beats. Eyes and ears
also begin to form during this week.
12. Fine hair called lanugo covers the body. Eyebrows, lashes and fingernails
appear. The mother may begin to feel fetal movement around this week.
13. Considered full term, the baby continues to add weight. Head hair becomes
thicker and fingernails grow longer, extending beyond the finger tips.
14. Cells spend the next few days traveling down the Fallopian tube and
dividing to form a ball of cells called a morula.
15. By this week, the head makes up nearly half of the fetus’ size. Genitals are
visible. Eyelids are closed. The fetus can make a fist.
16. Hands and feet can be seen. Fingers and toes may appear webbed. The
lungs also begin to form during this week.
Biology HSL
Department of Science
Page 280
Teacher
Comparing Cells
NGSSS:
SC.912.L.14.3. Compare and contrast the general structure of plant and animal cells. Compare
and contrast the general structure of prokaryotic and eukaryotic cells. (AA)
Purpose of Lab/Activity:
 Students will compare and/or contrast the structures found in plant cells and in animal
cells.
 Students will compare and/or contrast the structures found in prokaryotic cells and in
eukaryotic cells.
Prerequisite: Prior to this activity, the student should be able to
 Explain what cells are and some basic organelles and their function.
 List the 3 parts of the cell theory.
 Identify the main parts of a light microscope.
Materials (individual or per group):
 microscopes
 prepared slides of bacteria
 methylene blue
 microscope slide
 coverslip
 toothpick
 onion
 Elodea plant
 deionized water
Procedures: Day of Activity:
What the teacher will do:
a. Begin with a brief introduction of prokaryotes and eukaryotes by showing
students the following video Assignment Discovery: Prokaryotes
Eukaryotes
b. Have students read through the background information and answer
introductory questions:
1. Who was the first person to observe cells?
2. How should the microscope be carried?
Before
3. Describe what two things should be done to the microscope before
activity:
putting a slide onto the stage or removing a slide from the stage.
4. Imagine that you have just put a slide onto the stage. How would you
bring it into focus?
5. If you have the low power objective in place, which focus adjustment
knob or knobs should be used to focus the image?
6. When returning the microscope to the case, what precautions should be
taken to prevent damaging the microscope?
c. Gather materials and set-up lab equipment.
Biology HSL
Department of Science
Page 281
Teacher
During
activity:
After
activity:
What the teacher will do:
a. As students perform the lab activity, allow students to use additional
resources to answer the introductory questions, such as the textbook and
the Internet.
1. Explain the function of the nucleus in eukaryotic cells and tell how
prokaryotic cells carry out this function.
2. What structures do both prokaryotic and eukaryotic cells have?
3. What structures (organelles) do eukaryotic cells have that prokaryotic
cells do not?
4. Compare the size and shape of both eukaryotic cells and prokaryotic
cells.
b. Monitor student groups to ensure that they are recording their observations
of each cell. Remind them to label each diagram and include the total
magnification being used.
What the teacher will do:
a. Assess student understanding of cells by reviewing the different types.
- You should emphasize that prokaryotes (Archaea and bacteria) have
DNA, but it is not in a nucleus, and they do not have many membranebound organelles. In contrast, eukaryotes (all life forms except those in
Archaea and bacteria) have a nucleus and other membrane-bound
organelles.
- You should highlight the major differences between plant and animal
cells for the students: 1) plant cells have a chloroplast so they are
green and make their own food, 2) plant cells have a rigid cell wall so
they maintain a set shape, unlike animal cells which vary with their
environment, 3) plant cells have a large vacuole to store water (for
photosynthesis), which pushes the nucleus off-center and also helps to
maintain the plant shape, and 4) plant cells do not have centrioles.
b. You may project images of the cells using a projector or digital microscope
in order to make sure all students viewed the cells. Ask them to identify the
organelles that can be seen and discuss their function in cellular processes.
c. Have students complete a cell analogy.
- The cell is the structural and functional unit of all organisms. Its
organelles work together to carry out all the processes necessary for
life. Each organelle is essential – the cell cannot run smoothly unless all
the organelles are working in sync.
- Example: This is why we can compare a cell and its organelles to a
shoe factory. A shoe factory cannot be successful unless all its different
components are working together properly.
Extension:
 Prokaryotic and Eukaryotic Cells Animation: Cells Alive
 Gizmo: Cell Structure
Biology HSL
Department of Science
Page 282
Student
Comparing Cells
NGSSS:
SC.912.L.14.3. Compare and contrast the general structure of plant and animal cells. Compare
and contrast the general structure of prokaryotic and eukaryotic cells. (AA)
Background:
In 1665, and Englishman named Robert Hooke reported an interesting observation that he had
made while looking at a thin slice of cork through a microscope that of his own design. As he
reported it: “I took a good clear piece of cork and with a penknife as keen as a razor, I cut piece
off of it. Then, examining it with a microscope, me thought I could perceive it to appear a little
porous, much like a honeycomb, but the pores were not regular.”
The porous structures that Hooke had observed reminded him of the rooms that monks lived in
at the time which were known as cells. As a result, Hooke named the structures that he had
observed under the microscope cells as well, and the name has been used ever since. Since
the time of Hooke, many other people have studied cells through the microscope, and learned
much more about them. What they learned has become the basis of much of what we now know
about living things. Today, you will follow in the footsteps of Hooke and other biological
luminaries as you observe and compare cells with the microscope.
Cells are the basic units of life. New and better instruments, such as electron microscopes, have
allowed scientists to study the structure of living cells in increasing detail. In doing so, it was
discovered that there are two basic kinds of cells: prokaryotic and eukaryotic.
Prokaryotic cells do not have a nucleus or any internal membrane-bound structures. Within
these cells, membranes do not separate different areas from one another. Bacteria in the
Kingdom Monera are prokaryotes. There are some universal structures that all bacteria have.
Like every living organism, they have the basic building blocks of life -- DNA, RNA, and protein.
Therefore, these prokaryote cells will generally have an area of genetic material but no nuclear
membrane. They will also have RNA and free-floating ribosomes for protein synthesis. In
addition, all bacteria have a cell membrane, and most have a cell wall outside that. Since
prokaryotic means “without or before nucleus,” it may help to remember them as the POOR,
PRIMITIVE PROKARYOTES. (Pro means before and karyote means nucleus.)
In contrast, eukaryotic cells have many kinds of internal membrane-bound structures called
organelles. Essentially then, eukaryotes have EVOLVED EVERYTHING IN ENVELOPES. The
most important of these is the nucleus where the hereditary DNA is separated. Compared to
prokaryotes, eukaryotes are much more compartmentalized and specialized. Eukaryotic cells
are present in all living things except bacteria that would include protists, fungus, plant, and
animal cells. (eu means true and karyote means nucleus.)
Purpose or Problem Statement:
 To identify and define similarities and differences between prokaryotic and eukaryotic
cells.
Safety: Review the microscope reminders to ensure proper lab protocol.
Biology HSL
Department of Science
Page 283
Student
Vocabulary: prokaryote, eukaryotes, cell, plant cell, animal cell, cell wall, cell membrane
(plasma membrane), cytoplasm, plasmid, ribosomes, flagella, nucleus, nuclear envelope,
nucleolus, chromatin, chromosomes, endoplasmic reticulum, microtubules, microfilaments,
vacuoles, mitochondria, Golgi apparatus, chloroplasts, lysosomes, cilia, and flagella
Microscope Reminders
1. Always carry the microscope with one hand on the arm and the other on the base.
2. Place the microscope well in from the edge of the desk. Make sure the cord doesn’t hang
off of the desk.
3. Lower the stage all of the way down and have the scanning (4x) objective in place when
changing slides.
4. Turn on the light source, and center the specimen over the opening in the stage.
5. Switch to the low power objective (10x) and while looking through the microscope, use
the coarse adjust knob (large knob) raise the stage until the specimen is in focus.
6. Adjust the light with the diaphragm and the fine adjust knob (smaller focus knob) to
sharpen the focus.
7. Without lowering the stage, rotate the nosepiece until the high power objective is in place.
Then while looking through the eyepiece, use the fine adjust knob only to sharpen the
focus.
8. When returning the microscope to the cabinet the following things should be done to
prevent damage to the microscope:
 Lower the stage completely.
 Make sure that the scanning objective is in place.
 Center the stage clip on the stage so that no part of it is hanging off of the stage.
 Using two hands to carry the microscope, return it to its numbered space in the
cabinet
Part A: Comparing Prokaryotic and Eukaryotic Cells
Materials:
 microscopes
 prepared slides of bacteria
 methylene blue
 microscope slide
 coverslip
 toothpicks
Procedures:
Prepared Slide
1. Obtain a prepared slide of three bacterial types from the front of the room.
2. When you have returned to your seat, hold the slide up to the light. You will observe three
smudges on the slide. They will be either pink or purple in color. Each smudge contains
large numbers of one type of bacterial cells. Pick one of the smudges to observe.
3. Turn on the microscope.
4. With the stage lowered completely and the scanning objective in place, put the slide on
the stage with the smudge of cells that you chose centered over the stage opening.
Biology HSL
Department of Science
Page 284
Student
5. While looking through the microscope raise the stage, until the cells become visible. Then
sharpen the focus with the fine adjust knob. Adjust the diaphragm as necessary to get the
best view.
6. Without lowering the stage, rotate the nosepiece until the high power objective is in place.
Then while looking through the eyepiece, use the fine adjust knob only to sharpen the
focus. Adjust the diaphragm to get the best view.
7. Record your observations.
8. Lower the stage all of the way down and with the scanning (4x) objective in place remove
your bacterial slide and return it to the front of the room.
Making Your Own Slide
1. Add a drop of methylene blue to a clean glass slide. Use care with the methylene blue as
it is a stain and will stain skin and clothing.
2. Use the blunt end of a toothpick to swab the inside of your cheek. Stir the toothpick into
the methylene blue. Add one hair to the methylene blue to use as a focusing aid and add
a coverslip.
3. Turn on the microscope.
4. With the stage lowered completely and the scanning objective in place, put the slide on
the stage with the hair centered over the stage opening.
5. While looking through the microscope raise the stage, until the hair becomes visible.
Then sharpen the focus with the fine adjust knob. Adjust the diaphragm as necessary to
get the best view.
6. Use the stage adjustment knobs to search the slide for cells. When you find some,
sharpen the focus and adjust the diaphragm as necessary.
7. Without lowering the stage, rotate the nosepiece until the high power objective is in place.
Then while looking through the eyepiece, use the fine adjust knob only to sharpen the
focus. Adjust the diaphragm to get the best view.
8. Record your observations.
9. Lower the stage all of the way down and with the scanning (4x) objective in place remove
your slide and rinse it off.
Data:
 Inside each circle, sketch one cheek cell and one bacterial cell as they appear under high
power.
 Label any cell structures or organelles that are visible in the cheek cell. At least 3 will be
visible.
 Use the line beneath the circle to indicate the total magnification of the cells as they
appear in your drawings.
Biology HSL
Department of Science
Page 285
Student
Part B: Eukaryotic Cells: Looking at Plant Cells
Materials:
 microscopes
 methylene blue
 onion
 microscope slide
 coverslip
 Elodea plant
 deionized water
Procedures:
Onion Cells
1. Add a drop of methylene blue to a clean glass slide. Use care with the methylene blue as
it is a stain and will stain skin and clothing.
2. Obtain a piece of onion and use your fingernail to peel the skin from the inside surface.
Lay this skin into the methylene blue. Add a coverslip.
3. With the stage lowered completely and the scanning objective in place, put the slide on
the stage with the onion centered over the stage opening.
4. While looking through the microscope raise the stage, until the onion becomes visible.
Then sharpen the focus with the fine adjust knob. Adjust the diaphragm as necessary to
get the best view.
5. Without lowering the stage, rotate the nosepiece until the high power objective is in place.
Then while looking through the eyepiece, use the fine adjust knob only to sharpen the
focus. Adjust the diaphragm to get the best view.
6. Record your observations.
7. Lower the stage all of the way down and with the scanning (4x) objective in place remove
your slide and rinse it off.
Biology HSL
Department of Science
Page 286
Student
Elodea Cells
1. Add a drop of de‐ionized water to a clean glass slide. From the front of the room, obtain
an Elodea leaf. Try to pick a leaf from the top of the stalk.
2. Place the Elodea leaf into the water and add a coverslip.
3. With the stage lowered completely and the scanning objective in place, put the slide on
the stage with the leaf centered over the stage opening.
4. While looking through the microscope raise the stage, until the Elodea becomes visible.
Then sharpen the focus with the fine adjust knob. Adjust the diaphragm as necessary to
get the best view.
5. Without lowering the stage, rotate the nosepiece until the high power objective is in place.
Then while looking through the eyepiece, use the fine adjust knob only to sharpen the
focus. Adjust the diaphragm to get the best view.
6. Record observations
7. Lower the stage all of the way down and with the scanning (4x) objective in place remove
your slide and rinse it off.
Data:
 Inside each circle, sketch one onion and one Elodea cell as they appear under high
power.
 Label any cell structures or organelles that are visible in the cheek cell. At least 3 will be
visible.
 Use the line beneath the circle to indicate the total magnification of the cells as they
appear in your drawings.
Biology HSL
Department of Science
Page 287
Student
Analysis:
Suggested vocabulary: You should be able to apply the following terms in your writing.
Eukaryotic cell Prokaryotic cell Organelle
Cell membrane Cell wall
Chloroplast
Cytoplasm
Nucleus
Wet mount
Methylene blue Photosynthesis Chlorophyll
1. Explain the function of the chloroplast in plant cells and tell why animal cells do not have
a chloroplast.
2. Explain the structure and function of the cell wall in plant cells.
3. Are animal cells and plant cells eukaryotic or prokaryotic? Explain your answer.
4. What structures (organelles) do both plant and animal cells have?
5. What structures (organelles) do plant cells have that onion cells do not?
6. Compare the size and shape of both plant and animal cells.
7. Compare the size of plant and animal cells to the size of bacteria cells.
8. Are bacteria cells eukaryotic or prokaryotic? Explain your answer.
Conclusion:
1. What are the functions of the cell parts found only in plant cells?
2. Is the nucleus always found in the center of the cell?
3. Which part of an animal cell gives shape to the cell?
4. Which parts of a plant cell give shape to the cell?
5. Why are stains such as methylene blue used when observing cells under the
microscope?
6. Why don’t animal cells have chloroplasts? (HINT: How do animals get energy?)
7. Create a Venn diagram that compares prokaryotic and eukaryotic cells. Categories for
comparison may include size, DNA structure, types of organisms, and organelles.
Biology HSL
Department of Science
Page 288
Teacher
Diffusion and Osmosis
NGSSS:
SC.912.L.14.3 Compare and contrast the general structures of plant and animal cells. Compare
and contrast the general structures of prokaryotic and eukaryotic cells. (AA)
Purpose of the Lab/Activity:
 Address the movement of material through a semi-permeable membrane.
 To observe the process of osmosis and how it occurs in cells.
 Examine and describe the different environmental conditions that can affect a cell and its
processes.
Prerequisites:
 The movement of ions and molecules across membranes is discussed.
 Iodine indicator is used to test for the presence of starch. It turns blue-black when starch
is present.
 Basic understanding of the structure and function of cells.
Materials (per group):
 open space
Procedures: Day of Activity:
What the teacher will do:
a. Activate student’s prior knowledge by the following demonstration.
b. Drop several drops of food coloring into a glass beaker of water. Ask
students to observe what happens over the next couple of minutes and
have them note changes to water and food coloring in their journals. Have
students predict what will happen after 5, 10 and 20 minutes. Introduce the
concept of “diffusion”.
c. Define and tell students that we will be exploring how diffusion occurs in
Before
different
activity:
d. For activity #2, it is suggested that the teacher prepare the potato core
samples using a cork borer prior to the activity.
e. Ask the following questions:
1. Describe the function of the cell membrane.
2. Discuss how cell membranes are like a filter or gatekeeper.
3. Why is such a function necessary for a cell to function?
4. Define “selectively permeable.” Hint: dissect the word parts and then
explain its meaning)
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
proper lab protocol.
b. Review the experimental design diagram by asking individual students in
During
groups to explain the different parts of the experiment.
activity:
1. Follow laboratory procedural plan; making sure to model proper
laboratory safety and use of equipment.
2. Emphasize importance of data collection by groups.
3. Fill a test tube with Iodine in order for student’s to see it’s original color.
Biology HSL
Department of Science
Page 289
Teacher
Iodine acts as an indicator. Chemical indicators change color when the
substance you are testing for is present. Iodine (starch indicator) turns
blue-black when starch is mixed with iodine and remains amber
(orange-brown) when starch is not present.
What the teacher will do:
a. Have each group share their observations.
b. Lead discussion that focuses on questions in the investigations.
c. Record each group’s data for each investigation on the board or
transparency, discussing each set of results as you record them.
d. Identify the meaning of diffusion, permeable, semi-permeable, and
impermeable as they apply to cell membranes.
e. Identify impermeable as a membrane that will not allow any diffusion across
a membrane.
f. Show a visualization such as the following and discuss why materials have
to pass into and out of the cell:
1. Diffusion animation: http://highered.mcgrawhill.com/sites/0072495855/student_view0/chapter2/animation__how_diffusion_
works.html
2. Osmosis animation: http://highered.mcgrawhill.com/sites/0072495855/student_view0/chapter2/animation__how_osmosis_
works.html
After
activity:
g. Answer Key for Results/Conclusion:
Activity 1: Diffusion of Starch
1. Sketch the experiment, use arrows to show the way the diffusion was
occurring. Answers will vary. Students should illustrate that the starch
inside the Ziploc bag is moving through the semi-permeable membrane
(bag)
2. Observing the diffusion process in real cells is difficult because they are
too small to be seen easily. In this activity you created a giant model of
a cell so that you can observe the effects of diffusion through a
membrane. In your cell model describe the role of each of the following
parts:
a. Ziploc bag: cell’s membrane
b. contents of the bag: cell’s cytoplasm
c. area outside the bag: cell's environment
Activity 2: Potato Osmosis
1. In this experiment, why was it important that the potato cores were the
same length? In order for this to be a controlled experiment the core
samples must be the same size. If not, any change in the core sample
after placing them in the different solutions could be attributed to the
different size not the concentration of salt.
2. Why was it important to cover each beaker with a piece of aluminum
foil? To minimize the rate of evaporation.
3. Into which of the potato cores did water flow? From which of the potato
cores did water flow? How can you tell?
Surrounding the potato cell with a HYPOTONIC solution, such as 100%
water, will result in the net movement of water INTO the potato cells.
They will gorge up.
Biology HSL
Department of Science
Page 290
Teacher
Surrounding the potato cell with a HYPERTONIC solution, such as 80%
water, 20% NaCl solution, will result in the net movement of water OUT
of the potato cells. They will shrivel.
Surrounding the cell with an ISOTONIC solution, will result in no net
movement of water. They will stay the same.
4. Which solutions (if any) were hypertonic, isotonic, or hypotonic? Explain
how you know. The data from the experiment will assist the students
with identifying the tonicity of the solutions.
Extension:
 Gizmo: Osmosis, Diffusion
Biology HSL
Department of Science
Page 291
Student
Diffusion and Osmosis
NGSSS:
SC.912.L.14.3 Compare and contrast the general structures of plant and animal cells. Compare
and contrast the general structures of prokaryotic and eukaryotic cells. (AA)
Background: (Source: www.explorelearning.com)
Diffusion is the process in which there is a net movement of molecules from a high area of
concentration to a low area of concentration. Osmosis is the passage of water from a region of
high water concentration through a semi-permeable membrane (Semi-permeable membranes
are very thin layers of material which allow some things to pass through them but prevent other
things from passing through.) to a region of low water concentration. This is seen in cell
membranes. When there is a higher concentration of one type of molecule outside of a cell,
water will move through a membrane out of the cell in order to make the water concentrations
equal. This causes the cell to shrink (hypertonic). If the concentration of certain molecules is
higher inside of the cell, then the water will move into the cell causing it to swell (hypotonic).
When the molecule concentrations are equal on both sides of the membrane, water does not
move (isotonic).
In the human body, many salts and enzymes help to regulate a cell’s state and the processes
necessary for the human body to function such as potassium and calcium channels in the heart.
These functions are carried out by having constant changes in concentration of molecules from
one side of the membrane to another. Cell membranes will allow small molecules like oxygen,
water, carbon dioxide, ammonia, glucose, amino acids, etc., to pass through. Cell membranes
will not allow larger molecules like sucrose, starch, protein, etc., to pass through.
Problem Statement(s): What is the movement of material through a semi-permeable
membrane? (Activity 1) What is the osmotic effect of varying sodium chloride (NaCI) solutions
on the physical characteristics of a potato core? (Activity 2)
Vocabulary: cell, cell membrane, permeable, diffusion, semi-permeable membrane, osmosis,
hypertonic, hypotonic, isotonic
Materials (per group):
Activity 1
 Ziploc bag
 liquid starch
 forceps
 beaker (500 ml)
 water
 Iodine (Lugol’s solution)
Biology HSL
Department of Science
Activity 2
 razor
 potato
 ruler
 balance
 graduated cylinder
 distilled water
 NaCl solution
 dissecting needle
 beaker
 aluminum foil
Page 292
Student
Procedures:
Activity 1: Diffusion through a semi-permeable membrane.
1. Get a small plastic zip-top bag, a cup of liquid starch, a forceps and a large container of
water to which a few drops of iodine solution has been added. Be careful with container
and do not get the iodine solution on your skin. It will stain.
2. Place liquid starch in plastic bag and securely zip the top closed. Record observations of
the color of the starch and the water in the container.
3. Place bag with starch into the iodine/water solution. Let it sit while you go on to Activity 2.
4. Observe and record the changes over time to both the iodine/water solution and the
starch in the bag. You will need to carefully lift the bag part way out of the water with a
forceps to observe. Then lower the bag back into the water and return the container as
directed by the teacher.
Activity 2: Potato Osmosis
1. Using the razor carefully cut each potato core into a cylinder of about three to five
centimeters in length. Make sure that all of the potato cores are the same length and note
this length for later use. Also measure and record the diameter of each potato core.
2. Using the balance, measure, and record the mass of each potato core.
3. Fill the graduated cylinder with tap water two-thirds of the way up. Measure and record
the volume of water in the graduated cylinder. Attach each potato core, one at a time, to
the end of the dissecting needle and hold it so that the potato core is completely
submerged in the water. Measure and record the water level in the cylinder. The
difference in your two measurements is the volume of the potato core.
4. Place one potato core in the beaker with distilled water and label this beaker "100". Place
the second core in the beaker of 90% water/10% NaCl solution and label the beaker
"90/10". Place the third core in the beaker with 80% water/20% NaCl solution and label
this beaker "80/20".
5. Cover the top of each beaker with a piece of aluminum foil. Fold the aluminum foil down
along the sides of the beaker so that it cannot fall off easily.
6. Allow the beakers to sit for a day.
7. Remove the cores from each beaker using the dissecting needle and gently blot them.
Measure and record the length, diameter, mass, and volume of each potato core as you
did earlier.
8. Dispose of the cores in the trash, not the sink.
Observations/Data:
Table 1 - Diffusion of Starch
Initial Observations
Final Observations
Ziploc Bag with Starch
Iodine/Water Solution
Table 2 - Physical Changes in Potato Cores
Biology HSL
Department of Science
Page 293
Student
100% water
Day 1
Day 2
90% water
10% NaCl
Change Day 1 Day 2
Change
80% water
20% NaCl
Day 1 Day 2
Change
Length
(mm)
Diameter
(mm)
Mass (g)
Volume
(ml)
Record any qualitative changes (in color, texture, etc.) you noticed in the potato cores.
Observations/Data Analysis:
Activity 2: Potato Osmosis
1. Calculate the “Change” by subtracting “Day 1” from “Day
2. Calculate the “% Change” by dividing the “Change” by “Day 1” (NOTE: Keep any
calculations which are negative do not use the absolute value).
3. Graph the % change in mass on one graph and the % change in the volume on a
separate graph.
4. Correctly label the Y (vertical) axis and the X (horizontal) axis of each graph.
Activity 1: Diffusion of Starch
1. Sketch the experiment, use arrows to show the way the diffusion was occurring.
Biology HSL
Department of Science
Page 294
Student
Results/Conclusion:
Activity 1: Diffusion of Starch
Observing the diffusion process in real cells is difficult because they are too small to be seen
easily. In this activity you created a giant model of a cell so that you can observe the effects
of diffusion through a membrane. In your cell model describe the role of each of the following
parts:
a. Ziploc bag:
b. contents of the bag:
c. area outside the bag:
Activity 2: Potato Osmosis
1. In this experiment, why was it important that the potato cores were the same length?
2. Why was it important to cover each beaker with a piece of aluminum foil?
3. Into which of the potato cores did water flow? From which of the potato cores did water
flow? How can you tell?
4. Which solutions (if any) were hypertonic, isotonic, or hypotonic? Explain how you know.
Biology HSL
Department of Science
Page 295
Teacher
Investigating Inherited Traits: “Reebop” Genetics
(Modified Marshmallow Meiosis by Patti Soderberg)
NGSSS:
SC.912.L.16.1 Use Mendel’s laws of segregation and independent assortment to analyze
patterns of inheritance. (AA)
Purpose of Lab/Activity:
- Examine how characteristics are inherited and to illustrate one of the ways in which
meiosis is responsible for the variation that exists in every sexual species.
Prerequisite: Prior to this activity, the student should be able to
 Explain the basic relationship between DNA, genes and chromosomes.
 Understand the concepts of Punnett squares, probability, genotype, dominant traits,
recessive traits, alleles, genes, and phenotype.
 Review Mendels‘s laws of segregation and independent assortment and analyze how
these processes occur in the cell during the process of Meiosis.
 Explain the following modes of inheritance: dominant, recessive, co-dominant, sex-linked,
polygenic, and multiple alleles.
Materials (individual or per group):
 large marshmallows
 small marshmallows
 thumbtacks
 push pins
 pipe cleaners




small nails
toothpicks
set of male and female Reebop®
chromosomes
Decoder Table
Procedures: Day of Activity:
What the teacher will do:
a. During the Reebop activity, your students will have the opportunity to
observe all of the offspring produced by one set of Reebop parents. Your
students will sort Mom and Dad Reebop’s chromosomes, select the new
baby Reebop’s chromosomes, decode the “secret code” found on the
baby’s chromosomes, and construct the baby Reebop according to the
code. In other words, your students will be modelling the processes of
meiosis, fertilization, development and birth. After all of the babies are
Before
“born,” the Reebop family will be assembled so the offspring can be
activity:
compared to one another.
b. Prior to class, you need to assemble Mom and Dad Reebop. Mom and Dad
each have two antennae (small nails), a head (white large marshmallow), a
neck (two toothpicks), two eyes (thumb tacks), an orange nose (an orange
miniature marshmallow), three body segments (white large marshmallows),
two green humps (green miniature marshmallows), four blue legs (blue
push pins), and a curly tail (a pipe cleaner). Assembly works best if you let
the marshmallows sit out over night to firm up. The Reebops tend to be too
floppy to stand properly if fresh marshmallows are used.
Biology HSL
Department of Science
Page 296
Teacher
c. Next, you will have to print identical sets of Mom and Dad Reebop’s
chromosomes for the students to sort; use red (female) and green (male)
colored card stock to simulate male vs. female chromosomes. Place each
set in a large envelope. Each envelope should contain two different colored
subsets of 18 chromosomes (a total of 36). Each parental set consists of
pairs of chromosomes of 9 different lengths. The 18 red chromosomes are
Mom’s chromosomes and the 18 green ones are Dad’s. Create enough
sets so each pair of students will have their own set to work with.
d. Essential question (or problem statement):
- If you have both parent phenotypes for a trait, then can you accurately
predict the phenotype of an offspring? The answers to the hypothesis
will vary; an acceptable answer can be that they could not accurately
determine the phenotype of the offspring because of recessive traits.
e. Some common misconceptions associated with inherited traits and how
they can be resolved are provided below:
1. Students incorrectly believe that if no one else in the family is affected,
the condition is not inherited. Students often believe that if they do not
see a characteristic such as in their family, then it must not be inherited.
For example, if a student had a hitchhikers thumb, but their parents and
possibly grandparents did not, then the student may believe something
happened to their thumb to make it bend back. This is especially
common with genetic disorders, like colorblindness, which often skip
generations. Drawing Punnett Squares and pedigrees can help students
visualize that some traits or genetic disorders tend to skip generations.
 Students inaccurately believe that traits are inherited from only one of
their parents. Some students believe girls inherit most of their
characteristics from their mothers and boys inherit most of their
characteristics from their fathers. Some students may also believe their
mothers give them more genetic material because they were carried in
their mothers as fetuses. Students may tend to believe they look more
like one parent and therefore they received most of their genetic
material from that parent. In reality, each parent contributes half of their
genetic material to their offspring. One parent may pass more dominant
Biology HSL
Department of Science
Page 297
Teacher
traits to their offspring, which would result in that offspring looking more
like that parent. This misconception can be overcome by discussing the
processes of meiosis and fertilization.
 Students have difficulty with the relationship between genetics, DNA,
genes, and chromosomes. Students may realize that physical
appearances are inherited, but they may not make the connection that
these characteristics have underlying biochemical processes, such as
Meiosis. They do not understand the position of the traits on the
structure of a chromosome. This misconception can be overcome
through review and use of chromosomes in the discussion of Punnett
squares. Students need to understand that calculating probability in a
Punnett square is truly calculating the probability of which chromosome
will be present in a sex cell.
 Students have difficulty distinguishing the difference between acquired
and inherited characteristics. While many of our characteristics come
directly from our genetics, that is not the case for all of our
characteristics. Genetics plays a role in some behaviors and diseases,
but the majority of these are the result of one‘s environment. Talent is
something that can be inherited, but skills must be practiced in order for
talent to develop. This misconception can be overcome by looking at
several examples of inherited characteristics and several examples of
acquired characteristics.
 Students inaccurately believe that one gene controls one trait and all
genetics show Mendelian patterns of inheritance. When teaching
genetics, it is important to emphasize that there are non-Mendelian
patterns of inheritance. Most traits in humans are not monogenic
(controlled by one gene). Monogenic traits are the first examples that we
teach, so students assume that all traits are governed by one gene.
Examples should be given for other patterns of inheritance, such as
polygenic inheritance or linked genes, which will not show Mendelian
patterns.
f. Have students read through the laboratory procedures and complete the
test cross practice problems in the pre-lab discussion.
g. Make sure that they know what to look for in each phenotype. You may
want to review the Decoder Table and answer any questions students may
have about their identification.
What the teacher will do:
a. Circulate throughout the room to make sure that students are properly
completing Table 1 and 2 identifying each parental allele and determining
the genotype and phenotype for each chromosome.
During
activity:
b. Use the following questions to engage student thinking during the activity.
1. For the traits in this investigation, do all heterozygous pairs of alleles
produce an intermediate phenotype? No, some phenotypes are the
result of either homozygous combination of alleles.
2. Can you accurately determine a person‘s genotype by observing his or
her phenotype? Explain. No, some phenotypes are the result of either
homozygous or heterozygous combinations of alleles.
Biology HSL
Department of Science
Page 298
Teacher
After
activity:
What the teacher will do:
a. Have students display their Reebop to the class form a class analysis table
to see which traits are most dominant.
b. The following questions may be used to engage student thinking after the
activity and to connect the concepts of this activity to the NGSSS.
1. What does it mean when an organism is homozygous for a trait
or heterozygous for a trait?
2. What are some similarities your Reebop® offspring shares with
its parents?
3. How is your Reebop® offspring different from its parents?
4. Would you expect the other pairs of students in your class to
have an offspring completely similar to yours? Explain your
answer.
5. Which traits in this investigation showed dominance? Explain
using an example from your cross.
6. Which traits in this investigation were recessive? Explain using
an example from your cross.
7. Which traits in this investigation showed incomplete dominance?
Explain using an example from your cross.
8. Which traits in this investigation showed codominance? Explain
using an example from your cross.
9. Which traits in this investigation showed sex-linked inheritance?
Explain using an example from your cross.
10. Do you think that anyone in your class has all the same genetic
traits that you have? Explain your answer.
11. How might it be possible for you to show a trait when none of
your relatives shows it?
Extension:
 Gizmo: Chicken Genetics
 Gizmo: Mouse Genetics (One Trait)
 Gizmo: Mouse Genetics (Two Traits)
Biology HSL
Department of Science
Page 299
Student
Investigating Inherited Traits: Reebop Genetics
(Modified Marshmallow Meiosis by Patti Soderberg)
NGSSS:
SC.912.L.16.1 Use Mendel’s laws of segregation and independent assortment to analyze
patterns of inheritance. (AA)
Background:
Heredity is the passing on of traits, or characteristics, from parent to offspring. The genetic
makeup of an individual is known as its genotype. The physical traits you can observe in a
person are his or her phenotype. Phenotype is a result of the genotype and the individual’s
interaction with the environment. The units of heredity are called genes.
Genes are found on the chromosomes in a cell. Different forms of the gene for a trait are called
alleles. When the two alleles of a pair are the same, the genotype is homozygous, or pure.
When the two alleles are not the same, the genotype is heterozygous, or hybrid. In nature,
specific combinations of alleles happen only by chance. Some alleles are expressed only when
the dominant allele is absent. These alleles produce recessive phenotypes. Alleles that are
expressed when the genotype is either homozygous or heterozygous produce dominant
phenotypes. An allele that codes for a dominant trait is represented by a capital letter, while an
allele that codes for a recessive trait is represented by a lowercase letter. Sometimes when the
genotype is heterozygous, neither the dominant nor recessive phenotype occurs. In this case,
an intermediate phenotype is produced.
In humans, the sex of a person is determined by the combination of two sex chromosomes.
People who have two X chromosomes (XX) are females, while those who have one X
chromosome and one Y chromosome (XY) are males. In this investigation, you will see how
different combinations of alleles produce different characteristics.
Biology HSL
Department of Science
Page 300
Student
Problem Statement:
 If you have both parent phenotypes for a trait, then can you accurately predict the
phenotype of an offspring?
Vocabulary: DNA, heredity, allele, gene, recessive, dominant, phenotype, genotype, offspring,
chromosome, heterozygous, homozygous, codominance, incomplete dominance, sex-linked
inheritance, law of independent assortment, law of segregation
Pre-Lab Discussion Questions:
Directions: Complete the following test crosses.
Materials:
 large marshmallows
 small marshmallows
 thumbtacks
 push pins
 pipe cleaners
 small nails
 toothpicks
 set of male and female Reebop® chromosomes
 Decoder Table
Biology HSL
Department of Science
Page 301
Student
Procedures:
1. Work in teams of two only. You and your partner represent two Reebop ® parents.
2. Collect a set of male and female chromosomes located in different envelopes.
A. Male envelopes have an XY label outside.
B. Female envelopes have an XX label outside.
3. At your workspace, remove the male and female colored chromosomes from each
envelope. Do not mix them!
A. There are 16 chromosomes (8 pairs) in each envelope.
4. Place the chromosomes upside down so no letters are showing. Scramble them.
5. Each “parent” must select one chromosome of each of the eight pairs to form a gamete
(to represent the sperm or egg).
6. Put the 8 remaining chromosomes of each parent back in the correct envelope.
7. Now your Reebop® parents “reproduce” and the sperm and egg unite to form a zygote.
Match up the homologous pairs of chromosomes – the longest with the longest, etc. Turn
over the 8 pairs of chromosomes.
8. Write down the letters you have obtained in the “My Reebop ® Offspring” table. For
example, if you have one card with the letter A and another card with the letter a, your
genotype is Aa.
9. Use the “Decoder Table” to decide what the characteristics (phenotype) of your Reebop®
offspring. For example, if its genotype is BB, it will have 3 body segments.
10. Collect all the materials you need for your Reebop® offspring body parts. For example, for
3 body segments you need 3 large marshmallows.
11. Build your Reebop® offspring with the characteristics that its genes determine.
12. When completed, compare your Reebop® with other groups.
13. After observing your Reebop®, deconstruct them and return all materials to their
appropriate containers.
Data/Observations: Fill in the tables below.
Table 1 – My Reebop® Parents
Physical Trait
Genotype
Body Type
Bb
Leg color
XBXb or XBY
Type of Tail
Tt
Color of Tail
Tt
Number of humps
Hh
Nose color
Nn
Number of eyes
Ee
Number of antenna
Aa
Biology HSL
Department of Science
Phenotype
Page 302
Student
Table 2 – My Reebop® Offspring
Physical Trait
Allele from
Allele from
♀ parent
♂ parent
Genotype
Phenotype
Sex
Body Type
Leg color
Type of Tail
Color of Tail
Number of humps
Nose color
Number of eyes
Number of antenna
Analysis:
1. What does it mean when an organism is homozygous for a trait or heterozygous for a
trait?
2. What are some similarities your Reebop® offspring shares with its parents?
3. How is your Reebop® offspring different from its parents?
4. Would you expect the other pairs of students in your class to have an offspring
completely similar to yours? Explain your answer.
5. Which traits in this investigation showed dominance? Explain using an example from your
cross.
6. Which traits in this investigation were recessive? Explain using an example from your
cross.
7. Which traits in this investigation showed incomplete dominance? Explain using an
example from your cross.
8. Which traits in this investigation showed codominance? Explain using an example from
your cross.
9. Which traits in this investigation showed sex-linked inheritance? Explain using an
example from your cross.
10. Do you think that anyone in your class has all the same genetic traits that you have?
Explain your answer.
11. How might it be possible for you to show a trait when none of your relatives shows it?
Conclusion:
Develop a written report that summarizes the results of this investigation. Use the analysis
questions as a guide in developing your report. Make sure to give possible explanations for your
findings by making connections to the NGSSS found at the beginning of this lab hand-out. Also,
mention any recommendations for further study in this investigation.
Biology HSL
Department of Science
Page 303
Student
Set of Male and Female
Reebop® Chromosomes
Biology HSL
Department of Science
Page 304
Student
Biology HSL
Department of Science
Page 305
Student
DECODER TABLE
Physical Trait
Sex
Body Type
Leg color
Type of Tail
Color of Tail
Number of humps
Nose color
Number of eyes
Number of antenna
Biology HSL
Department of Science
Genotype
Phenotype
XX
Female
XY
Male
BB and Bb
3 body segments
bb
2 body segments
X bY
4 blue legs
XBY, XBXB, XBXb
4 red legs
TT and Tt
curly tail
tt
straight tail
TT
black
Tt
black and white
tt
white
HH
1 green hump
Hh
2 green humps
hh
3 green humps
NN
red nose
Nn
orange nose
nn
yellow nose
EE and Ee
2 eyes
ee
3 eyes
AA
1 antenna
Aa
2 antenna
aa
3 antenna
Page 306
Student
Biology HSL
Department of Science
Page 307
Student
Biology HSL
Department of Science
Page 308
Teacher
Pedigree Studies
(Modified from http://learn.genetics.utah.edu)
NGSSS:
SC.912.L.16.1 Use Mendel’s laws of segregation and independent assortment to analyze
patterns of inheritance. (AA)
Purpose of Lab/Activity:
 Students are challenged to track and record the passage of colored pom poms
(representing genes) through generations of a family using a pedigree.
 Students learn that common chronic diseases (such as heart disease) run in families and
are caused by the combined action of multiple genes.
 Students learn the meaning of all symbols and lines that are used in a pedigree.
Prerequisite: Prior to this activity, the student should know
 Genes are passed from parents to offspring and contribute to observable physical
characteristics.
 Pedigrees are used to track genetic information.
Materials (individual or per group):
 2 - 3 disposable cups
 Colored pencils or crayons
 Colored pom poms (5 different colors: at least 10 red, 2 yellow, 1 each of orange, green,
blue)
Procedures: Day of Activity:
What the teacher will do:
a. Explain that the following activity will explore how common “polygenic”
diseases (in this case, heart disease) are inherited.
b. Invite students to find a partner with whom they will work to complete the
activity; pass out the student pages and other materials.
c. Review the symbols and structure used for a pedigree:
Before
activity:
d. Some common misconceptions associated with inherited traits and how
they can be resolved are provided below:
 Students may think that all heritable traits (and genetic disorders) are
Biology HSL
Department of Science
Page 309
Teacher
During
activity:
After
activity:
caused by a single gene and exhibit dominant or recessive patterns of
inheritance. But more commonly, traits result from the combined action
of many genes and environmental factors. Such multifactorial traits can
exhibit varied and complex patterns of inheritance that are not easy to
predict.
What the teacher will do:
a. Invite students to begin by following the procedures on the student pages;
each pair of students should complete the pedigree analysis and answer
the pre-lab questions.
b. To engage students in this topic:
1. Compare the prevalence of rare genetic disorders caused by a single
gene such as cystic fibrosis (1 in 10,000) with the prevalence of more
common diseases such as heart disease (1 in 3).
2. Ask the students: Do common diseases like heart disease, diabetes, or
colon cancers have a genetic component?
- Explain that most common diseases do have a genetic component
and tend to run in families. However, common diseases differ from
rare genetic disorders in that they are usually not caused by defects
in a single gene. Rather, they result from the combined effects of
multiple genes and environmental factors. Thus, they are called
multifactorial diseases.
- Explain that because more than one gene is involved in most
common diseases, the inheritance of a common disease is not
predictable.
- Information found in a family health history and recorded on a
pedigree is used to estimate an individual’s genetic risk (low,
medium, or high) of developing a common disease.
c. Circulate throughout the room to make sure that students are properly
completing the Pedigree chart identifying each parental allele and
determining the genotype and phenotype for each chromosome.
What the teacher will do:
a. Review answers to analysis questions:
1. Answers will vary.
2. Decrease. Risk of inheriting heart disease from an affected individual
(such as a grandparent) decreases throughout the generations because
it is unlikely that all of the necessary risk factors (genes) will be passed
down to less closely related family members.
3. An individual’s risk of developing heart disease IS difficult to predict
because:
- Heart disease is polygenic; the number of genes contributing to heart
disease is not known.
- The number of genes carried by parents or offspring that can
increase heart disease risk is not known.
- Environmental factors also vary an individual’s risk of developing
heart disease.
4. Not necessarily. But because heart disease does have a genetic
component, children of an affected parent have an increased risk of
developing heart disease (relative to the population at large).
Biology HSL
Department of Science
Page 310
Teacher
b. Illustrate that multifactorial traits vary within a population along a continuum:
1. Combine class results from Grandma and Grandpa’s children (not
grandchildren) to generate a population of people who inherited a low,
medium, or high risk of developing heart disease.
2. Calculate the total number of individuals in the population (4 X # of
student pairs).
3. Calculate the number of individuals that inherited a low, medium or high
risk of developing heart disease.
4. Graph the results with the low, medium and high risk categories along
the x axis, and the number of individuals along the y axis.
5. Draw a curved line over the histogram to show that this trait follows a
bell-shaped distribution in the population, with most people at medium
(or average) risk of developing heart disease.
6. Emphasize that in reality heart disease risk varies within a population
along a continuum, and an individual’s location along this risk continuum
is determined by his or her genes and environment.
Extension:
 Pedigree Investigation: On The Case of Nicotine Addiction
 Pedigree Virtual Lab: Pedigree Analysis
Biology HSL
Department of Science
Page 311
Student
Pedigree Studies
(Modified from http://learn.genetics.utah.edu)
NGSSS:
SC.912.L.16.1 Use Mendel’s laws of segregation and independent assortment to analyze
patterns of inheritance. (AA)
Background:
Pedigrees are not reserved for show dogs and race horses. All living things, including humans,
have pedigrees. A pedigree is a diagram of family relationships that uses symbols to represent
people and lines to represent genetic relationships. These diagrams make it easier to visualize
relationships within families, particularly large extended families. Pedigrees are often used to
determine the mode of inheritance (dominant, recessive, etc.) of genetic diseases. Patterns of
inheritance have the following modes of inheritance: autosomal dominant, autosomal recessive,
X-linked (recessive), y-linked.
In a pedigree, squares represent males and circles represent females. Horizontal lines
connecting a male and female represent mating. Vertical lines extending downward from a
couple represent their children. Subsequent generations are, therefore, written underneath the
parental generations and the oldest individuals are found at the top of the pedigree.
A sample pedigree is below:
Genotypes for individuals in a pedigree usually can be determined with an understanding of
inheritance and probability. If the purpose of a pedigree is to analyze the pattern of inheritance
of a particular trait, it is customary to shade in the symbol of all individuals that possess this trait.
Other times, you will see the genotypes of the individuals written inside the circles or squares. If
the genotype is unknown or partially unknown, a question mark is used in the pedigree.
Problem Statement:
 How can inherited traits be traced through a family’s history pedigree chart?
Vocabulary: DNA, heredity, allele, gene, recessive, dominant, phenotype, genotype, offspring,
chromosome, heterozygous, homozygous, codominance, incomplete dominance, sex-linked
inheritance, law of independent assortment, law of segregation
Biology HSL
Department of Science
Page 312
Student
Materials:
 2 - 3 disposable cups
 Colored pencils or crayons
 Colored pom poms (5 different colors: at least 10 red, 2 yellow, 1 each of orange, green,
blue)
Pre-Lab Questions:
Reading a Pedigree
The pedigree in Figure 1 shows the pattern of inheritance in a family for a specific trait. The
trait being shown is earlobe shape. Geneticists recognize two general earlobe shapes, free
lobes and attached lobes (see Figure 2). The gene responsible for free lobes (E) is dominant
over the gene for attached lobes (e).
In a pedigree, each generation is represented by a Roman numeral. Each person in a
generation is numbered. Thus each person can be identified by a generation numeral and
individual number. Males are represented by squares whereas females are represented by
circles.
In Figure 1, persons I-1 and I-2 are the parents. The line which connects them is called a
marriage line. Persons II-1, II-2, and II-3 are their children. The line which extends down from
the marriage line is the children line. The children are placed left to right in order of their
births. That is, the oldest child is always on the left.
1. What sex is the oldest child? ______________________
2. What sex is the youngest child? _____________________
3. What is the genotype of free lobes? ______________ and ______________
4. What is the genotype of attached lobes? ______________
Using a different pedigree of the same family at a later time shows three generations. Figure
3 shows a son-in-law as well as a grandchild. Generation I may now be called grandparents.
Biology HSL
Department of Science
Page 313
Student
1. Which person is the son-in-law? _________________
2. To whom is he married? ________________________
3. What sex is their child? ________________________
Procedures:
Pick the Risk: The Polygenic Pedigree Challenge
You are a researcher investigating heart disease. You know there are 6 genes in humans
that can contribute to heart disease risk. All humans have these 6 genes, but we can inherit
slightly different forms or “flavors” of these genes. Your challenge is to track and record the
passage of these 6 genes (signified by colored pom poms) through generations of a family
using a pedigree. Then, predict which members of this family are most likely to develop heart
disease.
Part 1:
1. Obtain a blank pedigree, colored pencils or crayons, 2 disposable cups, and an
assortment of colored pom poms from your teacher.
2. Choose one cup that will represent a grandmother. Place inside the cup 5 red pom poms
(5 “normal” genes that do NOT contribute to heart disease) and 1 blue pom pom (1 gene
that increases heart disease risk).
3. Choose one cup that will represent a grandfather. Place inside the cup 3 red pom poms
(3 “normal” genes that do NOT contribute to heart disease), as well as 1 orange, 1 green,
and 1 yellow pom pom (3 genes that increase heart disease risk).
4. On the pedigree, record the colors of pom poms present in both the grandmother and
grandfather by filling in the blank circles using crayons or colored pencils.
5. With closed eyes, mix and randomly draw out 3 pom poms from each grandparent (6
pom poms total). This will represent the genetic information inherited by their first child.
Remember: No peeking! This needs to be random.
Biology HSL
Department of Science
Page 314
Student
6. On the Pedigree, color in the combination of pom poms that were passed on to the child.
7. Return the pom poms to the appropriate grandparent. (Give grandma’s genes back to
grandma, and give grandpa’s genes back to grandpa.)
8. Repeat steps 5-7 for each son or daughter in the second row of the pedigree. Do not do
the son’s partner.
9. Diagnosis:
Look at each individual’s 6 heart disease susceptibility genes (their combination of
colored pom poms).
Remember: The forms or “flavors” of a gene that increase heart disease risk are
Label each individual in your pedigree as low, medium or high risk according to the chart
below.
Part 2:
1. Place in a cup 6 pom poms that are the colors you drew for the second son in row 2.
2. The partner of the second son is a “low risk” woman. Place inside a cup 5 red pom poms
and 1 yellow pom pom to represent her 6 heart disease susceptibility genes.
3. On the pedigree, color in the combination of pom poms (or genes) carried by the partner
of the second son.
4. The couple has children. With closed eyes, mix and randomly draw out 3 pom poms from
each parent (6 pom poms total). This will represent the genetic information inherited by
their first child.
5. On the pedigree, color in the combination of pom poms that were passed on to the child.
6. Return the pom poms to the appropriate parent.
7. Repeat steps 12-14 to determine the genetic make-up of the other two children
represented in the pedigree.
8. Label each individual that has been added to your pedigree as low, medium or high risk.
Biology HSL
Department of Science
Page 315
Student
Data/Observations: Fill in the tables below.
Student Pedigree
Analysis:
1. The grandfather in this family was a “high risk” individual. How many of his children were
either medium or high risk individuals? How many of his grandchildren were either
medium or high risk individuals?
2. Did the number of “medium risk” and “high risk” individuals decrease or increase over
subsequent generations? Why do you think that happened?
3. In this activity you were able to label family members as having a low, medium or high
risk of developing heart disease. In reality, do you think it might be difficult to predict an
individual’s risk of developing heart disease? Why?
Biology HSL
Department of Science
Page 316
Student
4. If a parent is diagnosed with heart disease, does that mean the children will have it also?
Defend your answer. (Your brief answer should include the key word “risk”.)
Conclusion:
Develop a written report that summarizes the results of this investigation. Use the
analysis questions as a guide in developing your report. Make sure to give possible
explanations for your findings by making connections to the NGSSS found at the
beginning of this lab hand-out. Also, mention any recommendations
Biology HSL
Department of Science
Page 317
Teacher
DNA Extraction Lab
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Purpose of Lab/Activity:
 To observe DNA in an organism.
 To compare and contrast the amount of DNA found in different individuals of a species.
Prerequisites:
 Students should have already been introduced to the structure of DNA including the
phosphate backbone, deoxyribose sugar location, and the nucleotides found within it
such as Adenine (A), Cytosine (C), Guanine (G) and Thymine (T).
 Students should know that all living organism contain DNA and DNA is contained within
the nucleus of the living organism.
 Students should have been introduced to chromosome number of different organism i.e.
haploid, diploid, and etc.
Materials (per group):
 Ziploc baggies
 blender
 Small (10 mL) graduated cylinders
 Beakers or cups for straining
 Cheesecloth
 Test tubes and containers or racks to
hold them




Wood
splints
or
disposable
inoculation loops
3 Bananas, 10-15 mushrooms, 2 big
clumps of seaweed or other algae, 5
chunks of liver, yeast
Extraction solution (10% shampoo
and a dash of salt)
Ice cold ethanol (70% pharmacy
ethanol will work)
Procedures: Day of Activity:
What the teacher will do:
a. Prepare the DNA extraction buffer. In a container add 900mL water, then
50mL dishwashing detergent (or 100mL shampoo), and finally 2 teaspoons
salt. Slowly invert the bottle to mix the extraction buffer.
b. Blend organisms separately and pour into individual 500 ml beakers for
student use
c. Be sure to clean the blender between each type of organism you are
Before
blending
activity:
d. Keep ethanol in refrigerator or ice bath the night before experiment.
e. Discuss where in the cell the DNA is contained in each sample’s cells.
f. Pre-Lab questions:
1. Do you think the DNA will look alike for each sample organism? Answers
may vary.
2. Where is DNA found? DNA is found in the nucleus of a cell of an
organism.
Biology HSL
Department of Science
Page 318
Teacher
During
activity:
After
activity:
What the teacher will do:
a. Ask students why an extraction buffer is needed. We will use an extraction
buffer containing salt, to break up protein chains that bind around the
nucleic acids, and dish soap to dissolve the lipid (fat) part of the strawberry
cell wall and nuclear membrane. This extraction buffer will help provide us
access to the DNA inside the cells.
b. Ask students what components of the cells are being filtered out with the
cheesecloth. Cheesecloth will filter out the larger cell parts like the cell wall
and nuclear membrane.
c. Be sure to make the ethanol VERY cold. If it is not, the amount of DNA
extracted will be less.
d. When the ethanol is poured SLOWLY into the solution, white thread-like
DNA strands should be observed.
What the teacher will do:
a. Have the students complete the following “Data Analysis (Calculations)”:
1. How is the appearance of your DNA similar or dissimilar to what you
have learned about DNA structure? Answers may vary.
2. A person cannot see a single strand of cotton thread from 30 meters
away, but if thousands of threads are wound together into a rope, the
rope can be seen at some distance. How is this statement an analogy to
the DNA extraction you did? DNA strands are very small and similar to a
single strand of thread. When DNA material is clumped together, it is
more visible than a single strand.
3. DNA dissolves in water but not in ethanol. Explain what happened when
the ethanol came in contact with the strawberry extract during the DNA
extraction. Because DNA is not soluble in ethanol, the DNA strands will
form a precipitate (clump together).
b. It is important that the students understand the steps in the extraction
procedure and why each step is necessary.
1. Filter strawberry slurry through cheesecloth: To separate components of
the cell
2. Mush strawberry with salty/soapy solution: To break up proteins and
dissolve cell membranes
3. Initial smashing and grinding of strawberry: To break open the cells
4. Addition of ethanol to filtered extract: To precipitate DNA from solution
c. Have the students summarize the significance of this experiment, use the
following questions as a guide:
1. What did the DNA look like? Relate what you know about the chemical
structure of DNA to what you observed today. Answers may vary. DNA
looks like thin white threads.
2. Why is it important for scientists to be able to remove DNA from an
organism? List two reasons. DNA can be used for study of genetic
diseases and in forensic science. DNA can be used in biotechnological
research.
3. Is there DNA in your food? How do you know? Yes, foods are either
plant or animal. Plants and animals are made up of cells, therefore
contains DNA.
Biology HSL
Department of Science
Page 319
Teacher
Extension:
 Gizmo: DNA Fingerprinting Analysis
 Discuss results and analysis questions with the class. Determine as a class what might
be the prevailing factor in the amount of DNA extracted. Design a simple experiment that
would test these factors.
Biology HSL
Department of Science
Page 320
Student
DNA Extraction Lab
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Background Information:
DNA is too small to see under a regular microscope, so how can it be studied? DNA is a large
molecule found in all living things; therefore it is possible to extract it from cells or tissues. All we
need to do is disrupt the cell’s plasma membrane and nuclear envelope, make the DNA clump
together and - voila! - DNA extraction is possible. DNA extractions from onion, bananas, liver, or
wheat germ are commonly used in laboratory investigations.
Plants used in agriculture and horticulture are often artificially selected for their large flowers and
fruits. Strawberries are no exception; wild strawberries are not as large as the ones you get in
the grocery store. Strawberries are octoploid, meaning that they have eight copies of each type
of chromosome. With eight sets of chromosomes, they have plenty of DNA for classroom
extraction.
Problem Statement: Do you think you have ever eaten DNA?
Safety:
 Handle breakable materials with care. Do not touch broken glassware.
 If you are allergic to certain plants, tell your teacher before doing activity in which plants
are involved. Wash your hands when you are finished with the activity.
 Flammable materials may be present. Make sure no flames, sparks, or exposed heat
sources are present.
Vocabulary: extraction, buffer, octaploid, chromosome, artificial selection
Materials (per group):
 Ziploc baggies
 blender
 Small (10 mL) graduated cylinders
 Beakers or cups for straining
 Cheesecloth
 Test tubes and containers or racks to
hold them




Wood splints or disposable inoculation
loops
3 Bananas, 10-15 mushrooms, 2 big
clumps of seaweed or other algae, 5
chunks of liver, yeast
Extraction solution (10% shampoo and
a dash of salt)
Ice cold ethanol (70% pharmacy
ethanol will work)
Procedures:
1. Smash several strawberries in a Ziploc baggie for 1 minute.
2. Add 10 mL extraction solution.
3. Smash solution/berry mix for an additional 1 minute.
4. Filter through cheesecloth.
5. Pour 2-3 mL of filtrate into a test tube.
6. Layer twice this volume (4-6 mL) with ice cold ethanol.
Biology HSL
Department of Science
Page 321
Student
7. Stir gently with inoculation loop and spool DNA as it clumps at the EtOH (ethanol)/filtrate
interface.
8. Compare the amount of your extracted DNA with other groups’ DNA.
Observations/Data: Draw and describe the DNA removed from the strawberries.
Data Analysis/Results:
1. How is the appearance of your DNA similar or dissimilar to what you have learned about
DNA structure?
2. A person cannot see a single strand of cotton thread from 30 meters away. But if
thousands of threads are wound together into a rope, the rope can be seen at some
distance. How is this statement an analogy to the DNA extraction you did?
3. DNA dissolves in water but not in ethanol. Explain what happened when the ethanol
came in contact with the strawberry extract during the DNA extraction.
Conclusions:
1. It is important that you understand the steps in the extraction procedure and why each
step was necessary. Each step in the procedure aided in isolating the DNA from other
cellular materials. Match the procedure with its function:
2. Match the procedure with the appropriate function
PROCEDURE
FUNCTION
A. Filter strawberry slurry through
___ To precipitate DNA from solution
cheesecloth
B. Mush strawberry with salty/soapy
___ Separate components of the cell
solution
C. Initial smashing and grinding of
___ Break open the cells
strawberry
D. Addition of ethanol to filtered
___ Break up proteins and dissolve
extract
cell membranes
3. What did the DNA look like? Relate what you know about the chemical structure of DNA
to what you observed today.
4. Why is it important for scientists to be able to remove DNA from an organism? List two
reasons.
5. Is there DNA in your food? ________ How do you know?
6. Compare the amount of DNA you extracted with the amounts other groups in your class
were able to extract. What may be the reasons for the differences in the amounts?
Discuss size, ripeness, lab method, etc.
Biology HSL
Department of Science
Page 322
Teacher
Candy DNA Replication
(Adapted from Flagler Schools: http://flaglerschools.com/media/documents/68684242-948b4ed9-a06d-152a70ed5aa8.pdf)
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Purpose of Lab/Activity:
 To describe the basic process of DNA replication and how it relates to the transmission
and conservation of the genetic information.
Prerequisites:
 How to describe the process of DNA replication and/or its role in the transmission and
conservation of genetic information.
 How to describe gene and chromosomal mutations in the DNA sequence.
 How gene and chromosomal mutations may or may not result in a phenotypic change.
Materials:
 Red licorice chunks (red and black) - 24 piece each color
 Gum drops or colored marshmallows (4 different colors) - 6 of each color
 Wooden toothpick halves – about 70
Procedures: Day of Activity:
What the teacher will do:
a. Obtain different candy pieces from a wholesale or dollar store. Make sure
the outside pieces for the DNA are two different colors and the “bases” are
four different colors.
Before
b. Provide wax paper in order to cover tables and protect the models. You
activity:
may also want to provide a base such as a paper plate or box top in order
to store the models.
c. Break the toothpick pieces in half so joints are seamless and materials are
not wasted.
What the teacher will do:
a. Ask questions of the students in relation to the importance of the structure
of DNA to hold genetic information.
b. As you move around the class, check the models as the students are
working on them to ensure correct placement and sequence in building the
model. Six complete nucleotides are to constructed first before the building
of the full DNA model. The idea is that this activity is modeling what is
During
occurring in the nucleus of a eukaryotic cell during mitosis. Student
activity:
misconceptions include a misunderstanding of where replication occurs and
hence, where DNA is located in an organism.
c. If necessary explain to the students that the paper or base they are using is
meant to represent the nucleus and they are modeling nucleotide synthesis
as well as DNA replication during Interphase of Mitosis or Meiosis in the
cell.
d. Students may also not be paying attention to the direction in which the
Biology HSL
Department of Science
Page 323
Teacher
After
activity:
complementary strand is going. Even though it is not assessed, an
understanding of how a complementary strand in DNA is oriented (5’, 3’
direction) should be reviewed.
e. Another student misconception and important factor in DNA replication is
the importance of enzymes in a DNA model in order to allow for its
unzipping in the replication process. Without these restriction enzymes,
replication would not occur. Have the students model the “cutting” of the
hydrogen bonds in their DNA model, using their restriction “enzymes”
(scissors).
f. Students also need to understand that these enzymes are actually proteins
in the body. When macromolecules are taught, restriction enzymes can be
applied to the content as an example of a protein.
g. Students should be drawing every stage of their modeling process into their
journals and label what is occurring at every point. Use these observations
for your assessments.
What the teacher will do:
a. Ensure the students clean up their models. You may choose to have them
store it with plastic wrap in order to use them on assessments or during
discussions.
b. Have the students complete the following “Data Analysis”:
1. What is the function of DNA? (to preserve genetic information in the cell)
2. Why is it so important that the order of base pairs stays the same? (to
ensure that the sequence of the genetic code stays the same and to
prevent mistakes from occurring in cell division)
3. What would happen if there was a change in the base pair sequence?
(Changes in the DNA sequence can cause a mutation in the individual
proteins of an organism causing problems such as cancer or
uncontrolled cell growth. These mutations can also become new
variations in a species if they are carried on.)
4. What special proteins make replication of DNA possible? (Enzymes
allow the unzipping of a DNA strand in order to allow it to be replicated.)
5. What is the difference between replication and duplication? (Replication
is a complimentary copy of the strand of DNA, filling one side to its
matching pairs. Duplication would mean exact copy of the original
bases)
6. At which stage of cell division (mitosis) does replication take place?
(During the Synthesis phase before Mitosis)
c. Discuss your results and your analysis questions with the rest of the class
in a whole group discussion. Determine as a class what might be the
prevailing factor in the amount of DNA extracted. Design a simple
experiment that would test these factors.
Extension:
 Gizmo: DNA Fingerprinting Analysis
Biology HSL
Department of Science
Page 324
Student
Candy DNA Replication
(Adapted from Flagler Schools: http://flaglerschools.com/media/documents/68684242-948b4ed9-a06d-152a70ed5aa8.pdf)
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Background Information: DNA or deoxyribonucleic acid is an organic compound called a
nucleic acid. The building blocks of nucleic acids are nucleotides. Nucleotides are made up of 3
parts: phosphate group, deoxyribose sugar, and a nitrogen base. The differences in DNA lie in
the different sequence of nitrogen bases. DNA is replicated during the Synthesis phase of
Interphase of Mitosis. It is a simple process involving the unwinding of the helix by an enzyme
called DNA helicase and adding complementary nitrogen bases by an enzyme called DNA
polymerase.
Objective:
 To describe the basic process of DNA replication and how it relates to the transmission
and conservation of the genetic information.
Safety:
Be sure that working surfaces and hands have been cleaned before starting this activity, if you
intend to consume your models after finishing.
Vocabulary: Nitrogen base, replication, nucleotides, deoxyribonucleic acid, phosphate group,
deoxyribose sugar, polymerase, complimentary strand
Materials:
 Red licorice chunks (red and black) - 24 piece each color
 Gum drops or colored marshmallows (4 different colors) - 6 of each color
 Wooden toothpick halves – about 70
Procedures:
1. Gather the supplies you need. The red licorice represent the phosphate backbone with
the part of the gummy representing the deoxyribose sugar. The gumdrops will represent
the different nitrogen bases. Choose any order you want, but remember to follow the
base- pairing rule
2. Assign one nitrogen base to each of the four colors of gum drops or marshmallows.
Adenine (A) =_________________
Thymine (T) =_________________
Cytosine (C) =_________________
Guanine (G) =_________________
3. What do the black Licorice represent?______________________________
4. What do the red Licorice represent?______________________________
5. What structure is formed from a red Licorice, a black Licorice and a gum drop (or
marshmallow)? _________________________________________________________
Biology HSL
Department of Science
Page 325
Student
6. Prepare six individual nucleotides: use toothpicks to connect one black to one red
Licorice piece. Then add one color candy piece perpendicularly to the black candy. Is this
a full DNA strand? Explain why or why not. ________________________________
7. Assemble nucleotides into a polynucleotide strand by connecting the red piece of one
nucleotide to the black of another. Continue until a strand of six nucleotides has been
constructed. DRAW THIS IN YOUR JOURNAL.
8. Which combinations of two bases form the complimentary base pair “rungs” of DNA?
____________________________________________________________
9. Assemble a strand that is complementary to the strand that you have already built. Place
the second strand next to the first so that the complimentary "bases" touch. DRAW THIS
STRUCTURE IN YOUR JOURNAL.
10. Have your teacher check your model and initial your journal.
11. You are now ready to REPLICATE!!!!
12. To demonstrate replication, first make 12 more nucleotides with the same nitrogen bases
as the first two strands.
13. "Unzip" the DNA double strand, one “rung” at a time.
14. Assemble the proper nucleotides, one by one. DRAW THIS NEW STRUCTURE ALONG
WITH THE “OLD” ONE
15. Once you have finished replicating, have your teacher check your model and initial your
journal ________________________.
16. After you demonstrate this to the teacher you may dispose of your models. This is one
case where you may eat your science project, if you have kept everything clean. Be sure
to remove toothpicks before you eat!!!
17. Clean up, being sure that no toothpicks or sticky residue is left behind. Wash your hands!
Observations/Data: Draw and describe the Nucleotides (step 7), the DNA strand (step 9), and
the unzipped DNA strand (steps 12-14).
Data Analysis/Conclusions:
1. What is the function of DNA?
2. Why is it so important that the order of base pairs stays the same?
3. What would happen if there was a change in the base pair sequence?
4. What special proteins make replication of DNA possible?
5. What is the difference between replication and duplication?
6. At which stage of cell division (mitosis) does replication take place?
Biology HSL
Department of Science
Page 326
Teacher
Making Protein Sense
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the transmission
and conservation of the genetic information. (AA)
SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic
change. Explain how mutations in gametes may result in phenotypic changes in offspring.
Purpose: To help students understand the role of DNA, mRNA, tRNA, and amino acids in the
process of protein synthesis. This activity can also be used to introduce the concept of mutations.
Introduction: Students will use the steps of transcription and translation to assemble a protein that
forms a sentence. Members of groups will use the handout to work through each step of the process.
Group sizes of 2 or 3 work best.
Nucleus: A table (or the floor) in the middle of the room which holds the DNA code cards.
1. There are 20 different single strands of DNA. Take a moment and code for the
complementary strand of the DNA you have.* (Lower proficiency students can use the one
that has the complementary strand already on it.) The bold stand represents the template
strand and is the one that will be used during transcription. None of the DNA cards can
leave the nucleus. Students will try to take them to their desks; emphasize why they must
transcribe them in the nucleus.
2. The first step is unzipping (un-Velcro) the double strand of DNA.
3. They must copy the bold DNA template onto the top strand in the nucleus on their handout.
This strand should be labeled “Template DNA”.
4. The students must transcribe the RNA code from the template stand of DNA onto the bottom
strand in the nucleus on their handout. This strand should be labeled “mRNA” and the process
should be labeled “Transcription.” This entire process should be done while in the area of the
nucleus, because DNA cannot leave the nucleus.
5. Tell them to record the number that is on the DNA card—it makes checking for accuracy easier
later.
Ribosome:
1. The student desks or tables are the ribosomes; this is where they will decode the mRNA
codons to know which tRNA they need to find the correct amino acids (words).
2. The mRNA molecule should be copied onto the ribosome at the bottom of the handout.
3. The dotted arrow represents the mRNA molecule leaving the nucleus and combining with a
ribosome.
4. Using the mRNA, they determine the correct anticodon for each on the tRNA’s above the
strand.
tRNA:
1. After they have identified the tRNA anticodons, anticodon cards are distributed around the
perimeter of the room. Each anticodon card has a word on the back.
2. When assembled in the correct order the sentence will read: “Start—sentence (some silly)—
Stop.”
3. If the anticodon cards are clustered with all those beginning with the same letter in the same
part of the room, students can find the cards quicker.
Biology HSL
Department of Science
Page 327
Teacher
Report Your Protein:
1. Student groups will read their sentence to the teacher. (It is easiest for you to check if they tell
you the number of the DNA card.)
2. If it is not correct, they have to go back and begin again to determine when their mutation
occurred.
WATCH OUT FOR MUTATIONS!!!
If students incorrectly transcribe the DNA or mRNA, then a mutation will occur and the sentence will
not make sense or not be complete.
Materials:
 20 DNA template cards
 64 Anticodon cards
 Students need diagram worksheet and pencil
Teacher Preparation:
 Print the DNA strands on cardstock. Cut the double strand into two pieces. Cut close to the
template DNA and leave room above the complementary strand of DNA as shown by the
dotted line on DNA strand 1.
 Once you have laminated the cards, place pieces of Velcro on the extra space on the
complementary strand. Position the other side of the Velcro on the template strand so that the
nitrogen bases of the two strands lay right next to each other.
 Make tRNA cards with words on back. Make sure the right words on are the back of each
anticodon card. They are made to be run front and back.
 Prepare copies on the handout.
Procedures: Day of Activity:
What the teacher will do:
a. Obtain different candy pieces from a wholesale or dollar store. Make sure
the outside pieces for the DNA are two different colors and the “bases” are
four different colors.
Before
b. Provide wax paper in order to cover tables and protect the models. You
activity:
may also want to provide a base such as a paper plate or box top in order
to store the models.
c. Break the toothpick pieces in half so joints are seamless and materials are
not wasted.
What the teacher will do:
a. Ask questions of the students in relation to the importance of the structure
of DNA to hold genetic information.
b. As you move around the class, check the models as the students are
working on them to ensure correct placement and sequence in building the
During
model. Six complete nucleotides are to constructed first before the building
activity:
of the full DNA model. The idea is that this activity is modeling what is
occurring in the nucleus of a eukaryotic cell during mitosis. Student
misconceptions include a misunderstanding of where replication occurs and
hence, where DNA is located in an organism.
c. If necessary explain to the students that the paper or base they are using is
meant to represent the nucleus and they are modeling nucleotide synthesis
Biology HSL
Department of Science
Page 328
Teacher
After
activity:
as well as DNA replication during Interphase of Mitosis or Meiosis in the
cell.
d. Students may also not be paying attention to the direction in which the
complementary strand is going. Even though it is not assessed, an
understanding of how a complementary strand in DNA is oriented (5’, 3’
direction) should be reviewed.
e. Another student misconception and important factor in DNA replication is
the importance of enzymes in a DNA model in order to allow for its
unzipping in the replication process. Without these restriction enzymes,
replication would not occur. Have the students model the “cutting” of the
hydrogen bonds in their DNA model, using their restriction “enzymes”
(scissors).
f. Students also need to understand that these enzymes are actually proteins
in the body. When macromolecules are taught, restriction enzymes can be
applied to the content as an example of a protein.
g. Students should be drawing every stage of their modeling process into their
journals and label what is occurring at every point. Use these observations
for your assessments.
What the teacher will do:
1. Ensure the students clean up their models. You may choose to have them
store it with plastic wrap in order to use them on assessments or during
discussions.
2. Have the students complete the following “Data Analysis”:
1. What is the function of DNA? (to preserve genetic information in the cell)
2. Why is it so important that the order of base pairs stays the same? (to
ensure that the sequence of the genetic code stays the same and to
prevent mistakes from occurring in cell division)
3. What would happen if there was a change in the base pair sequence?
(Changes in the DNA sequence can cause a mutation in the individual
proteins of an organism causing problems such as cancer or
uncontrolled cell growth. These mutations can also become new
variations in a species if they are carried on.)
4. What special proteins make replication of DNA possible? (Enzymes
allow the unzipping of a DNA strand in order to allow it to be replicated.)
5. What is the difference between replication and duplication? (Replication
is a complimentary copy of the strand of DNA, filling one side to its
matching pairs. Duplication would mean exact copy of the original
bases)
6. At which stage of cell division (mitosis) does replication take place?
(During the Synthesis phase before Mitosis)
3. Discuss your results and your analysis questions with the rest of the class
in a whole group discussion. Determine as a class what might be the
prevailing factor in the amount of DNA extracted. Design a simple
experiment that would test these factors.
Extension:
 Gizmo: DNA Fingerprinting Analysis
Biology HSL
Department of Science
Page 329
Teacher
DNA template cards:*
1. TAC AAA GTT AGA GAG TAG
11. TAC GCT CCG AGA GGA
ATC
GGC AGA GGG ATC
2. TAC ACA CAC AGG GAC AAC
TTA ATC
3.
TAC AGG TAA ACG GCG
CAA ATC
12. TAC AAA GAC ATT AGA TTC
ATC
13. TAC AAT GTG CAG TGC
ACT ATC
14. TAC TAA AGG GAA ATG
TAT TCA ATC
4. TAC ATA CTT CCG AGA AGC
ATC
5.
TAC CCA ACC GGT AGG
AGA AGC ATC
6. TAC CCC CCG AGA AGC CCT
ATC
15. TAC TAA TCC TCG TCT
CGG CGT ATC
16. TAC ATA GAT CTG CTT CCG
AGA AGC ATC
17. TAC CCC CCG GAA TGA
TGC ATC
7. TAC CGA CGC CGG CGT ATC
8. TAC CTA CTC ATA GAT CTG
CTT ATC
18. TAC TGG GTA TGT CGG
CGT ATC
9. TAC AAG CAG GTC CAT ATC
19. TAC TTA CCG AGA TTC TTG
TTT ATC
10. TAC CCC CCG GCA GCC
GCG ATC
20. TAC TTA TCC TCG TGG TTG
TTT ATC
Biology HSL
Department of Science
Page 330
Teacher
Anticodons and the words to write on the back of each one of the
cards that represent the tRNA on the wall (cytoplasm):
AUC = STOP
UAG = OUT
GGG = FUTURE
AUG= START
AUU = UP
GGU= COOKIES
CCG = IS
CAA = YET
GUA = A
CGC = WATER
CAC=JEANS/GENES
GUC = NEW
UAC = START
CAG = MAKE
GUG = MOVIES
CCU=SUBJECT
CAU = TRAITS
GUU = LET
CGG = EVERY
CCA=CHOCOLATE
UAA = WE
AAA = WHO
CCC = BIOLOGY
AUG = IN
CGA = DRINK
CUA = I
UAU = THIS
CGU = DAY
CUC = LOVE
UCA=TOGETHER
AAC = FROM
CUG = ROLL
UCC = MUST
AAG=MUTATIONS
CUU = MUSIC
UCG = BE
AAU = SAD
GAA = ALL
UCU=INFORMED
ACG = HAVING
GAC = MADE
UGA=AROUND
ACC = CHIP
GAG = DOGS
UGC = ME
ACU = CRY
GAU = AND
UGG = READ
ACA=DESIGNER
GCA = SO
UGU = LITTLE
AGA = THE
GCC = MUCH
UUA = DNA
AGG = ARE
GCG = FUN
UUC = CODE
AGU=BEATLES
GCU= EDUCATION
UUG = FOR
AGC = BEST
GGA = DOOR
UUU = LIFE
AUA = ROCK
GGC = TO
Biology HSL
Department of Science
Page 331
Teacher
20 Sentences (Answer Key):
1. Who let the dogs out?
2. Designer jeans genes are made from DNA.
3. Are we having fun yet?
4. Rock music is the best.
5. Chocolate chip cookies are the best!
6. Biology is the best subject.
7. Drink water every day.
8. I love rock and roll music.
9. Mutations make new traits.
10. Biology is so much fun.
11. Education is the door to the future.
12. Who made up the code?
13. Sad movies make me cry.
14. We are all in this together!
15. We must be informed every day.
16. Rock and roll music is the best!
17. Biology is all around me.
18. Read a little every day.
19. DNA is the code of life.
20. DNA must be read for life.
Biology HSL
Department of Science
Page 332
Teacher
EVALUATION:

Determine if students produce the right sentence for their sequence of DNA. If they do,
students have correctly transcribed the DNA into mRNA and translated the mRNA using
tRNA.
 Use the protein synthesis sequencing strips to assess students after the activity.
Distribute a set of strips to each student and allow them to put them in the correct order.
The correct sequence is:
RNA polymerase unzips the DNA.
RNA free nucleotides in the nucleus bond to the template strand of the DNA, forming mRNA.
mRNA leaves the nucleus and goes into the cytoplasm.
One mRNA codon enters the ribosome.
A tRNA picks up an amino acid.
The tRNA brings the amino acid to the ribosome, matching the anticodon to codon.
The tRNA drops off the amino acid and tRNA and mRNA leave the ribosome.
Amino acids stack up (attached by a peptide bond) until a stop codon is reached.
A polypeptide is formed.
The polypeptide folds.
The polypeptide combines with other polypeptides to make hemoglobin.
The hemoglobin is faulty because of an incorrect amino acid. Results in sickle cell anemia.
Biology HSL
Department of Science
Page 333
Teacher
Print these out, cut them into strips, and place them in plastic bags for the activity. Have the
students do them in groups.
RNA polymerase unzips the DNA.
RNA free nucleotides in the nucleus bond to the template strand of the DNA, forming mRNA.
mRNA leaves the nucleus and goes into the cytoplasm.
One mRNA codon enters the ribosome.
A tRNA picks up an amino acid.
The tRNA brings the amino acid to the ribosome, matching the anticodon to codon.
The tRNA drops off the amino acid and tRNA and mRNA leave the ribosome.
Amino acids stack up (attached by a peptide bond) until a stop codon is reached.
A polypeptide is formed.
The polypeptide folds.
The polypeptide combines with other polypeptides to make hemoglobin.
The hemoglobin is faulty because of an incorrect amino acid. Results in sickle cell anemia.
Biology HSL
Department of Science
Page 334
Teacher
DNA Card Templates (to be left on teacher desk or “nucleus”):
1. TAC AAA GTT AGA GAG TAG ATC
ATG TTT CAA TCT CTC ATC TAG
2. TAC ACA CAC AGG GAC AAC TTA ATC
ATG TGT GTG TCC CTG TTG AAT TAG
3. TAC AGG TAA ACG GCG CAA ATC
ATG TCC ATT TGC CGC GTT TAG
4. TAC ATA CTT CCG AGA AGC ATC
ATG TAT GAA GGC TCT TCG TAG
5. TAC CCA ACC GGT AGG AGA AGC ATC
ATG GGT TGG CCA TCC TCT TCG TAG
6. TAC CCC CCG AGA AGC CCT ATC
ATG GGG GGC TCT TCG GGA TAG
7. TAC CGA CGC CGG CGT ATC
ATG GCT GCG GCC GCA TAG
Biology HSL
Department of Science
Page 335
Teacher
8. TAC CTA CTC ATA GAT CTG CTT ATC
ATG GAT GAGTAT CTA GAC GAA TAG
9. TAC AAG CAG GTC CAT ATC
ATG TTC GTC CAG GTA TAG
10. TAC CCC CCG GCA GCC GCG ATC
ATG GGG GGC CGT CGG CGC TAG
11. TAC GCT CCG AGA GGA GGC AGA GGG ATC
ATG CGA GGC TCT CCT CCG TCT CCC TAG
12. TAC AAA GAC ATT AGA TTC ATC
ATG TTT CTG TAA TCT AAG TAG
13. TAC AAT GTG CAG TGC ACT ATC
ATG TTA CAC GTC ACG TGA TAG
14. TAC TAA AGG GAA ATG TAT TCA ATC
ATG ATT TCC CTT TAC ATA AGT TAG
Biology HSL
Department of Science
Page 336
Teacher
15. TAC TAA TCC TCG TCT CGG CGT ATC
ATG ATT AGGAGC AGA GCC GCA TAG
16. TAC ATA GAT CTG CTT CCG AGA AGC ATC
ATG TAT CTA GAC GAA GGCTCT TCG TAG
17. TAC CCC CCG GAA TGA TGC ATC
ATG GGG GGC CTT ACT ACG TAG
18. TAC TGG GTA TGT CGG CGT ATC
ATG ACC CAT ACA GCC GCA TAG
19. TAC TTA CCG AGA TTC TTG TTT ATC
ATG AAT GGC TCT AAG AAC AAATAG
20. TAC TTA TCC TCG TGG TTG TTT ATC
ATG AAT AGGAGC ACC AAC AAA TAG
Biology HSL
Department of Science
Page 337
Teacher
Building Macromolecules
NGSSS:
SC.A.912.L.18.1 Describe the basic molecular structures and primary functions of the four
major categories of biological macromolecules. (AA)
Purpose of Lab:
 Students will construct the basic components of organic molecular structure.
 Describe and illustrate different ways in which molecules are represented.
 Synthesize what occurs in a chemical reaction.
Prerequisites:
 Students should have a basic understanding of the four basic categories of
macromolecules and their roles and function in the body of an organism.
Materials (per group):
 Use different household or food items to represent the different elements
o Blueberries= Hydrogen
o Red Grapes= Oxygen
o Green grapes= Carbon
o Radish= Nitrogen
o Bonds= wooden toothpicks or dry spaghetti pieces
Procedure: Day of Activity:
What the teacher will do:
a. Prep work: Obtain all materials before beginning this lab activity.
b. Before passing out the fruit, have the students think about what
macromolecules are necessary for growth and energy in the body. .
c. Use the following questions to engage student thinking during a pre-lab
discussion:
Before
1. Do all macromolecules look the same?
activity:
2. Does their structure relate directly to their function in an organism?
d. What factors may affect the structure of these macromolecules? Assign
four students per group. For student reference, make copies of the “Lab
Roles and Their Descriptions.”
e. Review the types of molecules in the handout with the students.
f. Pass out the fruit and provide wax paper or paper plates to hold the
“molecules.”
What the teacher will do:
a. Circulate throughout the room and help any group that is having trouble
with any aspect of the procedure.
b. Monitor students for safety procedures, and keep students focused on their
During
hypothesis.
activity:
c. The following questions may be used to engage student thinking during the
lab activity:
1. What is the process that allows molecules to bond? Why does this
occur?
2. What is the function of the macromolecules in the body of an organism?
Biology HSL
Department of Science
Page 338
Teacher
After
activity:
3. Does the size of the different molecules affect its purpose or the amount
of energy needed to make it?
4. What do all the molecules have in common? What makes them different
from each other?
What the teacher will do:
Ask the following questions.
1. How many valence electrons does each carbon atom have? (4 electrons
or bonding sites)
2. What gives carbon the ability to form chains that are almost unlimited in
length? (The amount of bonding sites on each atom.)
3. Many of the molecules in living cells are so large they are called
___________________. (Macromolecules)
4. ______________________________ is the process that forms large
organic molecules. (Dehydration Synthesis)
5. When two or more _________________ join together, a polymer
forms.(Molecules)
6. Create a table in which you compare the components and functions of
the following macromolecules: carbohydrates, lipids, nucleic acids, and
proteins. (Answers will vary.)
Extension:
 Use this link to show the students the conceptual drawings of each of the different types
of macromolecules and review how the structure of each is different. (There is extra
information in the Powerpoint so focus on the four categories the students will be
responsible for.
http://teacher.cgs.k12.va.us/bwebster/Biology/Chapter%20PowerPoints/5%20Macromole
cules.pdf
Biology HSL
Department of Science
Page 339
Student
Building Macromolecules
NGSSS:
SC.A.912.L.18.1 Describe the basic molecular structures and primary functions of the four
major categories of biological macromolecules. (AA)
Background:
Biological macromolecules are defined as large molecules made up of smaller organic
molecules. There are four classes of macromolecules: carbohydrates, lipids, proteins, and
nucleic acids. The base elements of carbohydrates and lipids are Carbon (C), Hydrogen (H)
and Oxygen (O). Protein is also made up of these base elements but it also contains Nitrogen
(N). When viewing the chemical structures of carbohydrates, lipids and proteins you can
distinguish proteins from the other two by the presence of N in its chemical structure.
Each macromolecule is made up of smaller organic molecules. For carbohydrates and proteins
these smaller molecules are known as monomers. These similar or identical monomers are
covalently bonded together to create a large polymer molecule. The monomer unit for
carbohydrates is a monosaccharide or a simple sugar. When two of these monosaccharides
are linked by covalent bonds a disaccharide is created. When several monosaccharides are
bonded together a polysaccharide or complex sugar, is created. Polysaccharides are the
polymers of carbohydrates. Proteins are made up of monomers called amino acids. There are
twenty amino acids and they can be strung together in unique combinations known as
polypeptide chains, the polymer unit for proteins.
The exception to the monomer/polymer rule is lipids. Lipid base units are not considered
monomers. One type of lipid or fat is made up of fatty acids and glycerol molecules in a 3:1
ratio. The bonding of three fatty acids to one glycerol molecule creates a triglyceride.
Monomers, or base units are bonded together to create larger molecules via dehydration. This
involves the removal of a water molecule at the bonding site. The larger molecule can be broken
down by the reverse process, hydrolysis. This occurs when water is added to break the covalent
bonds created during dehydration.
Carbohydrates have the general molecular formula CH2O, and thus were once thought to
represent "hydrated carbon". However, the arrangement of atoms in carbohydrates has little to
do with water molecules.
Starch and cellulose are two common carbohydrates. Both are macromolecules with molecular
weights in the hundreds of thousands. Both are polymers (hence "polysaccharides"); that is,
each is built from repeating units, monomers, much as a chain is built from its links. The
monomers of both starch and cellulose are the same: units of the sugar glucose.
Objective:
 Students will construct the basic components of organic molecular structure.
 Students will recognize the way macromolecules are put together and discover how
smaller molecules are repeated to form polymers.
Vocabulary: Macromolecule, Monomer, Polymer, Carbohydrate, Monosaccharide,
Disaccharide, Proteins, Amino acids, Lipids, Nucleic acids
Biology HSL
Department of Science
Page 340
Student
Materials (per group):
 Use different household or food items to represent the different elements
o Blueberries= Hydrogen
o Red Grapes= Oxygen
o Green grapes= Carbon
o Radish= Nitrogen
o Bonds= wooden toothpicks or dry spaghetti pieces
Procedures:
1. Construct each of the following monomers and answer the questions using the
information in the explain portion. Each group will submit completed models as a group.
Include diagram of molecules as shown on this document.
2. Molecules are 3-dimensional so models cannot be flat! When constructing a functional
group (-OH, -COOH, -NH2) put bonds between all the elements!!
3. Create a key in your journal identifying which food represents which element. Refer to
this in building your models.
4. Draw all the molecules you create into your journal and answer the corresponding
questions for each completely.
Construct glucose
A. How many atoms of Carbon are there in Glucose? ___; Hydrogen? ____; Oxygen? ___
B. What is the chemical formula for glucose?
C. Glucose is a monomer for what macromolecule?
D. What other simple sugar(s) has the same chemical formula as glucose?
E. Simple sugars like glucose are called.
F. What is the function of carbohydrates for the body?
Biology HSL
Department of Science
Page 341
Student
Construct Glycine
A. Draw a BOX around the amino group on this picture.
B. Circle the carboxyl group on this picture.
C. Glycine is what type of monomer? (Two words)
D. Name the 4 things attached to the center carbon in ALL amino acids.
i.
ii.
iii.
iv.
E. How many amino acids exist?
F. What element is found in amino acid that isn’t found in simple sugars like glucose or
fructose?
G. Amino acids join together to make what type of macromolecule?
H. What are some of the functions of proteins in the body? (List several)
Biology HSL
Department of Science
Page 342
Student
Construct Glycerol
A. Place a CIRCLE around a hydroxyl group.
B. Glycerol is one of two molecules that make up a monomer known as
C. Besides glycerol, what 3 other molecules make up a triglyceride?
D. Glycerol and other organic compounds with an –ol ending are called
E. Triglycerides are the monomers for what type of macromolecule?
F. Give 3 types of lipids and give their function.
i.
ii.
iii.
Biology HSL
Department of Science
Page 343
Student
Construct a Fatty acid
A. Draw a BOX around the hydrocarbon chain in these pictures.
B. Circle the carboxyl group in both pictures.
C. Fatty acids are made of long chains of _______ atoms with attached ________ atoms.
D. How many bond(s) does each carbon atom have?
E. How many bond(s) does each hydrogen atom have?
F. What 3 elements make up fatty acids?
 ______________________________
 ______________________________
 ______________________________
Biology HSL
Department of Science
Page 344
Student
Construct Cytosine
A. Cytosine is an example of a nitrogen base found on ____________ acids.
B. Name the 2 nucleic acids found in organisms.
C. List the name for the elements making up cytosine.
D. Name the other 3 nitrogen bases found on DNA.
E. What nitrogen base is found on RNA but not DNA?
Biology HSL
Department of Science
Page 345
Student
Observations/Conclusions:
1. How many valence electrons does each carbon atom have?
2. What gives carbon the ability to form chains that are almost unlimited in length?
3. Many of the molecules in living cells are so large they are called ___________________
4. ______________________________ is the process that forms large organic molecules.
5. When two or more _________________ join together, a polymer forms.
6. Create a table in which you compare the components and functions of the following
macromolecules: carbohydrates, lipids, nucleic acids, and proteins.
Macromolecule
Components
Functions
Basic Structure and
Formula
Carbohydrates
Lipids
Nucleic acids
Proteins
7. What role does water play in the process of building macromolecules? Why is it such an
important component of life?
Biology HSL
Department of Science
Page 346
Student
Extension:

The Monomers of Macromolecules
All key components of every living cell are made of macromolecules. The four kinds of
macromolecules are lipids, carbohydrates, nucleic acids, and proteins. Most macromolecules
are polymers constructed of many organic molecules called monomers.
These molecules represent one level of basic building blocks of life. These monomers, or single
molecules, can be joined with other monomers to form larger units (polymers). They can be
divided into four groups:
1. carbohydrates (sugars for energy and structure)
2. lipids (fats for membranes and energy storage)
3. nucleic acids (information bearers)
4. proteins (the molecular machines of the cells).
Try to determine some ways of classifying these molecules below into four groups. There may
be more than one right answer. Number each molecule 1, 2, 3 or 4.
Biology HSL
Department of Science
Page 347
Student
Finally, what different kinds of atoms are present in these molecules? Write the initials of each
kind of atom here ____________________________________________________________.
Biology HSL
Department of Science
Page 348
Teacher
Factors Affecting Enzyme Activity
(Modified from ETO)
NGSSS:
SC.912.L.18.1 Describe the basic molecular structures and primary functions of the four major
categories of biological macromolecules. AA
SC.912.L.18.18 Explain the role of enzymes as catalyst that lower the activation energy of
biochemical reactions. Identify factors, such as pH and temperature, and their effect on enzyme
activity.
Purpose of Lab/Activity:
 To identify and describe the effect of environmental factors on enzyme activity.
Prerequisite: Prior to this activity, the student should know
 Genes are passed from parents to offspring and contribute to observable physical
characteristics.
 Pedigrees are used to track genetic information.
Materials (individual or per group):
 1 molar HCl solution (in dropper
bottle)
 1 molar NaOH solution (in dropper
bottle)
 6 Test tubes
 Test tube rack
 Measuring Pipette
 10-ml Graduated cylinder
 40 ml 3% Hydrogen peroxide
solution
 Scalpel









Scissors and Forceps (tweezers)
Stirring rod
Fresh liver
Apple
Potato
Test tube holders
Ice bath
Warm water bath
Boiling water bath
Procedures: Day of Activity:
What the teacher will do:
a. Prep work: Obtain all materials and prepare stock solutions well before
beginning this lab activity.
b. Before passing out the lab, have the students think about what processes in
the body use enzymes to function. Be sure to discuss as a class the vital
enzymes for human digestion such as protease, amylase, lipase, etc.
c. Use the following questions to engage student thinking during a pre-lab
Before
discussion:
activity:
1. What does catalyzed mean?
2. How does the induced-fit model apply to this lab activity?
3. What other factors can affect the rate of reaction?
4. What is meant by ―denaturation of the protein?
d. Assign four students per group. For student reference, make copies of the
―Lab Roles and Their Descriptions.
e. Review the background information with the students.
Biology HSL
Department of Science
Page 349
Teacher
During
activity:
After
activity:
f. Write the formula for hydrogen peroxide, H2O2, on the white board. Then
write the following equation for its decomposition: 2H2O2  2H2O + O2
g. Ask the following question. If hydrogen peroxide is a liquid, what might you
expect to see when it decomposes? (Accept all reasonable answers.)
Bubbles of gas will be visible as oxygen is released and water remains.
h. Explain to students that the function of the enzyme, catalase, is to speed up
the decomposition of hydrogen peroxide.
What the teacher will do:
a. Circulate throughout the room and help any group that is having trouble
with any aspect of the procedure.
b. Monitor students for safety procedures, and keep students focused on their
hypothesis.
c. Emphasize the following essential questions for each part of the
investigation:
Part A: What is a normal catalase reaction?
Part B: Is catalase reusable?
Part C: What is the effect of temperature on catalase activity?
Part D: What is the effect of pH on catalase activity?
Part E: What is the effect of substrate concentration on enzyme activity?
What the teacher will do:
a. Ask the following questions.
1. Was your hypothesis confirmed or refuted?
2. How do your results compare to your preconceptions of what would
happen?
3. What experimental conclusions can you now draw from your data?
b. Ask the following questions to connect the concepts of this activity to the
NGSSS.
1. Explain the role of activation energy in a reaction. How does an enzyme
affect activation energy?
2. Describe how a substrate interacts with an enzyme.
c. In a five-minute oral presentation, the students should share with the class
the results of their investigation. Here, they should state their hypothesis
and discuss whether their results confirm or refute their hypothesis. (Allow
for time to debate and discussion between groups.) Make sure all the
factors (concentration, pH, and temperature) that affect enzyme activity are
discussed.
d. Have students complete a formal lab report.
Extension:
 Gizmo: Collision Theory
Biology HSL
Office of Academics and Transformation
Page 350
Student
Factors Affecting Enzyme Activity
(Modified from ETO)
NGSSS:
SC.912.L.18.1 Describe the basic molecular structures and primary functions of the four major
categories of biological macromolecules. AA
SC.912.L.18.18 Explain the role of enzymes as catalyst that lower the activation energy of
biochemical reactions. Identify factors, such as pH and temperature, and their effect on enzyme
activity.
Background:
What would happen to your cells if they made a poisonous chemical? You might think that they
would die. In fact, your cells are always making poisonous chemicals. They do not die because
your cells use enzymes to break down these poisonous chemicals into harmless substances.
Enzymes are proteins that speed up the rate of reactions that would otherwise happen more
slowly. The enzyme is not altered by the reaction. You have hundreds of different enzymes in
each of your cells. All enzymes work best at an optimal temperature and pH. If an enzyme is
exposed to conditions outside this optimal range it can be become ineffective or destroyed
(denature).
Each of these enzymes is responsible for ONE specific reaction that occurs in the cell. Think of
a lock that accepts just one kind of key.
In this lab, you will study an enzyme that is found in the cells of many living tissues. The name
of the enzyme is catalase (KAT-uh-LAYSS); it speeds up a reaction which breaks down
hydrogen peroxide into water (H2O) and oxygen gas (O2). Hydrogen peroxide (H2O2) is a
poisonous byproduct of metabolism that can damage cells if it is not removed. The reaction is:
You will be using chicken or beef liver. It might seem strange to use dead cells to study the
function of enzymes. This is possible because when a cell dies, the enzymes remain intact and
active for several weeks, as long as the tissue is kept refrigerated.
Problem Statement:
 How will changes in concentration, pH, and temperature affect enzyme activity?
Vocabulary: chemical reaction, catalyst, enzyme, activation energy, ectothermic, denature, pH,
concentration, solute, solvent
Biology HSL
Office of Academics and Transformation
Page 351
Student
Materials:
 1 molar HCl solution (in dropper
bottle)
 1 molar NaOH solution (in dropper
bottle)
 6 Test tubes
 Test tube rack
 Measuring Pipette
 10-ml Graduated cylinder
 40 ml 3% Hydrogen peroxide solution
 Scalpel









Scissors and Forceps (tweezers)
Stirring rod
Fresh liver
Apple
Potato
Test tube holders
Ice bath
Warm water bath
Boiling water bath
Procedures:
Part A – What is a normal catalase reaction?
1. Place 5 ml of the 3% hydrogen peroxide (H2O2) solution into a clean test tube.
2. Using forceps and scissors cut a small piece of liver and add it to the test tube.
3. Push it into the hydrogen peroxide with a stirring rod. Observe the bubbles.
a. What gas is being released? ___________________
4. Throughout this investigation you will estimate the rate of the reaction (how rapidly the
solution bubbles) on a scale of 0-5. Assume that the reaction in step 3 proceeded at a
rate of "4" or “FAST”
REACTION RATE
0
no reaction
1
very slow
2
slow
3
medium
4
FAST
5
very fast
5. Recall that a reaction that absorbs heat is endothermic; a reaction that gives off heat is
exothermic. Now, feel the temperature of the test tube with your hand.
a. Has it gotten warmer or colder? ____________________
b. Is the reaction endothermic or exothermic? _____________________
Biology HSL
Office of Academics and Transformation
Page 352
Student
Part B – Is catalase reusable?
1. Pour off the liquid from Part A into a second test tube. Assuming the reaction is complete.
a. What is this liquid composed of? ____________________
b. What do you think would happen if you added more liver to this liquid?
____________________________________________________________________
____________________________________________________________________
2. Test this and record the reaction rate. Reaction Rate ___________ (1 – 5)
3. Add another 2 ml of hydrogen peroxide to the liver remaining in the first test tube.
a. What is the reaction rate? ________
4. Is catalase reusable? Explain how you know.
____________________________________________________________________
____________________________________________________________________
Part C – What is the effect of temperature on catalase activity?
Enzymes from different organisms tend to work best at different temperatures. The optimum
temperature in humans, for example, is about 98.6 °F, which is normal body temperature.
The optimum temperature in plants is about 77 °F. Enzymes are generally destroyed or
denature at temperatures above 122 °F.
1. Put a piece of liver into the bottom of a clean test
and cover it with a small amount of water.
tube
2. CAUTION: Use a test-tube holder for hot test tubes.
Place this test tube in a boiling water bath for
5 minutes.
a. What will boiling do to an enzyme?
____________________________________________________________________
____________________________________________________________________
3. Remove the test tube from the hot water bath, allow it to air cool, then pour out the water.
4. Add 2 ml of hydrogen peroxide.
a. What is the reaction rate for the boiled liver and peroxide? __________
Biology HSL
Office of Academics and Transformation
Page 353
Student
5. Put equal quantities of liver into 2 clean test tubes and 1 ml H2O2 into 2 other test tubes.
6. Put one test tube of liver and one of H2O2 into an ice bath.
7. Place the other set in a warm water bath (not boiling).
8. After 3 minutes, pour each tube of H2O2 into the corresponding tube of liver and observe
the reaction.
a. What is the reaction rate for the cold liver/peroxide? ______
b. What is the reaction rate for the warm liver/peroxide? ______
Part D – What is the effect of pH on catalase activity?
The pH of a solution describes how acidic or basic the solution is. Most enzymes function in
narrow pH ranges, which vary depending on the enzyme and its job. For most reactions, the
optimum pH is close to 7, which is neutral; that is, not acidic or basic. A few digestive
enzymes require an acidic environment, such as that found in the stomach, in order to
function. However, low (acidic) or high (basic) pH values tend to inhibit most enzyme activity.
1. Add 2 ml H2O2 to each of 5 clean test tubes.
a.
b.
c.
d.
e.
Tube 1 (strong acid) – add 4 drops of HCl
Tube 2 (weak acid) – add 1 drop of HCl and 3 mL of water)
Tube 3 (strong base) – add 4 drops of NaOH
Tube 4 (weak base) – add 1drop of NaOH and 3 mL of water
Tube 5 (neutral) – add 3 drops of distilled water
2. Now add liver to each of the test tubes (try to do it all at about the same time, so you can
easily compare)
3. Record the rate of reaction of each test tube on the table below.
Test Tube Contents
Strong acid
Weak acid
Strong base
Weak base
Neutral
Rate of Reaction
4. What is the optimal pH for catalase (estimate)? ______________________
Biology HSL
Office of Academics and Transformation
Page 354
Student
Part E – What is the effect of substrate concentration on enzyme activity?
The concentration of enzyme and substrate molecules also affects enzyme activity. Consider
a reaction for which the number of enzyme molecules is fixed. If there are more substrate
molecules than enzyme molecules, the reaction rate will rise until all the enzymes molecules
are attached to substrates. The reaction rate will then level off. The same is true if there are
more enzyme molecules than substrate molecules. Again, the reaction rate will rise and then
level off when all the substrate molecules are reacting.
1. Put equal quantities of liver into 5 clean test tubes.
2. Dilute the substrate (hydrogen peroxide) as described below. Each dilution should be
made in a separate, labeled beaker. Measure and record the depth of the hydrogen
peroxide.
a. 100% H2O2: 10 ml of H2O2
b. 80% H2O2: 8 ml of H2O2 + 2 ml distilled water
c. 50% H2O2: 5 ml of H2O2 + 5 ml distilled water
d. 20% H2O2: 2 ml of H2O2 + 8 ml distilled water
e. 0% H2O2 : 10 ml distilled water
3. Record the rate of reaction of each test tube on the table below.
Test Tube Contents
100% H2O2
80% H2O2
50% H2O2
20% H2O2
0% H2O2
Rate of Reaction
4. What is the optimal concentration for catalase (estimate)? _________________
Analysis:
1. What are enzymes? What are their roles in chemical reactions?
2. Why are enzymes considered biological catalysts?
3. Why are enzymes substrate specific?
4. What is the effect of substrate concentration on enzyme activity? How does enzyme
activity change as substrate concentration decreases? Explain your observations by
discussing this reaction on a molecular level.
5. How does temperature affect the activity of catalase? Explain your observations by
discussing the effect of temperature on protein structure. Discuss both high and low
temperature effects.
Biology HSL
Office of Academics and Transformation
Page 355
Student
6. How does pH affect the activity of catalase? Consider both high and low pH, and explain
your observations by discussing the effect of pH on protein structure.
7. The function of the liver is to break down fats and build certain proteins. Cirrhosis of the
liver is a disease which causes the liver to become thickened and “rubbery.” Hypothesize
how enzyme function in the liver would be affected in a person with cirrhosis.
8. Ectothermic organisms have body temperatures that vary with the temperature of their
surroundings. Discuss the effect this variation might have on the functioning of enzymes
in these organisms. Suggest some ways ectothermic organisms might cope with this
problem.
Conclusion:
Develop a written report that summarizes the results of this investigation. Use the
analysis questions as a guide in developing your report. Make sure to give possible
explanations for your findings by making connections to the NGSSS found at the
beginning of this lab hand-out. Also, mention any recommendations
Biology HSL
Office of Academics and Transformation
Page 356
Teacher
Classification – Fishing for Protists
(Adapted from: Biology Exploring Life. Prentice Hall)
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Purpose of Lab/Activity:
 The student will be able to observe different types of protists in aquatic ecosystems and
compare how those living near the surface of the water differ from those living near the
bottom.
 The student will be able to construct a dichotomous key using the protists studied.
Prerequisite:
 Students should be able to know the names of anatomical structures of protists.
 Students should be familiar with the classification system of organisms.
Materials (per group):
 Microscopes
 Microscope slides
 Protist identification key
 Protist cultures (Euglena, Paramecium, Amoeba, and Stentor).
Procedures: Day of Activity:
What the teacher will do:
a. Collect pond or canal water from your area and check for protists for use in
the lab. Make sure to include algae or other type of producer in the water in
order to keep the protists alive for a longer period of time.
b. Discuss the following essential questions:
Before
1. What kind of organisms do you think you will find in the water samples?
activity:
2. Predict features in protists that can be used to classify them.
3. Activate students’ prior knowledge of protists and engage their interest.
4. Show the students pictures of protists and prompt them to see if they
know: “How they are classified?”, “Where do we find them in our
environment?”
What the teacher will do:
a. Reinforce the expectations of the lab and review the directions.
1. Remind students to draw all other protists they see and write down their
observations on their structure and movement.
During
b. Review the following questions with the students.
activity:
1. What is the definition of a protist?
2. What specific features distinguishes them from each other?
3. What distinguishing characteristics allow them to be classified into their
own kingdom?
What the teacher will do:
After
a. Engage in class discussion use the following questions as a guide:
activity:
1. Compare the anatomy of the protists in both habitats. What are the
differences?
Biology HSL
Office of Academics and Transformation
Page 357
Teacher
2. Did the data support your hypothesis? Explain your response.
3. Did the protists share any characteristics?
4. How did habitat affect the type and characteristics of the protists that
live in the area?
5. Why is it necessary to construct dichotomous keys?
b. Construct a dichotomous key using four protists studied in the lab. What is
your reasoning for putting them in this order?
c. Closure Activity: Share results and discuss as a class your findings and
your dichotomous key
Extension:
 Repeat the lab activity with pond water from different water samples.
Biology HSL
Office of Academics and Transformation
Page 358
Student
Classification – Fishing for Protists
(Adapted from: Biology Exploring Life - Prentice Hall)
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Background:
The Kingdom Protista includes incredible diversity. Protists differ in shape, structures, and sizes,
but also in their habitats, motility, nutrition, and reproduction. Some protists are able to
photosynthesize and some are heterotrophs.
Purpose or Problem Statement: (Choose one or make up your own)
 Does environment determine the type of protist found?
 How does the presence of light affect the type of protists that inhabit an area?
 What protist characteristic affects its classification?
Safety: Wash hands after handling protists, microscope procedures
Vocabulary:
Protist, Euglena, Amoeba, Paramecium, Stentor, flagella, pseudopod, cilia, dichotomous key
Materials:
 Microscopes
 Microscope slides
 Protist identification key
 Protist cultures (Euglena, Paramecium, Amoeba, and Stentor).
Procedures:
1. Label one microscope slide “surface” and the other microscope slide “bottom.”
2. With a microscope, observe the “surface” slide under low, medium, and high power.
Make sure to move the slide around the stage to survey the entire area under the cover
slip.
3. Repeat step two with the “bottom” slide.
4. Describe and sketch the protists you observe on the slides. In your description, note
specific characteristics, such as method of locomotion (cilia, flagella, and pseudo pod),
color, shape, etc. Use a protist key to identify the different types of protists you observe.
5. Construct a dichotomous key of the protists observed using the characteristics noted.
Biology HSL
Office of Academics and Transformation
Page 359
Student
Observations/Data:
Surface Sample
Sketch
Description
Identification
Bottom Sample
Sketch
Description
Identification
Data Analysis/Results:
1. Compare the anatomy of the protists in both habitats
2. Construct a dichotomous key using four protists studied in the lab.
3. Did the data support your hypothesis? Explain your response.
4. Did the protists share any characteristics?
5. How did habitat affect the type and characteristics of the protists that live in the area?
6. Why is it necessary to construct dichotomous keys?
Biology HSL
Office of Academics and Transformation
Page 360
Teacher
Genetic Disorders: Informational Poster and Presentation
NGSSS:
SC.912.L.16.1 Use Mendel’s Laws of Segregation and Independent Assortment to analyze
patterns of inheritance. (AA)
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Purpose of Activity:
 To research the symptoms, causes, treatments, social ramifications, and support groups
of various genetic disorders.
 To provide students with a forum to discuss the significance of genetic factors,
environmental factors, and pathogenic agents to health from the perspectives of both
individual and public health.
 To provide an opportunity for students to analyze how heredity and family history can
impact personal health.
Prerequisite: Students should be familiar with Mendelian inheritance patterns. They should
know about chromosomes and the process of meiosis. Review meiosis before beginning this
activity. Students should be familiar with how to read and construct a pedigree. They should
also be familiar with such terms as single-gene defect, sex-linked disorders, and chromosomal
disorders.
Materials (per group):
 Construction paper
 Diagrams
 Drawings
 Glue




Markers
Pictures
Poster board
Stapler
Procedures: Day of Activity:
What the teacher will do:
a. Prep work: A week before the due date for the poster presentation, have
students read the entire activity and clarify any misunderstandings they
may have for the development of their Genetic Disorder Informational
Poster and Presentation. Remind students that information must be typed
and glued to a poster board. Emphasize that pictures, drawings and
diagrams are desired.
b. Some students may wish to use a “Power Point” presentation. If possible,
Before
the computer, LCD Projector, and/or overhead projector should be made
activity:
available for student use.
c. Review the causes of genetic disorders. The following questions can be
used to elicit students’ prior knowledge:
1. What is the relationship between trisomy 21 and Down syndrome.
Describe how nondisjunction can result in trisomy 21. A person with
trisomy 21 shows a set of symptoms called Down syndrome. If the pair
of chromosomes in chromosome 21 fails to separate during meiosis,
this could result in a gamete with an abnormal number of chromosome
21.
Biology HSL
Office of Academics and Transformation
Page 361
Teacher
During
activity:
After
activity:
2. List and define four types of damage to chromosome structure that can
cause disorders. Duplication occurs when part of a chromosome is
repeated; deletion occurs; deletion occurs when a fragment of a
chromosome is lost; inversion occurs when a fragment of a
chromosome reverses; translocation occurs when a fragment attaches
to a nonhomologous chromosome.
3. How is a mother’s age related to the probability of nonseparation of
chromosomes in her gametes? With an increase in the mother’s age,
there is an increase in the probability of nonseparation of chromosomes
(nondisjunction) during meiosis.
What the teacher will do:
After each poster presentation, the following questions should be asked in
order to engage student thinking during the activity:
1. How do you recognize someone with this particular disease?
2. What is/are the cause(s) of this disease?
3. What are the complications of this disease? Is the disease fatal?
4. What are the social ramifications for those afflicted with this particular
disease?
What the teacher will do:
Conduct a whole class discussion to assess student understanding and
connect concepts of this activity to the NGSSS. Ask the following questions to
guide your discussion:
1. What are examples of a recessive disorder, a dominant disorder, and a
sex-linked recessive disorder, and describe how each is inherited?
Recessive disorders such as albinism occur when a child inherits a
recessive allele from each parent. Dominant disorders such as
Huntington’s disease occur when a child receives at least one dominant
allele from a parent. A sex-linked recessive disorder such as
colorblindness occurs when a male inherits the allele on an X
chromosome from his mother or a female inherits the recessive allele
on both X chromosomes.
2. What does a genetic counselor do? A genetic counselor examines a
couple’s family histories for any disorders with Mendelian
characteristics; interprets genetic test results; helps couple determine
risk of passing on disease to offspring.
Extension:
 Genetic Disorder Library: http://learn.genetics.utah.edu/content/disorders/whataregd/
 Gizmo: Human Karyotyping
Biology HSL
Office of Academics and Transformation
Page 362
Student
Genetic Disorders: Informational Poster and Presentation
NGSSS:
SC.912.L.16.1 Use Mendel’s Laws of Segregation and Independent Assortment to analyze
patterns of inheritance. (AA)
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Background:
Genetic disorders are caused by abnormalities in genes or chromosomes. While some
diseases, such as cancer, are due in part to genetic disorders, they can also be caused by
environmental factors. Most disorders are quite rare and affect one person in every several
thousands or millions. In this activity, you will select a genetic disorder from a list and develop a
poster presentation.
Purpose of Activity:
 To research the symptoms, causes, treatments, social ramifications, and support groups
of various genetic disorders.
 To provide students with a forum to discuss the significance of genetic factors,
environmental factors, and pathogenic agents to health from the perspectives of both
individual and public health.
 To provide an opportunity for students to analyze how heredity and family history can
impact personal health.
Vocabulary: autosomal dominant, autosomal recessive, chromosomal defect, deletion,
inversion, karyotype, multifactorial, mutation, pedigree, polygenic, sex-linked disorder, singlegene defect, translocation, X-linked dominant, X-linked recessive, Y-linked
Materials (per group)
 Construction paper
 Diagrams
 Drawings
 Glue
Biology HSL
Office of Academics and Transformation




Markers
Pictures
Poster board
Stapler
Page 363
Student
Genetic Disorder: ___________________________________ Due Date: ________________
Procedures:
Information on your poster must be written in your own words and include the following:
1. The name of your disease. (Choose a genetic disorder from the next page.)
2. Phenotypic characteristic: How do you recognize someone with your disease?
3. Describe the genetics of the disease. For example:
a. What chromosome pair is affected?
b. Is it a result of translocation?
c. Is it sex-linked?
d. Does it skip a generation?
4. What are the causes of your disease? How does it occur? Is it preventable? How?
5. What are the symptoms and complications of your disease?
6. Is the disease fatal? When? What is the life expectancy of an individual with the
disorder?
7. What are current treatments for the disease? How effective are they?
8. What questions are researchers currently attempting to answer?
9. What are the social ramifications for those afflicted with the disease?
10. What are the support groups that exist for this disease? List at least one support
organization.
11. Bibliography must contain a minimum of four references, two of which must be from the
internet.
Information must be typed and glued to a poster board. Pictures, drawings and diagrams
increase your grade.
GRADING: The final grade will have a value of three grades and will be calculated based on the
following:
 Poster Content (60 points)
 Poster Presentation (40 points)
This form must be signed and turned in on the project due date.
I have read and understand the guidelines for the poster project assignment.
I understand that not turning in a poster will result in a zero grade. I also understand that
if I do not present, the maximum number of points I can receive is 60, which will result in
a D for the assignment. I also understand that the information on my poster board MUST
be in my own words and not copied directly from the source!
STUDENT SIGNATURE: _______________________________________________
PARENT/GUARDIAN SIGNATURE: ______________________________________
Biology HSL
Office of Academics and Transformation
Page 364
Student
Genetic Disorders
Choose a disorder from this list for your group’s project.
No two groups may choose the same topic.
Achondroplasia
Leukodystrophy
Achromatopsia
Marfan Syndrome
Adrenoleukodystrophy
Neurofibromatosis
Cri Du Chat Syndrome
Porphyria
Cystic Fibrosis
Prader-Willi Syndrome
Fragile X Syndrome
Progeria
Hemochomatosis
Sickle Cell Disease
Hemophilia
Tay - Sachs Disease
Huntington’s Disease
Trisomy X
Klinefelter Syndrome
Turner’s Syndrome
Krabbes Disease
Wilson’s Disease
Biology HSL
Office of Academics and Transformation
Page 365
Additional
Hands-on Activities
Teacher
Fun with Bubbles
NGSSS:
SC.912.N.1.1 Define a problem based on a specific body of knowledge, for example: biology,
chemistry, physics, and earth/space science, and do the following: 1) pose questions about the
natural world, 2) conduct systematic observations, 3) examine books and other sources of
information to see what is already known, 4) review what is known in light of empirical evidence,
5) plan investigations, 6) use tools to gather, analyze, and interpret data (this includes the use of
measurement in metric and other systems, and also the generation and interpretation of
graphical representations of data, including data tables and graphs), 7) pose answers,
explanations, or descriptions of events, 8) generate explanations that explicate or describe
natural phenomena (inferences), 9) use appropriate evidence and reasoning to justify these
explanations to others, 10) communicate results of scientific investigations and,11) evaluate the
merits of the explanations produced by others. (AA)
Purpose of the Lab/Activity:
 To distinguish between qualitative and quantitative data.
 Utilize tools of measurements and emphasize importance of using the metric system.
 Practice making observations and inferences.
 Develop the steps of the scientific method by writing hypothesis and gathering data.
 Apply the scientific method to determine which bubble solution produces the largest
bubble.
Prerequisites:
 Students should know laboratory safety rules and proper use of laboratory equipment.
 Students should be assigned their lab roles prior to the beginning of the activity.
 Students should know the steps of the scientific method.
Materials (per group):
 3 different kinds of clear dishwashing
liquids
 commercial bubble solution
 water
 glycerin




rulers
straws
plastic trash bags to cover tables
Four 50-ml beakers
Procedures: Day of Activity:
What the teacher will do:
a. Gather materials and make sure to cover lab tables with plastic trash bags.
(You may also want to complete this activity outdoors.)
b. You can modify this lesson by providing the materials to the students and
allowing them to develop their own controlled experiment. Procedural plan
Before
would have to be approved prior to experimentation.
activity:
c. It is important for students to complete an experimental design diagram
prior to the investigation in order for them to understand all parts of the
activity.
1. What is the problem statement? Which solution makes the biggest
bubbles?
Biology HSL
Department of Science
Page 367
Teacher
During
activity:
After
activity:
2. State the hypothesis. Answer will vary but should include both
independent and dependent variable. (Example: If Bubble Solution # 1
is used, the bubble diameter will be the largest.)
3. Identify the independent and dependent variable. Independent: type of
bubble solution (detergent), Dependent: bubble size (diameter)
4. Identify the variables held constant. amount of each solution, straw,
bubble surface
5. Explain the tests conducted, identify both the experimental and control
test.
Experimental Test: Detergent Bubble Solutions 1 – 3
Control Test: Commercial Bubble Solution
6. List the number of trials per test. 3 trials
d. Complete a KWL (what do you Know – what do you Want to know – what
did you Learn) in order to activate student’s prior knowledge.
e. Students’ misconceptions should be addressed.
Some common
misconceptions are: There is no universal scientific method. If a hypothesis
proven to be false the experiment has failed. Quantitative data and
qualitative data are the same. If two events occur repeatedly, one event
causes the other. Scientific-sounding studies in tabloid magazines are true.
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are following
proper lab protocol.
b. Review the experimental design diagram by asking individual students in
groups to explain the different parts of the experiment.
c. Follow laboratory procedural plan; making sure to model proper laboratory
safety and use of equipment.
d. Create class data table on board.
e. Emphasize importance of data collection by groups.
f. Ask the following questions:
1. Do you think the size and thickness of the straw affects the size of the
bubble? How and why?
2. Do you think that the size and gender of a person making the bubbles
affect the size of the bubble? How and why?
3. What about if a tries to blow the bubbles?
4. Is the size dependent on the person or the solution?
5. Would being a smoker affect the size of the bubble blown?
6. What is the effect, if any, of the material on the surface of the table, on
the size of the bubble?
What the teacher will do:
a. Have the students record their groups data (the average bubble diameter
by solution) and hypothesis on class data table.
b. Analyze class data; making sure to note the importance of multiple trials,
and repeatability in scientific investigations.
c. Have students graph the data of their experiment; have them use the
average bubble size diameter. (Mr. DRY MIX: the Dependent variable is
the Responding variable that in a graph is recorded on the Y-axis; the
Manipulated variable is the Independent variable and is graphed on the Xaxis.
Biology HSL
Department of Science
Page 368
Teacher
d. Answer Key for Results:
1. From the data collected, which bubble solution makes the biggest
bubbles? Commercial bubble solution should create the biggest bubble.
2. Compare the commercial bubble solution with the detergent solutions.
Was there a difference? Answers will vary. Students show include data
that explains the difference in bubble size between the 4 solutions
tested.
3. Predict the importance of adding glycerin to bubble solutions. The
Glycerin (or glycerol) improves the soap bubble mixture in two ways: It
increases the lifetime of the bubbles, and it makes the bubbles bigger.
Extension:
 Interactive Scientific Method Investigation:
http://sunshine.chpc.utah.edu/labs/scientific_method/sci_method_main.html
 GIZMO: Growing Plants
Biology HSL
Department of Science
Page 369
Student
Fun with Bubbles
NGSSS:
SC.912.N.1.1 Define a problem based on a specific body of knowledge, for example: biology,
chemistry, physics, and earth/space science, and do the following: 1) pose questions about the
natural world, 2) conduct systematic observations, 3) examine books and other sources of
information to see what is already known, 4) review what is known in light of empirical evidence,
5) plan investigations, 6) use tools to gather, analyze, and interpret data (this includes the use of
measurement in metric and other systems, and also the generation and interpretation of
graphical representations of data, including data tables and graphs), 7) pose answers,
explanations, or descriptions of events, 8) generate explanations that explicate or describe
natural phenomena (inferences), 9) use appropriate evidence and reasoning to justify these
explanations to others, 10) communicate results of scientific investigations and,11) evaluate the
merits of the explanations produced by others. (AA)
Background:
The scientific method is a process for experimentation that is used
to explore observations and answer questions. Scientists use the
scientific method to search for cause and effect relationships in
nature. In other words, they design an experiment so that changes
to one item cause something else to vary in a predictable way.
Your own curiosity is the starting point for exploring through
inquiry.
The questions that drive inquiry are based on
observations. Recorded observations are called data. Quantitative
data is measured on a numerical scale. Data also may be
qualitative, in the form of descriptions instead of measurements.
The basis of the scientific method is observing and gathering
background information, asking a question, forming an hypothesis
(or an educated guess about the answer to your question), and
then trying to come up with the answers by collecting and
analyzing data. Scientists use an experimental design diagram to
identify the essential components of an experiment.
Biology HSL
Department of Science
Page 370
Student
Problem Statement: Which solution makes the biggest bubbles?
Safety: Make sure that the bubble solution is poured on top of trash bags on the tables, report
any spills immediately to the teacher. Use napkins routinely to clean up your lab area.
Vocabulary: scientific method, hypothesis, independent variable, dependent variable, controlled
experiment, quantitative, qualitative
Materials (per group):
 3 different kinds of clear dishwashing
liquids
 commercial bubble solution
 water
 glycerin




rulers
straws
plastic trash bags to cover tables
Four 50-ml beakers
Procedures:
1. Mix three bubble solutions in separate beakers using the following proportions of liquids:
5 ml dishwashing liquid, 30 ml water, and 5 ml plain glycerin. Note: If you want to make
a lot of bubble solution, just use larger quantities of each ingredient, keeping them in the
1:6:1 proportion.
2. Put 40 ml of commercial bubble solution in a fourth beaker.
3. To test a solution, pour it onto the plastic trash bag on your table top, put your straw into
one of the small bubbles and blow more air into the bubble. Continue blowing air into the
bubble until it bursts.
4. Using centimeters, measure the diameter of each bubble print left behind on the trash
bag.
5. Repeat this procedure three times for each of the different solutions.
6. While you are doing this activity, make some observations about the colors and other
physical characteristics of the bubbles.
7. Record your group’s results on the data sheet.
8. Complete the class data table and write a conclusion for the activity.
Biology HSL
Department of Science
Page 371
Student
Observations/Data:
Diameter of
Bubble Solution
Detergent #1
(cm)
Diameter of
Bubble Solution
Detergent #2
(cm)
Diameter of
Bubble Solution
Detergent #3
(cm)
Diameter of
Bubble Solution
Commercial
(cm)
Trial #1
Trial #2
Trial #3
Average
You should also collect qualitative data such as observations about the colors and other
physical characteristics of the bubbles.
Data Analysis:
Create a bar graph using the data from the table above; make sure to label your axis(s) and
include the units of measurements.
Average Bubble Size Diameter by Solution
Biology HSL
Department of Science
Page 372
Student
Results:
1. From the data collected, which bubble solution makes the biggest bubbles?
2. Compare the commercial bubble solution with the detergent solutions. Was there a
difference?
3. Predict the importance of adding glycerin to bubble solutions.
Conclusion:
Write a lab report using the “Power Writing Model 2009”. Make sure to answer the following
questions:
 What was investigated?
 Was the hypothesis supported by the data?
 What were the major findings?
 How did your findings compare with other researchers?
 What possible explanations can you offer for your findings?
 What recommendations do you have for further study and for improving the experiment?
 What are some possible applications of the experiment?
Biology HSL
Department of Science
Page 373
Teacher
Study of Abiotic and Biotic Factors
NGSSS:
SC.912.L.17.5 Analyze how population size is determined by births, deaths, immigration,
emigration, and limiting factors (biotic and abiotic) that determine carrying capacity. (AA)
Purpose of the Lab/Activity:
 Identify organisms living in the soil, plants, insects, and any other animals living within the
site.
 Examine abiotic factors in the same study site.
 Compare abiotic and biotic factors in an ecosystem.
Prerequisites:
 Understand the role of photosynthesis in ecosystems.
 A general sense of the major groups of organisms in order to help determine their role
and habitat.
 Knowledge of weather instrumentation and soil analysis kits.
Materials (per group):
 4 stakes
 hammer
 measuring rope (10 m) marked in
meters
 soil pH test kit




thermometer
wind vane
anemometer
trowel or hand shovel
Procedures: Day of Activity:
What the teacher will do:
a. Select a study site. It does not have to be large (10 x 10 m) but it should
show some diversity of plants and have some animal life in the area. An
un-mowed corner of the campus, a section of trees behind the gym, or
even a vacant lot down the street can be used. Use a different 10 x 10 m
area for each lab group so that it is not so trampled. Also go over in
advance and check the area for anything that could harm the students or
make walking difficult.
b. Tell students that today we will be looking at the schoolyard as an
ecosystem. Go over expectations about gathering data and making
Before
observations in their assigned group.
activity:
c. Review expectations about working within their groups.
d. Assign groups and jobs within; there should be 11 groups (see procedural
plan for explanation). Tell students that the schoolyard ecosystem is
practice for gathering data and making observations of the ecosystem.
e. Student misconceptions should be addressed. Some common
misconceptions are: Ecology is just the study of pollution.
f. Complete a Quick Write (literacy strategy that is designed to give students
the opportunity to reflect on their learning) with the following scenario:
Have students think of their favorite outdoor spot. As they recall their
memory of that spot, have them list the living things that exist there. Have
them also describe important nonliving aspects of their experience.
Biology HSL
Department of Science
Page 374
Teacher
During
activity:
After
activity:
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are
examining their selected environment.
b. Assist groups with identification of species.
c. Emphasize importance of data collection by groups.
d. Ask the following questions:
1. What are abiotic factors? Identify at least three abiotic factors in your
ecosystem.
2. What are biotic factors? Identify at least three biotic factors in your
ecosystem.
3. Predict the role of abiotic factors on an ecosystem.
What the teacher will do:
a. Compile class data; making sure to note the importance of multiple trials,
and repeatability in scientific investigations.
b. Have students return to their Quick Write and identify the abiotic and
biotic factors.
c. Answer Key for Results/Conclusion:
1. Show the abundance and type of producers, consumers, herbivores,
carnivores, and decomposers in the food web. This may be
diagrammed. Answers will vary.
2. Using the information you have, construct an energy-flow diagram for
the area. Answers will vary. Remember arrows show the direction of
the energy flow.
3. What ecological relationships did you observe? Give specific
examples of each. Answers will vary according to the dynamics of the
ecosystem observed.
4. Describe the niche of one organism to the best of your ability.
Answers will vary. Niche is defined as the unique arrangement of an
organism defined by its habitat, food sources, time of day it is most
active, and other factors.
5. Can you see any relationship between the abundance of an organism,
its size and its place in the food chain? Explain.
Extension:
 Distribute a picture of an ecosystem and have students identify biotic and abiotic factors.
 Show video clip: Abiotic vs. Biotic
 Interactive Lab: How do organisms react to changes in abiotic factors?
 Gizmo: Pond Ecosystem
Biology HSL
Department of Science
Page 375
Student
Study of Abiotic and Biotic Factors
NGSSS:
SC.912.L.17.5 Analyze how population size is determined by births, deaths, immigration,
emigration, and limiting factors (biotic and abiotic) that determine carrying capacity. (AA)
Background:
An ecosystem can be divided into biotic and abiotic components. The community of the
organisms living in the area comprise of the biotic components of the ecosystem. The
community includes the organisms and actions such as mutualism and predation. And the
environment in which the organisms thrive is the abiotic ecosystem. The abiotic components
include the energy produced through the cycling of nutrients, the solar energy, and other nonliving components in the ecosystem. The abiotic components of the ecosystem can be
temperature, light, air current, etc.
Biotic components shape an ecosystem and are the living components in the organism’s
environment. In a grassland ecosystem, biotic components can be categorized as producers,
consumers, and decomposers. The producers capture the solar energy, use the nutrients
available, and produce energy. For example, grasses, trees, lichens, cyanobacteria, etc are
producers. Consumers do not have the ability to produce or capture energy on their own and
depend on the producers. They are the herbivores, carnivores, and omnivores. Decomposers
break down the organic layer providing nutrients for the producers. Insects, fungi, bacteria, etc.
are examples of decomposers. In the grassland ecosystem, soil is the important link between
the biotic and abiotic components.
Abiotic factors affect the living organisms in a community. In a barren ecosystem new organisms
start colonizing the ecosystem. They depend on the environmental components to thrive well in
the system. These environmental components which facilitate the thriving of the organisms are
the abiotic factors. It can be the soil, climate, water, energy, and anything helping the
sustenance of the organism. The abiotic components impact the evolution cycle.
In an ecosystem, if one factor is altered, it can impact the whole system. The availability of the
other resources in the system can be impacted as a whole. Human beings are capable of
altering the physical environment through development, construction, farming, and pollution. As
a result the abiotic components in the system change and affect the biotic organisms. Global
warming affects many organisms like plants and microbes. Acid rains have resulted in the
destruction of the fish population.
Problem Statement: What are the biotic and abiotic components of an ecosystem?
Safety: Do not touch poisonous plants or animals.
Vocabulary: ecosystem, environment, abiotic, biotic, temperature, pH, plant, insect, bird,
mammal, reptile, amphibian, soil, wind, anemometer, wind vane
Biology HSL
Department of Science
Page 376
Student
Materials (per group):
 4 stakes
 hammer
 measuring rope (10 m) marked in meters
 soil pH test kit
 thermometer
 wind vane
 anemometer
 trowel or hand shovel
Procedures:
1. Select a study site close by.
2. Groups will accomplish the following tasks: (the list gives the name of the group and the
procedure for that group)
a. Staking (3 students minimum). Using the measuring rope, mark a 10 m x 10 m
square. Mark the corners of the square and rectangles with stakes, and then connect
the stakes with string. At the end of the period rewind the string and take up the
stakes.
b. Trees (a plant with a stem more than 1 cm. in diameter): Count each type of tree in
the 10 m x 10 m square.
c. Shrubs (a plant with a stem greater that .5 cm. in diameter but less than 1 cm. in
diameter): Count each type of shrub in the 10 m x 10 m square.
d. Primitive plants (a plant with a stem less than 0.5 cm in diameter): and Herbs
(ferns, mosses, liverworts, etc.): Count each one in the 10 m x 10 m square.
e. Insects: Count and identify insects collected, then release them.
f. Birds: Count and identify any birds in the vicinity of the study site.
g. Mammals, reptiles and amphibians: Look for tracks, burrows, or other signs of
these animals in or near the 10 m x 10 m area. Identify animal or its sign. DO NOT
PICK UP ANY SNAKES.
h. Temperature: Take the air temperature at head, shoulder, waist, knee, and ground
level in the open, under a tree, and under a shrub.
i. Soil: Take soil samples at the same location as the soil and litter group. Follow
directions of the soil pH kit. Describe the color and texture of the soil.
j. Wind: On the first day, set out the rain gauge in the study site at a location that is not
sheltered by vegetation. Check each day for any rain. Read and record.
k. Description: Describe what the study site looks like. Try to paint a picture with words.
3. Each student is responsible for finding ecological relationships and identifying it within the
study area.
4. Return to classroom and share data. Some groups may need help with identifying their
samples.
Biology HSL
Department of Science
Page 377
Student
Observations/Data:
# Identified
(divided by type)
Description
(by type)
Abiotic or Biotic
Trees
Shrubs
Primitive Plants
Herbs
Insects
Birds
Mammals
Reptiles
Amphibians
Temperature
Soil
Wind
Biology HSL
Department of Science
Page 378
Student
Data Analysis:
Create a sketch of your ecosystem. Color code the abiotic and biotic components.
Sketch of School Yard Ecosystem
Results/Conclusion:
1. Show the abundance and type of producers, consumers, herbivores, carnivores, and
decomposers in the food web. This may be diagrammed.
2. Using the information you have, construct an energy-flow diagram for the area.
3. What ecological relationships did you observe? Give specific examples of each.
4. Describe the niche of one organism to the best of your ability.
5. Can you see any relationship between the abundance of an organism, its size and its
place in the food chain? Explain.
6. Write a paper describing all your results and conclusion of your observations.
Biology HSL
Department of Science
Page 379
Teacher
Stimuli Effects on Heart Rate: Sympathetic Stimuli and Coughing
NGSSS:
SC.912.L.14.36 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Purpose of Lab/Activity: The purpose of this lab is to observe how the heart rate changes
according to sympathetic (and parasympathetic) stimuli. The lab includes two separate stations,
each focusing on a different stimulus.
Prerequisite: Prior to this activity, the student should be able to:
 Determine the constant breathing rate and constant heart rate
 Determine the resting breathing rate and resting heart rate
 Know how to get consistent and realistic readings for heart rate
 know the function of the sympathetic nervous system and the parasympathetic nervous
system
 Relate the cough reflex to heart rate
Materials (per station or per group):
 CBL2 with TI 83 calculator
 ice water bath
 towel
 DataMate App
 Vernier Respiration Rate Monitor
 Vernier Hand-Grip Heart Rate Monitor or Vernier Exercise Heart Rate Monitor
 saline solution in dropper bottle for the exercise heart rate monitor
Procedures: Day of Activity:
What the teacher will do:
a. The teacher will have to gather all materials and should trouble shoot the
different heart rate monitors to determine if a constant and realistic heart
rate reading is observed.
b. The teacher will prepare 4 sets of stations, each set focusing on different
stimuli: (1) Sympathetic stimuli and (2) Coughing.
c. Engage students by eliciting prior knowledge and asking questions
pertinent for each station (e.g., How will the heart rate respond to different
sympathetic stimuli? How does coughing (a sympathetic stimulation) affect
Before
the heart rate?)
activity:
d. Review general procedures for using the respiration and heart rate
monitors. It is expected that all students be involved and participate during
the lab. This means that all students must take turns in running the heart
rate monitor or in being the patient who is being monitored. Students need
to know what parts of the body are affected by stimulation of the
sympathetic nervous versus stimulation from the parasympathetic nervous
system.
e. Students need to be sure to have consistent and realistic heart rates at the
beginning of each experiment.
Biology HSL
Department of Science
Page 380
Teacher
During
activity:
After
activity:
What the teacher will do:
a. Students should first be able to measure a base line reading for heart rate
that is realistic and not excessively fluctuating. Once the base line reading
has been established, the student can be directed to undergo the treatment
phase. After the treatment phase, the student can be directed to stand
quietly next to the lab station to begin the recovery phase.
b. As you walk around the room, question students on general concepts and
ideas. Examples:
1. What is the resting heart rate?
2. How a person’s vital sign can be an indicator about their health?
3. What are realistic base line values for vital signs?
4. What are some vital sign values that indicate if the person is in good
physical shape?
5. What are some vital sign values that indicate that the person’s vital
signs are showing a person in poor health?
c. As you walk around the room, question students on station specific
concepts and ideas. Examples:
Sympathetic Stimuli:
1. What are examples of sympathetic stimuli? Parasympathetic stimuli?
2. How can you properly simulate sympathetic stimuli? Parasympathetic
stimuli?
Coughing Stimuli:
1. What effect will not coughing (a sympathetic inhibition) have on heart
rate?
2. In what direction did your heart rate change in this experiment? Why?
3. According to the table in the Introduction, what are the possible
explanations for this change? (Relate to stimulation and inhibition of
sympathetic or parasympathetic nervous system).
What the teacher will do:
The teacher will propose the following questions:
1. In what direction did your heart rate change in this experiment during
the sympathetic experiment? What about the parasympathetic?
2. According to the table in the Introduction, what are the possible
explanations for this change?
3. There are medications that can selectively block the action of either
sympathetic or parasympathetic influences on the heart. How can such
medications be used to determine which of these systems is responsible
for a change in heart rate such as was seen in this experiment?
4. Compare the response and recovery times recorded in Table 2. List
possible survival advantages of the differences you see.
5. If the parasympathetic and sympathetic nerve supplies are severed
during heart transplantation and are not surgically repaired, explain if
the heart transplant recipient’s heart rate would change with coughing
(or with a severe fright)?
Extension:
 Gizmo: Human Homeostasis
Biology HSL
Department of Science
Page 381
Student
Stimuli Effects on Heart Rate: Sympathetic Stimuli and Coughing
(Adapted from Vernier Labs – www.Vernier.com )
NGSSS:
SC.912.L.14.36 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Background: Since the earliest days of medicine, heart rate has been recognized as a vital
sign (an indicator of health, disease, excitement, and stress). Medical personnel use heart rate
to provide clues as to the presence of many medical conditions. Reflex changes in heart rate
are one of the body’s most basic mechanisms for maintaining proper perfusion to the brain and
other tissues. Low blood volume caused by bleeding or dehydration results in the heart beating
faster as it attempts to maintain adequate blood pressure. Excitement, stress, and anxiety
activate the autonomic nervous system, which may also speed the heart rate and raise blood
pressure.
The autonomic nervous system consists of sympathetic and parasympathetic branches,
which have opposing effects on the circulatory and other organ systems. Sympathetic activation
raises blood pressure in addition to pulse. After an initial activation of the sympathetic nervous
system, the increase in blood pressure stretches nerve fibers in the baroreceptors (see Figure
1). This results in a reflex activation of the parasympathetic nervous system, which, through
actions opposite to those of the sympathetic nervous system, helps to restore homeostasis.
Figure 1
Involuntary coughing is the result of irritation of special sensory nerves in the respiratory tract.
This helps to clear potentially damaging substances from the lungs (water, foreign bodies, dust,
infection, mucous, etc.). Coughing can be more deleterious than helpful, causing discomfort,
preventing sleep, or leading, in some cases, to dizziness or loss of consciousness (known as
cough syncope).
The physiologic effects resulting from a cough are numerous. There is marked increase in
intrathoracic pressure just prior to expulsion of air. When blood pressure is normal, this leads to
Biology HSL
Department of Science
Page 382
Student
a decrease in venous return to the right side of the heart and a decrease in cardiac output. On
the other hand, a cough-induced increase in intrathoracic pressure may provide a form of
“internal cardiopulmonary resuscitation” in a heart attack victim whose blood pressure is falling
dangerously low. In this case, coughing can be as effective as the external chest compressions
of CPR in raising blood pressure and providing better blood circulation to vital tissues.
Coughing, and the resulting wide fluctuations in intrathoracic pressure it produces, causes reflex
stimulation of the autonomic nervous system. The sympathetic nervous system is an “activating
system,” preparing the body for a “flight or fight response” by increasing heart rate and blood
pressure. The parasympathetic nervous system acts through the vagus nerve to slow the heart
and to lower blood pressure. Both the sympathetic and parasympathetic systems may be
stimulated or inhibited by physiologic stimuli or medications.
The following table shows potential heart rate response to stimulation or inhibition of the
sympathetic or parasympathetic nervous systems:
Branch of Autonomic Nervous
System
Sympathetic
Parasympathetic
Heart Rate Response to Stimulation
Inhibition
↑
↓
↓
↑
Purpose or Problem Statement: In this experiment, you will observe how the heart responds
to two different stimuli: cold stimulus applied peripherally and coughing. In both cases, cold and
coughing will act as noxious stimuli, activating the “fight or flight” response through the
sympathetic nervous system. The purpose of this lab is to evaluate how sympathetic stimuli alter
the heart rate.
Safety: Do not attempt this experiment if physical exertion will aggravate a health problem.
Inform your instructor of any possible health problems that might be exacerbated if you
participate in this exercise. Do not attempt this experiment if you suffer from asthma or any
condition that may be aggravated by repeated coughing.
Vocabulary: baroreceptors, sympathetic nervous system, parasympathetic nervous system,
resting heart rate, maximum heart rate, homeostatic mechanisms, blood pressure, heart rate,
stroke volume, intrathoracic pressure
Materials (individual or per group):
 CBL2 with TI 83 calculator
 ice water bath
 towel
 DataMate App
 Vernier Respiration Rate Monitor
 Vernier Hand-Grip Heart Rate Monitor or Vernier Exercise Heart Rate Monitor
 saline solution in dropper bottle for the exercise heart rate monitor
Biology HSL
Department of Science
Page 383
Student
Procedures:
1. Select a station to test the stimuli effects on the heart rate. Identify among the group
members who will be the test subject(s) and who will collect data. Make sure to switch
places when changing stations. Test subject(s) must prepare to submerge one foot in the
ice water bath by removing the shoe and sock.
a. Position the foot adjacent to the ice water bath and be ready to submerge it.
2. Connect the receiver module of the Heart Rate Monitor to CBL2, channel 1, and from the
Apps menu choose DataMate.
3. Once you have entered the program, choose change time settings then press enter.
Change the interval between samples to 5 seconds, and change the number of samples
to 30. The duration of the experiment is 150 seconds. Then, select OK.
4. Set up the Heart Rate Monitor. Follow the directions for your type of Heart Rate Monitor.
a. Depending upon your size, select a small or large size elastic strap. Secure one of the
plastic ends of the elastic strap to the transmitter belt. It is important that the strap
provide a snug fit of the transmitter belt.
b. Wet each of the electrodes (the two textured oval areas on the underside of the
transmitter belt) with 3 drops of saline solution.
c. Secure the transmitter belt against the skin directly over the base of the rib cage (see
Figure 2). The POLAR logo on the front of the belt should be centered. Adjust the
elastic strap to ensure a tight fit.
d. Take the receiver module of the Heart Rate Monitor in your right hand. Remember
that the receiver must be within 80 cm of the transmitter in the Heart Rate Monitor
belt.
e. Stand quietly facing your table or work bench within the reception range of the
receiver module.
Figure 2
5. Set up the Hand-Grip Heart Rate Monitor: The receiver and one of the handles are
marked with a white alignment arrow as shown in Figure 3. Locate these two arrows.
a. Have the subject grasp the handles of the Hand-Grip Heart Rate Monitor so that their
fingers are in the reference areas indicated in Figure 3. Hold the handles vertically.
b. Have someone else hold the receiver near the handles so that the two alignment
arrows are pointing in the same direction and are at approximately the same height as
shown in Figure 3. Note: The receiver must stay within 60 cm of the handles during
data collection.
Biology HSL
Department of Science
Page 384
Student
Figure 3
Sympathetic Stimuli (Cold water)
6. To determine that everything is set up correctly, click Collect to begin monitoring heart
rate. Note that there may be up to a 30 second delay before data are seen. The readings
should be within the normal range of the individual, usually between 55 and 80 beats per
minute. Click Stop when you have determined that the equipment is operating properly,
and proceed to the next step.
7. Collect data to observe the effect of submerging your foot in an ice water bath. Note:
Read over this step prior to beginning data collection to familiarize yourself with the
process.
a. Click Collect. If the baseline is not stable, repeat Steps 6. If the baseline is stable,
plunge your foot into the ice water bath at 40 s.
b. Remove your foot from the ice water bath 30 s after immersion (when data have been
collected for 70 s) and rest it on the towel.
c. Remain seated and allow data collection to continue for the full 240 s data-collection
period.
8. Click and drag over the area of the graph where the resting (“baseline”) heart rate is
displayed. Click the Statistics button. The Statistics box will appear with the statistics
calculated for the selected region. Record the mean resting heart rate, to the nearest
whole number, in Table 1.
9. Move the Statistics brackets to highlight the total time of data collection. The values in the
statistics box will be recalculated to reflect this change. Record the maximum and
minimum heart rates, to the nearest whole numbers, and the corresponding times at
which these rates are graphed, in Table 1.
10. Move the statistics brackets to highlight the region of the graph beginning at 40 s (when
the foot was immersed in the ice water bath) and ending at the first peak (see Figure 4).
Record the maximum heart rate value in Table 1. In the corresponding Time column
record (to the nearest whole number) the Δx value displayed at the lower left corner of
the graph.
11. Move the Statistics brackets to enclose the region of the graph beginning at the first peak
and ending at the lowest point in the valley that follows (see Figure 5). Record the
minimum heart rate value as the Rebound heart rate in Table 1. Record the Δx value in
the corresponding Time column.
Biology HSL
Department of Science
Page 385
Student
Figure 4
Figure 5
Coughing:
12. Click Collect to begin data collection. There will be a 15 s delay while data are collected
before the first point is plotted on the upper graph. Thereafter, a point will be plotted
every 5 s. Obtain approximately 45 s of graphed data as a baseline heart rate.
13. Begin data collection by pressing start.
a. At approximately 60 s, begin to cough continuously (every 1–3 s). The heart rate will
change in response to the coughing. When the heart rate levels off for at least 15 s (or
reverses direction), stop coughing. Data will be collected for at least 200 s.
14. Determine the baseline heart rate.
a. Tap and drag over the area of the graph where the baseline heart rate is displayed to
select the data.
b. Choose Statistics from the Analyze menu.
c. Record the mean baseline heart rate, to the nearest whole number, in Table 2.
d. Choose Statistics from the Analyze menu to turn off statistics.
15. Determine the maximum heart rate.
a. Tap and drag over the region where the heart rate levels off.
b. Choose Statistics from the Analyze menu.
c. Record the mean heart rate to the nearest whole number as the Maximum heart rate
in Table 2.
d. Choose Statistics from the Analyze menu to turn off statistics.
16. Determine the difference between the Maximum heart rate and the Baseline heart rate
and record this value in Table 2.
17. Determine the time between the onset of coughing and the beginning of the plateau.
a. Tap the data point at approximately 60 s that represents the time at the onset of
coughing and note the time component of this point.
b. Tap the point at the beginning of the plateau and note the time component of this
point.
18. Determine the difference between the two time values and record this value as the
response time in Table 2.
19. Determine the recovery time.
a. Tap the last data point on the plateau and note the time component of this point.
Biology HSL
Department of Science
Page 386
Student
b. Tap the point at which the heart rate returns to baseline and note the time component
of this point. Note: If the baseline heart rate is not achieved before the end of the
experiment, tap the last data point recorded.
20. Determine the difference between the two time values and record this value as the
recovery time in Table 2.
Observations/Data:
Table 1 – Sympathetic Stimuli (Cold Water)
Condition
Heart Rate (bpm)
Time (s)
Resting heart rate
Maximum heart rate
Recovery time
Baseline heart
rate (bpm)
Table 2 – Coughing Data
∆Heart rate
Maximum heart
(Max–baseline)
rate (bpm)
(bpm)
Response
time (s)
Recovery
time (s)
Data Analysis/Results:
Sympathetic Stimuli (Cold Water):
1. How long after immersion did your heart rate reach its maximum value? Explain the
physiologic mechanism that led to this change in heart rate.
2. Describe the changes in heart rate that occurred after the maximum value. How can you
explain the minimum heart rate value? How would you explain the heart rate variations
seen in the remainder of the experiment?
3. How long after the maximum heart rate did it take to arrive at your rebound heart rate?
What can you say about the relative speed of physiologic response to a stimulus vs. the
speed of mechanisms that are designed to maintain homeostasis?
4. If the heart rate is too slow there is inadequate blood pressure to maintain perfusion to
the brain. This can lead to loss of consciousness (fainting). Keeping in mind the
autonomic nervous system responses that you observed in this experiment, explain the
sequence of events that results in a severely frightened person fainting.
Coughing:
1. In what direction did your heart rate change in this experiment? According to the table in
the Introduction, what are the possible explanations for this change?
2. There are medications that can selectively block the action of either sympathetic or
parasympathetic influences on the heart. How could such medications be used to
determine which of these systems is responsible for a change in heart rate such as was
seen in this experiment?
3. Compare the response and recovery times recorded in Table 2. List possible survival
advantages of the differences you see.
Biology HSL
Department of Science
Page 387
Student
4. The parasympathetic and sympathetic nerve supplies are severed during heart
transplantation and are not surgically repaired. Would a heart transplant recipient’s heart
rate change with coughing (or with a severe fright)?
5. You are in a remote location and a member of your party complains of chest pain and
dizziness. You find that his pulse is 35 bpm. You immediately call 911 and are told that it
will take 15 minutes for the helicopter to arrive. You know that CPR should not be
performed on conscious individuals. Drawing from the knowledge you have gained from
this experiment, what might be done to improve your patient’s pulse and blood pressure?
Conclusion: Write a report following the directions delineated by “Parts of a Lab Report” or
“Power Writing Model 2009”.
Biology HSL
Department of Science
Page 388
Teacher
Stimuli Effects on Heart Rate: Exercise and Baroreceptor Stimuli
NGSSS:
SC.912.L.14.36 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Purpose of Lab/Activity: The purpose of this lab is to observe how the heart rate changes
according to exercise and baroreceptor stimuli. The lab includes two separate stations, each
focusing on a different stimulus.
Prerequisite: Prior to this activity, the student should be able to:
 Determine the constant breathing rate
 Determine the constant heart rate
 Determine the resting breathing rate
 Determine the resting heart rate
 Know how to get consistent and realistic readings for heart rate
Materials (per station or per group):
 CBL2 with TI 83 calculator
 DataMate App
 Vernier Respiration Rate Monitor
 Vernier Hand-Grip Heart Rate Monitor or Vernier Exercise Heart Rate Monitor
 saline solution in dropper bottle for the exercise heart rate monitor
Procedures: Day of Activity:
What the teacher will do:
a. The teacher will have to gather all materials and should trouble shoot the
different heart rate monitors to determine if a constant and realistic heart
rate reading is observed.
b. The teacher will prepare 4 sets of stations, each set focusing on different
stimuli: (1) Exercise, and (2) Baroreceptor stimuli.
c. Engage students by eliciting prior knowledge and asking questions
pertinent for each station:
1. What effect does exercising have on the heart rate?
2. How does the heart rate change as a person stands up starting from a
Before
squatting position? (This motion produces a sudden increase in the
activity:
amount of blood circulation, how does this change affect the heart rate?)
d. Review general procedures for using the respiration and heart rate
monitors. It is expected that all students be involved and participate during
the lab. This means that all students must take turns in running the heart
rate monitor or in being the patient who is being monitored. Students need
to know what parts of the body are affected by stimulation of the
sympathetic nervous versus stimulation from the parasympathetic nervous
system.
e. As you start the lab, students need to be sure to have consistent and
realistic heart rates at the beginning of each experiment. Make sure that
students correctly gather and record their data.
Biology HSL
Department of Science
Page 389
Teacher
During
activity:
After
activity:
What the teacher will do:
a. Once the base line reading has been established, the student can be
directed to undergo the treatment phase. Treatment consists of performing
specific exercise as determined by the procedures. After the exercise
phase, the student can be directed to stand quietly next to the lab station to
begin the recovery phase.
b. As you walk around the room, question students on general concepts and
ideas. Examples:
1. What is the resting heart rate?
2. How a person’s vital sign can be an indicator about their health?
3. What are realistic base line values for vital signs?
4. What are some vital sign values that indicate if the person is in good
physical shape?
5. What are some vital sign values that indicate that the person’s vital
signs are showing a person in poor health?
c. As you walk around the room, question students on station specific
concepts and ideas. Examples:
Exercise Stimuli:
1. What are some of the reasons that the heart rate changes with increase
exercise?
2. Does the level of physical fitness have an effect on how quickly a
person’s heart rate recovers after exercise?
3. Describe what is changing within the muscles as you exercise.
4. What organs, besides the heart have increased use during exercise?
5. Do you expect to have an upper limit on increasing heart rate as you
exercise? Why/why not?
Baroreceptor Stimuli:
1. How much and in which direction (increase or decrease) did the heart
rate change as a result of standing? Squatting?
What the teacher will do:
a. The teacher will propose the following questions:
Exercise:
1. Normal resting heart rates range from 55−100 beats per minute. What
was the subject’s resting heart rate? How much did the subject’s heart
rate increase above resting rate with exercise? What percent increase
was this?
2. How does the subject’s maximum heart rate compare with other
students in the group or class? Is this what you expected?
3. Recovery time has been shown to correlate with degree of physical
fitness. How does the subject’s recovery rate compare to that of your
classmates? Is this what you expected?
4. Congestive heart failure is a condition in which the strength of
contraction with each beat may be significantly reduced. For example,
the ventricle may pump only half the usual volume of blood with each
beat. Would you expect a person with congestive heart failure to have a
faster or slower heart rate at rest? With exercise?
Baroreceptor:
1. Changing the heart rate is only one of a variety of homeostatic
Biology HSL
Department of Science
Page 390
Teacher
mechanisms that maintain a fairly constant blood pressure during
changes in body position. The sympathetic nervous system helps by
adjusting peripheral resistance in the arterial system. As this occurs the
heart rate is able to normalize again.
2. Compare the duration of the initial direction of heart rate change after
standing to the recovery time.
3. What does your data tell you about the relative speed of the change in
peripheral vascular resistance as compared to that of the heart rate
response? Dizziness may result from low blood pressure and can occur
in patients who take medicines which impair the ability of the heart to
increase its rate.
4. Given what you have learned from your data, which daily activities
would be most likely to cause dizziness in people who take these
medications?
Extension:
 Gizmo: Human Homeostasis
Biology HSL
Department of Science
Page 391
Student
Stimuli Effects on Heart Rate: Exercise and Baroreceptor Stimuli
(Adapted from Vernier Labs – www.Vernier.com )
NGSSS:
SC.912.L.14.36 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Background: One of the homeostatic mechanisms of the human body serves to maintain a
fairly constant blood pressure. Major determinants of blood pressure are heart rate, amount of
blood pumped with each beat (stroke volume), and the resistance of the arterial system which is
receiving the blood. The heart rate is influenced by baroreceptors, special sensors in tissues in
the aortic arch and carotid arteries which contain nerve endings that respond to stretching (see
Figure 1). An increase or decrease in stretch sends signals to the medulla in the brain which in
turn acts on the heart through the vagus nerve, completing what is called a feedback loop.
Sudden increase in pressure in the heart or carotid arteries causes an increase in stretch of the
baroreceptor sensors and results in a decrease in heart rate. Sudden lowering of pressure
causes the opposite effect. This feedback loop enables us to function in a gravity environment.
Figure 1
Most people have experienced the sensation of dizziness after standing abruptly from a seated
or squatting position. This effect can be seen in healthy individuals, but it is accentuated in the
elderly and in certain conditions including dehydration and Parkinson’s disease. In these cases,
the increase in heart rate may be significant but is still not able to make up for an insufficiency of
the other two contributors to blood pressure (i.e., low blood volume or poor regulation of the
resistance of the arterial system by the sympathetic nervous system). One of the first tests
performed by doctors on patients who complain of dizziness is to check the blood pressure and
pulse with the patient lying down and then standing. A drop in blood pressure of 20 points or an
increase in heart rate of 20 points with standing is considered significant. This condition is called
orthostatic hypotension.
The adaptability of the heart can be observed during exercise, when the metabolic activity of
muscle tissue increases. The cardiovascular system, consisting of the heart and blood vessels,
Biology HSL
Department of Science
Page 392
Student
responds to exercise with an increase in heart rate and strength of contraction with each beat,
resulting in a higher cardiac output (quantity of blood pumped through the heart per unit of time).
Physically fit people can deliver a greater volume of blood in a single heartbeat than unfit
individuals and can sustain a greater work level before reaching a maximum heart rate. Being
more physically fit also leads to a more rapid recovery of resting heart rate.
In this experiment, you will observe heart rate response to squatting and to standing from a
squatting position. In the former, there is a rapid increase in venous return to the heart as veins
in the leg muscles are compressed. This causes a sudden increase in stroke volume and
pressure sensed by the baroreceptors. In standing from a squatting position, there is a sudden
reduction in venous return to the heart because of “pooling” of blood in the legs. This results in a
decrease in stroke volume and pressure.
Purpose or Problem Statement: This lab measures how the number of heart beats changes
with increased exercise. The lab is important because heart rate is influenced by the autonomic
nervous system, which, in turn, responds to environmental cues. In this experiment, you will
observe how the heart responds to the increased metabolic demand of muscles during exercise
and will evaluate how the heart rate is influenced by baroreceptors, special sensors in tissues in
the aortic arch and carotid arteries which contain nerve endings that respond to stretching of the
blood vessels that are receiving blood.
Safety: Do not attempt this experiment if physical exertion will aggravate a health problem.
Inform your instructor of any possible health problems that might be exacerbated if you
participate in this exercise.
Vocabulary: metabolic activity, Cardiac output, resting heart rate, recovery time, homeostatic
mechanisms, blood pressure, heart rate, stroke volume, hypotension, hypertension,
baroreceptors, muscle compression against blood vessels
Materials (per group):
 CBL2 with TI 83 calculator
 DataMate App
 Vernier Respiration Rate Monitor
 Vernier Hand-Grip Heart Rate Monitor or Vernier Exercise Heart Rate Monitor
 saline solution in dropper bottle for the exercise heart rate monitor
Procedures:
1. Identify among the group members who will be the test subject(s) and who will collect
data. Make sure to switch places when changing stations.
2. Connect the receiver module of the Heart Rate Monitor to CBL2, channel 1, and from the
Apps menu choose DataMate.
3. Once you have entered the program, choose change time settings then press enter.
Change the interval between samples to 5 seconds, and change the number of samples
to 30. The duration of the experiment is 150 seconds. Then, select OK.
4. Set up the Heart Rate Monitor: Follow the directions for your type of Heart Rate Monitor.
a. Depending upon your size, select a small or large size elastic strap. Secure one of the
plastic ends of the elastic strap to the transmitter belt. It is important that the strap
provide a snug fit of the transmitter belt.
Biology HSL
Department of Science
Page 393
Student
b. Wet each of the electrodes (the two textured oval areas on the underside of the
transmitter belt) with 3 drops of saline solution.
c. Secure the transmitter belt against the skin directly over the base of the rib cage (see
Figure 2). The POLAR logo on the front of the belt should be centered. Adjust the
elastic strap to ensure a tight fit.
d. Take the receiver module of the Heart Rate Monitor in your right hand. Remember
that the receiver must be within 80 cm of the transmitter in the Heart Rate Monitor
belt.
e. Stand quietly facing your table or work bench within the reception range of the
receiver module.
Figure 2
5. Set up the Hand-Grip Heart Rate Monitor: The receiver and one of the handles are
marked with a white alignment arrow as shown in Figure 3. Locate these two arrows.
a. Have the subject grasp the handles of the Hand-Grip Heart Rate Monitor so that their
fingers are in the reference areas indicated in Figure 3. Hold the handles vertically.
b. Have someone else hold the receiver near the handles so that the two alignment
arrows are pointing in the same direction and are at approximately the same height as
shown in Figure 3. Note: The receiver must stay within 60 cm of the handles during
data collection.
Figure 3
Exercise:
6. To determine that everything is set up correctly, click Collect to begin monitoring heart
rate. Note that there may be up to a 30 second delay before data are seen. The readings
should be within the normal range of the individual, usually between 55 and 90 beats per
minute. Click Stop when you have determined that the equipment is operating properly,
and proceed to the next step.
7. Start data collection. If the baseline appears stable, begin to run in place at 40 s.
Continue data collection while running in place for the next 60 s.
Biology HSL
Department of Science
Page 394
Student
8. At approximately 100 s, stop running and stand in place while your heart rate slows
toward its resting pre-exercise value. Data will be collected for a total of 150 s.
9. Determine the maximum heart rate.
a. Choose Statistics from the Analyze menu and record the maximum heart rate in Table
1.
b. Choose Statistics from the Analyze menu to turn off statistics.
10. Determine the resting heart rate.
a. Tap and drag over the area of the graph where the resting heart rate is displayed
(from 0 to approximately 40 s). This will highlight the region of interest.
b. Choose Statistics from the Analyze menu and record the mean resting heart rate, to
the nearest whole number, in Table 1.
c. Choose Statistics from the Analyze menu to turn off statistics.
11. Determine the recovery time.
a. For your data, examine the region of the graph beginning with the maximum heart
rate and ending with the first data point that matches the initial baseline value (or the
last point graphed, if baseline is not achieved). To determine the time for a data point,
tap on the point and read its corresponding time value to the lower right of the graph.
b. Determine the recovery time, x, by subtracting the initial time for this region from the
final time for this region. Record this value in Table 1.
Baroreceptor stimuli:
12. To determine that everything is set up correctly, click Collect to begin monitoring heart
rate. Note that there may be up to a 30 second delay before data are seen. The readings
should be within the normal range of the individual, usually between 55 and 80 beats per
minute. Click Stop when you have determined that the equipment is operating properly,
and proceed to the next step.
a. After at least 30 s of stable baseline data has been collected, rapidly lower yourself
into a squatting position. Maintain this position until your heart rate returns to the initial
baseline rate. Press start to begin data collection.
13. After obtaining 10–20 s of stable heart rate values, rise rapidly to a standing position.
Continue to record data until the baseline heart rate has been achieved, or until the end
of the run. Data will be collected for at least 200 s.
14. Determine the baseline heart rate.
a. Tap and drag over the area of the graph where the resting heart rate is displayed to
select the data.
b. Choose Statistics from the Analyze menu and record the mean heart rate, to the
nearest whole number, in Table 2.
c. Choose Statistics from the Analyze menu to turn off statistics.
15. Determine the maximum heart rate over the entire run.
a. Choose Statistics from the Analyze menu and record the maximum heart rate in Table
2.
b. Choose Statistics from the Analyze menu to turn off statistics.
16. Determine the baroreceptor response time for squatting.
a. Tap the data point that represents the heart rate immediately prior to squatting and
record the time component of this point.
b. Tap the point that represents the maximum or minimum heart rate (first peak or
valley) that follows squatting and record the time component of this point.
Biology HSL
Department of Science
Page 395
Student
17. Determine the difference between the two time values, ∆x, and record this value in Table
3 (to the nearest whole number) as “Response time 1.”
18. Repeat Step 10 for the following regions:
a. From the maximum or minimum heart rate following squatting to the beginning of a
new stable heart rate. Record the ∆x value (time) in Table 3 as “Recovery time 1.”
b. The region just prior to standing and the maximum heart rate after standing. Record
the ∆x value (time) in Table 2 as “Response time 2.”
c. The region between the maximum heart rate after standing and the point at which the
heart rate has re-stabilized (i.e., stable for at least 40 s). Record the ∆x value (time) in
Table 3 as “Recovery time 2.”
Observations/Data:
Table 1 - Exercise
Resting Heart Rate (bpm)
Maximum Heart Rate (bpm)
Recovery Time (s)
Table 2 – Baroreceptor Stimuli
Baseline Heart Rate (bpm)
Baroreceptor
response time
Squatting (s)
Minimum Heart Rate (bpm)
Maximum Heart Rate (bpm)
Table 3 – Baroreceptor Stimuli
Baroreceptor
1: Recovery time 1 (s) response time
Standing (s)
2: Recovery time 2 (s)
Data Analysis/Results:
Exercise:
1. Normal resting heart rates range from 55−100 beats per minute. What was the subject’s
resting heart rate? How much did the subject’s heart rate increase above resting rate with
exercise? What percent increase was this?
2. How does the subject’s maximum heart rate compare with other students in the group or
class? Is this what you expected?
3. Recovery time has been shown to correlate with degree of physical fitness. How does the
subject’s recovery rate compare to that of your classmates? Is this what you expected?
4. Congestive heart failure is a condition in which the strength of contraction with each beat
may be significantly reduced. For example, the ventricle may pump only half the usual
volume of blood with each beat. Would you expect a person with congestive heart failure
to have a faster or slower heart rate at rest? With exercise?
5. Medications are available which can slow the heart or speed it up. If a patient complains
of feeling poorly and has a heart rate of 120 beats/min, should you administer a medicine
to slow the rate?
Biology HSL
Department of Science
Page 396
Student
Baroreceptor Stimuli:
1. How much and in which direction (increase or decrease) did the heart rate change as a
result of
a. standing?
b. squatting?
2. Changing the heart rate is only one of a variety of homeostatic mechanisms that maintain
a fairly constant blood pressure during changes in body position. The sympathetic
nervous system helps by adjusting peripheral resistance in the arterial system. As this
occurs the heart rate is able to normalize again. Compare the duration of the initial
direction of heart rate change after standing to the recovery time. What does your data
tell you about the relative speed of the change in peripheral vascular resistance as
compared to that of the heart rate response?
3. Dizziness may result from low blood pressure and can occur in patients who take
medicines which impair the ability of the heart to increase its rate. Given what you have
learned from your data, which daily activities would be most likely to cause dizziness in
people who take these medications?
Conclusion: Write a report following the directions delineated by “Parts of a Lab Report” or
“Power Writing Model 2009”.
Biology HSL
Department of Science
Page 397
Teacher
Investigating Bacterial Growth
NGSSS:
SC.912.L.14.52 Explain the basic functions of the human immune system, including specific and
nonspecific immune response, vaccines, and antibiotics. (AA)
Purpose of Lab/Activity: The purpose of this activity is to observe how bacteria grow in a
culture medium through time, and observe if antiseptics, antibiotics, and disinfectants will inhibit
bacterial growth. The lab will take place over 2 days. After preparing for day 1, you will need to
prepare for the second day, 5 days later.
Prerequisites:
 The students will know the differences between prokaryotic cells and eukaryotic cells
 The students will understand how under certain conditions populations could grow
exponentially.
 The students will have prior knowledge of characteristic structures and functions that
make cells distinctive.
 The students will know processes in a cell classified broadly as growth, maintenance,
reproduction, and homeostasis.
Materials (per group):
 1 agar plate
 Sample of bacteria
 Inoculating loop or cotton swab
 Forceps
 Tape
 1 wax pencil/Sharpie
 1 metric ruler
 Distilled water






Blank paper disk
3 disks immersed in either antibiotic,
antiseptic, or disinfectant solutions
1 paper disk not immersed with any
fluid
Penicillin or similar antibiotic
Bleach
Mouthwash
Procedures: Day of Activity:
What the teacher will do:
a. Prepare 1 clean Petri dish with agar for each group along with the
remaining materials needed for the lab.
b. Introduce the activity by asking the following questions:
Before
1. What effect will a microbe inhibitor have on the growth of bacteria
activity:
colonies?
2. Are there differences in the efficacy of the different microbial inhibitors
used in the lab?
3. What are some ways that you can measure the differences of the
efficacy of each solution?
What the teacher will do:
a. Engage student thinking during activity by asking the following questions:
During
1. What is the role of agar?
activity:
2. Why do you need to label the Petri dish so carefully?
3. Why do you need to keep the Petri dish covered?
4. Why do you need to control the temperature of the bacteria culture so
Biology HSL
Department of Science
Page 398
Teacher
After
activity:
that temperature is not too cold (near zero oC or too hot, above 42 oC)?
5. What could happen if you handled the paper holes with your hands and
not with forceps? Is this lab a quantitative or a qualitative lab?
6. What is the function of keeping all objects as clean as possible before
touching the bacteria?
b. Provide expectations during Observations, Data Analysis, and Results:
1. Ask and answer questions during the lab to promote student
assimilation and understanding of lab ideas and scientific concepts.
2. Draw the circle of inhibition for each agar plate in the data table.
What the teacher will do:
a. Design questions to engage student thinking after activity. (e.g., Are there
differences in the effectiveness of microbe inhibitor in killing bacteria for
each disk? How can you tell that bacteria were killed or that the bacteria
survived?
b. Provide directions (expectations) for student writing of lab/activity, “Parts of
a Lab Report” or “Power Writing Model 2009”
c. Assess student understanding by discussing factors that keep bacteria
population in control. (Ask students to write several factors that prevented
the bacteria population from increasing exponentially and thereby leaving
the Petri-dish).
Extension:
 Isolation and Screening of Antibiotic Producers Animation:
http://www.sumanasinc.com/webcontent/animations/content/antibioticproducers.html
Biology HSL
Department of Science
Page 399
Student
Investigating Bacterial Growth
NGSSS:
SC.912.L.14.52 Explain the basic functions of the human immune system, including specific and
nonspecific immune response, vaccines, and antibiotics. (AA)
Background: Most bacteria (and other microorganisms) are harmless. In fact, many bacteria
are beneficial. Cheesemaking, decay, and soil building are a few of the important processes that
depend on the action of decomposing bacteria, which thrive on decaying organic matter.
Bacteria are also important in the process of digestion for many organisms, including humans.
Bacteria in termites and ruminants (such as cows) help break down the cellulose in the food
they eat so it can be used for energy and nutrients. Bacteria in the human digestive system help
with the synthesis of vitamin K, which is essential for blood clotting. However, some bacteria are
pathogens (disease causers). Tuberculosis, tetanus, strep, diphtheria, anthrax, syphilis, and
some pneumonias are a few of the serious diseases caused by bacteria.
Chemical substances that either kill bacteria or inhibit bacterial growth are called antimicrobial
agents. Alcohol and some mouthwashes are antiseptics, and are used on cuts or wounds to
inhibit bacterial infection. Others, like chlorine bleach, are too concentrated or toxic for use on
living tissue. These are called disinfectants and are used on clothes, surfaces, or other nonliving objects. These agents generally work either by disrupting the cell membrane, causing the
bacterium to lyse, or binding to the bacterium enzymes, which inhibit its activity. Even though
antiseptics and disinfectants are very useful in helping to prevent infections, we cannot use
them internally to treat an infection. If bacteria enter our bodies, we rely on another class of
chemicals called antibiotics to kill them. Although their use is now commonplace, antibiotics
were only discovered about 85 years ago. Before then, more people died from infections than
from all the wars in history combined. Antibiotics were the first of the “miracle drugs” and they
have permanently altered the course of history.
The effectiveness of each type of antimicrobial agent is influenced by many factors. Some of
these factors include the environmental conditions in which the agent is applied, the chemical
properties of the agent, how long the agent has been stored, and the rate of deterioration of the
agent.
The procedure of placing bacteria on agar plates is called inoculation. Organisms so small that
they can only be seen with a microscope are living all around, on, and in us. They include
bacteria, viruses, molds, and yeasts.
In the laboratory, you will test the effectiveness of antibiotics in inhibiting the growth of bacteria.
You will grow samples of bacteria until they form colonies so big that you can see them with the
naked eye. You will grow your samples on sterile nutrient agar in a sterile petri dish. “Sterile”
means that there is nothing alive in the agar or on the dish. Nutrient agar supplies the nutrients
that microorganisms (not just bacteria) need to live and reproduce.
When you allow bacteria to grow, they will grow uniformly wherever their growth is not
effectively inhibited by a bactericide. This uniform growth is called a bacterial lawn and the
regions where no growth occurs are zones of inhibition. A large zone of inhibition is created by a
Biology HSL
Department of Science
Page 400
Student
bactericide that is more effective at inhibiting the strain’s growth than a bactericide that creates a
smaller zone of inhibition.
Purpose or Problem Statement: What are the effects of antiseptics, antibiotics, and
disinfectants on bacterial growth?
Safety:
 Wear goggles and an apron throughout this lab.
 Do not touch your face until you have thoroughly washed your hands with soap.
 Wash your hands for a minimum of 30 seconds (count in your head!) with soap and
running water before leaving lab.
 Use aseptic technique to avoid contamination of your culture and environment.
 Many antimicrobials are caustic or toxic; use caution when working with these reagents.
 No eating, drinking, gum-chewing, or horseplay in the lab!
Vocabulary: bacterial lawn, antiseptic, disinfectant, antibiotic, inoculation, zones of inhibition
Hypothesis: Develop a hypothesis for this lab based on the reagents you are assigned to use
in the procedure. It should be written as an “If – Then – Because” statement.
Materials (per group):
 1 agar plate
 Sample of bacteria
 Inoculating loop or cotton swab
 Forceps
 Tape
 1 wax pencil/Sharpie
 1 metric ruler
 Distilled water




1Blank paper disk
1 antibiotic disk (previously soaked)
in penicillin
1
disinfectant
disk
(previously
soaked) in disinfectant
1 antiseptic disk (previously soaked)
in antiseptic
Procedures:
Day 1: Keep petri dish closed at all times except when inoculating and placing disks in
quadrants!!
1. On the outside bottom of the petri dish, close to the edge of the dish, write the names of
you and your partner(s) and your class period in small letters with the Sharpie/wax pencil.
2. On the outside bottom, draw lines to divide the dish into quadrants and number them 1,
2, 3, and 4.
Biology HSL
Department of Science
Page 401
Student
3. To inoculate your agar plate, obtain a sterile cotton swab. Wet the swab with sterile water
and gently roll the swab on one surface to obtain a sample of any bacteria present.
(Note: Agar is like Jello. If you press too hard on the agar with the swab, the agar will
tear.)
4. Raise the petri dish cover slightly. Starting at one edge, rub the cotton swab across the
entire surface. Use back-and-forth motion to ensure that the entire surface has been
covered with the culture. You are creating a lawn.
5. Turn the petri dish a quarter of a turn and re-streak the swab across the agar surface to
ensure that bacteria are on the entire surface. (Remember, bacteria are microscopic so
you won’t be able to see them!)
6. Replace the cover of the petri dish. To dispose of the swab, place it in the Ziploc bag
containing bleach. Be careful not to place the swab on any surface or allow the swab to
come into contact with anyone.
7. To assay bacterial effectiveness, you will conduct a sensitivity test. You will place the 3
antibiotic disks one blank (plain) disk soaked in sterile water on your plate, one per
quadrant.
a. Raise the cover of the petri dish slightly and place one disk that has been soaked in
sterile water in quadrant #1 and record it in the data table. Follow the same procedure
of the other 3 disks placing them in quadrants 2 (penicillin), 3 (antiseptic), and 4
(Disinfectant). Press lightly on the antibiotic disks so that they are stuck to the agar.
Record this information in the data table.
8. Tape the petri dish shut and return it to your teacher.
Day 5: DO NOT OPEN YOUR PETRI DISH!!!!
1. Observe your petri dish after the incubation period. Hold your dish up to the light to see
the zones of inhibition more clearly.
2. Use a metric ruler to measure the zone of inhibition (the diameter of the clear zone).
Biology HSL
Department of Science
Page 402
Student
3. Draw, label, and color a diagram of your petri dish to scale in the space provided below.
Use a petri dish and a ruler to draw the dish. DO NOT OPEN YOUR PETRI DISH!!!!
4. Underneath the drawing, write what location you swabbed. Label each quadrant with the
appropriate number. Color the drawing the correct colors that you observed. The zones
of inhibition should be the correct size (use a ruler!) and should be labeled. Put a title for
your figure on the line provided.
5. Return the taped UNOPENED petri dish to your teacher.
Observations/Data:
Day 5: Source of bacteria
Title:________________________________
Day 5 - Figure 1
Quadrant
1
2
3
4
Biology HSL
Department of Science
Table 2 –Zone of Inhibition
Antimicrobial Reagent
Blank Disk
Penicillin Disk
Antiseptic Disk
Disinfectant Disk
Zone of Inhibition (mm)
Page 403
Student
Data Analysis/Results:
Answer the following questions. Refer to the background section of this lab, as well as your
notes, text, and other available references for help.
Day 1:
1. Predict what will happen in each quadrant. Why?
2. What is the difference between decomposing bacteria and pathogenic bacteria?
3. What was the control used in this experiment? Why is a control needed?
Day 5
1. Based on your observations, did you have only one type of organism grow on your plate,
or more than one. Explain how you know.
2. Did you have any indication that any of your organisms were fungi instead of bacteria?
Explain.
3. Did you expect to find as much growing in your plate as you did based on what you
chose to swab? Explain.
4. Over time some bacteria can fail to die even when treated with an antibiotic. What
genetic change is happening to the bacteria over time?
5. What do the results of your lab tell you about the importance of washing your hands?
6. Based on your data, rank your test reagents in order from most effective to least effective
at killing the bacteria you were given. Explain.
Conclusion:
Write a conclusion using the following as a guide:
 Start with what you did (purpose and the gist of the procedure),
 Then describe what you saw (REFERENCE your data table and figure; DESCRIBE every
piece of information you recorded!),
 Then describe what it means (then analyze and conclude by DISCUSSING every piece
of data and explaining what it means!).
 State whether your hypothesis was supported or not supported by the results of your lab.
EXPLAIN why or why not.
 Include information about your bacteria and how the characteristics of your bacteria might
be related to the results of your lab.
 Who needs to know the kind of information you found out about the effectiveness of
antimicrobials on a specific bacteria?
 Why do people need to know this kind of information?
 How might you change this experiment to find out more, find out something different, or
improve it?
Biology HSL
Department of Science
Page 404
Teacher
Differences in Similar Phenotypes
NGSSS:
SC.912.L.16.1 Use Mendel’s Laws of Segregation and Independent Assortment to analyze
patterns of inheritance. (AA)
Purpose of Lab/Activity:
 To observe differences in phenotypes for a particular trait among individuals in a
population.
 To determine the reason for the differences in phenotypes for a particular trait among
individuals in a population.
Prerequisites:
Before conducting this activity, the teacher should have covered Mendel’s Laws of Inheritance.
Students should know the meanings of terms such as alleles, dominant, recessive, phenotype,
genotype, homozygous, and heterozygous. They should also be familiar with inheritance
patterns caused by various modes of inheritance, including dominant, recessive, co-dominant,
sex-linked, polygenic, and multiple alleles.
Materials (per group):
 Metric ruler
 Meter Stick
Procedure: Day of Activity:
What the teacher will do:
a. The day before this activity, you may want to place “Table 2 - Class Data on
Right-hand Width and Length” on the board in front of the room.
b. In order to access prior knowledge and detect any misconceptions, review
Mendel’s Laws of Segregation and Independent Assortment. Also, review
the meaning of the vocabulary words which are located in the student’s
Before
hand-out.
activity:
c. Have students read the entire lab, and ensure they understand the
procedures.
d. Assign each student a partner.
e. Demonstrate to students how to measure the length and width of their right
hand in centimeters. Some students may need assistance making
measurements in metric.
What the teacher will do:
a. Circulate around the room and monitor students to ensure they are
accurately measuring the length and width of their right-hand.
b. In order to minimize “traffic flow” in the classroom, select a student to
record class data to minimize any errors in recording data.
During
c. Have all students involved in tabulating the results of the class
activity:
measurements by totaling the number of males and females with each
hand length and width and recording in Table 3 and Table 4.
d. The teacher has the option to include the data from all the classes running
this experiment. Table 5 and Table 6 is provided that will allow the
tabulation of several classes of data.
Biology HSL
Department of Science
Page 405
Teacher
After
activity:
e. Make sure the students understand that they will be developing two bar
graphs; one for hand length and one for hand width.
f. As students are developing their bar graph, ask the following: “What is the
independent variable and dependent variable?” The measurements of the
width and length are the independent variables and the number of times
that measurement appeared is the dependent variable. Remind students to
make sure that the graph has a title and that both axes are labeled clearly.
What the teacher will do:
a. Use the questions, found in the Observations/Data Analysis, to assess
student understanding of the activity.
b. Have students develop a written report in which they summarize the results
of this investigation. In this report, they should give possible explanations
for their findings by making connections to the NGSSS and mention any
recommendations for further study in this investigation.
Extension:
 Gizmo: Chicken Genetics
Biology HSL
Department of Science
Page 406
Student
Differences in Similar Phenotypes
NGSSS
SC.912.L.16.1 Use Mendel’s Laws of Segregation and Independent Assortment to analyze
patterns of inheritance. (AA)
Background:
Humans are classified as a separate species because of all the special characteristics that they
possess. These characteristics are controlled by strands of DNA located deep inside their cells.
This DNA contains the code for every protein that an organism has the ability to produce.
These proteins combine with other chemicals within the body to produce the cells, tissues,
organs, organ systems, and finally the organism itself. The appearance of these organs, such as
the shape of one’s nose, length of the fingers, or the color of the eyes is called the phenotype.
Even though humans contain hands with five fingers, two ears, or one nose, there are subtle
differences that separate these organs from one another. There are subtle differences in a
person’s genes that allows for these different phenotypes. In this lab, we are going to observe
some of these differences in phenotype and try to determine why they happened.
Problem Statement: Do all human hands measure the same?
Vocabulary: alleles, dominant, genotype, homozygous, heterozygous (hybrid), phenotype,
recessive
Materials (per group):
 Metric ruler
 Meter stick
Procedures:
Hand Measurement:
All human hands look pretty much alike. There are genes on your chromosomes that code for
the characteristics making up your hand. We are going to examine two of these characteristics:
hand width and hand length.
1. Choose a partner and, with a metric ruler, measure the length of their right hand in
centimeters, rounding off to the nearest whole centimeter. Measure from the tip of the
middle finger to the beginning of the wrist. Now have your partner do the same to you.
Record your measurements in Table 1.
2. Have your partner measure the width of your hand, straight across the palm, and record
the data in Table 1. Have your partner do the same to you.
Biology HSL
Department of Science
Page 407
Student
Table 1 - Group Data on Right Hand Width and Length
Name:
____________________________
Name:
____________________________
Length
of
___________________cm.
Hand Length
of
____________________cm.
Hand
Width
of
____________________cm.
Hand Width
of
_____________________cm.
hand
Class Data: After the entire class has completed Table 1, have the students record their data on
the board in the front of the room. Use Table 2 below to record the data for your use. Extend
the table on another sheet of paper if needed.
Table 2 - Class Data on Right- Hand Width and Length
Student
Gender
M/F
Hand Length (cm)
Hand Width (cm)
M/F
M/F
M/F
M/F
M/F
M/F
M/F
M/F
M/F
M/F
M/F
Tabulate the results of your class measurements by totaling the number of males and females
with each hand length and width and entering these totals in the tables below.
Biology HSL
Department of Science
Page 408
Student
Table 3 - Class Hand Length
Measurement of Hand
Length in cm.
# of Males
# of Females
Total No. of Males
and Females
Table 4 - Class Hand Width
Measurement of Hand
Length in cm.
# of Males
# of Females
Total No. of Males
and Females
In order to form a more accurate conclusion, the collection of additional data is necessary. The
teacher has the option to include the data from all the classes running this experiment. Below
find tables that will allow the tabulation of several classes of data.
Biology HSL
Department of Science
Page 409
Student
Table 5 - All Classes Hand Length
Measurement of Hand
Length in cm.
# of Males
# of Females
Total No. of Males
and Females
Table 6 - All Classes Hand Width
Measurement of Hand
Length in cm.
# of Males
# of Females
Total No. of Males
and Females
Bar Graph the data from Tables 5 and 6, and then answer the questions that follow. Use the
measurements of the width and length as your independent variable and the number of times
that measurement appeared as your dependent variable.
Biology HSL
Department of Science
Page 410
Student
Graph Title: ___________________________________________________________
Biology HSL
Department of Science
Page 411
Student
Observations/Analysis:
1. Examine the graphs. What is the shape of the graph for hand length? What is the most
abundant measurement for hand length?
2. What is (are) the least abundant measurement(s)?
3. If we are to assign letters to represent the various lengths, what value(s) would we assign
to the dominant genotype (HH)? The recessive genotype (hh)? The heterozygous
genotype (Hh)?
4. What would be the phenotypic name for the (HH) genotype?
5. What would be the phenotypic name for the (Hh) genotype?
6. What would be the phenotypic name for the (hh) genotype?
7. What is the shape of the graph for hand width?
8. What is the most abundant measurement for hand width?
9. What is (are) the least abundant measurement(s)?
10. If we assign letters to represent the various widths, what value(s) would we assign to the
dominant genotype (WW)? The recessive genotype (ww)? The heterozygous genotype
(Ww)?
11. What would be the phenotypic name for the (WW) genotype?
12. What would be the phenotypic name for the (Ww) genotype?
13. What would be the phenotypic name for the (ww) genotype?
14. Are there any similarities in the graphs of the two characteristics? If so, what are they?
15. Are there any differences in the graphs of the two characteristics? If so, what are they?
16. Is there a difference in the length and width of the male and female hand? Does the
gender of a person have an effect on the phenotype of a trait? Explain:
Conclusion:
Develop a written report that summarizes the results of this investigation. Use the analysis
questions as a guide in developing your report. Make sure to give possible explanations for your
findings by making connections to the NGSSS found at the beginning of this lab hand-out. Also,
mention any recommendations for further study in this investigation.
Biology HSL
Department of Science
Page 412
Teacher
Making Karyotypes
(Adapted from: Prentice Hall, Lab Manual A)
NGSSS:
SC.912.L.16.10 Evaluate the impact of biotechnology on the individual, society and the
environment, including medical and ethical issues. (AA)
Purpose of Lab/Activity:
 To construct a karyotype.
 To understand the importance of karyotypes in determining genetic disorders or
syndromes.
Prerequisites:
 Students should already be familiar with the topics of mitosis and meiosis. They should
be able to distinguish among DNA, genes, and chromosomes.
 Students should also understand the meanings of autosomes and homologous pairs
before doing this lab.
 Students should also understand that this activity is modeling a genetic engineering lab
procedure in which a picture is taken of the nucleus of a cell during mitosis; it is enlarged,
and then analyzed for abnormalities.
Materials (per individual):
 Scissors
 Glue or transparent tape
Procedure: Day of Activity:
What the teacher will do:
a. Review the topics of mitosis and meiosis.
b. Essential question (or problem statement): “Can chromosomal
abnormalities be observed?”
Before
c. Inform the students to read the entire investigation.
activity:
d. Use the following questions to initiate a class discussion on karyotypes.
1. What is a karyotype?
2. What information can we obtain from a karyotype?
3. Can chromosomal abnormalities be detected from analyzing a
karyotype? Give examples.
What the teacher will do:
a. Ensure that students are matching the chromosomes by taking into
consideration their overall size, the position of the centromere, and the
pattern of the light and dark bands.
b. Engage student thinking during the lab activity by asking the following
During
questions.
activity:
1. What clues to the presence of certain genetic disorders can be seen in a
karyotype? Karyotypes can reveal missing, damaged, or extra
chromosomes.
2. Why might a laboratory worker attempting to diagnose a genetic
disorder prefer to work with photographs of chromosomes rather than
the chromosomes themselves? Chromosomes are very small and
Biology HSL
Department of Science
Page 413
Teacher
After
activity:
fragile, and photographs of them can provide a great deal of information
about the presence and structure of specific chromosomes in an
individual’s cells.
3. Why would it be much more difficult to construct a karyotype of
unstained chromosomes? Stained bands on the chromosomes help
workers distinguish one from the other.
4. Which pair of chromosomes can contain two very different
chromosomes and still be considered normal? Explain your answer.
Members of chromosome pair 23, the sex chromosomes, are very
different in a normal male, including an X chromosome and a Y
chromosome.
5. How do autosomes differ from sex chromosomes? Autosomes do not
carry information about the individual, while sex chromosomes
determine the individual’s sex.
c. Ensure students have developed a data table in which they have recorded
their observations of the karyotypes shown in Figures 1, 3, 4, & 5.
What the teacher will do:
a. The following questions may be used to connect concepts of the activity to
the NGSSS.
1. Of the four karyotypes that you observed, which was normal? Which
showed evidence of an extra chromosome? Which showed evidence of
an absent chromosome? The karyotype in Figure 1 is normal. The
karyotypes in Figures 3 and 4 show evidence of an extra chromosome,
while the karyotype in Figure 5 shows that a chromosome is missing.
2. What chromosomal abnormality appears in the karyotype in Figure 4?
Can you tell from which parent this abnormality originated? Explain your
answer. Chromosome 23 has an extra chromosome. Of these three
chromosomes, the Y originated from the father, and one of the X
chromosomes originated from the mother. The second X chromosome,
however, could have come from either parent.
3. Are chromosomal abnormalities such as the ones shown confined only
to certain parts of the body? Explain your answer. No; because all
chromosomes occur in every cell in the body, these abnormalities would
pervade the body.
4. Are genetic defects associated with abnormalities of autosomes or of
sex chromosomes? Explain your answer. Genetic defects can be
associated with abnormalities of either autosomes or sex chromosomes,
for example, the extra autosome at 21 in Figure 3, and the missing sex
chromosome in Figure 5.
5. Formulate a question that could be answered by observing
chromosomes of different species of animals. Students’ questions might
center on comparisons of the number and appearance of chromosomes
of different animal species.
b. Closure Activity: Have the students present their karyotypes to the class
and explain the importance about karyotyping in determining genetic
disorders.
Biology HSL
Department of Science
Page 414
Teacher
Extension:
 Gizmo: Human Karyotyping
 Using library materials or the Internet, the students will research one type of deletion
syndrome (a syndrome that results from loss of parts of chromosomes), and write a short
paragraph describing the chromosomal abnormality involved and the characteristics of
the disorder.
 Students can also use their computers to generate a pamphlet about the syndrome which
includes information about the chromosomal abnormality involved, how it affects the
organism, characteristics of the syndrome. Include some relevant pictures or websites
that people can refer to if they want to learn more about the syndrome.
Biology HSL
Department of Science
Page 415
Student
Making Karyotypes
(Adapted from: Prentice Hall, Lab Manual A)
NGSSS:
SC.912.L.16.10 Evaluate the impact of biotechnology on the individual, society and the
environment, including medical and ethical issues. (AA)
Background:
Several human genetic disorders are caused by extra, missing, or damaged chromosomes. In
order to study these disorders, cells from a person are grown with a chemical that stops cell
division at the metaphase stage. During metaphase, a chromosome exists as two chromatids
attached at the centromere. The cells are stained to reveal banding patterns and placed on
glass slides. The chromosomes are observed under the microscope, where they are counted,
checked for abnormalities, and photographed. The photograph is then enlarged, and the images
of the chromosomes are individually cut out. The chromosomes are identified and arranged in
homologous pairs. The arrangement of homologous pairs is called a karyotype. In this
investigation, you will use a sketch of chromosomes to make a karyotype. You will also examine
the karyotype to determine the presence of any chromosomal abnormalities.
Problem Statement: Can chromosomal abnormalities be observed?
Safety: Be careful when handling scissors.
Vocabulary: centromere, chromosomes, chromatids, genes, homologous pairs, karyotype,
mutations, Trisomy 21- Down syndrome, Klinefelter syndrome, Turner syndrome
Materials (per individual):
 Scissors
 Glue or transparent tape
Procedures:
Part A. Analyzing a Karyotype
1. Make a hypothesis based on the problem statement above.
2. Observe the normal human karyotype in Figure 1. Notice that the two sex chromosomes,
pair number 23, do not look alike. They are different because this karyotype is of a male,
and a male has an X and a Y chromosome.
Biology HSL
Department of Science
Page 416
Student
3. Identify the centromere in each pair of chromosomes. The centromere is the area where
each chromosome narrows.
Part B. Using a Karyotype to Identify a Genetic Disorder
1. Study the human chromosomes in Figure 2 on the next page. Notice that 23
chromosomes are numbered 1 through 23.
2. To match the homologous chromosomes, look carefully at the unnumbered
chromosomes. Note their overall size, the position of the centromere, and the pattern of
the light and dark bands. Next to the unnumbered chromosome that is most similar to
chromosome 1, write 1.
3. Repeat step 2 for chromosomes 2 through 23.
Biology HSL
Department of Science
Page 417
Student
Biology HSL
Department of Science
Page 418
Student
4. Use scissors to cut out all the chromosomes from Figure 2. Tape them in their
appropriate places in Figure 3. Note any chromosomal abnormalities. CAUTION: Be
careful when handling sharp instruments.
Observations/Data Analysis:
Biology HSL
Department of Science
Page 419
Student
1. Observe the karyotypes in Figures 4 and 5. Note the presence of any chromosomal
abnormalities.
Biology HSL
Department of Science
Page 420
Student
2. Comparing and Contrasting: Of the four karyotypes that you observed, which was
normal? Which showed evidence of an extra chromosome? An absent chromosome?
3. Formulating Hypotheses: What chromosomal abnormality appears in the karyotype in
Figure 4? Can you tell from which parent this abnormality originated? Explain your
answer.
4. Inferring: Are chromosomal abnormalities such as the ones shown confined only to
certain parts of the body? Explain your answer.
Results/Conclusions:
1. Draw a data table in the space below in which to record your observations of the
karyotypes shown in Figures 1, 3, 4, and 5. Record any evidence of chromosomal
abnormalities present in each karyotype. Record the genetic defect, if you know it,
associated with each type of chromosomal abnormality present.
2. Drawing Conclusions: Are genetic defects associated with abnormalities of autosomes or
of sex chromosomes? Explain your answer.
3. Posing Questions: Formulate a question that could be answered by observing
chromosomes of different species of animals.
Biology HSL
Department of Science
Page 421
Teacher
Building a DNA Model Project
(Adapted from: Prentice Hall - Laboratory Manual A)
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Purpose of the Lab/Activity:
 To create what the structure of a DNA molecule looks like and explain its composition.
 To describe the function of the parts which make up a DNA molecule.
 Recognize the purpose and relationships of the nucleotide bases found in DNA.
Prerequisites:
 Students should have already been introduced to the structure of DNA including the
phosphate backbone, deoxyribose sugar location, and the nucleotides found within it
such as Adenine (A), Cytosine (C), Guanine (G) and Thymine (T).
 Students should also have knowledge of which nucleotides bind together and how DNA
replicates.
 Genetic and chromosomal mutations should also have been covered with the students
including substitution, inversion, deletion, duplication, non-disjunction, frame-shift
mutation, and others so that the students can understand the concept of what occurs in
each and how that can affect the DNA of an offspring.
Materials (per group):
 2 strips of cardboard, 38 cm x 3 cm
 Metric ruler
 Toothpicks
 Crayons
 Tape




Colored gumdrops
Modeling clay
Digital camera (optional; if available)
Colored printer (optional; if available)
Procedures: Day of Activity:
What the teacher will do:
a. Address the essential question:
1. If during replication a base pair gets substituted, then what effect might
it have on the DNA molecule?
b. Start the lesson by asking the students to answer the pre-lab questions.
1. Which two molecules make up the “sides” of a DNA molecule?
Deoxyribose and phosphate group
2. When you construct your model of DNA, which materials will you use to
Before
represent the sides of a DNA molecule? Strips of cardboard
activity:
3. Which molecules make up the “rungs” of a DNA molecule? Adenine,
guanine, cystosine, and thymine
4. When you construct your model of DNA, which materials will you use to
represent the rungs of a DNA molecule? Different color gumdrops
5. Which bases usually pair together to form the rungs of a DNA molecule?
A-G; C-T
c. Introduce the structure of the DNA including the phosphate and
deoxyribose backbone; nitrogen bases found within as Adenine(A),
Teacher
During
activity:
Cystosine(C), Guanine (G), and Thymine (T)
d. Review the steps of DNA replication and what happens in a chromosomal
mutation including substitution, inversion, deletion, duplication, nondisjunction, and frame shift mutation.
e. Be sure students understand the concept of what occurs in each mutation
and how it can affect the DNA of an offspring.
What the teacher will do:
a. Ask students to make a hypothesis based on the problem statement. If
during replication a base pair gets substituted, then the DNA molecule will
be mutated.
b. Have students construct a rough draft of what the DNA model is going to
look like, include the keys prior to constructing the final model.
c. Make sure students understand that adenine and thymine; cytosine and
guanine pairs with each other exclusively. A-T;C-G
d. Ask students what makes up a nucleotide: phosphate group, sugar
(deoxyribose), and a nitrogen base.
e. Given the following bases, predict to which base each would be bonded:
1. A _T__ T _A__ G _C__C __G__
2. G _C__ A _T__ T_A_ C__G_
After
activity:
3. T _A__ C _G__ G_C__ A _T__
f. If you changed the base on one side of the DNA molecule, what should you
do to the base on the other side of the molecule? Explain your answer. If
you changed the base on one side of the DNA molecule, you should
change the base on the other side of the molecule to the complementary
base.
What the teacher will do:
a. Have the student groups present their DNA models and explain their
illustrations. Also have the students explain the importance of DNA
replication.
b. Have students explain the role of DNA on the Human Genome and what it
means for the future concerning medicine, diseases, and adaptations to
organisms.
c. Apply their understanding of a DNA model by asking the following
questions:
1. Consider the following base sequence in one DNA chain:
G G C A T G A C G AA C T T A T C GG C A T T A G C C A A T T
How would you fill in the corresponding portion of the other chain?
C C G T A C T G C T T G A A T AG CC G T A A T C G G T T A A
2. How could a very high fever affect DNA replication, if temperature
affects enzymes in the body? Temperature affects enzymes’ function,
DNA replication involves enzymes and with high temperature, those
enzymes cannot function properly.
d. Answers for Results and Conclusions:
 How does the model you constructed differ from an actual DNA
molecule? Answers may vary.
 When DNA is replicated or copied, the ladder splits as the bases
Biology HSL
Department of Science
Page 423
Teacher
separate. New units are added to each half of the DNA molecule. How
does this create two identical molecules of DNA? Both strands are used
as a template for replication therefore creating two identical molecules
of DNA.
Extension:
 Gizmo: Building DNA
Biology HSL
Department of Science
Page 424
Student
Building a DNA Model Project
(Adapted from: Prentice Hall - Laboratory Manual A)
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Background Information:
DNA, deoxyribonucleic acid, is found in the chromosomes of all living things. The structure of
this molecule encodes the genetic information that controls the development of each living thing.
When scientists figured out the structure of DNA, they built a model. The structure of this model
helped them see how DNA can carry information and be copied to make new DNA molecules. In
this investigation you will examine the structure of DNA by building your own DNA model.
The DNA molecule is the shape of a double helix (spiral). The molecules making up DNA are
deoxyribose, phosphate, and four nitrogenous bases: adenine, thymine, cytosine, and guanine.
These are called nucleotides. Adenine and guanine are purines and cytosine and thymine are
pyrimidine. They are also known by their code letters of A, G, T, and C. There is a specific
manner in which they bond A only to T and C only to G.
Problem Statement:
If during replication a base pair gets substituted, then what effect might it have on the DNA
molecule?
Safety: Do not eat any of the edible food items used in this lab.
Pre-Lab Questions:
1. Which two molecules make up the “sides” of a DNA molecule?
2. When you construct your model of DNA, which materials will you use to represent the
sides of a DNA molecule?
3. Which molecules make up the “rungs” of a DNA molecule?
When you construct your model of DNA, which materials will you use to represent the
rungs of a DNA molecule?
4. Which bases usually pair together to form the rungs of a DNA molecule?
Vocabulary: double helix, nucleotide, purines, pyrimidines, DNA replication, DNA polymerase,
mutation
Materials (per group):
 2 strips of cardboard, 38 cm x 3 cm
 Metric ruler
 Toothpicks
 Crayons
 Tape
 Colored gumdrops
 Modeling clay
 Digital camera (optional; if available)
 Colored printer (optional; if available)
Biology HSL
Department of Science
Page 425
Student
Procedure:
1. Make a hypothesis based on the problem statement above.
2. Study Figure 1. It illustrates the shape of the DNA molecule. DNA is a double helix (a
helix is a spiral). The two helices of the DNA molecule form what is often referred to as a
“twisted ladder.” The sides of the ladder are made up of alternating sugar molecules and
phosphate groups. The sugar is a 5-carbon deoxyribose sugar. Each phosphate group is
a phosphate atom with 4 oxygen atoms bonded to it. Each “rung” of the DNA ladder is
made up of two nitrogen bases. Together, a sugar, a phosphate group, and a base make
up a nucleotide. A nucleotide is the basic unit of DNA.
Figure 1
3. Nitrogen bases are grouped into two classes: the purines and the pyrimidines. The
purines are adenine (A) and guanine (G). The pyrimidines are cytosine (C) and thymine
(T). In a DNA molecule, a purine bonds to a pyrimidine to make up each rung of the
ladder. Adenine usually bonds only with thymine. Cytosine usually bonds only with
guanine.
4. Now you can make a model of the DNA ladder. Choose two colored crayons and color
the cardboard strips with alternating colored boxes. Use one color to represent the sugar
molecules and label those boxes S. Use the other color for the phosphate groups. Label
those boxes P. Remember to make a key designating what each color represents.
5. To make the rungs of the ladder, choose four different-colored gumdrops. Each color will
represent a particular nitrogen base. For example, a green gumdrop might represent an
adenine base. A yellow gumdrop might represent a guanine base. Be sure to make a key
to explain which color represents which nitrogen base.
6. Stick each gumdrop onto a toothpick. Determine which nitrogen base gumdrops can be
bonded together. Then join the correct gumdrops together by placing a toothpick between
them.
7. Attach the nitrogen base rungs to the ladder by taping the free toothpick ends to the
sugar bases.
8. Continue to add correctly paired nitrogen-base gumdrop rungs to the sugar units of the
ladder. When your ladder is completed, you might want to stand it up by inserting the two
strips into mounds of modeling clay.
Biology HSL
Department of Science
Page 426
Student
Observations/Data:
Construct a rough draft on paper of what the DNA model is going to look like, including the keys
prior to constructing the final model.
Data Analysis:
1. Given the following bases, predict to which base each would be bonded:
a. A ____ T ____ G ____C _____
b. G ____ A ____ T____ C_____
c. T ____ C ____ G____ A _____
2. If you changed the base on one side of the DNA molecule, what should you do to the
base on the other side of the molecule? Explain your answer.
Results/Conclusions:
1. How does the model you constructed differ from an actual DNA molecule?
2. When DNA is replicated or copied, the ladder splits as the bases separate. New units are
added to each half of the DNA molecule. How does this create two identical molecules of
DNA?
Biology HSL
Department of Science
Page 427
Student
DNA Model Project
(Adapted from: www.africangreyparrot.com)
Student Name: ____________________________________ Due Date: __________________
Requirements:
Make a model of DNA. Your model may be out of any materials that you choose as long as they are
not perishable and are sturdy. Please make sure that your model includes at least 8 nucleotides.
Each structure should look different from the others, and should clearly show which 2 other
structures they are connected to. Please attach a key to your model, which labels each structure and
shows what it is. Your model should be in a double helix form, as is DNA.
Please use this checklist to make sure you have completed your project, and check the parts as you
do them.
Rubric: The following need to be included for full credit. (Total possible points is 50)
Structure
Check
Connections
Check
Labels on Key
Check
2pts
Sugar

4pts
Sugar

1 pt
Sugar

2pts
Phosphate

2pts
Phosphate

1 pt
Phosphate

2pts
Adenine

2pts
Adenine

1 pt
Adenine

2pts
Thymine

2pts
Thymine

1 pt
Thymine

2pts
Cytosine

2pts
Cytosine

1 pt
Cytosine

2pts
Guanine

2pts
Guanine

1 pt
Guanine

2pts
Helix

---
---
---
2 pts
Nucleotide

2pts
H – bonds

6pts
Overall
neatness

1 pt
Hydrogen
bonds

2pts
8 nucleotides

2pts
Sturdy

1 pt
checklist

Extra Credit: DNA that unzips at the hydrogen bonds (2 pts)
Biology HSL
Department of Science
Page 428
Teacher
DNA Electrophoresis Simulation
(Adapted from: Mike Basham, El Dorado High School)
NGSSS:
SC.912.L.16.10 Evaluate the impact of biotechnology on the individual, society and the
environment, including medical and ethical issues. (AA)
Purpose of Lab/Activity:
 To give students a simulation of DNA electrophoresis.
 To describe the relationship between fragment size and migration rate in a gel via a
simulation with student groups in a large field.
Prerequisites:
 Students should be able to recognize the different uses and methods involved in
biotechnology.
 Students should be able to describe the different techniques used in biotechnology (e.g.
gel electrophoresis).
 Students should be able to explain how DNA fingerprinting can serve as a useful tool in
creating genomic libraries, conservation, forensics, and court cases.
Materials:
 Football, soccer or other large grass field (It is important to use a grass field in case
students fall during the activity.)
 50 m or 100 m measuring tape
 Stopwatch or other timing device
Procedures: Day of Activity:
What the teacher will do:
a. Review procedures of a gel electrophoresis. Refer to web stimulation:
http://learn.genetics.utah.edu/content/labs/gel/
b. Discuss uses of biotechnology i.e. industry, forensics, and research.
c. Introduce essential question: Will a small fragment of DNA move faster than
a larger fragment of DNA?
Before
d. Check weather forecasts to ensure the weather permits activity. Have
activity:
alternative activity just in case of unforeseen circumstances.
e. Have students set up a table to record their results while doing the activity.
Table should include number of students, distance traveled.
f. Address Misconceptions: Because DNA is negatively charged, some
students might think that the larger DNA strands will move faster towards
the positive end of the electrophoresis chamber because they have a larger
affinity/attraction for the positive charge.
What the teacher will do:
a. Monitor the time, you will need a 40 minute class period for the activity
b. Select two students to be “spotters”. Ask the class the following questions:
During
1. What do the two student spotters represent in a DNA gel
activity:
electrophoresis? Spotters represent the dye in the gel electrophoresis.
Dyes allow you to see how far the DNA fragments have travelled.
2. Why do you need to have the one student run as a standard?” The
Biology HSL
Department of Science
Page 429
Teacher
After
activity:
standard needed to be measure so the class has a reference point for
comparison.
c. Be sure each student lock arms in each run; each time increasing the
number of tightly locked students until the entire class is involved.
What the teacher will do:
a. Using the assumption that each student = 1000 DNA base pairs, have the
students plot the data on a graph. (y axis = # base pairs and x axis =
distance traveled in meters). Students should then draw the curve of best
fit. As an option, you may want to have the students use semi-log graph
paper as would be used with an actual gel. Graph should show that as the
number of base pairs/#of students increase; distance traveled will
decrease.
b. Discuss the process of electrophoresis to examine DNA samples.
1. Review the questions from the student worksheet
Extension:
 Gizmo: DNA Fingerprinting Analysis
Biology HSL
Department of Science
Page 430
Student
DNA Electrophoresis Simulation
(Adapted from: Mike Basham, El Dorado High School)
NGSSS:
SC.912.L.16.10 Evaluate the impact of biotechnology on the individual, society and the
environment, including medical and ethical issues. (AA)
Background Information:
Methods of DNA identification have been applied to many branches of science and technology,
including medicine (prenatal tests, genetic screening), conservation biology (guiding captive
breeding programs for endangered species), and forensic science. One of these techniques
involves gel electrophoresis.
DNA samples are often subjected to gel electrophoresis to characterize the size and number of
different fragments in the sample. Gel electrophoresis is used to analyze DNA or proteins.
Enzymes are used to cut the long DNA or protein samples at specific locations to form the
fragments. Then, the DNA or protein fragments are placed in a "well" with a DNA dye along the
top of the jello-like gel (agarose gel). Next, a current is applied to the gel, and the electrically
charged fragments of the sample migrate through the gel away from the wells. Strongly charged
pieces tend to migrate more quickly and, larger pieces migrate more slowly, since they have
more difficulty slipping through the gel's matrix. Because DNA is a negatively charged molecule,
it will always move toward the positive end of the gel electrophoresis box (red electrode). By
comparing the banding patterns of the samples with known substances (standard), scientists
can learn about the DNA or protein fragments. Repeated experiments with different enzymes
that cut at different locations help scientists determine the makeup of the DNA or protein
sample.
Problem Statement: Will a small fragment of DNA move faster than a larger fragment of DNA?
Safety:
 Take precautions to avoid injuring yourself or others when the experiment involves
physical activity.
 Alert your teacher if there is any reason you should not participate in the activity.
Vocabulary: biotechnology, genetic engineering, gel electrophoresis, DNA fingerprinting, DNA
base pairs, restriction enzyme, genome, genetic marker
Materials:
 Football, soccer or other large grass field (It is important to use a grass field in case
students fall during the activity.)
 50m or 100m measuring tape
 Stopwatch or other timing device
Biology HSL
Department of Science
Page 431
Student
Procedures:
1. The class is taken out to the football field and assembled in the end zone.
2. One student is selected as the timer.
3. Two students are chosen as "spotters" to mark how far each group of students is able to
migrate in the 10-second time period.
4. Two students are selected to operate the measuring tape and determine how far each
group of students migrates in the 10-second time period.
5. All students will record the data on a table.
6. Select one student and have him/her line up on the goal line. Using the standard "ready,
set, go" command, have the student run as fast as he/she can for 10 seconds.
7. Have the markers determine how far the student was able to travel in the 10-second
period. Finally, have the measurement team determine how far the student was able to
migrate in the time period. Have all students record the data.
8. For the next run, select 2-3 students and have them stand back-to-back and lock arms
tightly. Have this group of students migrate as far as they can in 10 seconds. Again, have
the marking and measurement teams determine the distance traveled. Have all students
record the data.
9. Repeat step 7 several more times, each time increasing the number of tightly locked
students in the group. For the last run, try to involve the entire class.
Biology HSL
Department of Science
Page 432
Student
Name: ____________________________________
Period: _____________
DNA Electrophoresis Simulation Worksheet
1. Construct a graph which plots the number of base pairs on the "Y" axis (remember each
person represents 1000 base pairs on the DNA ladder) vs. distance traveled on the "X"
axis. Draw the "curve of best fit" to represent the data.
2. Draw a diagram of the "gel" of what this DNA fingerprint would look like in the box below.
Be sure to label each band (how many base pairs in each band).
3. Using your graph, how many base pairs would you predict there would be in a DNA
segment that traveled 36m?
4. How far would you expect a segment of DNA which was 600-base-pairs long to migrate?
Explain how you arrived at your answer.
5. How far would you expect a segment of DNA which was 6000-base-pairs long to
migrate? Explain how you arrived at your answer.
Biology HSL
Department of Science
Page 433
Teacher
Identifying Organic Compounds
NGSSS:
SC.912.L.18.1 Describe the basic molecular structures and primary functions of the four major
categories of biological macromolecules. (AA)
Purpose of Lab Activity:
Note: This lab activity does not fulfill the AA benchmark but can be used to increase student
understanding of the role of macromolecules.
 To predict which types of macromolecules are present in various foods.
 To use several indicators to test for the presence of carbohydrates, proteins, and lipids in
some common foods.
 To become familiar with the sources of three of the four macromolecules of life.
Prerequisites: It is important that students are able to describe the molecular structures and
primary functions of the four major categories of biological molecules.
Materials (per group):
 10 Test tubes
 Test-tube rack
 Test-tube holder
 Masking tape
 Glass-marking pencil
 10-mL graduated cylinder
 Bunsen burner or hot plate
 Iodine solution Dissolve 5 g
potassium iodide and 1.5 g iodine
crystals in 500 mL of distilled water.
 20 mL Honey solution Dissolve 20 mL
honey in 500 mL distilled water.
 20 mL Egg white and water mixture
Mix egg whites from 3 eggs with 500
mL distilled water.
 20 mL Corn oil
 20 mL Lettuce and water mixture Mix
20 mL macerated lettuce with 500 mL
distilled water.













20 mL Gelatin and water solution
Dissolve 3.5 g gelatin in 346.5 mL
distilled water. Refrigerate until
needed.
20 mL Melted butter
20 mL Potato and water mixture Mix
20 mL macerated potato with 500 mL
distilled water.
20 mL Apple juice and water mixture
Mix 250 mL unsweetened apple juice
with 250 mL distilled water.
20 mL Distilled water
20 mL Unknown substance
10 Dropper pipettes
Paper towels
600-mL Beaker
Brown paper bag
Sudan III stain
Biuret reagent
Benedict’s solution
Procedure: Day of Activity:
What the teacher will do:
a. Prep work: Prepare the following solutions at least one day before the lab
investigation.
Before
1. Iodine solution - Dissolve 5 g of potassium iodide and 1.5 g iodine
activity:
crystals in 500 mL distilled water.
2. 20 mL Honey solution - Dissolve 20 mL of honey in 500 mL of distilled
water.
Biology HSL
Department of Science
Page 434
Teacher
b.
c.
d.
e.
f.
g.
h.
f.
g.
3. 20 mL Egg white and water mixture - Mix egg whites from 3 eggs with
500 mL of distilled water.
4. 20 mL Lettuce and water mixture - Mix 20 mL of macerated lettuce with
500 mL of distilled water.
5. 20 mL Gelatin and water solution - Dissolve 3.5 g of gelatin in 346.5 mL
of distilled water. Refrigerate until needed.
6. 20 mL Potato and water mixture - Mix 20 mL of macerated potato with
500 mL of distilled water.
7. 20 mL Apple juice and water mixture - Mix 250 mL of unsweetened
apple juice with 250 mL of distilled water.
8. Biuret solution must be fresh.
9. Benedict’s solution will not react with sucrose. Avoid materials that
contain sucrose.
Before beginning this activity, it is suggested that you review the basic
molecular structure and primary function(s) of the four main biological
macromolecules.
Students should read the entire investigation, and work with a partner to
answer the pre-lab questions. Once the students have completed the prelab questions, initiate a class discussion asking different students to share
their answers. Continue the discussion by asking the following questions:
1. Explain how carbohydrates, proteins, and lipids are classified.
2. How are lipids different from the other classes of macromolecules?
3. Explain how one would determine which food substances contain more
protein than others.
4. What materials in your bodies are made out of proteins? (hair,
fingernails, muscles, tendons, cartilage, enzymes, antibodies,
hemoglobin, hormones, etc.), fats? (cell membranes, insulating layer
around nerve cells, steroids, etc.) and carbohydrates? (energy source =
blood sugar, stored as glycogen in liver and muscles etc.).
Continue the discussion to include where we get the materials from to build
the structures and molecules inside of our bodies (through our food).
Have students brainstorm sources of proteins, carbohydrates and fats in
their diet.
Tell students that they will test various food items for the presence of these
three macromolecules.
Show students the available foods for testing. Ask them which ones they
expect to contain protein.
Demonstrate to students how to perform the tests for carbohydrates,
proteins, and lipids.
Grouping: Students should be divided up into three groups which rotate
between the stations (carbohydrate station, protein station, and lipid
station). There, students can work independently or in pairs. If you don't
use stations, students should work in pairs.
Time needed: At each station, students will need about 30 minutes. The
time required for this lab is 90 minutes.If you wish to shorten this
investigation, you may want to have your students omit Part D of the
Procedures (testing of an unknown substance). It is also possible to have
students test fewer than the eight listed food substances. If you wish to
Biology HSL
Department of Science
Page 435
Teacher
During
activity:
After
activity:
have students complete the entire investigation but do not feel that the time
within one class period is adequate, schedule Parts A, B, and C for one
class period and Part D for part of another class period.
What the teacher will do:
a. Monitor students as they carry out proper lab procedure.
b. The following questions can be used to engage student thinking during the
activity.
1. What is the purpose of this lab? The purpose of this lab is to determine
the presence of biological macromolecules in some common foods.
2. You have added Sudan III stain to each of the test tubes. What change
indicates the presence of lipids? The Sudan III stain will dissolve in
lipids and stain them red.
3. How do you know a food substance contains sugar by adding
Benedict’s solution? Benedict’s solution will change color from blue to
green, yellow, orange, or red in the presence of a simple sugar, or
monosaccharide.
4. How do you test for the presence of a protein in a food sample? Using a
biuret reagent to test for the presence of protein. The solution will
change color from yellow to blue-violet in the presence of a protein.
What the teacher will do:
a. The following questions may be used to engage student thinking after the
lab and asses their understanding.
1. Which test substances contain lipids? Corn oil and butter (possibly the
unknown).
2. Which test substances contain starch? Potato (possibly the unknown).
3. Which test substances contain simple sugar? Honey and apple juice
(possibly the unknown).
4. Which test substances contain protein? Egg white and gelatin (possibly
the unknown).
5. Which test substances did not test positive for any of the organic
compounds? Lettuce (possibly the unknown).
6. People with diabetes are instructed to avoid foods that are rich in
carbohydrates. How could your observations in this investigation help
you decide whether a food should be served to a person with diabetes?
The food could be tested using iodine and/or Benedict’s solution. If a
color change occurs, the food might not be appropriate for diabetics.
7. Your brown lunch bag has a large, translucent spot on the bottom. What
explanation could you give for this occurrence? Some food item in the
lunch bag contains lipids. (Students might say the bag accidentally
rested on a substance containing lipids.)
8. What conclusion could you make if a positive test for any of the organic
compounds occurred in the test tube containing only distilled water? The
test tube, distilled water, or indicators may have been contaminated.
The tests should be conducted again to achieve accurate results.
9. A very thin slice is removed from a peanut and treated with Sudan III
stain. Then a drop of Biuret reagent is added to the peanut slice. When
you examine the peanut slice under a microscope, patches of red and
blue-violet are visible. What conclusions can you draw from your
Biology HSL
Department of Science
Page 436
Teacher
examination? Peanuts contain lipids and proteins.
b. In order to connect concepts of the activity to the NGSS, have the students
develop a Venn Diagram on a large poster board to show the similarities
and differences of the three biological macromolecules investigated in this
activity. Make sure they include representative food substances as well as
molecular structures and functions for each of the three main categories.
This can be assigned as a home learning experience. The next day, have
students present their results before the class.
Extension:
 Gizmo: Identifying Nutrients
Biology HSL
Department of Science
Page 437
Student
Identifying Organic Compounds
(Adapted from Prentice Hall Biology Laboratory Manual A)
NGSSS:
SC.912.L.18.1 Describe the basic molecular structures and primary functions of the four major
categories of biological macromolecules. (AA)
Background:
All living things contain organic macromolecules: lipids, proteins, carbohydrates and nucleic
acids. Characteristic for these organic molecules is that they are made up of only a small
number of elements: carbon, hydrogen, oxygen, and to smaller amounts nitrogen, phosphorus
and sulfur. They are called "macromolecules" because they are very large, containing long
chains of carbon and hydrogen atoms and often consist of repeating smaller molecules bonded
together in a repeating pattern (polymers).
Macromolecule
Protein
Carbohydrate
Lipid
nucleic acid
Building Block
amino acids
monosaccharides
glycerol + fatty acids
nucleotides
In this investigation, you will determine which macromolecules are components of the foods you
eat. Substances, called indicators, can be used to test for the presence of organic compounds.
An indicator is a substance that changes color in the presence of a particular compound. You
will use several indicators to test for the presence of carbohydrates, lipids and proteins in
various foods.
Purpose of Lab Activity:
 To predict which types of macromolecules are present in various foods.
 To use several indicators to test for the presence of carbohydrates, proteins, and lipids in
some common foods.
 To become familiar with the sources of three of the four macromolecules of life
Safety: Wear safety goggles at all times in the science laboratory. Be careful to avoid breakage
when working with glassware. Always use special caution when using any laboratory
chemicals, as they may irritate the skin or cause staining of the skin or clothing. Never touch or
taste any chemical unless instructed to do so. Use extreme care when working with heated
equipment or materials to avoid burns. Wear plastic gloves when handling eggs or egg whites
or tools that have been in contact with them. Wash hands thoroughly after carrying out this lab.
Vocabulary: Macromolecule, Carbohydrates, Lipids (fats), Proteins, Sugar, Starch, Amino acid,
Glucose, Sucrose, Monosaccharide, Disaccharide, Polysaccharide, Enzyme, Fatty acids,
Polar/non-polar molecules, Nucleic acid, Polymer
Biology HSL
Department of Science
Page 438
Student
Materials (per group):
 10 test tubes
 Test-tube rack
 Test-tube holder
 Masking tape
 Glass-marking pencil
 10-mL graduated cylinder
 Bunsen burner or hot plate
 Iodine solution
 20 mL Honey solution
 20 mL Egg white and water mixture
 20 mL Corn oil
 20 mL Lettuce and water mixture
 20 mL Gelatin and water












20 mL Melted butter
20 mL Potato and water
20 mL Apple juice and water mixture
20 mL Distilled water
20 mL Unknown substance
10 Dropper pipettes
Paper towels
600-mL Beaker
Brown paper bag
Sudan III stain
Biuret reagent
Benedict’s
solution
Pre-Lab Discussion:
Read the entire investigation, and work with a partner to answer the questions below.
1. What is an indicator how are indicators used in this experiment?
2. What is the purpose of using distilled water as one of your test substances?
3. What is the controlled variable in Part C?
4. What is the purpose of washing the test tubes thoroughly?
5. You have added Sudan III stain to each of the test tubes. What change indicates the
presence of lipids?
Procedures:
Part A. Testing for Lipids
1. Place 9 test tubes in a test-tube rack. Use masking tape to make labels for each test
tube. Write the name of a different food sample (listed in Materials) on each maskingtape label. Label the ninth test tube “distilled water.”
2. Use a graduated cylinder to transfer 5 mL of distilled water into the test tube labeled
“distilled water.” Use a glass-marking pencil to mark the test tube at the level of the water.
Mark the other test tubes in the test-tube rack at the same level.
3. Use a separate dropper pipette to fill each of the other test tubes with 5 mL of the
substance indicated on the masking-tape label. Add 5 drops of Sudan III stain to each
test tube. Sudan III stain will dissolve in lipids and stain them red.
4. Gently shake the contents of each test tube. CAUTION: Use extreme care when handling
Sudan III to avoid staining hands or clothing. In the Data Table, record any color changes
and place a check mark next to those substances testing positively for lipids.
5. Wash the test tubes thoroughly but leave the labels on.
6. For another test for lipids, divide a piece of a brown paper bag into 10 equal sections. In
each section, write the name of one test substance, as shown in Figure 2. (Note:The
empty square can be used to test an unknown substance)
Honey
Egg white
Corn oil
Lettuce
Butter
Potato
Apple juice
Distilled water
Gelatin
Figure 2
Biology HSL
Department of Science
Page 439
Student
7. In each section, place a small drop of the identified food onto the brown paper. With a
paper towel, wipe off any excess pieces of food that may stick to the paper. Set the paper
aside until the spots appear dry—about 10 to 15 minutes.
8. Hold the piece of brown paper up to a bright light or window. You will notice that some
foods leave a translucent spot on the brown paper. The translucent spot indicates the
presence of lipids.
Part B. Testing for Carbohydrates
1. Sugars and starches are two common types of carbohydrates. To test for starch, use the
same dropper pipettes to refill each cleaned test tube with 5 ml of the substance
indicated on the masking-tape label. Add 5 drops of iodine solution to each test tube.
Iodine will change color from yellow-brown to blue-black in the presence of starch.
2. Gently shake the contents of each test tube. CAUTION: Use extreme caution when using
iodine as it is poisonous and can also stain hands and clothing. In the Data Table, record
any color changes and place a check mark next to those substances testing positive for
starch.
3. Wash the test tubes thoroughly.
4. For a sugar test, set up a hot-water bath as shown in Figure 3. Half fill the beaker with tap
water. Heat the water to a gentle boil. CAUTION: Use extreme care when working with
hot water. Do not let the water splash onto your hands.
5. While the water bath is heating, fill each cleaned test tube with 5 mL of the substance
indicated on the masking-tape label. Add 10 drops of Benedict’s solution to each test
tube. When heated, Benedict’s solution will change color from blue to green, yellow,
orange, or red in the presence of a simple sugar, or monosaccharide.
6. Gently shake the contents of each test tube. CAUTION: Use extreme caution when using
Benedict’s solution to avoid staining hands or clothing.
7. Place the test tubes in the hot-water bath. Heat the test tubes for 3 to 5 minutes. With the
test-tube holder, remove the test tubes from the hot-water bath and place them back in
the test-tube rack. CAUTION: Never touch hot test tubes with your bare hands. Always
use a test-tube holder to handle hot test tubes. In the Data Table, record any color
changes and place a check mark next to any substances that test positive for a simple
sugar.
8. After they have cooled, wash the test tubes thoroughly.
Part C. Testing for Proteins
1. Put 5 mL of the appropriate substance in each labeled test tube. Add 5 drops of biuret
reagent to each test tube. CAUTION: Biuret reagent contains sodium hydroxide, a strong
base. If you splash any reagent on yourself, wash it off immediately with water. Call your
teacher for assistance.
2. Gently shake the contents of each test tube. Biuret reagent changes color from yellow to
blue-violet in the presence of protein. In the Data Table, record any changes in color and
place a check mark next to any substances that test positively for protein.
3. Wash test tubes thoroughly.
Part D. Testing an Unknown Substance for Organic Compounds
1. Obtain a sample of an unknown substance from your teacher and pour it into the
remaining test tube. Repeat the tests described in Parts A, B, and C of the Procedure to
Biology HSL
Department of Science
Page 440
Student
determine the main organic compounds in your sample. Record your results in the Data
Table.
2. Wash the test tube thoroughly.
3. Wash your hands with soap and warm water before leaving the lab.
Observations/Data:
Lipid Test
Substance
Sudan
color
Lipids
Present
(X)
Carbohydrate Test
Iodine
color
Starches
Benedict’s
present
color
(X)
Protein Test
Sugars
Proteins
Present Biuret color Present
(X)
(X)
Honey
Egg white
Corn oil
Lettuce
Gelatin
Butter
Potato
Apple
juice
Distilled
water
Unknown
Results/Conclusions:
Classifying
1. Which test substances contain lipids?
2. Which test substances contain starch?
3. Which test substances contain simple sugar?
4. Which test substances contain protein?
5. Which test substances did not test positive for any of the organic compounds?
Drawing Conclusions
6. People with diabetes are instructed to avoid foods that are rich in carbohydrates. How
could your observations in this investigation help you decide whether a food should be
served to a person with diabetes?
7. Your brown lunch bag has a large, translucent spot on the bottom. What explanation
could you give for this occurrence?
8. What conclusion could you make if a positive test for any of the organic compounds
occurred in the test tube containing only distilled water?
9. A very thin slice is removed from a peanut and treated with Sudan III stain. Then, a drop
of Biuret reagent is added to the peanut slice. When you examine the peanut slice under
Biology HSL
Department of Science
Page 441
Student
a microscope, patches of red and blue-violet are visible. What conclusions can you draw
from your examination?
10. Develop a Venn diagram on a large poster to show the similarities and differences of the
three macromolecules investigated in this activity. Include representative food
substances as well as molecular structures and functions for each of the three
macromolecules. Be prepared to present your results before the class in a five minute
presentation.
Biology HSL
Department of Science
Page 442
Teacher
Protein Synthesis: Transcription and Translation
(Adapted from: Protein Synthesis Lab, www.Accessexcellence.org)
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Purpose of Lab/Activity:
 The student will learn the process of RNA transcription.
 The student will understand the implication of a mistake in RNA translation.
Prerequisites:
 Students should have already been introduced to the structure of DNA including the
phosphate backbone, deoxyribose sugar location, and the nucleotides found within it
such as Adenine (A), Cytosine (C), Guanine (G) and Thymine (T).
 Students should have learned about the importance of the base-pairing rule in DNA
structure and DNA replication.
 Students should understand process of transcription and compare of transcription vs.
replication.
o similarities: base-pairing rule crucial for both; monomers added one at a time and
joined by covalent bonds; carried out by a polymerase enzyme
o differences (see table on page 4 of student protocol)
 Students should understand the process of translation, including roles of mRNA, tRNA
and ribosomes
o understand function of mRNA and tRNA
o mRNA carries genetic message from nucleus to ribosomes; each mRNA codes for the
sequence of amino acids in a protein and each triplet codon in the mRNA codes for a
specific amino acid in the protein
o tRNA needed for translation -- different types of tRNA bring the right amino acid for
each position in the polypeptide; tRNA anti-codon has three nucleotides which are
complementary to the three nucleotides in an mRNA codon; the other end of each
tRNA molecule binds to the amino acid specified by that mRNA codon
o explain how proteins are synthesized using genetic information from DNA
Materials (per group):
 Pencils
 DNA strands worksheet
Procedures: Day of Activity:
What the teacher will do:
a. Make copies of the strands of DNA and table worksheet.
b. Essential Question: “What effect would occur from the change in the exact
chemical makeup of a protein?”
Before
c. Review the vocabulary words and the importance of the DNA “language”
activity:
d. Each codon (three nitrogenous base) codes for a specific amino acid;
discuss what will happen if one or two nitrogenous base is missing or
deleted.
e. Review the procedures on how to encode the mRNA with the table given.
Biology HSL
Department of Science
Page 443
Teacher
During
activity:
After
activity:
f. Misconceptions: DNA replication is similar to transcription but is not the
same. Students usually confuse them to have the same purpose. DNA
replication is for mitosis and meiosis. Transcription is for used to make a
copy of the DNA for the purpose to making a particular protein/enzyme.
What the teacher will do:
a. While students are decoding the DNA strand to mRNA, be sure the
students understand that RNA does not contain Thymine and contains
Uracil (U) instead.
b. Discuss the similarities of transcription and translation; and how the activity
closely related the process itself i.e. review and checking mechanisms.
c. Also, ask what happens in misread base in transcription and translation.
chromosomal mutation will occur including substitution, inversion, deletion,
duplication, non-disjunction
d. Review the “Data Analysis (Calculations)”, Have the students record the
entire list of amino acids and write it in on the board. Start with the
beginning segment, followed by the middle, and ending with tail. Refer to
worksheet.
What the teacher will do:
a. Review the results of the experiments in order to assess student’s
understanding of the protein transcription and translation.
b. Engage in class discuss using the following questions as a guide:
1. How many amino acids does this complete protein contain? 80
amino acids
2. This protein is called pro-insulin. In order for it to operate in the
body, a segment between #30 and #66 amino acids must be
removed. The remaining sections are reconnected to form
insulin. How many amino acids are there in the protein insulin?
51 amino acids
3. Explain the importance of having the exact genetic code for this
protein and why mutations can cause a problem. Answers
should include that insulin plays an important role in glucose
regulation and with mutations other methods have to be used to
monitor blood glucose.
4. If the sixth letter in the entire strand is changed to a “G,” does it
change the protein? Explain your answer.No it does not change
the protein. The change will code for the same amino acid.
5. If the sixth letter in the entire strand is changed to “T,” does it
change the protein? Explain your answer. Yes it also changes the
protein; change will code for Leu instead of Phe.
6. What if the last letter on the DNA strand was deleted due to an
environmental change? What could that do to the cell and to the
individual itself as a whole? The last letter being deleted would
cause a mutation in the cell and individual.
7. Discuss as a class the answers to #4, #5, and #6. Compare the
different responses and write a consensus for each on the board.
Biology HSL
Department of Science
Page 444
Teacher
Extension:
 Gizmo: RNA and Protein Synthesis
 Provide the students with the opportunity to research another protein and compare its
structure to the one shown below. What are the similarities in the function/structure of the
additional protein?
Biology HSL
Department of Science
Page 445
Teacher
Answer Key - Protein Synthesis: Transcription and Translation
Strand A
TACAAACATTTAGTTGTA AACACACCCTCAG TGGACCAACTCCGCAACATAAACCAAAC
A UG/U U U/G UA/A A U/C A A/C A U/UU G/U G U/G G G/A G U/C A C/C U G/GU U/G A G/G CG/U UG/U A U/U UG/G U U/UG
A C C G C T C G C G C C G A A A A A G A T A T G G G G G T T T T G G------------------------------------------------------------------------U/G G C/G AG/C G C/G G C/U UU/UU C/U A U/ A C C/C C C/A A A/A C C
Strand B
TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAATCCGCCGCCAGGGCCCCG
A G A/A G G/G A G/C G C/G AG/G AU/U UG/C A A/GU U/G G C/C AA/G U U/G AA/U U A/GG C/G G C/G G U/CC C/G G G/G C
C C C C T C A G A A G T T G G T G A T G C G-----------------------------------------------------------------------------------------------------------G/G G G/AG U/C UU/C A A/C C A/C U A/C G C
Strand C
AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCA
UU A/G A G/G GU/A G U/C U G/C AA/A A A/C G G/GG C/A UU/G U U/G AA/C A A/U G U/UG U/A C C/A G U/A UU/UG C/A G U
G A G A T G G T C A A T C T C T T A A T G A C G T T A A C T--------------------------------------------------------------------------------------C U C/U A C/C A G/UU A/G A G/AA U/U A C/U G C/A AU/U G A
Data (Tables and Observations):
DNA strand mRNA
Protein (amino acid or polypepetide chain)
Which
End?
A
Refer to key Met(start)-Phe-Val-Asn-Gln-Leu-Cys-Gly-Ser-His-Leu-Val-Glu-Ala-Leu-Val-Cys-Glyabove.
Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys-Thr
Start strand
B
Refer to key Arg-Arg-Glu-Arg-Glu-Asp-Leu-Gln-Val-Gly-Gln-Gln-Pro-Gly-Ala-Gly-Ser-Leu-Gln-Proabove.
Gln-Pro-Leu-Arg
Middle
strand
C
Refer to key Leu-Glu-Gly-Ser-Leu-Gln-Lys-Arg-Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Leuabove.
Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn-Stop
Last strand
Biology HSL
Department of Science
Page 446
Student
Protein Synthesis: Transcription and Translation
(Adapted from: Protein Synthesis Lab, www.Accessexcellence.org)
NGSSS:
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the
transmission and conservation of the genetic information. (AA)
Background Information:
Protein synthesis involves a two-step process. One strand of the DNA double helix is used as a
template by the RNA polymerase to synthesize a messenger RNA (mRNA). This mRNA
migrates from the nucleus to the cytoplasm. Then, in the cytoplasm, the ribosomes bind to the
mRNA at the start codon (AUG). The ribosome moves from codon to codon along the mRNA as
amino acids are added one by one to form a polypeptide (amino acid chain). At one of three
stop codons, the amino acid chain or polypeptide chain will stop forming. The instructions on the
mRNA are very specific and usually only code for one type of protein. If a “mistake” is made,
such as a deletion, inversion, or substitution, the whole protein may or may not change. This
could be either harmful, or beneficial.
Given the DNA code for the hormone insulin, you will determine the correct amino acid
sequence of a molecule. This exercise is divided into three strands of DNA that need to be
coded for their proteins. Each strand represents the beginning, the middle, or the end of the
insulin molecule. Based on the DNA code, the student will determine which segments is the
beginning, middle, or end of the insulin molecule. Once they have determined their segment,
they will group up with the missing two segments and complete the exercise.
Problem Statement: What effect would occur from the change in the exact chemical makeup of
a protein?
Vocabulary: transcription, translation, codon, anti-codon, messenger RNA (mRNA), mutations,
substitution, inversion , deletion, duplication, non-disjunction, transfer RNA (tRNA), ribosomes,
polypeptide, amino acid
Materials (per group):
 Pencils
 DNA strands worksheet
Procedures:
1. Decode the strands of DNA given you. Write out the resulting m-RNA in your chart
given.
2. Divide the m-RNA into its codons by placing a vertical line between them.
3. Using the amino acid chart found below, determine the name of the amino acid
that each codon codes for. In the chart below, write the abbreviation of the amino
acids in their proper order.
4. After examining the polypeptide chains just constructed, determine if it is a
beginning, middle, or an end segment of the pro-insulin molecule. (Hint: Look for a
start code at the beginning, a stop code at the end, or no stop or start code.)
Biology HSL
Department of Science
Page 447
Student
Biology HSL
Department of Science
Page 448
Student
Protein Synthesis: Transcription and Translation
Strand A
TACAAACATTTAGTTGTAAACACACCCTCAG TGGACCAACTCCGCAACATAAACCAAAC
ACCGCTCGCGCCGAAAAAGATATGGGGGTTTTGG
Strand B
TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAATCCGCCGCCAGGGCCCCG
CCCCTCAGAAGTTGGTGATGCG
Strand C
AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCA
GAGATGGTCAATCTCTTAATGACGTTAACT
Data (Tables and Observations):
DNA strand
mRNA
Biology HSL
Department of Science
Protein (amino acid or polypepetide chain)
Which
End?
Page 449
Student
Data Analysis:
1. Record the entire list of amino acids and write it in the space below. Start with the
beginning segment, followed by the middle, and ending with tail.
Results/Conclusions:
1. How many amino acids does this complete protein contain?
2. This protein is called pro-insulin. In order for it to operate in the body, a segment
between #30 and #66 amino acids must be removed. The remaining sections are
reconnected to form insulin. How many amino acids are there in the protein
insulin?
3. Write an essay on the importance of having the exact genetic code for this protein
and why mutations can cause a problem.
4. If the sixth letter in the entire strand is changed to a “G,” does it change the
protein? Explain your answer.
5. If the sixth letter in the entire strand is changed to “T,” does it change the protein?
Explain your answer.
6. What if the last letter on the DNA strand was deleted due to an environmental
change? What could that do to the cell and to the individual itself as a whole?
Biology HSL
Department of Science
Page 450
Teacher
Examining the Fossil Record
NGSSS:
SC.912.L.15.1 Explain the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
Purpose of the Lab/Activity:
 analyze characteristics of fossils
 compare placement of fossils and determine relative ages
 develop a model evolutionary tree based on the morphology and age of fossils
Prerequisites:
 Students should be familiar with the evidences that support the Theory of Evolution:
through comparative anatomy: homologous structures, analogous structure, and vestigial
structures; comparative embryology, and molecular biology.
Materials (per group):
 Chart paper
 Scissors
 Markers
 Glue or tape
Procedures: Day of Activity:
a. What the teacher will do: Set up different stations that would allow
space for each of the parts of the activity.
b. Make sure there is a copy of the lab for each group. Provide chart paper
or newsprint to record the information collected from their investigation.
Students will need space to cut out the “fossils” and arrange them in their
logical order.
c. It is important for students to complete an experimental design diagram
prior to the investigation in order for them to understand all parts of the
activity.
1. What is the problem statement? Allow the students to discuss with
their group and decide on a question they choose to answer. For
Before
example: How did the “fossil” of this species change over time? What
activity:
did the fossils suggest in terms of how this species evolved?
2. State the hypothesis. Answer will vary but should include both
independent and dependent variable or reasoning from the students
and what they might be looking for. In this type of investigation
QUALITATIVE DATA will be collected. Therefore, students will provide
analysis and discussion
3. Identify the possible independent and dependent variable.
Independent: progression of changes in the species Dependent:
analysis and conclusion of the way the species may have evolved.
4. Examples: how often the fossils branched, the number of differences,
possible age of the fossils found.
Biology HSL
Department of Science
Page 451
Teacher
d. Student misconceptions should be addressed:
The concept of
punctuated equilibrium versus gradualism as mechanisms for evolution,
geologic age where fossils are found, dating methods of rocks
surrounding fossils, index fossils and their use.
During
activity:
After
activity:
What the teacher will do:
a. Monitor students to make sure they are remaining on task and are
following proper lab protocol.
b. Review the experimental design diagram by asking individual students in
groups to explain the different parts of the experiment.
c. Follow laboratory procedural plan; making sure to model proper laboratory
safety and use of equipment.
d. Emphasize importance of data collection by groups, including
observations and analysis about the different “fossil samples” observed. .
e. Ask groups to brainstorm the different mechanisms for evolution and what
that may look like.
f. Ask the following questions:
1. Predict what kind of fossils you might expect in any of the gaps.
Explain your reasoning.
2. What kind of environmental or other selective pressures could have
caused the different changes in body plans in the species as
evidenced by the fossils?
What the teacher will do:
a. Analyze class data; making sure to note the importance of differing
opinions and allowing for class discussion for each of the points of views.
b. Remind students to pay close attention to the jumps in variations and the
different geologic time periods the fossils match. Have the groups report
their analysis and investigations to the rest of the class and defend their
statements.
c. Facilitate a group discussion for the students on the findings for the group
and the possible reasons for the adaptations and body plan changes in
the species.
d. Answer Key for Results:
1. Give a brief description of the evolutionary changes that occurred in
the organism. (Answers will vary among the groups, but must be
directly from observations from the pictures observed)
2. During which time period did the fossils differentiate into two
branches? (Coloradian)
3. Explain how the chart illustrates both punctuated equilibrium and
gradualism. Use specific fossils from the chart to support your
answer.(student answers should include a description of the change in
body plan during the Coloradian period for punctuated equilibrium and
any of the others for gradualism.)
4. Making the assumption that each fossil represents a separate species.
Explain how the chart illustrates divergent and phyletic speciation. Use
specific fossils from the chart to support your answer. (Student
answers will vary, but should include the change in body plans in the
Coloradian period as divergent speciation and the other less drastic
Biology HSL
Department of Science
Page 452
Teacher
changes as phyletic speciation.)
e. Define the following terms:
1. morphology (the form and structure of an organism considered as a
whole.)
2. fossil (A remnant or trace of an organism of a past geologic age, such
as a skeleton or leaf imprint, embedded and preserved in the earth's
crust)
3. phylogenetic tree (diagram that depicts the lines of evolutionary
descent of different species, organisms, or genes from a common
ancestor)
f. Examine the fossil that was unearthed in a museum, apparently the labels
and other information were lost. Using your fossil record, determine the
time period this fossil is likely from.
(Middle Montanian)
g. Of the two major species that arose from the parent species, which was
more successful? How do you know? (The species with more body
segments because there were more occurrences of this body plan in the
fossil record)
h. For each of the "blanks" on your fossil record make a sketch of what the
animal would look like. Draw these on your fossil record. (Answers will
vary)
Biology HSL
Department of Science
Page 453
Student
Examining the Fossil Record
NGSSS:
SC.912.L.15.1 Explain the scientific theory of evolution is supported by the fossil record,
comparative anatomy, comparative embryology, biogeography, molecular biology, and observed
evolutionary change. (AA)
Objectives:
 analyze characteristics of fossils
 compare placement of fossils and determine relative ages
 develop a model evolutionary tree based on the morphology and age of fossils
Background
Fossils are traces of organisms that lived in the past. When fossils are found, they are analyzed
to determine the age of the fossil. The absolute age of the fossil can be determined though
radiometric dating and determining the layer of rock in which the fossil was found. Older layers
are found deeper within the earth than newer layers.
The age and morphologies (appearances) of fossils can be used to place fossils in sequences
that often show patterns of changes that have occurred over time. This relationship can be
depicted in an evolutionary tree, also known as a phylogenetic tree.
There are two major hypotheses on how evolution takes place: gradualism and punctuated
equilibrium. Gradualism suggests that organisms evolve through a process of slow and
constant change. For instance, an organism that shows a fossil record of gradually increased
size in small steps, or an organism that shows a gradual loss of a structure. Punctuated
equilibrium suggests that species evolve very rapidly and then stay the same for a large period
of time. This rapid change is attributed to a mutation in a few essential genes. The sudden
appearance of new structures could be explained by punctuated equilibrium.
Speciation
The fossil record cannot accurately determine when one species becomes another species.
However, two hypotheses regarding speciation also exist. Phyletic speciation suggests that
abrupt mutations in a few regulatory genes occur after a species has existed for a long period of
time. This mutation results in the entire species shifting to a new species. Phyletic speciation
would also relate to the Punctuated Equilibrium hypothesis regarding evolution. Divergent
speciation suggests that a gradual accumulation of small genetic changes results in
subpopulation of a species that eventually accumulate so many changes that the
subpopulations become different species. This hypothesis would coincide with the gradualism
Biology HSL
Department of Science
Page 454
Student
model of evolution. Most evolutionary biologists accept that a combination of the two models
has affected the evolution of species over time.
Procedure:
1. The diagram you are creating requires a large space. To create your workspace, tape
together 8 sheets of standard sized paper and use a ruler to draw the following chart on
your workspace
Time Period
(2 1/2 inches wide)
Began (years ago)
(2 1/2 inches wide)
Wyomington (oldest)
995,000
Ohioian
745, 000
Nevadian
545,000
Texian
445,000
Oregonian
395,000
Coloradian
320,000
Montanian
170,000
Californian
80,000
Idahoan (the present)
30,000
Fossils
(8 inches wide)
(Each row
must be 5 inches tall)
here
2. The group of "fossils" you will work with are fictitious animals. Each fossil on your sheet is
marked with a time period. Cut out each fossil and make sure you include the time period
marked below it.
3. Arrange the fossils by age. On your data chart, place each fossil next to the period from
which the fossil came from. Some fossil names are preceded by “lower” and “upper”
descriptions. The term "upper" means more recent, these fossils should be placed lower
on the chart. The term "lower" means an earlier time period, fossils from a "lower" time
Biology HSL
Department of Science
Page 455
Student
period should be place toward the older time periods. In each fossil column, you may
have 3 specimens, one from the main time period, one from the upper, and one from the
lower. Not all fossils are represented, illustrating the incompleteness of any fossil record.
4. While keeping the fossils in the proper age order, arrange them by morphology
(appearance). To help you understand the morphology of the specimen, view the
diagram. Arrange the fossils using the following steps.
a. Center the oldest fossil at the top of the fossil column (toward the oldest layer)
b. Throughout the chart, those fossils that appear to be the same (or close to the same)
as the fossils preceding them should be placed in a vertical line
c. During a certain period, the fossils will split into two branches. In other words, one
fossil from that period will show one type of change, and another fossil will show a
different change. When this happens, place the fossils side by side in the appropriate
time period. From this point on you will have two lineages.
5. Once all the fossils have been placed correctly according to time and morphology, tape
or glue the fossils in place.
Analysis:
1. Give a brief description of the evolutionary changes that occurred in the organism.
2. During which time period did the fossils differentiate into two branches?
3. Explain how the chart illustrates both punctuated equilibrium and gradualism. Use
specific fossils from the chart to support your answer.
4. Making the assumption that each fossil represents a separate species. Explain how the
chart illustrates divergent and phyletic speciation. Use specific fossils from the chart to
support your answer.
5. Define the following terms:
a. morphology
b. fossil
c. phylogenetic tree
6. Examine the fossil that was unearthed in a museum, apparently the labels and other
information were lost. Using your fossil record, determine the time period this fossil is
likely from.
7. Of the two major species that arose from the parent species, which was more
successful? How do you know?
8. For each of the "blanks" on your fossil record make a sketch of what the animal would
look like. Draw these on your fossil record.
Biology HSL
Department of Science
Page 456
Student
Fossils
Biology HSL
Department of Science
Page 457
Teacher
Circulation Lab
(Adapted from: Prentice Hall. Biology Exploring Life)
NGSSS:
SC.912.L.14.36 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Purpose of Lab/Activity: The purpose of this activity is to:
1. Describe how the sounds of a heart through a stethoscope relate to the stages of a
heartbeat.
2. Observe the relationship between heart rate and exercise.
Prerequisite: Prior to this activity, the student should be able to:
 Label the parts of the heart
 Identify and describe the general flow of blood through the circulatory system
Materials (per station or per group):
 Stethoscope
 Rubbing alcohol
 Cotton balls
 Stopwatch
Procedures: Day of Activity:
What the teacher will do:
a. The teacher will have to gather all materials and should trouble shoot the
different heart rate monitors to determine if a constant and realistic heart
rate reading is observed.
b. The teacher will prepare 4 sets of stations, each set focusing on different
stimuli:
1. Exercise, and
2. Baroreceptor stimuli.
c. Engage students by eliciting prior knowledge and asking questions
pertinent for each station:
1. What effect does exercising have on the heart rate?
Before
2. How does the heart rate change as a person stands up starting from a
activity:
squatting position? (This motion produces a sudden increase in the
amount of blood circulation, how does this change affect the heart rate?)
d. Review general procedures for using the respiration and heart rate
monitors. It is expected that all students be involved and participate during
the lab. This means that all students must take turns in running the heart
rate monitor or in being the patient who is being monitored. Students need
to know what parts of the body are affected by stimulation of the
sympathetic nervous versus stimulation from the parasympathetic nervous
system.
e. As you start the lab, students need to be sure to have consistent and
realistic heart rates at the beginning of each experiment. Make sure that
students correctly gather and record their data.
Biology HSL
Department of Science
Page 458
Teacher
During
activity:
After
activity:
What the teacher will do:
a. Once the base line reading has been established, the student can be
directed to undergo the treatment phase. Treatment consists of performing
specific exercise as determined by the procedures. After the exercise
phase, the student can be directed to stand quietly next to the lab station to
begin the recovery phase.
b. As you walk around the room, question students on general concepts and
ideas. Examples:
1. What is the resting heart rate?
2. How a person’s vital sign can be an indicator about their health?
3. What are realistic base line values for vital signs?
4. What are some vital sign values that indicate if the person is in good
physical shape?
5. What are some vital sign values that indicate that the person’s vital
signs are showing a person in poor health?
c. As you walk around the room, question students on station specific
concepts and ideas. Examples:
Exercise Stimuli:
1. What are some of the reasons that the heart rate changes with increase
exercise?
2. Does the level of physical fitness have an effect on how quickly a
person’s heart rate recovers after exercise?
3. Describe what is changing within the muscles as you exercise.
4. What organs, besides the heart have increased use during exercise?
5. Do you expect to have an upper limit on increasing heart rate as you
exercise? Why/why not?
Baroreceptor Stimuli:
1. How much and in which direction (increase or decrease) did the heart
rate change as a result of standing? Squatting?
What the teacher will do:
Have the students share results with other students and have a class
discussion about data, graphs, and conclusions.
Extension:
 Gizmo: Circulation System
Biology HSL
Department of Science
Page 459
Student
Circulation Lab
(Adapted from: Prentice Hall. Biology Exploring Life)
NGSSS:
SC.912.L.14.36 Describe the factors affecting blood flow through the cardiovascular system.
(AA)
Background Information:
When the ventricles in your heart contract, your atrioventricular valves, pulmonary valve, and
aortic valve open and allow blood to flow through them. The valves then close, stopping blood
from flowing backward. As the valves close, they make sounds that can be heard using the
stethoscope. When the atrioventricular valves close, a “lub” sound is produced. When the
pulmonary and aortic valves close, a “dubb” sound is produced.
Heart rate is the number of times a minute that the ventricles in your heart contract and pump
blood. Each time blood is pumped, artery walls expand and then relax. This causes a surge of
blood that can be felt at certain points in your body—your pulse. Heart rate can be measured
without a stethoscope by measuring the pulse rate.
When you exercise, your heart rate increases. After exercise, the heart rate slows to a normal
resting rate. The length of time it takes for heart rate to return to normal after exercise is a
measure of the efficiency of the heart.
Problem Statement / Engagement: “How does heart rate change with exercise?”
Safety:
Vocabulary: heart rate, blood, pulse
Materials:
 Stethoscope
 Rubbing alcohol
 Cotton balls
 Stopwatch
Procedures:
1. Use alcohol-clean earpieces on the stethoscope.
2. Listen to your heart by placing the diaphragm (flat side of the stethoscope) over your
heart.
3. Describe what you hear in your data section of the lab.
Biology HSL
Department of Science
Page 460
Student
4. While sitting, take your pulse for 15 seconds and multiply it by 4 to get your heart rate per
hour. Record the result in your data section.
5. Run in place for 30 seconds. Immediately afterward, take your pulse for 15 seconds and
calculate your pulse per hour again; then record your findings.
6. After an additional 45 seconds (to allow a total recovery time of 1 minute after exercising)
take your pulse again for 15 seconds, calculate, and record it.
Data (Tables and Observations):
Describe the sounds of your heart: __________________________
Pulse Type
Sitting Pulse
Peak Pulse
Recovery Pulse
Pulse Rate
Data Analysis (Calculations):
1. Make a line graph to represent how your heart responds to exercise. Plot time on the xaxis and pulse rate on the y-axis. Use the equation below to calculate your maximum
heart rate:
220-your age in years = maximum heart rate per minutes
2. Use the equation below to calculate the lower end of your target heart rate, which is 70%
of your maximum heart rate.
Maximum heart rate X 0.7 = lower end of target heart rate zone
3. Use the equation below to calculate the upper end of your target heart rate zone, which is
80% of your maximum heart rate.
Maximum heart rate X 0.8 = upper end of target heart rate zone
Results and Conclusions:
1. Did the data support your hypothesis? Explain your answer.
2. While listening to someone’s heart, a doctor discovers that the “lub” sound is weaker than
the “dubb” sound. What might this clue suggest about the functioning of the heart valves?
3. While listening to your heart, did you find that there was more time between the “lub” and
the “dubb” sounds or between one “lub dubb” and the next? Suggest a possible
explanation.
4. Explain why athletes often have lower resting pulse rates than non-athletes.
5. How is it useful to know your target heart rate zone? What forms of exercise do you think
might increase your heart rate so that it is in your target heart rate zone?
Extension:
Repeat lab activity with people of different age groups.
Biology HSL
Department of Science
Page 461
Teacher
Cell Model Project
NGSSS:
SC.912.L.14.3 Compare and contrast the general structures of plant and animal cells. Compare
and contrast the general structures of prokaryotic and eukaryotic cells. (AA)
Purpose of the Lab/Activity:
 Construct a model of an animal or plant cell.
 Compare and contrast the general structures of plants and animals cells.
 Relate the structure to function for the components of plants and animal cells.
Prerequisites:
 An understanding of the cellular roles of biomolecules, including carbohydrates, lipids,
proteins, and nucleic acids.
Materials (per group):
 open space
Procedures: Day of Activity:
What the teacher will do:
a. Activate student’s prior knowledge:
1. What are some of the structures inside a cell that help it to live and
perform its role in an organism? Answers will vary. Students may be
aware of the nucleus and plasma membrane.
Before
2. How do you think plant cells differ from animal cells? (Hint: What can
activity:
plants do that animals cannot?) Answers will vary. Students may note
that plants can produce energy from sunlight, so they must need some
kind of structure for doing this.
b. Prior to this activity, Students’ misconceptions should be addressed. Some
common misconceptions are:
1. Cells are the same in all living things.
What the teacher will do:
a. It is suggested that the cell model project be completed as a home learning
activity, however if completed during class period have students review the
cell to city analogy. Website:
http://biology.unm.edu/ccouncil/Biology_124/Summaries/Cell.html
b. Creating an analogy of a cell to a city can help students understand the
basic functions of the organelles. You may use the analogy provided or
come up with your own.
During
In many ways, cells can be compared to the structures and institutions that
activity:
keep a city running.
c. As students are working or just after they are done, discuss the following
questions:
1. Which organelle functions like a city government? nucleus
2. Which organelle can be compared to the post office? golgi apparatus
3. Which organelle is the power plant for the cell? mitochondria
4. Which organelles are like factories? ribosomes
5. Which organelle is like a solar panel? chloroplast
Biology HSL
Department of Science
Page 462
Teacher
6. Which organelle is like a road system? endoplasmic reticulum
What the teacher will do:
a. Have the student groups present their cell models and explain how they
created their model. Randomly ask individual students to identify 5 parts
and explain their function.
b. Answer Key for Results/Conclusion:
1. Complete the following chart:
ORGANELLE
cell wall
LOCATION
plant, not animal
cell membrane both plant/animal
After
activity:
nucleus
both plant/animal
nuclear
membrane
cytoplasm
both plant/animal
DESCRIPTION
FUNCTION
*outer layer
*rigid, strong, stiff
*made of cellulose
*support (grow tall)
*protection
*allows H2O, O2, CO2 to
pass into and out of cell
*plant - inside cell wall *support
*animal - outer layer; *protection
cholesterol
*controls
movement
of
*selectively permeable materials in/out of cell
*barrier between cell and its
environment
*maintains homeostasis
*large, oval
*controls cell activities
*surrounds nucleus
*Controls
movement
of
*selectively permeable materials in/out of nucleus
both plant/animal *clear, thick, jellylike *supports
/protects
cell
material and organelles organelles
found
inside
cell
membrane
endoplasmic
both plant/animal *network of tubes or *carries materials through
reticulum (E.R.)
membranes
cell
ribosome
both plant/animal *small bodies free or *produces proteins
attached to E.R.
mitochondrion both plant/animal *bean-shaped with inner *breaks
down
sugar
membranes
molecules into energy
vacuole
plant - few/large *fluid-filled sacs
*store food, water, waste
animal - small
(plants need to store large
amounts of food)
lysosome
plant – uncommon *small, round, with a *breaks down larger food
animal - common membrane
molecules
into
smaller
molecules
*digests old cell parts
chloroplast
plant, not animal *green, oval usually *uses energy from sun to
containing
chlorophyll make food for the plant
(green pigment)
(photosynthesis)
2. Complete a Venn Diagram to compare plant and animal cells. Use table
above to check student’s diagram.
3. Identify two similarities and two differences between plant and animal
cells. Similar: nucleus, plasma membrane, mitochondria Different: plant
cells have cell walls and chloroplasts; animal cells have neither
Biology HSL
Department of Science
Page 463
Teacher
Extension:
 Gizmo: Cell Structure
 The Biology Place Lab Bench: Cell Structure and Function
 Cells Alive! Website: http://www.cellsalive.com/cells/3dcell.htm
Biology HSL
Department of Science
Page 464
Student
Cell Model Project
NGSSS:
SC.912.L.14.3 Compare and contrast the general structures of plant and animal cells. Compare
and contrast the general structures of prokaryotic and eukaryotic cells. (AA)
Background: (Source: www.explorelearning.com)
All living cells can be divided into two general groups, the prokaryotes and eukaryotes. All
bacteria are prokaryotes, while all other organisms (protists, fungi, plants and animals) are
eukaryotes. Prokaryote cells are more simple and primitive than eukaryote cells. Prokaryotes
have no nucleus, lack most organelles (they do have ribosomes), and lack internal membranes.
Eukaryotes, by contrast, have a nucleus and a variety of membrane-bound organelles.
Many of the differences between plants and animals are explained by differences between plant
cells and animal cells. Plant cells have three structures that animal cells lack: a cell wall,
chloroplasts, and a large vacuole. Chloroplasts allow the plant to produce its own food from
sunlight, carbon dioxide, and water. The cell wall provides support and structure to the plant cell,
but does not facilitate mobility. The vacuole stores water for the plant and also helps support the
cell.
Because they cannot produce their own food, animals must consume other organisms for
energy. Animal cells are descended from mobile protists that used flagella, cilia, or pseudopods
to move around and hunt for food. Some of these protists could engulf other organisms by
surrounding them with their cell membrane. (Our white blood cells use this method to engulf
harmful bacteria.) The only organelle that is unique to animal cells is the lysosome, a sac of
digestive chemicals that animals use to break down food. Animal cells generally have greater
energy requirements than plant cells, and usually contain more mitochondria than plant cells.
Problem Statement: Do plant and animal cells have the same structures?
Vocabulary: Cell membranes, cell wall, rough endoplasmic reticulum, smooth endoplasmic
reticulum, chloroplast, nucleus, nucleolus, lysosome, vacuole, centriole, cytoplasm,
mitochondria, ribosomes, Golgi apparatus.
Materials (per group):
 You will be providing your own materials, use recyclable household items.
Requirements:
 Your cell must be 3-dimensional, as was shown in class. This means it needs to have a
front, back, and sides. It cannot be a piece of paper with things glued on it. Your plant cell
must be rectangular and/or your animal cell must be circular.
 Materials used should be recyclable household items that are not edible. Be unique and
creative.
 All parts of your cell must be labeled clearly in order to receive credit; I suggest using
toothpicks and pieces of paper to make little flags, as was shown in class.
 Your representations of the organelles must be similar to the ones seen in class: for
example, your nucleus can not be square. Review the chapter on cells in your textbook,
and also diagrams for plant and animals cells that we have gone over in class.
Biology HSL
Department of Science
Page 465
Student


You must be able to locate parts on your model and explain their functions. You will be
asked to identify 5 parts (at random) and explain their function.
You will use the attached rubric to see which organelles need to be present, accurate,
and labeled. You will turn your copy of the rubric when you turn in your 3-D model.
Results/Conclusion:
1. Complete the following chart.
Location
Organelle
(plant and/or
Description
Function
animal)
cell wall
cell membrane
nucleus
nuclear
membrane
cytoplasm
endoplasmic
reticulum (E.R.)
ribosome
mitochondrion
vacuole
lysosome
chloroplast
2. Complete a Venn diagram in your journal to compare plant and animal cells.
3. Identify two similarities and two differences between plant and animal cells.
Biology HSL
Department of Science
Page 466
Student
Name: ______________________________________
Group: ________________
3-D Plant Cell Model Project Rubric
Grading:
You will initially start with a 100 for your project grade. You will lose points for the following
items:
 Missing an organelle (deduct 4 points for each organelle)
 Missing a label on an organelle (deduct 4 points for each label)
 Organelle is mislabeled (deduct 4 points for each mistake)
 No name on project (deduct 4 points)
 Plant cell is not square (deduct 20 points)
 Project is sloppy (deduct up to 8 points)
 Project is late (deducted: 10 points per day: after 5 days project grade is a 0)
 Project is not three-dimensional (deduct 30 points)
Remember: Your project grade is worth 100 points total. It is intended to help you better
understand the cell and improve your grade. Please take this seriously and turn it in on time.
Organelle
Cell Wall
Cell Membrane
Cytoplasm
Nucleus
Nucleolus
Smooth ER
Rough ER
Ribosomes
Golgi Complex
Vacuoles
Mitochondria
Chloroplasts
Present
Label
Total
General Project Guidelines
No name on project
Plant cell is not square
Sloppiness
Not 3-dimensional
Late: Date turned in: __________
Total
# of days late:_____________
Final Grade: __________/100__
Comments:
Biology HSL
Department of Science
Page 467
Student
Name: ______________________________________
Group: ________________
3-D Animal Cell Model Project Rubric
Grading:
You will initially start with a 100 for your project grade. You will lose points for the following
items:
 Missing an organelle (deduct 4 points for each organelle)
 Missing a label on an organelle (deduct 4 points for each label)
 Organelle is mislabeled (deduct 4 points for each mistake)
 No name on project (deduct 4 points)
 Animal cell is not circular (deduct 20 points)
 Project is sloppy (deduct up to 8 points)
 Project is late (deducted: 10 points per day: after 5 days project grade is a 0)
 Project is not three-dimensional (deduct 30 points)
Remember: Your project grade is worth 100 points total. It is intended to help you better
understand the cell and improve your grade. Please take this seriously and turn it in on time.
Organelle
Cell Membrane
Cytoplasm
Nucleus
Nucleolus
Smooth ER
Rough ER
Ribosomes
Golgi complex
Vacuoles
Mitochondria
Lysosomes
Present
Label
Total
General Project Guidelines
No name on project
Animal cell is not circular
Sloppiness
Not 3-dimensional
Late: Date turned in: __________
Total
# of days late:_____________
Final Grade: __________/100__
Comments:
Biology HSL
Department of Science
Page 468
Teacher
Investigating Inherited Traits
(Adapted from: District Adopted – Prentice Hall Lab Manual B)
NGSSS:
SC.912.L.16.1 Use Mendel’s laws of segregation and independent assortment to analyze
patterns of inheritance. (AA)
Purpose of Lab/Activity:
 To investigate the probability of genotypes and phenotypes of an offspring.
 To investigate traits that are dominant, hybrid, and recessive.
Prerequisites:
 Students should understand the concepts of Punnett squares, probability, genotype,
dominant traits, recessive traits, alleles, genes, and phenotype.
 Review Mendels’s laws of segregation and independent assortment.
 Students should understand how these processes occur in the cell during the process of
Meiosis.
 Students should also be familiar with the following modes of inheritance: dominant,
recessive, co-dominant, sex-linked, polygenic, and multiple alleles.
Materials (per pair):
 3 textbooks
 2 coins
Procedure: Day of Activity:
What the teacher will do:
a. Prep work: To reduce the noise produced by the flipping of coins, use
plastic disks used for bingo or tiddlywinks (available at toy or hobby shops).
1. Have students place a small piece of masking tape on each side of the
two disks. Mark one side of each disk ”H” (heads) and the other side of
each disk “T” (tails).
2. Remind students that the pieces of masking tape should be the same
size so that both sides of the coin or disk are the same mass. (Optional)
b. Essential question (or problem statement):
“If you have both parent phenotypes for a trait, then can you accurately
predict the phenotype of an offspring?”
Before
The answers to the hypothesis will vary; an acceptable answer can be that
activity:
they could not accurately determine the phenotype of the offspring
because of recessive traits.
c. Some common misconceptions associated with inherited traits and how
they can be resolved are provided below:
1. Students incorrectly believe that if no one else in the family is affected,
the condition is not inherited. Students often believe that if they do not
see a characteristic such as in their family, then it must not be inherited.
For example, if a student had a hitchhikers thumb, but their parents and
possibly grandparents did not, then the student may believe something
happened to their thumb to make it bend back. This is especially
common with genetic disorders, like colorblindness, which often skip
Biology HSL
Department of Science
Page 469
Teacher
generations. Drawing Punnett Squares and pedigrees can help students
visualize that some traits or genetic disorders tend to skip generations.
2. Students inaccurately believe that traits are inherited from only one of
their parents. Some students believe girls inherit most of their
characteristics from their mothers and boys inherit most of their
characteristics from their fathers. Some students may also believe their
mothers give them more genetic material because they were carried in
their mothers as fetuses. Students may tend to believe they look more
like one parent and therefore they received most of their genetic
material from that parent. In reality, each parent contributes half of their
genetic material to their offspring. One parent may pass more dominant
traits to their offspring, which would result in that offspring looking more
like that parent. This misconception can be overcome by discussing the
processes of meiosis and fertilization.
3. Students have difficulty with the relationship between genetics, DNA,
genes, and chromosomes. Students may realize that physical
appearances are inherited, but they may not make the connection that
these characteristics have underlying biochemical processes, such as
Meiosis. They do not understand the position of the traits on the
structure of a chromosome. This misconception can be overcome
through review and use of chromosomes in the discussion of Punnett
squares. Students need to understand that calculating probability in a
Punnett square is truly calculating the probability of which chromosome
will be present in a sex cell.
4. Students have difficulty distinguishing the difference between acquired
and inherited characteristics. While many of our characteristics come
directly from our genetics, that is not the case for all of our
characteristics. Genetics plays a role in some behaviors and diseases,
but the majority of these are the result of one’s environment. Talent is
something that can be inherited, but skills must be practiced in order for
talent to develop. This misconception can be overcome by looking at
several examples of inherited characteristics and several examples of
acquired characteristics.
5. Students inaccurately believe that one gene controls one trait and all
genetics show Mendelian patterns of inheritance. When teaching
genetics, it is important to emphasize that there are non-Mendelian
patterns of inheritance. Most traits in humans are not monogenic
(controlled by one gene). Monogenic traits are the first examples that we
teach, so students assume that all traits are governed by one gene.
Examples should be given for other patterns of inheritance, such as
polygenic inheritance or linked genes, which will not show Mendelian
patterns.
d. Have students read through the laboratory procedures.
e. Make sure that they know what to look for in each phenotype. You may
want to point out each phenotype (particularly the earlobes and the widow’s
peak) to the class and answer any questions students may have about their
identification.
f. Explain to the students that the actual combination of some genes is more
Biology HSL
Department of Science
Page 470
Teacher
During
activity:
After
activity:
complicated than is indicated here. Some traits shown in Figure 1 actually
result from multiple genes. In order to simplify the investigation, assume
that all of the traits used are the result of a single allele pair.
What the teacher will do:
a. Circulate throughout the room to make sure that students are properly
identifying each phenotype.
1. Emphasize to students that no phenotype listed is more or less
desirable than another.
2. Discourage any kind of comparisons or observations that might make a
student feel self-conscious about a particular trait, such as the shape of
his or her earlobes or the amount of freckles he or she has.
b. Use the following questions to engage student thinking during the activity.
1. What does a single side of the coin or disk represent? Each side
represents one of two possible alleles.
2. What are the chances that any coin or disk tossed will land heads up?
The chance of a coin or disk landing heads up is ½, or one out of two.
3. How is a coin toss like the selection of a particular allele? They are alike
because the results of both occur only by chance.
4. For the traits in this investigation, do all heterozygous pairs of alleles
produce an intermediate phenotype? No, some phenotypes are the
result of either homozygous combination of alleles.
5. Can you accurately determine a person’s genotype by observing his or
her phenotype? Explain. No, some phenotypes are the result of either
homozygous or heterozygous combinations of alleles.
c. Have the students repeat this investigation with their partner to “produce” a
second offspring. Afterwards, they can make a drawing of their offspring.
What similarities exist between your first and second offspring? What are
the differences? Would you expect a third offspring to resemble either the
first or the second offspring? Explain your reason.
What the teacher will do:
a. Make a table on the white board of each student’s results and form a class
analysis table to see which traits are most dominant in the class.
b. The following questions may be used to engage student thinking after the
activity and to connect the concepts of this activity to the NGSSS.
1. What percent chance did you and your partner have of “producing” a
male offspring? There is a 50% chance of producing either a male or a
female offspring because there is a 50% chance that the coins will land
with the same side up.
2. Would you expect the other pairs of students in your class to have an off
spring completely similar to yours? Explain your answer? No. Because
there are so many traits being modeled, and chance plays an important
role in this investigation, it would be highly unlikely to have two
completely similar offspring.
3. What are the possible genotypes of the parents of a child who has wavy
hair (Hh)? HH and Hh; Hh and Hh; Hh and hh.
4. Which traits in this investigation showed incomplete dominance? Size of
mouth, nose, ears, and eyes; shape of lips; texture of hair; spacing of
eyes.
Biology HSL
Department of Science
Page 471
Teacher
5. Do you think that anyone in the class has all the same genetic traits that
you have? Explain your answer. No. With the exception of identical
twins, each person has a unique combination of many genetic traits
passed on by parents.
6. How might it be possible for you to show a trait when none of your
relatives shows it? Relatives might be heterozygous; one or more
masked recessive genes could be passed to you. As a homozygous
recessive for that trait, you would display the recessive trait.
Extension:
 Gizmo: Mouse Genetics (1 trait), Mouse Genetics (2 traits)
Biology HSL
Department of Science
Page 472
Student
Investigating Inherited Traits
(Adapted from: District Adopted – Prentice Hall Lab Manual B)
NGSSS:
SC.912.L.16.1 Use Mendel’s laws of segregation and independent assortment to analyze
patterns of inheritance. (AA)
Background:
Heredity is the passing on of traits, or characteristics, from parent to offspring. The genetic
makeup of an individual is known as its genotype. The physical traits you can observe in a
person are his or her phenotype. Phenotype is a result of the genotype and the individual’s
interaction with the environment. The units of heredity are called genes. Genes are found on the
chromosomes in a cell. An allele is one of two or more forms of a gene. When the two alleles of
a pair are the same, the genotype is homozygous, or pure. When the two alleles are not the
same, the genotype is heterozygous, or hybrid. In nature, specific combinations of alleles
happen only by chance.
Some alleles are expressed only when the dominant allele is absent. These alleles produce
recessive phenotypes. Alleles that are expressed when the genotype is either homozygous or
heterozygous produce dominant phenotypes. An allele that codes for a dominant trait is
represented by a capital letter, while an allele that codes for a recessive trait is represented by a
lowercase letter.
Sometimes when the genotype is heterozygous, neither the dominant nor recessive phenotype
occurs. In this case, an intermediate phenotype is produced.
In humans, the sex of a person is determined by the combination of two sex chromosomes.
People who have two X chromosomes (XX) are females, while those who have one X
chromosome and one Y chromosome (XY) are males. In this investigation, you will see how
different combinations of alleles produce different characteristics.
Problem Statement: If you have both parent phenotypes for a trait, then can you accurately
predict the phenotype of an offspring?
Vocabulary: allele, dominant, genotype, heterozygous
intermediate inheritance, phenotype, recessive
(hybrid),
homozygous
(pure),
Materials (per group):
 3 textbooks
 2 pennies
Procedures:
1. Make a hypothesis based on the problem statement above for the resources being
supplied.
2. Place the textbooks on the laboratory table so that they form a triangular well.
3. Obtain two coins. You and your partner will each flip a coin to determine the traits in a
hypothetical offspring.
Biology HSL
Department of Science
Page 473
Student
4. Start by determining the sex of the offspring. Flip the coins into the well. If both coins land
the same side up, the offspring is a female. If the coins land different sides up, the
offspring is a male. Record the sex of the offspring in the blank on “Data Analysis” page.
5. For the rest of the coin tosses you will make, heads will represent the dominant allele and
tails will represent the recessive allele.
6. You and your partner should now flip your coins into the well at the same time to
determine the phenotype of the first trait, the shape of the face. Note: The coins should
be flipped only once for each trait. After each flip, record the trait of your offspring by
placing a check in the appropriate box in Figure 1.
7. Continue to flip the coins for each trait listed in the table in Figure 1.
8. Note: Some information in Figure 1 has been simplified. Some listed traits are actually
produced by two or more genes.
9. Using the recorded traits, draw the facial features for your offspring in the space provided
on the “Data Analysis” page.
Biology HSL
Department of Science
Page 474
Student
Observations/Data:
Biology HSL
Department of Science
Page 475
Student
Biology HSL
Department of Science
Page 476
Student
Data Analysis:
Sex of offspring ___________________________________________________
Drawing of Offspring:
What percentage chance did you and your partner have of “producing” a male offspring? A
female offspring? Explain your answer.
Biology HSL
Department of Science
Page 477
Student
Results/Conclusions:
1. Would you expect the other pairs of students in your class to have an offspring
completely similar to yours? Explain your answer.
2. What are the possible genotypes of the parents of a child who has wavy hair (Hh)?
3. Which traits in this investigation showed incomplete dominance?
4. Do you think that anyone in your class has all the same genetic traits that you have?
Explain your answer.
5. How might it be possible for you to show a trait when none of your relatives shows it?
Biology HSL
Department of Science
Page 478
Teacher
Enzyme Catalyst Lab
NGSSS:
SC.A.912.L.18.1 Describe the basic molecular structures and primary functions of the four
major categories of biological macromolecules. (AA)
Purpose of Lab:
 Investigate the effect of variations in enzyme concentration on rate of reaction.
 Investigate the effect of variations in substrate concentration on rate of reaction.
Prerequisites: Review with students how enzymes affect activation energy. Describe how an
enzyme’s shape is important to its function. Ensure that students know the difference between
the meaning of the word catalase and the word catalyst. Some students may confuse these
terms. It is important that students are familiar with all of the vocabulary terms listed in the
student section.
Materials (per group):
 Yeast solution
 Eight 50 ml beakers
 Hydrogen peroxide
 Distilled water
 Filter paper disks




Marking pencil
Forceps
Paper towels
Graph paper
Procedure: Day of Activity:
What the teacher will do:
g. Prep work: Obtain all materials and prepare yeast solution well before
beginning this lab activity.
h. Before passing out the lab, have the students think about what processes in
the body use enzymes to function. Be sure to discuss as a class the vital
enzymes for human digestion such as protease, amylase, lipase, etc.
i. Use the following questions to engage student thinking during a pre-lab
discussion:
1. What does catalyzed mean?
2. How does the induced-fit model apply to this lab activity?
3. What other factors can affect the rate of reaction?
Before
4. What is meant by “denaturation of the protein?”
activity:
j. Assign four students per group. For student reference, make copies of the
“Lab Roles and Their Descriptions.”
k. Review the background information with the students.
1. Write the formula for hydrogen peroxide, H2O2, on the white board. Then
write the following equation for its decomposition: 2H2O2  2H2O + O2
2. Ask the following question. If hydrogen peroxide is a liquid, what might
you expect to see when it decomposes? (Accept all reasonable
answers.) Bubbles of gas will be visible as oxygen is released and water
remains.
3. Explain to students that the function of the enzyme, catalase, is to
speed up the decomposition of hydrogen peroxide.
l. Read aloud or have a student read aloud the problem statement at the
Biology HSL
Department of Science
Page 479
Teacher
During
activity:
After
activity:
beginning of the investigation. Based upon the problem statement, have
students decide on an individual hypothesis for their lab group, focusing on
lower concentration effects and higher concentration effects on the rate of
reaction.
m. Remind students that they will complete a minimum of three trials for each
peroxide solution.
What the teacher will do:
d. Circulate throughout the room and help any group that is having trouble
with any aspect of the procedure.
e. Monitor students for safety procedures, and keep students focused on their
hypothesis.
f. The following questions may be used to engage student thinking during the
lab activity:
1. What is the substrate in this investigation? What is the enzyme?
2. What is the function of the enzyme in this investigation? 3. What are the
reactants and products in the following equation? 2 H2O2 → 2 H2O + O2
What the teacher will do:
a. Ask the following questions.
1. Was your hypothesis confirmed or refuted?
2. How do your results compare to your preconceptions of what would
happen?
3. What experimental conclusions can you now draw from your data?
b. Ask the following questions to connect the concepts of this activity to the
NGSSS.
1. Explain the role of activation energy in a reaction. How does an enzyme
affect activation energy?
2. Describe how a substrate interacts with an enzyme.
c. In a five-minute oral presentation, the students should share with the class
the results of their investigation. Here, they should state their hypothesis
and discuss whether their results confirm or refute their hypothesis. (Allow
for time to debate and discussion between groups.)
d. Have students complete a formal lab report.
Extension:
 Gizmo: Collision Theory
 This Extension is necessary to fulfill the annually assessed benchmark associated
with this unit:
1. Choose another factor to test. Develop a new problem statement and design a new
experiment to test for this factor. Record all parts of the lab (from the parts of a lab) in
your journal. Present your findings to the class.
2. Make sure to identify the test (independent) variable, responding (dependent)
variable, controls, and constants.
Biology HSL
Department of Science
Page 480
Student
Enzyme Catalyst Lab
NGSSS:
SC.A.912.L.18.1 Describe the basic molecular structures and primary functions of the four
major categories of biological macromolecules. (AA)
Background:
This lab focuses on one particular enzyme – catalase. Catalase plays an indispensable role in a
living cell by preventing the accumulation of toxic levels of hydrogen peroxide formed as a
byproduct of metabolism. The enzyme, catalase, speeds up the breakdown of hydrogen
peroxide (H2O2) into water (H2O) and oxygen gas (O2). The reaction is described by the
following equation:
2 H2O2 → 2 H2O + O2
Problem Statement: How will different concentrations of hydrogen peroxide affect the reaction
of an enzyme? Or develop your own problem statement and experiment based on the factors
that can affect the reaction rate of a catalyst. (pH, temperature, or concentration)
Safety:
 Hydrogen peroxide is an oxidizer and could bleach clothing.
 Protect clothing by wearing a lab apron.
 Wear safety goggles
Vocabulary: activation energy, active site, enzyme, catalase, catalyst, denaturation, enzyme,
induced-fit model, rate of reaction, substrate
Materials (per group):
 Yeast solution
 Hydrogen peroxide
 Filter paper disks
 Forceps
 Eight 50 ml beakers
 Distilled water





Marking pencil
Paper towels
Hot plate
Vinegar
Graph paper
Procedures:
1. Make a hypothesis based on the problem statement.
2. Prepare peroxide solutions in separate test tubes as outlined in Table 1.
Table 1: Concentration Hydrogen Peroxide Solutions
Concentration
0% Peroxide Solution
25% Peroxide Solution
50% Peroxide Solution
75% Peroxide Solution
100% Peroxide Solution
Biology HSL
Department of Science
Hydrogen Peroxide
0 ml
9 ml
18 ml
27 ml
35 ml
Distilled Water
35 ml
27 ml
18 ml
9 ml
0 ml
Page 481
Student
3. Using the forceps, dip a filter paper disk into the beaker containing the solution of
activated yeast. Keep the disk in the solution for 4 seconds, and then remove it.
4. Place the disk on a paper towel for 4 seconds to remove any excess liquid.
5. Using the forceps, transfer the filter paper disk to the bottom of a rubber stopper.
Note: The yeast solution contains the catalase enzyme and when the enzyme soaked
disk comes into contact with hydrogen peroxide, the reaction results in the formation of
oxygen bubbles.
6. Insert the stopper into one of the test tubes and quickly invert the test tube. Have one
person in your group measure how long it takes for the bubbles to carry the disk to the
top of the test tube. Record the time in a data table similar to the one shown below.
7. Repeat steps 2-5 until you have a minimum of three trials for each peroxide solution.
8. Calculate the average rising time for each of the peroxide solutions. Record this
information in your data table.
9. Construct a graph plotting the concentration of hydrogen peroxide on the x-axis
(independent variable) and rising time on the y-axis (dependent variable).
Observations/Data:
Table: Rising Time
Beaker
Trial 1
Trial 2
Trial 3
Average
0% Peroxide
25% Peroxide
50% Peroxide
75% Peroxide
100% Peroxide
Data Analysis:
Construct and analyze a graph from your table.
Results/Conclusions:
1. Suppose you had placed a filter paper disk in a 30% peroxide solution. Using your graph,
predict how long it would take this disk to rise to the top.
2. In a paragraph describe how the concentration of peroxide affects the breakdown rate of
hydrogen peroxide. Use the results of this experiment to justify your answer.
3. In a paragraph explain why your hypothesis was or was not supported.
4. Complete a formal laboratory report.
Extension:
1. Choose another factor to test. Develop a new problem statement and design a new
experiment to test for this factor. Record all parts of the lab (from the parts of a lab) in
your journal. Present your findings to the class.
2. Make sure to identify the test (independent) variable, responding (dependent) variable,
controls, and constants.
Biology HSL
Department of Science
Page 482
Teacher
Animal-Vertebrate Fish "Perch" Dissection
(Adapted from: Prentice Hall Biology and various internet sites)
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Purpose of Lab/Activity: The purpose of the lab is to:
1. Observe and identify the external parts of a fish.
2. Dissect and identify the internal organs of fish.
3. Observe and record the movement and breathing rate of goldfish.
Prerequisites: Prior to this activity, the student should be able to know the names of anatomical
structures from the vocabulary of the student section of this laboratory. The student should be
familiar with the classification system of organisms.
Materials:
 Preserved perch (fish)
 Dissecting tray
 Dissecting kit
 Dissecting microscope
 Paper towel
 Plastic bags





Live goldfish
Beaker
Water from aquarium
Fish net
Stopwatch
Procedure: Day of Activity:
Before
activity:
During
activity:
After
activity:
What the teacher will do:
a. Acquire necessary materials and have stations ready for each group to survey or
enough of each species in order for each group to survey all the species.
b. Review the important parts or vocabulary with the students.
c. Review safety procedures and guidelines, making sure that goggles, gloves, and
aprons are being used.
d. Group the students in productive teams. You can assign roles based on guidelines
provided by the District. This would assist in classroom management and
accountability.
What the teacher will do:
a. Provide guidance and support for questions on how to make initial incisions and
dissection cuts. Move about the room and be available.
What the teacher will do:
Have a class discussion about the data collected and whether the hypotheses were
proven or not.
Discuss and review new questions that may have arisen about the evolutionary
features of vertebrate fish.
Extension:
 Repeat the experiment with a cartilaginous fish for comparison.
 Write a report on jawless fish or lobe-finned fish (coelacanth).
Biology HSL
Department of Science
Page 483
Student
Animal-Vertebrate Fish "Perch" Dissection
(Adapted from: Prentice Hall Biology and various internet sites)
NGSSS:
SC.912.L.15.6 Discuss distinguishing characteristics of the domains and kingdoms of living
organisms. (AA)
Objective/Purpose: The purpose of the lab/activity is to:
1. Observe and identify the external parts of a fish.
2. Dissect and identify the internal organs of fish.
3. Observe and record the movement and breathing rate of goldfish.
Background Information:
Fishes are members of the phylum chordate and the subphylum vertebrata. The largest class of
fishes, class Osteichthyes, contains fishes with skeletons made of bone. Fishes exhibit many
adaptations for life in an aquatic environment. The perch and the goldfish are representative
members of the Osteichthyes class.
Problem Statement / Engagement:
1. How are the structures of a fish evident of adaptations for living in an aquatic
environment?
2. What is the relationship between the number of times the mouth of the goldfish opens
and closes and the number of times the gill covers move?
Materials:
 Preserved perch (fish)
 Dissecting tray
 Dissecting kit
 Dissecting microscope
 Paper towel
 Plastic bags





Live goldfish
Beaker
Water from aquarium
Fish net
Stopwatch
Procedures:
1. Obtain a preserved fish and rinse under running water to remove excess preservatives.
2. Make observations of the external anatomy and fill in the observations table.
3. Fill a large glass beaker three-quarters full with water from an aquarium.
4. With a fish net, transfer one goldfish into beaker.
5. Observe the goldfish and using a stopwatch count how many times the fish opens and
closes its mouth in one minute. Count how many times the gill covers move in one
minute.
6. Carefully return the goldfish to its appropriate aquarium.
7. Using your thumb, lift up the edge of the operculum on the preserved fish and raise it up
as far as you can. Using your scissors, cut the operculum off as close to the eye as
possible. You have exposed the gills. The gills are layered one on top of another.
8. Using your probe, carefully lift each of these layers. How many layers do you find?
9. Using your scissors, remove one of these layers. Examine the feathery structure.
10. To expose the internal organs you will cut away part of its muscular wall. Grasp your
preserved fish, holding it with your thumb on one side and fingers on the other. Turn your
Biology HSL
Department of Science
Page 484
Student
hand upward to expose the ventral surface. Using your scissors, insert the point into the
skin just in front of the anus. Cut forward to the gills. Be careful not to destroy any of the
internal organs, since they are mostly found in this area.
11. Place your thumb into the open cut area and lift up, separating the bottom from the top.
Using your scissors, cut upward near the anus and the operculum and form a flap of skin
and muscle. Finish cutting along the lateral line and remove the flap of tissue. See the
figure below.
12. The fish contains a 2-chambered heart. Locate this organ found just behind and below
the gills.
13. Locate the tube-like digestive system. Begin just behind the mouth in the area called the
pharynx. This area leads into the gullet or the opening of the esophagus. This area is
very elastic and can stretch when the fish is alive.
14. Locate the rather large liver located just in front of the stomach.
15. Follow the intestine to the anus.
16. Locate the kidneys, found just below the spinal column. Their main function is to rid the
body of nitrogenous waste.
17. The swim bladder is the last remaining organ to be identified. It is located between the
kidneys and gonads.
18. Label the perch figure.
19. Draw or record the different internal and external features and organs in your journal or
handout.
Biology HSL
Department of Science
Page 485
Student
Data (Tables and Observations):
Type of Fin
Anterior dorsal
Posterior dorsal
Anal
Caudal
Pectoral
Pelvic
Body part
Mouth opening and
closing
Gill cover movement
Body Part
Gills
Operculum
Heart
Liver
Kidneys
Swim Bladder
Anus
Data Table 1: External Anatomy
Function
Data Table 2: Goldfish Behavior
Number of times recorded in one minute
Data Table 3: Internal Anatomy
Function
Data Analysis (Calculations):
1. How is the fish’s body shape an adaptation to its environment?
2. What is the relationship between the number of times the mouth opens and closes and
the number of times the gill covers move?
3. How are the perch’s teeth adapted to their function?
4. What does the body structure imply about its evolutionary origins?
Results and Conclusions:
1. What structures on the perch make it adapted for living in an aquatic environment?
2. While many invertebrates have an exoskeleton, vertebrates such as fishes have an
endoskeleton. Of what advantage to the fish is the endoskeleton?
3. The perch fertilizes its eggs externally and leaves the eggs exposed on rocks. The guppy
fertilizes its eggs internally and gives birth to live young. Which fish probably produces
fewer eggs? Explain your response.
4. Write a conclusion of your observations following the guidelines on the Parts of a Lab
Report: A Step-by-Step Checklist.
Biology HSL
Department of Science
Page 486
Anti-Discrimination Policy
Federal and State Laws
The School Board of Miami-Dade County, Florida adheres to a policy of nondiscrimination in employment and
educational programs/activities and strives affirmatively to provide equal opportunity for all as required by:
Title VI of the Civil Rights Act of 1964 - prohibits discrimination on the basis of race, color, religion, or
national origin.
Title VII of the Civil Rights Act of 1964 as amended - prohibits discrimination in employment on the basis of
race, color, religion, gender, or national origin.
Title IX of the Education Amendments of 1972 - prohibits discrimination on the basis of gender.
Age Discrimination in Employment Act of 1967 (ADEA) as amended - prohibits discrimination on the basis of
age with respect to individuals who are at least 40.
The Equal Pay Act of 1963 as amended - prohibits gender discrimination in payment of wages to women and
men performing substantially equal work in the same establishment.
Section 504 of the Rehabilitation Act of 1973 - prohibits discrimination against the disabled.
Americans with Disabilities Act of 1990 (ADA) - prohibits discrimination against individuals with disabilities
in employment, public service, public accommodations and telecommunications.
The Family and Medical Leave Act of 1993 (FMLA) - requires covered employers to provide up to 12 weeks of
unpaid, job-protected leave to "eligible" employees for certain family and medical reasons.
The Pregnancy Discrimination Act of 1978 - prohibits discrimination in employment on the basis of
pregnancy, childbirth, or related medical conditions.
Florida Educational Equity Act (FEEA) - prohibits discrimination on the basis of race, gender, national origin,
marital status, or handicap against a student or employee.
Florida Civil Rights Act of 1992 - secures for all individuals within the state freedom from discrimination
because of race, color, religion, sex, national origin, age, handicap, or marital status.
Title II of the Genetic Information Nondiscrimination Act of 2008 (GINA) - prohibits discrimination against
employees or applicants because of genetic information.
Boy Scouts of America Equal Access Act of 2002 – no public school shall deny equal access to, or a fair
opportunity for groups to meet on school premises or in school facilities before or after school hours, or
discriminate against any group officially affiliated with Boy Scouts of America or any other youth or
community group listed in Title 36 (as a patriotic society).
Veterans are provided re-employment rights in accordance with P.L. 93-508 (Federal Law) and Section 295.07
(Florida Statutes), which stipulate categorical preferences for employment.
In Addition:
School Board Policies 1362, 3362, 4362, and 5517 - Prohibit harassment and/or discrimination against
students, employees, or applicants on the basis of sex, race, color, ethnic or national origin, religion, marital
status, disability, genetic information, age, political beliefs, sexual orientation, gender, gender identification,
social and family background, linguistic preference, pregnancy, and any other legally prohibited basis.
Retaliation for engaging in a protected activity is also prohibited.
Revised: (07.14)