Journal of Integrative Agriculture 2016, 15(0): 60345-7
Available online at www.sciencedirect.com
ScienceDirect
RESEARCH ARTICLE
Establishment of an avian leukosis Virus subgroup A-resistant cell line
FENG Min1, 2, 3, 4*, DAI Man-man1, 2, 3, 4*, LIAO Ming1, 2, 3, 4, CAO Wei-sheng1, 2, 3, 4
1
College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, P.R.China
National and Regional Joint Engineering Laboratory for Medicament of Zoonosis Prevention and Control, Guangzhou 510642,
P.R.China
3
Key Laboratory of Veterinary Vaccine Innovation, Ministry of Agriculture, Guangzhou 510642, P.R.China
4
Key Laboratory of Zoonosis Prevention and Control of Guangdong Province, Guangzhou 510642, P.R.China
2
Abstract
Rapid diagnostic methods for classifying avian leukosis subgroups in the field were needed for routine, large-scale screening. As a first step in method development, we inserted the avian leukosis virus subgroup A (ALV-A) env gene into plasmid
pcDNA3.1/Zeo (+) and used this construct to transfect DF-1 cells. Zeocin-resistant cells were obtained after 2 weeks of
zeocin selection. Then, the cells were analyzed using PCR, immunofluorescence, and Western blot for expression of the
envA-encoded envelope protein after 30 serial passages. The DF-1/A cell line was completely resistant to 104 TCID50 (50%
tissue culture infective dose) ALV-A and was partially resistant to 105 TCID50 ALV-A viral particles. By comparing the DF-1/A
and DF-1 cell lines, an ALV-A isolate was identified using a gag-specific ELISA for capsid protein p27. Thus, we established
a DF-1/A cell line that was resistant to ALV-A infection. This cell line will be useful as a diagnostic tool.
Keyword: avian leukosis virus subgroup A (ALV-A), env, DF-1/A cell line, diagnostic tool
1. Introduction
Avian leukosis viruses (ALVs) cause a number of neoplastic
diseases and reproduction problems in chickens. ALVs belongs to the family Retroviridae, subfamily Orthoretrovirinae,
and genus Alpharetrovirus. Chicken ALVs are classified
into A, B, C, D, E, and J subgroups based on their antibody
cross neutralization patterns and host ranges (Payne and
Received 13 April, 2016 Accepted 14 July, 2016
FENG Min, E-mail: hunanfengmin@163.com; Correspondence
CAO Wei-sheng, Tel: +86-20-85282536, Fax: +86-20-85280234,
E-mail: caoweish@scau.edu.cn
*
These authors contributed equally to this study.
© 2016, CAAS. All rights reserved. Published by Elsevier Ltd.
doi: 10.1016/S2095-3119(16)61453-3
Nair 2012). A new ALV subgroup has been recently identified
in China in 2012 (Cui et al. 2014).
Because there are no effective eradication programs for
ALV infections in most chicken farms in China, ALV infections
in chickens remain widespread. ALV strains have spread
throughout China (Li Y et al. 2013), and the frequency of new
strain emergence has required the development of faster
detection tools to aid eradication programs. Therefore,
diagnostic methods suitable for ALV eradication programs
in China should be established.
Retroviruses efficiently infect host cells via specific surface receptors that can interact with viral envelope glycoproteins (Coffin et al. 1997). The retroviral envelope protein
can block superinfection of viruses in the same subgroup by
saturating cell surface receptors (Hunt et al. 1999). Using
this principle, a cell line (DF-1/J) has been established,
which is able to resist infection by a diverse group of ALV-J
isolates (Hunt et al. 1999). Previous experiments have
*** et al. Journal of Integrative Agriculture 2016, 15(0): 60345-7
proven that animals and chicken germ line cells that express
ALV-A envelope glycoproteins are resistant to superinfection
by subgroup A retroviruses (Crittenden et al. 1989; Salter
and Crittenden 1989, 1991).
ALV-A strains were prevalent in the 1970s–1980s and
caused decreased production traits including egg numbers,
fertility, and hatchability in chickens (Payne and Nair 2012).
Though ALV-A is not widespread in China today, it still can
be isolated from many places and has been isolated from
wild birds (Li D et al. 2013).
There is a need for a method of subgrouping ALV isolates
that is suitable for routine, large-scale screening of field
samples. In this study, we expressed the ALV-A env gene
in DF-1 cells to establish the DF-1/A cell line. DF-1/A cells
were resistant to ALV-A infection. We used this new cell
line to identify an ALV-A strain by comparing DF-1/A and
DF-1 cells using ELISA and PCR. This study demonstrates
that the DF-1/A cell line is useful for mass screening and
analysis of ALV isolates in both experimental and industrial
laboratory settings.
2. Materials and methods
2.1. Cell and virus
The DF-1 fibroblastic cell line developed spontaneously
from a high-density seeding of fibroblasts. This cell line was
developed from 10-day-old Line 0 (EV-0) chick embryos and
was known to be susceptible only to exogenous ALV (Himly
et al. 1998). ALV-J strain CHN06 (Zhang et al. 2011), ALV-A
strains RAV-1 and GD13-1, plasmid RCAS(A) as well as
DF-1 cells were provided by the Key Laboratory of Veterinary Vaccine Development, Ministry of Agriculture of China.
2.2. Molecular biology methods
The ALV-A env gene was amplified using PCR from
plasmid RCAS (A) using the oligonucleotide primers
F (CGCGGATCCGCCACCATGGAAGCCGTCATTAAGGCATTTCTGACTGGATACCCT) and R (AAGGAAAAAAGCGGCCGCTTATACTATTCTGCTT). The primers contained
BamHI (underlined) and NOTI (double underline) restriction
endonuclease sites for cloning into the plasmid vector pcDNA3.1/Zeo (+) (Invitrogen, Carlsbad, CA, USA). Sequences
surrounding the start codon (bold) were modified to conform to
an optimal Kozak consensus sequence (italics) (Kozak 1991).
The PCR amplifications were performed in 50 µL reaction
volumes using 100 ng of plasmid RCAS(A), 1× TaKaRa LA
Taq DNA polymerase, and 0.6 µmol L–1 primers. Amplification was carried out via incubation at 95°C for 5 min, then
30 cycles of 95°C for 30 s, 57°C for 30 s, 72°C for 2 min,
with a final extension time of 8 min at 72°C. The amplified
3
product of 1 884 bp representing the coding sequence for the
ALV-A env was gel-purified, digested with BamHI and NotI,
and then cloned into pcDNA3.1/Zeo (+) using the BamHI
and NotI sites in the vector. The identity of the insert in the
pcDNA-env-A plasmid was confirmed via sequencing.
Then, the purified pcDNA-env-A plasmid was transfected
into DF-1 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) and 6-well plates. 48 h after the transfection,
the cells were detached via 0.25% trypsin digestion and
suspended in Dulbecco’s modified Eagle’s medium (DMEM)
containing 15% FBS (Gibco, Carlsbad, CA, USA) and 200
µg mL–1 of zeocin (Invitrogen). The cells were added at 500
μL aliquots per well to 24 well plates and incubated until the
appearance of colonies. Single colonies appeared approximately 2 weeks later. These colonies were expanded by
changing the growth medium every 3 to 4 days while maintaining zeocin (200 µg mL–1) selection. The selected cells
were subcultured up to 30 times using the abovementioned
procedure. The cells were named DF-1/A and have since
been cultured in a medium without zeocin while maintaining
envA expression.
2.3. Indirect immunofluorescence assay
An indirect immunofluorescence assay (IFA) test was performed on DF-1/A cells using an ALV-A specific antibody
(courtesy of the Avian Disease and Oncology Laboratory,
East Lansing, MI, USA). Binding of the primary antibody
was detected using FITC-labeled goat-anti-mouse IgG
(Sigma-Aldrich, USA).
2.4. Analysis of env expressed in DF-1/A
To validate env expression in DF-1/A cells, we used Western blot to compare DF-1/A with normal DF-1 cells. Total
cellular proteins (20 μg) were subjected to SDS-PAGE and
transferred to nitrocellulose membranes. The membranes
were blocked with 5% skimmed milk for 2 h at 37°C and then
incubated overnight at 4°C with a specific mouse anti-ALV-A
specific antibody and a rabbit anti-actin antibody. The
membranes were washed and incubated with a secondary
horseradish peroxidase (HRP)-labelled goat anti-mouse
IgG or with an anti-rabbit IgG (Zhongshan Goldenbridge,
Beijing, China). The protein bands were detected using
the ECL Plus kit (Beyotime Inst Biotech, Shanghai, China).
Band densities were measured using the Image-Pro Plus 6.0
software (Media Cybernetics, USA) from images obtained
using a CanoScan LiDE 100 scanner (Canon, Japan).
2.5. Determination of antiviral effect of DF-1/A cells
DF-1/A cells and DF-1 cells infected with dilutions (100 to
4
*** et al. Journal of Integrative Agriculture 2016, 15(0): 60345-7
104) of ALV-J (CHN06) and ALV-A (RAV-1 and GD13-1) were
diluted with DMEM. The viral dilutions (in triplicate) were
inoculated into 1.7×105 cells mL–1 in 24-well plates. The
cells were cultured in DMEM with 10% FBS at 37°C with
5% CO2 except when grown as a monolayer when 1% FBS
was used. The supernatants from DF-1/A and DF-1, which
were collected after freezing and thawing, were analyzed
for p27 antigen ELISA (IDEXX, USA) detection after 6 days
of culturing according to the manufacturer instructions.
ELISA results are reported as s/p values according to the
manufacturer protocol, where s/p=(Sample mean–Cell culture negative control mean)/(Kit positive control mean–Cell
culture negative control mean).
other hand, fluorescence in the DF-1 cells was completely
absent (Fig. 3).
To further confirm the IFA results, we generated protein
lysates from confluent DA-1/A and DF-1 monolayers and
subjected them to Western blot. A protein band with an
expected molecular weight of ~90 kDa was detected in DF1/A but not in DF-1 lysates (Fig. 4). Altogether, these results
indicate that DF-1/A cells express the env gene product.
3.2. Antiviral effects of DF-1/A cells
Expression of a subgroup-specific env gene product on
2.6. Field ALV-A identification
The isolated from the clinical plasma sample virus was inoculated into both DF-1/A and DF-1 cells, and p27 antigen
ELISA (IDEXX, USA) was performed on the supernatants
after 6 days of culturing. PCR tests were carried out with
genomic DNA extracted from infected DF-1 cells using
primers specific for ALV-A, B, and J, as previously described
(Smith et al. 1998; Fenton et al. 2005; Silva et al. 2007).
2.7. DF-1/A cell line storage
As previously described (Lai et al. 2011), PCR tests were
performed using primers specific for ALV-A, B, J, and reticuloendotheliosis virus (REV) with genomic DNA extracted
from DF-1/A cells to detect whether the DF-1/A cells were
contaminated by virus. Then, DF-1/A cells were submitted
to the China Center for Type Culture Collection (CCTCC).
Fig. 1 Photomicrograph of a confluent DF-1/A monolayer (200×
magnification).
M
DF-1
DF-1/A
3. Results
3.1. DF-1/A cell analysis
Zeocin-resistant DF-1/A cells were routinely cultured in
DMEM supplemented with 10% FBS, and their morphology
was similar to the parental DF-1 cells (Fig. 1). Both types
displayed a uniform, fibroblast-like morphology and formed
monolayers on plastic tissue culture plates.
To confirm that DFA-1/A cells had integrated the transfected env gene, we compared PCR products from DF-1
and DF-1/A cells using env-specific primers. The expected
1 884 bp fragment was observed with DNA from the DF-1/A
cells but not from its parental counterpart (Fig. 2).
If DF-1/A cells expressed a functional env gene, then the
cloned gene product should have been detectable on the
cell surface. We compared DF-1/A cells with DF-1 cells in
an IFA using an ALV-A-specific antibody. DF-1/A cells displayed a positive, albeit weak, fluorescence (Fig. 3). On the
bp
2 000
1 000
Fig. 2 Agarose gel analysis of env-specific PCR products
that were amplified from DF-1 and DF-1/A cells, respectively.
M, molecular size markers; bp, base pairs of designated size
markers.
*** et al. Journal of Integrative Agriculture 2016, 15(0): 60345-7
DF-1/A
DF-1
Fig. 3 Indirect immunofluorescence assay (IFA) analysis of
pcDNA-env-A expression in the DF-1/A cell line and its parental
counterpart DF-1 cells (200× magnification).
DF-1/A
DF-1
env
β-actin
Fig. 4 Western blot analysis of the pcDNA-env-A envelope
expression in the DF-1/A cell line and in its parental counterpart
DF-1. β-actin was used as a loading control.
the cell surface precludes infection by viruses of that same
subgroup. To determine whether env expression acts as a
surrogate for superinfection from the subgroup A virus, we
experimentally infected DF-1/A cells with two subgroup A
viruses (RAV-1 and GD13-1) and with the subgroup J virus
5
CHN06. Then, using ELISA, we measured p27 capsid
protein levels in infected cells to determine whether the
experimental virus set up a productive infection.
All three viruses were equally capable of infecting DF-1
cells (Fig. 5). This result was expected because this cell
line was free from avian retroviruses. In contrast, only the
subgroup J strain CHN06 infected the DF-1/A cells. The
two subgroup A viruses were almost completely blocked
from infecting these cells (Fig. 5). Higher viral loads of 105
TCID50 virus particles resulted in measurable p27 levels in
DF-1/A cells. However, these levels were at least 10-fold
lower than that of the control and near the assay detection
limits (Fig. 5).
3.3. Field ALV-A identification
Next, the antiviral effects or resistance to subgroup A superinfection of the DF-1/A cell line were tested using a field
virus sample. In the traditional p27 ELISA assay format, the
clinical sample was not able to infect DF-1/A cells but was
capable of infecting DF-1cells (Fig. 6). This result indicated
that the field virus sample identity should be subgroup A.
Next, we used ALV-A/B/J-specific PCR analysis to confirm this result. The 690-bp ALV-A-specific fragment was
identified only in the field sample and in the positive control
lanes (Fig. 7, lanes 1 and 3). The absence of ALV-J and
ALV-B PCR products in lanes 4 and 7 indicated that the
clinical sample contained only the subgroup A virus (Fig. 7).
Fig. 5 p27-specific ELISA analysis of the antiviral effects of
DF-1/A cells on virus superinfection. Cells were infected with
the indicated virion concentrations that were predetermined
using tissue culture infective dose (TCID50) values for titering
virus stocks. Virus subgroup and name are listed above each
graph. s/p, sample to positive ratio.
6
*** et al. Journal of Integrative Agriculture 2016, 15(0): 60345-7
3.4. DF-1/A cell line storage
The ALV-A-resistant cell line DF-1/A was submitted to the
China Center for Type Culture Collection (CCTCC) and was
given a preservation number C2014180. Exogenous ALV
and REV-specific PCR analyses confirmed that the DF-1/A
cell line was not infected with the common field infectious
neoplastic viruses (Fig. 8).
4. Discussion
Retroviruses enter host cells via specific interactions between cell membrane receptors and the viral envelope
protein, and ALV is not an exception. The envelope protein
surface subunit (SU) initially binds to the cell surface receptors, and conformational changes of the envelope protein
transmembrane (TM) subunit drives fusion of the viral and
cellular membranes (Mothes et al. 2000). Different ALV
subgroups use different receptors such as the low-density
lipoprotein receptor (Tva encoded by tva gene), which
mediates ALV-A infections (Bates et al. 1993, 1998). The
receptors for all other major ALV subgroups (e.g., ALV-J,
ALV-B/D, ALV-C, and ALV-E) have been identified (Brojatsch
et al. 1996; Adkins et al. 1997; Elleder et al. 2005; Chai and
Bates 2006).
During the early stage of ALV entering into the host cell,
ALV synthesizes envelope proteins that are transported to
the cell membrane when virus finally exits post-replication.
This saturates the corresponding receptors, which leads to
the resistance to superinfection by another virus that uses
the same cellular receptor (Hunt et al. 1999). We wanted
to better understand whether an envelope protein singly
expressed in a cell interfere with the entry of viruses encoding the same env gene product. This would amount to
an artificial method of testing resistance to superinfection.
We constructed a plasmid env expression vector. In addition, from ALV-A, we constructed a cell line with a stable
M
ALV-A
–
+
1
2
3
ALV-J
–
+
4
5
6
ALV-B
–
+
7
8
9 M
bp
2 000
1 000
750
500
Fig. 6 p27-specific ELISA results of supernatants from DF-1/A
and DF-1 cells after 6 days of incubation with a field sample of
unknown virus subgroup.
ALV-A
DF-1/A –
+
ALV-B
DF-1/A –
Fig. 7 Classification of ALV types from a field sample using
ALV-A, B, and J specific PCR. The samples are grouped in
triplicate according to virus subtype-specific PCR primer pairs:
lanes 1–3, ALV-A; lanes 4–6, ALV-J; lanes 7–9 ALV-B. Lanes
1, 4, 7, experimental sample genomic DNA; (–), no template
control; (+), subgroup-specific plasmid DNA.
+
ALV-J
DF-1/A – +
REV
DF-1/A –
+
bp
2 000
1 000
750
500
250
100
Fig. 8 ALV-A, B, J, and REV specific PCR analysis for the detection of exogenous viral infections of the DF-1/A cell line. Virus
subgroup names at the top of the gel indicate plasmid DNA containing cloned genes of the specified virus. DF/A, DF-1/A cell line
genomic DNA; M, molecular size standards in bp of the indicated gel marker bands; (–), no template control; (+), subgroup-specific
plasmid DNA.
*** et al. Journal of Integrative Agriculture 2016, 15(0): 60345-7
expression of envelope protein.
Our IFA and Western blot results demonstrated that
the envelope protein was successfully expressed and was
functional, as confirmed by the antiviral tests. However,
the green fluorescence and the envelope protein band
were weak. The pcDNA3.1/Zeo (+) vector did not contain
a chicken-specific promoter. Thus, the low envelope protein
expression was most likely the result of decreased promoter
activity. Additionally, this low expression most likely resulted
in the ability of an increased viral load to infect the DF-1/A
cells at 105 TCID50.
The traditional methods of ALV subgroup classification
include receptor interference and virus neutralization patterns (Vogt and Ishizaki 1965; Ishizaki and Vogt 1966).
However, these tests rely on RSV pseudotypes and immune
sera and are labor intensive, time-consuming, and are not
suitable for routine diagnostic work (Vogt and Ishizaki 1966;
Venugopal et al. 1998). Other methods that distinguish between different ALV subgroups using PCR, qRT-PCR, and
loop-mediated isothermal amplification (LAMP) have been
reported, and each of these methods have their advantages
and disadvantages (Zhang et al. 2010; Qin et al. 2013). For
example, Hunt et al. (1999) established a DF-1/J cell line
that was resistant to infection by a diverse group of ALV-J
isolates and was a useful diagnostic tool.
The DF-1 parental cell line used in our study was highly
susceptible to ALV subgroups A and J. Because DF-1/A cells
are resistant to ALV-A infection and remain ALV-J-susceptible suggests that ALV-A and ALV-J use different receptors
for cell invasion. Our ALV-A-resistant cell line DF-1/A can
also serve as a useful diagnostic tool and can provide a
reliable and rapid method for screening large number of
samples. Inoculation of DF-1/A and DF-1 cells with unknown subgroup field samples will explicitly identify ALV-A
using the classical p27 ELISA. Samples containing only
ALV-A will produce a negative p27 response infecting the
DF-1/A cells and a positive p27 response using the DF-1.
Mixed samples containing ALV-A and other ALV subgroups
will be positive on both cell types. A special case is when
a titer of the ALV-A in samples is >104 TCID50. Thus, there
may be a weak positive p27 response using DF-1/A cells.
This problem can be overcome by repeating the inoculation
using the supernatant from the DF-1/A cells that gave a
weak response.
ALVs have been successfully eradicated from chicken
breeding flocks in poultry industries of most developed
countries, and the control and eradication of ALVs in China
is now being carried out. Historically, some chicken breeds
that possess genetic resistance to ALV-A through E have
been found (Payne and Biggs 1965; Vogt and Ishizaki
1965; Crittenden et al. 1967). These chickens have been
previously used as a source of selectively-resistant chick
7
embryo fibroblasts (CEF). However, these chicken breeds
presently cannot be applied to production due to the possibility of resistance transfer to other breeds.
Antiviral activity by blocking ALV receptors in vitro has
been demonstrated in our study and by Hunt et al. (1999).
We would like to determine whether chickens expressing a
foreign env gene product would be resistant to virus. Our
study provides a powerful theoretical basis for producing
genetically modified (GM) chickens that can resist ALV
infection.
5. Conclusion
This study established an ALV-A resistant cell line. The DF1/A cell line can be used both as a diagnostic tool to easily
and reliably classify viral isolates in field samples and as a
tool to further investigate methods to resist ALV infections.
Acknowledgements
The work was founded by the National Key R&D Program
of China (2016YFD0501606), the Public Industry Research
Program, the Ministry of Agriculture of China (201203055),
the Program of Science and Technology Development of
Guangdong Province, China (2015A020209145), the China
Meat-Type Chicken Research System (CARS-42-G09) and
the Modern Agriculture Talents Support Program, Ministry
of Agriculture of China ([2012] no.160).
References
Adkins H B, Brojatsch J, Naughton J, Rolls M M, Pesola J
M, Young J A. 1997. Identification of a cellular receptor
for subgroup E avian leukosis virus. Proceedings of the
National Academy of Sciences of the United States of
America, 94, 11617–11622.
Bates P, Rong L, Varmus H E, Young J A, Crittenden L B. 1998.
Genetic mapping of the cloned subgroup A avian sarcoma
and leukosis virus receptor gene to the TVA locus. Journal
of Virology, 72, 2505–2508.
Bates P, Young J A, Varmus H E. 1993. A receptor for
subgroup A Rous sarcoma virus is related to the low density
lipoprotein receptor. Cell, 74, 1043–1051.
Brojatsch J, Naughton J, Rolls M M, Zingler K, Young J A.
1996. CAR1, a TNFR-related protein, is a cellular receptor
for cytopathic avian leukosis-sarcoma viruses and mediates
apoptosis. Cell, 87, 845–855.
Chai N, Bates P. 2006. Na+/H+ exchanger type 1 is a receptor
for pathogenic subgroup J avian leukosis virus. Proceedings
of the National Academy of Sciences of the United States
of America, 103, 5531–5536.
Coffin J M, Hughes S H, Varmus H E. 1997. The interactions
of retroviruses and their hosts, In: Coffin J M, Hughes S H,
8
*** et al. Journal of Integrative Agriculture 2016, 15(0): 60345-7
Varmus H E, eds., Retroviruses. Cold Spring, Harbor, NY.
Crittenden L B, Salter D W, Federspiel M J. 1989. Segregation,
viral phenotype, and proviral structure of 23 avian leukosis
virus inserts in the germ line of chickens. Theoretical and
Applied Genetics, 77, 505–515.
Crittenden L B, Stone H A, Reamer R H, Okazaki W. 1967.
Two loci controlling genetic cellular resistance to avian
leukosis-sarcoma viruses. Journal of Virology, 1, 898–904.
Cui N, Su S, Chen Z, Zhao X, Cui Z. 2014. Genomic sequence
analysis and biological characteristics of a rescued clone of
avian leukosis virus strain JS11C1, isolated from indigenous
chickens. The Journal of General Virology, 95, 2512–2522.
Elleder D, Stepanets V, Melder D C, Senigl F, Geryk J, Pajer
P, Plachy J, Hejnar J, Svoboda J, Federspiel M J. 2005.
The receptor for the subgroup C avian sarcoma and
leukosis viruses, Tvc, is related to mammalian butyrophilins,
members of the immunoglobulin superfamily. Journal of
Virology, 79, 10408–10419.
Fenton S P, Reddy M R, Bagust T J. 2005. Single and concurrent
avian leukosis virus infections with avian leukosis virus-J
and avian leukosis virus-A in Australian meat-type chickens.
Avian Pathology (Avian Pathol), 34, 48–54.
Himly M, Foster D N, Bottoli I, Iacovoni J S, Vogt P K. 1998. The
DF-1 chicken fibroblast cell line: transformation induced by
diverse oncogenes and cell death resulting from infection
by avian leukosis viruses. Virology, 248, 295–304.
Hunt H D, Lee L F, Foster D, Silva R F, Fadly A M. 1999. A
genetically engineered cell line resistant to subgroup J
avian leukosis virus infection (C/J). Virology, 264, 205–210.
Ishizaki R, Vogt P K. 1966. Immunological relationships among
envelope antigens of avian tumor viruses. Virology, 30,
375–387.
Kozak M. 1991. An analysis of vertebrate mRNA sequences:
Intimations of translational control. The Journal of Cell
Biology, 115, 887–903.
Lai H, Zhang H, Ning Z, Chen R, Zhang W, Qing A, Xin C, Yu
K, Cao W, Liao M. 2011. Isolation and characterization of
emerging subgroup J avian leukosis virus associated with
hemangioma in egg-type chickens. Veterinary Microbiology,
151, 275–283.
Li D, Qin L, Gao H, Yang B, Liu W, Qi X, Wang Y, Zeng X, Liu
S, Wang X, Gao Y. 2013. Avian leukosis virus subgroup A
and B infection in wild birds of Northeast China. Veterinary
Microbiology, 163, 257–263.
Li Y, Liu X, Liu H, Xu C, Liao Y, Wu X, Cao W, Liao M. 2013.
Isolation, identification, and phylogenetic analysis of two
avian leukosis virus subgroup J strains associated with
hemangioma and myeloid leukosis. Veterinary Microbiology,
166, 356–364.
Mothes W, Boerger A L, Narayan S, Cunningham J M, Young
J A. 2000. Retroviral entry mediated by receptor priming
and low pH triggering of an envelope glycoprotein. Cell,
103, 679–689.
Payne L N, Biggs P M. 1965. Effect of lymphoid leukosis virus
on the response of the chorioallantoic membrane to Rous
sarcoma virus. Virology, 27, 620–623.
Payne L N, Nair V. 2012. The long view: 40 years of avian
leukosis research. Avian Pathology, 41, 11–19.
Qin L, Gao Y, Ni W, Sun M, Wang Y, Yin C, Qi X, Gao H, Wang
X. 2013. Development and application of real-time PCR
for detection of subgroup J avian leukosis virus. Journal of
Clinical Microbiology, 51, 149–154.
Salter D W, Crittenden L B. 1989. Artificial insertion of a
dominant gene for resistance to avian leukosis virus into the
germ line of the chicken. Theoretical and Applied Genetics,
77, 457–461.
Salter D W, Crittenden L B. 1991. Insertion of a disease
resistance gene into the chicken germline. Biotechnology,
16, 125–131.
Silva R F, Fadly A M, Taylor S P. 2007. Development of a
polymerase chain reaction to differentiate avian leukosis
virus (ALV) subgroups: Detection of an ALV contaminant
in commercial Marek’s disease vaccines. Avian Diseases,
51, 663–667.
Smith L M, Brown S R, Howes K, McLeod S, Arshad S S,
Barron G S, Venugopal K, McKay J C, Payne L N. 1998.
Development and application of polymerase chain reaction
(PCR) tests for the detection of subgroup J avian leukosis
virus. Virus Research, 54, 87–98.
Venugopal K, Smith L M, Howes K, Payne LN. 1998. Antigenic
variants of J subgroup avian leukosis virus: sequence
analysis reveals multiple changes in the env gene. The
Journal of General Virology, 79, 757–766.
Vogt P K, Ishizaki R. 1965. Reciprocal patterns of genetic
resistance to avian tumor viruses in two lines of chickens.
Virology, 26, 664–672.
Vogt P K, Ishizaki R. 1966. Patterns of viral interference in
the avian leukosis and sarcoma complex. Virology, 30,
368–374.
Zhang H N, Lai H Z, Qi Y, Zhang X T, Ning Z Y, Luo K J, Xin C
A, Cao W S, Liao M. 2011. An ALV-J isolate is responsible
for spontaneous haemangiomas in layer chickens in China.
Avian Pathology, 40, 261–267.
Zhang X, Liao M, Jiao P, Luo K, Zhang H, Ren T, Zhang
G, Xu C, Xin C, Cao W. 2010. Development of a loopmediated isothermal amplification assay for rapid detection
of subgroup J avian leukosis virus. Journal of Clinical
Microbiology, 48, 2116–2121.
(Managing editor ZHANG Juan)