STRUCTURE AND FUNCTION OF TRYPTOPHAN HYDROXYLASE
By
GEORGE CHIH-THAI JIANG
A Thesis Submitted to the Graduate Faculty of
WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND
SCIENCES
in Partial Fulfillment of the Requirements
for the Degree of
MASTER OF SCIENCE
in the Molecular Genetics Program
of the Wake Forest University School of Medicine
May 2003
Winston-Salem, North Carolina
Approved by:
Kent E. Vrana, Ph.D., Advisor
_______________________
Examining Committee:
Linda C. McPhail, Ph.D., Chairman
_______________________
Mark O. Lively, Ph.D.
_______________________
Leslie B. Poole, Ph.D.
_______________________
William E. Sonntag, Ph.D.
_______________________
DEDICATION
I would like to dedicate this work to my parents, Allan Lii-Shang and Grace
Mei-Chuon Jiang. Without your constant love and support throughout the turbulent
times of my graduate career, this would not have been possible. Thank you for your
constant words of wisdom and encouragement.
ii
ACKNOWLEDGMENTS
First and foremost, I would like to thank Dr. Kent E. Vrana. I appreciate all
the patience and guidance to achieve my career goals. My time at Wake Forest
University has been filled with many ups and downs and I thank you for always
supporting me, taking the time to further motivate and guide me in the right direction,
and providing numerous opportunities for professional development.
I would also like to acknowledge Dr. James Smith and the entire Department
of Physiology and Pharmacology for providing the resources and supportive
environment that have made my graduate career here so enjoyable. I would like to
specifically thank all the members of the Vrana Lab, past and present, for their
assistance and friendship in the laboratory. In particular, I would like to thank Dr.
George J. Yohrling IV for his guidance and for serving as the model student-scientist
which I have aspired to emulate. I would also like to thank Amanda Domer for all
her assistance with protein expression, purification and enzymatic assays.
Special thanks to Dean Melson, Dean Solano, Pearl Lawrence, and Beth
Whitsett for their help in all aspects of the Graduate Student Association, and their
support and assistance throughout my graduate career. I would also like to thank
my committee members, Drs. Lively, McPhail, Poole, and Sonntag for their patience
and guidance through the scientific process. Finally, but not least, I would like to
thank all my classmates, friends, and colleagues. The support network you have
provided has been remarkable and is greatly appreciated.
iii
TABLE OF CONTENTS
LIST OF FIGURES AND TABLES.......................................................................vi
ABBREVIATIONS.............................................................................................. viii
ABSTRACT.......................................................................................................... x
CHAPTER I - INTRODUCTION: STRUCTURAL AND FUNCTIONAL
CHARACTERIZATION
OF
THE
AROMATIC
AMINO
ACID
HYDROXYLASES ..................................................................................... 1
Aromatic Amino Acid Hydroxylases...................................... 2
Tryptophan Hydroxylase and Serotonin Biosynthesis .......... 6
Serotonin in Human Health and Disease.............................. 7
AAAH Polymorphisms and Disease ..................................... 9
Protein Purification Studies ................................................ 13
X-Ray Crystallographic Studies.......................................... 17
References ......................................................................... 23
Statement of Purpose......................................................... 33
CHAPTER II - IDENTIFICATION OF SUBSTRATE ORIENTING AND
PHOSPHORYLATION SITES WITHIN TRYPTOPHAN HYDROXYLASE
USING HOMOLOGY-BASED MOLECULAR MODELING ..................... 35
This chapter is published in Journal of Molecular Biology 302:1005-1017
(2000).
Abstract .............................................................................. 36
Introduction........................................................................ 38
Results .............................................................................. 44
Discussion ......................................................................... 60
Materials and Methods ....................................................... 71
References ........................................................................ 78
CHAPTER III – FUNCTIONAL ANALYSIS OF THE V177I CODING REGION
POLYMORPHISM IN HUMAN TRYPTOPHAN HYDROXYLASE (TPH1) 82
In Preparation, Journal of Neurochemistry (2003)
Abstract ............................................................................. 83
Introduction........................................................................ 84
Materials and Methods ...................................................... 88
iv
Results .............................................................................. 94
Discussion ......................................................................... 96
References ...................................................................... 107
CHAPTER IV - SUMMARY AND CONCLUSIONS ......................................... 113
References ...................................................................... 121
APPENDIX - PHENYLKETONURIA …………………………………………..….. 124
This chapter is published in Encyclopedia of Life Sciences 14:150-154
(2000).
Introduction...................................................................... 125
Clinical Signs and Symptoms ........................................... 126
Classical Phenylketonuria ............................................... 132
Nonclassical Phenylketonuria.......................................... 137
Future Treatments for Phenylketonuria ........................... 139
Summary ......................................................................... 143
Further Reading .............................................................. 144
CURRICULUM VITA ....................................................................................... 145
v
LIST OF FIGURES AND TABLES
CHAPTER I
Figure 1:
Biosynthetic pathway for catecholamines and indoleamines........... 5
Table I:
Published TPH purification protocols ............................................ 13
Figure 2:
Structural comparisons of the AAAHs ........................................... 22
CHAPTER II
Table 1:
Published TPH mutagenesis studies............................................. 41
Figure 1:
Hypothetical model of human TPH (monomer) ............................. 46
Figure 2:
Side by side comparison of TH, PAH, and hypothetical TPH ........ 48
Figure 3:
Tetramer of hypothetical TPH ....................................................... 50
Table 2:
Steady-state kinetic parameters of wild-type TPH and mutants .... 51
Figure 4:
Phosphorylation and immunodetection of TPH ............................. 53
Figure 5:
Specific activities of TPH active-site mutations ............................. 57
Figure 6:
Lineweaver-Burk analysis of wild-type TPH and TPH Y235A ....... 59
Figure 7:
Multiple sequence alignment ........................................................ 68
Figure 8:
Sequence alignment of the aromatic amino acid hydroxylases..... 70
CHAPTER III
Table I:
Site-directed mutagenesis primers................................................ 90
Figure 1:
Structural depictions of Val177 mutations ................................... 102
vi
Table II:
Purification data for wild-type and mutant enzymes .................... 103
Figure 2:
Coomassie and immunoblots of purified proteins........................ 105
Table III:
Steady-state kinetic parameters of wild-type TPH and mutants.. 106
CHAPTER IV
Figure 1:
Structural location of the functional residues of interest in the
present work. .............................................................................. 118
APPENDIX
Figure 1:
Phenylalanine metabolism ......................................................... 128
Table 1:
Genetic defects in phenylketonuria ............................................ 135
vii
ABBREVIATIONS
5-HT
5-Hydroxytryptamine (Serotonin)
5-HTP
5-Hydroxytryptophan
AAADC
Aromatic Amino Acid Decarboxylase (EC 4.1.1.28)
AAAH
Aromatic Amino Acid Hydroxylase(s)
BH4
Tetrahydrobiopterin ((6R)-5,6,7,8-Tetrahydro-L-biopterin)
CaMPKII
Calcium/Calmodulin-Dependent Protein Kinase II
C∆/N∆
Carboxyl/Amino Terminal Deletion
cDNA
Complementary DNA
CNS
Central Nervous System
DA
Dopamine (3-hydroxydopamine)
DNA
Deoxyribonucleic Acid
DOPA
3,4-Dihydroxyphenylalanine
DTT
Dithiothreitol
EDTA
Ethylenediaminetetraacetic Acid
Fe
Iron
HEPES
N-[2-Hydroxyethyl] Piperazine-N’-[2-Ethanesulfonic Acid]
kb
Kilobase
kDa
Kilodalton
Km
Michaelis-Menten Constant
mRNA
Messenger Ribonucleic Acid
OCD
Obsessive Compulsive Disorder
viii
PAH
Phenylalanine Hydroxylase (phenylalanine-4-monooxygenase; EC
1.14.16.1)
PD
Parkinson’s Disease
PKA
Protein Kinase A; cAMP-Dependent Protein Kinase
PMSF
Phenylmethylsulfonyl Fluoride
RMSD
Root Mean Square Deviation
SDS-PAGE Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis
SEC
Size-Exclusion Chromatography
SN
Substantia Nigra
SNP
Single Nucleotide Polymorphisms
TH
Tyrosine Hydroxylase (tyrosine-3-monooxygenase; EC 1.14.16.2)
TPH
Tryptophan Hydroxylase (tryptophan-5-monooxygenase; EC
1.14.16.4)
Vmax
Maximal Velocity
ix
ABSTRACT
George C.-T. Jiang
STRUCTURE AND FUNCTION OF TRYPTOPHAN HYDROXYLASE
Thesis under the direction of
Kent E. Vrana, Ph.D., Professor of Physiology and Pharmacology and Director of
Graduate Studies
Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis
of serotonin, and is a member of a family of enzymes known as aromatic amino acid
hydroxylases (AAAH). Studies into the regulation, structure, and function of TPH
have lagged behind those of the other AAAH. In the absence of an experimentallydetermined crystal structure, we generated a hypothetical model of human TPH
using multiple sequence alignment homology-based molecular modeling of the other
AAAH. We then performed site-directed mutagenesis to identify functional domains
within the TPH protein, and to validate the hypothetical model.
Our studies
demonstrated that tyrosine 235 plays a role in tryptophan substrate interactions in
the active site, and that serine 58 and serine 260 are substrates for Ca2+/calmodulindependent protein kinase II.
Additional studies analyzed a coding region
polymorphism in human TPH, a subtle valine to isoleucine substitution at residue
177 (V177I). Our studies suggest that this residue is involved in the optimal
x
orientation of the tryptophan substrate binding pocket in the TPH active site. These
studies have added to our understanding of the structure and function of TPH.Using
this type of information, novel TPH-specific pharmacotherapies may be developed
for use in the treatment of serotonergic disorders in human health and disease.
xi
CHAPTER I
INTRODUCTION:
STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF THE
AROMATIC AMINO ACID HYDROXYLASES
George C.-T. Jiang
1
2
AROMATIC AMINO ACID HYDROXYLASES
Tryptophan hydroxylase (TPH; EC 1.14.16.4) is a member of a family of
enzymes known as aromatic amino acid hydroxylases (AAAH). The other members
of this family are tyrosine hydroxylase (TH; EC 1.14.16.2) and phenylalanine
hydroxylase (PAH; EC 1.14.16.1). TPH catalyzes the rate-limiting step in the
biosynthesis of the neurotransmitter serotonin (Grahame-Smith, 1964; Lovenberg et
al., 1967), and is involved in melatonin biosynthesis (Chanut et al., 2002; Privat et
al., 2002; reviewed in Martinez et al., 2001). TH is the rate-limiting enzyme in the
synthesis of the catecholamines (dopamine, epinephrine, and norepinephrine), while
PAH is rate-limiting in the synthesis of the amino acid tyrosine (for reviews, see
Hufton et al., 1995; Kumer and Vrana, 1997) and the primary enzyme responsible
for the catabolism of phenylalanine (reviewed in Martinez et al., 2001).
All three enzymes share a high degree of amino acid identity and distinct
structural and functional characteristics. Structurally, AAAH are composed of three
regions - an amino terminal regulatory domain, a carboxyl catalytic domain, and an
oligomeric binding domain at the extreme carboxyl terminus (Liu and Vrana, 1991;
Wang et al., 2000; reviewed in Ftizpatrick, 1999). While the regulatory domains
exhibit approximately 30% sequence identity, over 60% sequence identity is
exhibited in the catalytic region. The junction delineating the regulatory and catalytic
domains (Val-Pro-Trp-Phe-Pro) is completely conserved in all species of the
hydroxylases, and marks the beginning of the conserved catalytic domain (Yang et
al., 1994; Kumer et al., 1997a; Mockus et al., 1997b; Moran et al., 1998; reviewed in
3
Ftizpatrick 1999). Recent crystallographic data show that the proteins fold in a
similar manner and are virtually superimposeable in their catalytic domains. It is
generally accepted that the three hydroxylases evolved from a common progenitor
(Grenett et al., 1987; Neckameyer and White, 1992).
Evidence for this is
demonstrated by the fruit fly, Drosophila melanogaster, which possesses only two
AAAH – TH and an enzyme that hydroxylates both tryptophan and phenylalanine
(Neckameyer and White, 1992).
Functionally, all AAAHs require the same co-substrates – molecular oxygen
(O2), tetrahydrobiopterin (BH4) – and a non-heme, ferrous iron co-factor to
hydroxylate their respective amino acid (Figure 1). Another similarity revolves
around the hydroxylation reaction itself, which produces water as a bi-product in all
cases. The release of water serves as the basis of one method for determining
enzyme activity. By utilizing a tritiated tryptophan substrate in the hydroxylation
reaction, one can determine enzyme activity by measuring the tritiated water
released (Beevers et al., 1983; Reinhard et al., 1986; Vrana et al., 1993). The other
method for determining enzyme activity in vitro is based on a continuous
fluorometric assay using the different spectral characteristics of tryptophan and 5hydroxytryptophan (Moran and Fitzpatrick, 1999). Using this assay, one directly
detects the fluorescent yield of 5-hydroxytryptophan.
4
Figure 1: Biosynthetic pathway for catecholamines and indoleamines. TH is the
rate-limiting enzyme in the synthesis of the catecholamines (DA, NE, and E), while
TPH is the rate-limiting enzyme for serotonin formation. TPH also serves as a nonlimiting enzyme in the synthesis of melatonin. Both TH and TPH require the cosubstrates molecular oxygen (O2) and tetrahydrobiopterin (BH4), as well as the cofactor ferrous iron (Fe2+). Following hydroxylation of tryptophan at the 5' position,
aromatic amino acid decarboxylase (AAADC) decarboxylates 5-hydroxytryptophan
to form 5-hydroxytryptamine (serotonin). Serotonin is then acetylated in a ratelimiting fashion by N-acetyltransferase (NAT) to allow for melatonin formation (not
shown). AAADC also serves to decarboxylate DOPA to form dopamine. Dopamine
is further metabolized to norepinephrine (NE) and epinephrine (E) by dopamine-βhydroxylase (DBH) and phenylethanolamine N-methyltransferase (PNMT),
respectively.
5
6
TRYPTOPHAN HYDROXYLASE AND SEROTONIN BIOSYNTHESIS
TPH is the rate-limiting enzyme in the biosynthesis of the neurotransmitter
serotonin (Grahame-Smith, 1964; Lovenberg et al., 1967). It is also involved in
melatonin biosynthesis though is not rate-limiting in that reaction. Localization of cell
bodies, as determined by in situ hydridization, illustrate that TPH mRNA-positive
neurons can be found throughout the raphe nuclei and the pineal gland (Austin and
O’Donnell, 1999). TPH is predominantly made in the central nervous system in
these brain regions (Jequier et al., 1969; Joh et al., 1975). There is also evidence
for peripheral synthesis of TPH, including cells of the enteric neurons of the gut,
platelets, retina, and thyroid cells (reviewed in Mockus and Vrana, 1998).
In mammalian species, serotonin has been detected in nearly all tissues of
the body and plays a number of different roles (reviewed in Azmitia, 2001).
Because of its important regulatory role, a number of processes have evolved to
regulate serotonin biosynthesis. In the brain, rapid regulatory control is achieved by
modulating TPH enzyme activity through phosphorylation. This mechanism of
action allows for rapid and local regulation of 5-HT biosynthesis without requiring
new enzymes to be transported from the cell body area to the synapse, which could
take hours to days to accomplish (reviewed in Azmitia, 2001).
7
SEROTONIN IN HUMAN HEALTH AND DISEASE
Serotonin (5-HT) is the neurotransmitter end-product following tryptophan
hydroxylation by TPH and subsequent decarboxylation by AAADC. Serotonin is
implicated in a variety of CNS functions such as temperature control, aggression,
pain and memory (Kandasamy and Williams, 1984; reviewed in Oliver et al., 1995;
Brentegani and Lico, 1982; and Cornwell-Jones et al., 1989). Aberrations in
serotonin synthesis, regulation, and homeostasis have been associated with
numerous psychiatric illnesses including depression, anxiety, obsessive-compulsive
disorder (OCD), bulimia, migraines and drug abuse (reviewed in Mockus and Vrana,
1998). Moreover, 5-HT itself can be oxidized in vivo by superoxide to form the toxic
metabolite, tryptamine-4,5-dione (T-4,5-D) which has been implicated in the
degeneration of serotonergic neurons following methamphetamine exposure or
cerebral ischemia reperfusion (Jiang et al., 1999).
Recent data from the National Institute of Mental Health (NIMH) demonstrate
that there is a severe socioeconomic impact of mental illness in the United States.
An estimated 22.1% of Americans suffer from a diagnosable mental disorder in a
given year (Regier et al., 1993). For example, it is estimated that 19 million adults in
the United States (10% of the US population) suffer from depression, and only onethird of this population receives treatment. As mentioned earlier, depression is
associated with aberrant serotonergic function. Previously, treatment regimen for
depressive disorders involved tricyclic antidepressants (TCAs) which have a large
number of side effects. Today, treatment predominantly involves selective serotonin
8
reuptake inhibitors (SSRIs) and/or monoamine oxidase inhibitors (MAOIs) that
modulate neurotransmitter levels (including serotonin) with less side effects. In
2001, the pharmaceutical giants Eli Lilly and GlaxoSmithKline – producers of the
leading antidepressant drugs, Prozac (fluoxetine) and Paxil (paroxetine) – reported
$2.2 Billion and $6.2 Billion in US sales, respectively.
Typically, the treatment for serotonin-related diseases is to modulate the
serotonergic system, often by way of selective serotonin reuptake inhibitors, such as
fluoxetine or sertraline as described above. Alternative treatments, using lithium or
the former diet drug fenfluramine, work presynaptically to alter the serotonin system.
However, the side effects are vast and long-term effects remain to be determined.
TPH could contribute to the root of many of these serotonin-related disorders.
Therefore, it is necessary to further understand the structure, function and regulation
of this important enzyme to potentially provide an alternative therapeutic approach
to treat these diseases.
9
AAAH POLYMORPHISMS AND DISEASE
As the AAAHs are all rate-limiting enzymes in their respective metabolic
pathways, it is not suprising that changes in enzyme structure could change enzyme
function, and thereby manifest themselves, ultimately in abnormal clinical conditions.
This is indeed the case for PAH and TH, and subtle hints of such polymorphisms
resulting in human disease have been suggested for TPH.
It has been demonstrated that a dysfunctional or compromised PAH will result
in increased blood phenylalanine levels, or hyperphenylalaninemia (HPA) (Nowacki
et al., 1997) due to the inability to catabolize the amino acid. More severe cases of
HPA result in the condition commonly known as phenylketonuria (PKU; reviewed in
Erlandsen et al., 2001; reviewed in Jiang et al., 2001a). Researchers have identified
over 400 mutations in PAH that result in decreased enzymatic activity, and can be
linked to PKU. Unfortunately, PKU results in severe mental retardation of patients, if
left untreated.
Numerous researchers have utilized PAH crystal structures
(Erlandsen et al., 1997a; Fusetti et al., 1998; Kobe et al., 1999; Jennings et al.,
2000; Miranda et al., 2002, reviewed in Erlandsen et al., 1997b) to explain the
functional effect of many of these mutations on enzymatic activity. Often, these
mutations map to important active site residues, but some map to amino acids in
structural motifs, or in important hinge structures (Bjorgo et al., 2001; Jennings et
al., 2001; Miranda et al., 2002; Horne et al., 2002).
Polymorphisms in the coding region for TH have also been identified that
result in clinical abnormalities. These point mutations in TH result in autosomal
10
recessive L-DOPA- responsive parkinsonism and dystonias (Ludecke et al., 1995,
1996, reviewed in Ichinose et al., 1999). Clinically, all of these polymorphisms
manifest themselves as motor coordination symptoms in patients as they result in
dopamine deficiency, yet without the neuronal death associated with juvenile
parkinsonism or Parkinson’s Disease. To date, only a handful of TH polymorphisms
have been described. A Glu381Lys (Q381K) change in human TH was first
described (Knappskog et al., 1995; Ludecke et al., 1995) to result in decreased TH
specific activity to about 15% of wild-type when expressed in vitro. Additionally, the
Km for the tyrosine substrate of the mutant was 6-fold higher compared to wild-type
enzyme (Knappskog et al., 1995). Similarly, a Leu205Pro (L205P) polymorphism
was described that resulted in a recombinant enzyme that exhibits 1.5% of the
activity of wild-type (Ludecke et al., 1996). Other TH polymorphisms that have been
characterized include Arg233His (R233H) (van den Heuvel et al., 1998), Cys359Phe
(C359F) (Bräutigam et al., 1999), Val112Met (V112M), and Asp498Gly (D498G)
(Wevers et al., 1999). In all cases, the effect on enzyme function can be explained
by the change in enzymatic structure, as rationalized using a crystal structure.
Due to challenges in enzyme purification and retention of activity, research on
the structure and regulation of TPH has fallen behind that of the other amino acid
hydroxylases. Only recently has the TPH crystal structure been deciphered (Wang
et al., 2002). As 5-HT plays a role in the etiology of a wide variety of neurological
diseases, but only subtle phenotypic changes occur, it has been difficult to identify
polymorphisms in the TPH gene that associate with a disease in a clear-cut manner.
Nielsen and colleagues first described an intronic polymorphism in the human TPH
11
gene (intron 7) that is associated with suicidality and variable 5-hydroxyindolacetic
acid concentrations in Finnish Caucasians (Nielsen et al., 1994). Another study has
associated another intronic TPH gene polymorphism with aggression and angerrelated traits (Manuck et al., 1999). Recently, the first coding region polymorphism
of TPH was described by Ramaekers and colleagues in a pediatric patient exhibiting
neurodevelopment problems (Ramaekers et al., 2001). Analysis of cerebral spinal
fluid (CSF) and serum from five pediatric patients exhibiting motor and
neurodevelopment problems illustrated decreased serotonin metabolites, suggesting
a deficiency in serotonin production. When treated with the end-product of TPH, 5hydroxytryptophan, the patients all regained normal motor and neurological function,
further suggesting a potential problem with TPH. Sequencing of the TPH gene
revealed a G529A polymorphism in the gene that would produce a subtle valine to
isoleucine substitution at residue 177 (Val177Ile) in the protein. The role of this
specific residue remains undetermined. However, a complicating factor is that the
specific Val177Ile polymorphism only occurred in one of the five patients
(Ramaekers et al., 2001).
Interestingly, however, in all the TPH-associated clinical situations, structural
and catalytic consequences of potential polymorphisms remain unknown. Through
our work, we have developed a structural model for TPH to explain the effect of
such polymorphisms, in conjunction with biochemical studies to assess the effect of
such polymorphisms on TPH function.
A fundamental hypothesis is that
investigation of additional patient populations will reveal more TPH polymorphisms
that could be the cause of the neurological disorders associated with aberrant
13
PROTEIN PURIFICATION STUDIES
The first attempts to purify tryptophan hydroxylase started in the 1970s using
a number of different sources and chromatographic techniques, though there were
few publications when compared to the other AAAHs (reviewed in Cash, 1998). The
difficulty in obtaining pure TPH protein can be attributed primarily to 1) the low
quantities of TPH protein available in natural sources; and 2) the inherent sensitivity
of the enzyme to proteolytic degradation and/or inactivation (reviewed in Cash,
1998).
The initial work on tryptophan hydroxylase was focused on protein obtained
from bovine (Jequier et al., 1969; Nukiwa et al., 1974), rabbit (Tong et al., 1975;
Nakata et al., 1981; Banik et al., 1997; Moran et al., 1998), and rat (Jequier et al.,
1969; Nakata et al., 1982; Cash et al., 1985; Cash, 1998) sources. However, TPH
has been isolated from other mammalian species, including mouse (Hosada 1975;
Nakata et al., 1982b; Fujisawa et al., 1987a; Park et al., 1994), pig (Youdim et al.,
1974, 1975) and human samples (Yang et al., 1994; Kowlessur et al., 1999; Wang
et al., 2002). Successful purification of TPH was difficult as the procedures required
considerable time and extensive multi-step chromatography procedures. In fact, the
enzyme frequently lost activity and the protocols typically produced small quantities
of pure protein. Moreover, unlike more ubiquitous proteins, researchers found it
challenging to obtain significant quantities of starting material. For example, the first
purification of rat TPH used 17 rat brainstems and 9 grams of tissue yet only
produced 13.6 mg of TPH (Jequier et al., 1969). More recent purification protocols
14
entail recombinant expression of a TPH cDNA and subsequent purification, which
generates copious amounts of starting material at a very low cost. Table I also
illustrates the different yields and fold purifications that have previously been
achieved.
The recent advances in protein chemistry technologies have facilitated the
purification of greater amounts of protein, namely by the use of fusion proteins. The
first use of an affinity tag for TPH purification was by Yang and Kaufman (1994),
who produced recombinant full length and truncated human TPH fused to maltose
binding protein in E. coli. Though this technique was very useful in obtaining pure
protein, the concept of attaching a 49 kD maltose binding protein with a 2 kD linker
to TPH, or any other protein for that matter, is not optimal. Banik and colleagues
(Banik et al., 1997) utilized a much smaller fusion with an amino-terminal hexahistidine tag to express rabbit TPH in insect cells (Spodoptera frugiperda) for
subsequent purification. These researchers removed the hexa-histidine tag after the
purification procedures, unlike Hamdan and Ribeiro (Hamdan et al., 1999), who also
used a hexa-histidine tag (amino terminal) to express and purify E. coli expressed
rabbit TPH and TPH from the parasite Schistosoma mansoni (SmTPH). These latter
researchers were able to achieve a 45-fold purification with a yield of 0.66-0.8 mg of
purified SmTPH from 100ml of induced bacterial culture (with a specific activity of
170 nmol 5-HTP/min·mg). The recent crystallization of the catalytic core of hTPH
was also done with TPH expressed as a hexa-hisitidine fusion enzyme, although the
use of an alternative prokaryotic expression vector resulted in this enzyme being
expressed with a carboxy-terminal hexa-hisitidine tag instead of an amino-terminal
15
fusion (Wang et al., 2002). The current work has also concurrently developed a
purification system for human TPH, utilizing an amino-terminal hexa-histidine affinity
tag for rapid purification as described in Chapter 3 of this thesis.
16
17
X-RAY CRYSTALLOGRAPHIC STUDIES
Due to the inherent instability of TPH enzyme activity, large amounts of
purified protein have been difficult to obtain (Kuhn et al., 1980; D’Sa et al., 1996a,
Cash 1998).
This posed a significant challenge for researchers attempting
crystallization studies. As stated above, the recent advances in protein chemistry
technologies have facilitated the purification of large amounts of protein and, thus, it
was only recently that the first crystallographic structure of TPH was determined
(Wang et al., 2002). Prior to the actual determination of the crystal structure of the
enzyme, researchers had success in determining the crystal structures for the other
members of the AAAH.
In 1997, the structure for tyrosine hydroxylase was first resolved at 2.3Å
(Goodwill et al., 1997). This structure was incomplete as it only represented the rat
catalytic domain (residues 164-498), missing the entire amino terminal regulatory
domain.
This crystal structure validated the presence of a 40Å alpha helix
consisting of a 4,3-hydrophobic repeat, that was first postulated by Liu and Vrana
(1991) to be responsible for tetramerization through the interactions of anti-parallel
coiled coils. The crystal structure also revealed potential intersubunit binding
domains, such as a dimerization interface between two TH monomers formed by a
salt bridge between Lys170 and Glu282 and adjacent hydrogen bonding
interactions. This interaction is conserved in TPH and was studied by Yohrling and
colleagues (Yohrling et al., 1999; Yohrling et al., 2000). Shortly following the report
of the initial TH crystal structure, the second crystal structure of TH was resolved to
18
2.3Å by Goodwill and colleagues (1998). This new structure was also truncated,
missing the entire regulatory domain (N∆1-159). Nonetheless, the structure did
provide new insights to the enzyme, as it was resolved with iron and a pterin
cosubstrate analogue in the active site (Goodwill et al., 1998).
The number of published crystal structures for phenylalanine hydroxylase is
significantly greater. The first PAH crystal structure was determined at about the
same time as that for tyrosine hydroxylase in 1997. This crystal structure was a
homodimer but truncated, only representing the catalytic domain of human PAH
(residues 117-424, Erlandsen et al., 1997a). Soon after, the structure of the
catalytic domain of human PAH (residues 118-452) in its tetrameric form was
resolved (Fusetti et al., 1998). Additionally, researchers were able to determine the
structure of the human PAH catalytic domain to 2.0Å (residues 117-424) with
various catechol inhibitors bound (Erlandsen et al., 1998). These structures gave
insight into residues in the active site that might play a role in substrate binding and
catalysis. A more complete structure for PAH was resolved to 2.2Å with the
crystallization of rat PAH (residues 1-429) that was missing only the carboxyl
terminal tetramerization domain (Kobe et al., 1999). Interestingly, it was observed
that phosphorylation did not result in dramatic structural changes, suggesting subtle
allosteric regulatory mechanisms for PAH following phosphorylation.
The structure for pterin-bound human PAH (residues 118-424) was
determined by Erlandsen and colleagues in 2000 (Erlandsen et al., 2000). This
provided a more detailed view into the active site of the enzyme, and the potential
mechanism of catalysis. Soon thereafter, the structure of the human PAH catalytic
19
domain (N∆1-102/C∆428-452) with catalytically active Fe(II) and in a binary complex
with the natural cosubstrate, BH4, was resolved (Andersen et al., 2001). This has
been followed up with a report of the structure of a truncated human PAH enzyme
(N∆1-102/C∆428-452) ternary complex with BH4 and 3-(2-thienyl)-L-phenylalanine
(Andersen et al., 2002). Further insights into understanding PAH, and by extension,
understanding the structure and function of TH and TPH, were provided by the
comparison of bacterial versus human PAH (Erlandsen et al., 2002).
These
researchers observed similar folding in the catalytic domain, but different enzyme
stability and reaction rates between the prokaryotic and eukaryotic enzymes.
Recently, researchers have investigated the role of the amino terminus of
PAH, which has provided no interpretable electron density in previous PAH
crystallographic studies. This N-terminal sequence had been surmised to play a role
in autoregulation of PAH, based on the crystal structure of PAH (Kobe et al., 1999)
and deletion mutagenesis (Jennings et al., 2001, and Wang et al., 2001; Horne at
al., 2002). Using NMR, Horne and colleagues demonstrated that the N-terminus is
a mobile flexible region that associates with the folded core of the molecule after
binding of the phenylalanine substrate, the association of which can be facilitated by
phosphorylation (Horne at al., 2002).
In spite of intensive efforts by several groups, no successful crystallization of TPH
occurred until recently (Wang et al., 2002). In advance of such a structure, and
given the high sequence homology between the AAAHs, the present work includes
the construction of the first hypothetical molecular model of human TPH (Vrana,
1999; Jiang et al., 2000b; Figure 2) based upon the then available crystal structures
20
of both rat TH and rat PAH (Goodwill et al., 1997; Kobe et al., 1999). Due to the
challenges involved in getting crystal formation with all domains present, the
hypothetical model was, and still remains, the most comprehensive structure of any
AAAH to date as it is nearly full length (missing only one amino acid residue). This
model also has significant advantages over an automated model of TPH generated
by SWISS-MODEL (Guex et al., 1997, 1999). This latter structure was truncated
(containing residues 104-411), and not subject to rigorous investigator-interactive
energy minimizations used in the present work. Potential functional motifs, as well
as amino acids involved in substrate binding and phosphorylation, have been
identified with the use of our hypothetical model. The recent crystallization of a
truncated form of human TPH (N∆1-102/C∆402-444) at a resolution of 1.7Å and
with bound cofactor analogue (7,8-dihydro-L-biopterin), validates the catalytic
domain of this hypothetical model and provides new insights into tryptophan
hydroxylation. An “iterative magic fit” of the TPH crystal structure and hypothetical
model using Swiss-PdbViewer (Guex and Peitsch, 1997) indicate a root mean
square deviation (R.M.S.D.) of 1.02 Å between the carbon backbones of the
structures.
21
Figure 2: Structural Comparisons of the AAAHs. The crystal structures of PAH and
TH are shown beside a predicted structure of the TPH catalytic domain. These
structures only depict the catalytic domains of these AAAHs. The PAH structure
(PDB entry 1PAH) depicts residues 117 to 424, thereby missing the entire regulatory
domain and the extreme carboxy terminal. The TH structure (1TOH) depicts
residues 164 to 498, and is also missing the entire regulatory domain.
The
predicted TPH catalytic domain was generated by homology-based modeling in the
“Composer” module of Sybyl 6.5 (Tripos, St. Louis, MO). This figure was originally
generated by Mr. Jiang and is reproduced from Vrana, 1999.
22
23
REFERENCES
Andersen O.A., Flatmark T., and Hough E. (2001) High resolution crystal structures
of the catalytic domain of human phenylalanine hydroxylase in its catalytically
active Fe(II) form and binary complex with tetrahydrobiopterin. J. Mol. Biol.
314, 270-291.
Andersen O.A., Flatmark T., and Hough E. (2002) Crystal structure of the ternary
complex of the catalytic domain of human phenylalanine hydroxylase with
tetrahydrobiopterin and 3-(2-thienyl)-L-alanine, and its implications for the
mechanism of catalysis and substrate activation. J. Mol. Biol. 320, 10951108.
Austin, M.C. and O’Donnell, S.M. (1999) Regional distribution and cellular
expression of tryptophan hydroxylase messenger RNA in postmortem human
brainstem and pineal gland. J. Neurochem. 72, 2065-2073.
Azmitia E.C.G. (2001) Serotonin. Encyclopedia of Life Sciences 1-11.
Banik U., Wang G.A., Wagner P.D., and Kaufman S. (1997) Interaction of
phosphorylated tryptophan hydroxylase with 14-3-3 proteins. J. Biol. Chem.
272, 26219-25
Beevers, S.J., Knowles, R.G., and Pogson, C.I. (1983) A sensitive radiometric
assay for tryptophan hydroxylase applicable to crude extracts.
J.
Neurochem. 40, 894-897.
Boadle-Biber M.C. (1982) Blockade by haloperidol of the increase in tryptophan
hydroxylase activity induced by incubation of slices of brain stem with
dibutyryl cyclic AMP. Biochem. Pharmacol. 31, 2203-2207.
Boadle-Biber M.C., and Phan T.H. (1987) Involvement of calmodulin-dependent
phosphorylation of brainstem tryptophan hdydroxylase induced by
depolarization of slices or other treatments that raise intracellular free
calcium levels. Biochem Pharmacol. 36, 1174-1176.
Bräutigam C., Steenbergen-Spanjers G.C.H., Hoffmann G.F., Dionisi-Vici C., van
den Heuvel L.P.W.J., Smeitink J.A.M., and Wevers R.A. (1999). Biochemical
and molecular genetic characteristics of the severe form of tyrosine
hydroxylase deficiency. Clin. Chem. 45, 2073-2078.
24
Bjorgo E., de Carvalho R.M., and Flatmark T. (2001) A comparison of kinetic and
regulatory properties of the tetrameric and dimeric forms of wild-type and
Thr427->Pro mutant human phenylalanine hydroxylase: contribution of the
flexible hinge region Asp425-Gln429 to the tetramerization and cooperative
substrate binding. Eur. J. Biochem. 268, 997-1005.
Brentegani, L.G. and Lico, M.C. (1982) Dental pain and the injection of agents into
the trigeminal nerve of guinea pigs. Phys. and Behav. 28, 49-52.
Cash C.D., Vayer P., Mandel P., and Maitre M. (1985) Tryptophan 5-hydroxylase.
Rapid purification from whole rat brain and production of a specific antiserum.
Eur. J. Biochem. 149, 239-245.
Cash C.D. (1998) Why tryptophan hydroxylase is difficult to purify: a reactive
oxygen-derived species-mediated phenomenon that may be implicated in
human pathology. Gen. Pharmacol. 30, 569-574.
Chanut E., Nguyen-Legros J., Labarthe B., Trouvin J.H., and Versaux-Botteri C.
(2002) Serotonin synthesis and its light-dark variation in the rat retina. J.
Neurochem. 83, 863-9.
Cornwell-Jones, C.A., Decker, M.W., Chang, J.W., Cole, B., Goltz, K.M., Tran, T,,
and McGaugh, J.L. (1989) Neonatal 6-hydroxydopa, but not DSP-4, elevates
brainstem monoamines and impairs inhibitory avoidance learning in
developing rats. Brain Res. 493, 258-68.
Daubner S.C., Lohse D.L., and Fitzpatrick P.F. (1993) Expression and
characterization of catalytic and regulatory domains of rat tyrosine
hydroxylase. Protein Sci. 2, 1452-1460.
Darmon M.C., Guibert B., Leviel V., Ehret M., Maitre M., and Mallet J. (1988)
Sequence of two mRNAs encoding active rat tryptophan hydroxylase. J.
Neurochem. 51, 312-316.
D’Sa C.M., Arthur R.E. Jr., Jennings I., Cotton R.G.H., and Kuhn D.M. (1996a)
Tryptophan hydroxylase: Purification by affinity chromatography on
calmodulin-sepharose. J. Neurosci. Meth. 69, 149-153.
D’Sa C.M., Arthur R.E.Jr., Kuhn D.M. (1996b) Expression and deletion mutagenesis
of tryptophan hydroxylase fusion proteins: Delineation of the enzyme catalytic
core. J. Neurochem. 67, 917-926.
Erlandsen, H., Martinez A., Knappskog P.M., Haavik, J., Hough, E. and Flatmark, T.
(1997a) Crystallization and preliminary diffraction analysis of a truncated
homodimer of human phenylalanine hydroxylase. FEBS Letters. 406, 171174.
25
Erlandsen, H., Fusetti F., Martinez A., Hough E., Flatmark, T. and Stevens R.C.
(1997b) Crystal structure of human phenylalanine hydroxylase reveals the
structural basis for phenylketonuria. Nat. Struct. Biol. 4, 995-1000.
Erlandsen H., Flatmark T., Stevens R.C., and Hough E. (1998) Crystallographic
analysis of the human phenylalanine hydroxylase catalytic domain with
bound catechol inhibitors at 2.0A resolution. Biochem. 37, 15638-15646.
Erlandsen H., Bjorgo E., Flatmark T., and Stevens R.C. (2000) Crystal structure and
site-specific mutagenesis of pterin-bound human phenylalanine hydroxylase.
Biochem. 39, 2208-2217.
Erlandsen H., and Stevens R.C. (2001). A structural hypothesis for BH4
responsiveness in patients with mild forms of hyperphenylalaninaemia and
phenylketonuria. J. Inherit. Metab. Dis. 24, 213-30.
Erlandsen H., Kim J.Y., Patch M.G., Han A., Volner A., Abu-Omar M.M., and
Stevens R.C. (2002) Structural comparison of bacterial and human irondependent phenylalanine hydroxylases: Similar fold, different stability and
reaction rates. J. Mol. Biol. 320, 645-661.
Fisher, D.B. and Kaufman, S. (1973) The stimulation of rat liver phenylalanine
hydroxylase by lysolecithin and chymotrypsin. J. Biol. Chem. 248, 43454353.
Fitzpatrick P.F. (1999) Tetrahydrobiopterin-dependent amino acid hydroxylases.
Annu. Rev. Biochem. 68, 355-381.
Fujisawa H., and Nakata H. (1987a) Tryptophan 5-monooxygenase from mouse
mastocytoma clone P815. Methods Enzymol. 142, 93-96.
Fujisawa H., and Nakata H. (1987b) Tryptophan 5-monooxygenase from rat brain
stem. Methods Enzymol. 142, 83-87.
Fusetti F., Erlandsen H., Flatmark T., and Stevens R.C. (1998) Structure of
tetrameric phenylalanine hydroxylase. J. Biol. Chem. 273, 16962-16967.
Goodwill, K.E., Sabatier, C., Marks, C., Raag, R., Fitzpatrick, P.F., and Stevens,
R.C. (1997) Crystal structure of tyrosine hydroxylase at 2.3 A and its
implication for inherited neurodegenerative diseases. Nature Struct. Biol. 4,
578-585.
Goodwill, K.E., Sabatier, C., and Stevens, R.C. (1998) Crystal structure of tyrosine
hydroxylase with bound cofactor analogue and iron at 2.3Å resolution: selfhydroxylation of Phe300 and pterin-binding site. Biochem. 37, 13437-13445.
26
Grahame-Smith, D.G. (1964) Tryptophan hydroxylation in brain. Biochem Biophys
Res Commun 16, 586-592.
Grenett H.E., Ledley F.D., Reed L.L., and Woo S.L.C. (1987) Full-length cDNA for
rabbit tryptophan hydroxylase: Functional domains and evolution of aromatic
amino acid hydroxylases. Proc. Natl. Acad. Sci. USA, 84, 5503-5534.
Grima B., Lamouroux A., Blanot F., Faucon Biguet N., and Mallet J. (1985)
Complete coding sequence of rat tyrosine hydroxylase mRNA. Proc. Natl.
Acad. Sci. USA, 82, 617-621.
Guex N., and Peitsch M.C. (1997) SWISS-MODEL and the Swiss-PdbViewer: an
environment for comparative protein modeling. Electrophoresis 18, 27142723.
Guex N., Diemand A., and Peitsch M.C. (1999) Protein modeling for all. Trends
Biochem. 24, 364-367.
Hamdan, F.F., and Ribeiro P. (1999) Characterization of a stable form of tryptophan
hydroxylase from the human parasite Schistosoma mansoni. J. Biol. Chem.
274, 21746-21754.
Horne J., Jennings I.G., The T., Gooley P.R., and Kobe B. (2002) Structural
characterization of the N-terminal autoregulatory sequence of phenylalanine
hydroxylase. Prot. Sci. 11, 2041-2047.
Hosoda S. (1975) Further studies on tryptophan hydroxylase from neoplastic murine
mast cells. Biochim. Biophys. Acta. 397, 58-68.
Hufton S.E., Jennings I.G., and Cotton R.G.H. (1995) Structure and function of the
aromatic amino acid hydroxylases. Biochem. J. 311, 353-366.
Ichinose H., Suzuki T., Inagaki H., Ohye T., and Nagatsu T. (1999) Molecular
genetics of Dopa-responsive dystonia. Biol. Chem. 380, 1355-1364.
Jennings I.G., Cotton R.G., and Kobe B. (2000) Structural interpretation of
mutations in phenylalanine hydroxylase protein aids in identifying genotypephenotype correlations in phenylketonuria. Eur. J. Hum. Genet. 8, 683-696.
Jennings I.G., Teh T., and Kobe B. (2001) Essential role of the N-terminal
autoregulatory sequence in the regulation of phenylalanine hydroxylase.
FEBS Lett. 488,196-200.
Jequier E., Robinson D.S., Lovenberg W., and Sjoerdsma A. (1969) Further studies
on tryptophan hydroxylase in rat brain stem and beef pineal. Biochem.
Pharmacol. 18, 1071-1081.
27
Jiang G.C.-T., Yohrling IV G.J., and Vrana K.E. (2000a). Phenylketonuria. In:
Encyclopedia of Life Sciences. 14, 150-154. London: Nature-Scientific
American Publishing Group. http://www.els.net (invited review).
Jiang G.C.-T., Yohrling IV G.J., Schmitt J.D., and Vrana K.E. (2000b). Identification
of substrate orienting and phosphorylation sites within tryptophan
hydroxylase using homology-based molecular modeling. J. Mol. Biol. 302,
1005-1017.
Jiang, X.R., Wrona, MZ., and Dryhurst, G. (1999) Tryptamine-4,5-dione, a putative
endotoxic metabolite of the superoxide-mediated oxidation of serotonin, is a
mitochondrial toxin: Possible implications in neurodegenerative brain
disorders. Chem Res in Toxicol. 12, 429-436.
Joh T.H., Shikimi T., Pickel V.M., and Reis D.J. (1975) Brain tryptophan
hydroxylase: Purification of, production of antibodies to, and cellular and
ultrastructural localization in serotonergic neurons of rat midbrain. Proc. Natl.
Acad. Sci. USA 72, 3575-3579.
Johansen P.A., Jennings I., Cotten R.G.H., and Kuhn D.M. (1995) Tryptophan
hydroxylase is phosphorylated by protein kinase A. J. Neurochem. 65, 882888.
Johansen P.A., Jennings I., Cotten R.G.H., and Kuhn D.M. (1996) Phosphorylation
and activation of tryptophan hydroxylase by exogenous protein kinase A. J.
Neurochem. 66, 817-823.
Kandasamy, S.B. and Williams, B.A. (1984) Hypothermic and anti-pyretic effects of
ACTH (1-24) and alpha-melanotropin in guinea pigs. Neuropharmacology 23,
49-53.
Knappskog P.M., Flatmark T., Mallet J., Ludecke B., and Bartholome K. (1995)
Recessively inherited L-DOPA-responsive dystonia caused by a point
mutation (Q381K) in the tyrosine hydroxylase gene. Hum. Mol. Genet. 4,
1209-1212.
Kobe B, Jennings I.G., House, C.M., Feil, S.C., Michell, B.J., Tiganis, T., Parker,
M.W., Cotton, R.G.H., and Kemp, B.E. (1997) Regulation and crystallization
of phosphorylated and dephosphorylated forms of truncated dimeric
phenylalanine hydroxylase. Protein Science, 6, 1352-1357.
Kobe B, Jennings I.G., House, C.M., Michell, B.J., Goodwill, K.E., Santarsiero, B.D.,
Stevens, R.C., Cotton, R.G.H., and Kemp, B.E. (1999) Structural basis of
auto regulation of phenylalanine hydroxylase. Nature Struct. Biol. 6, 442448.
28
Kowlessur D. and Kaufman S. (1999) Cloning and expression of recombinant
human pineal tryptophan hydroxylase in Escherichia coli: purification and
characterization of the cloned enzyme. Biochimica et Biophysica Acta. 1434,
317-330.
Kuhn D.M., Rosenberg R.C., and Lovenberg W. (1979) Determination of some
molecular parameters of tryptophan hydroxylase from rat midbrain and
murine mast cells. J. Neurochem. 33, 15-21.
Kuhn D.M., Ruskin B., and Lovenberg W. (1980) Tryptophan hydroxylase: The role
of oxygen, iron, and sulfhydryl groups as determinants of stability and
catalytic activity. J. Biol. Chem. 255, 4137-4143.
Kumer S.C., Mockus S.M., Rucker P.J., Vrana K.E. (1997a) Amino terminal deletion
analysis of tryptophan hydroxylase: PKA phosphorylation occus at serine-58.
J. Neurochem. 69, 1738-1745.
Kumer S.C. and Vrana, K.E. (1997b) Intricate regulation of tyrosine hydroxylase
activity and gene expression. J. Neurochem. 67, 443-462.
Ledley F.D., DiLella A.G., Kwok C.M., and Woo S.L.C. (1985) Homology between
phenylalanine hydroxylase and tyrosine hydroxylase reveals common
structural and functional domains. Biochemistry, 24, 3389-3394.
Liu X., and Vrana K.E. (1991) leucine zippers and coiled-coils in the aromatic amino
acid hydoxylases. Neurochem. Int. 18, 27-31.
Lovenberg W., Jequier E., and Sjoerdsma A. (1967) Tryptophan hydroxylation:
Measurement in pineal gland, brain stem and carcinoid tumor. Science 155,
217-219.
Ludecke, B., Dworniczak, B., Bartholome, K. (1995) A point mutation in the tyrosine
hydroxylase gene associated with Segawa’s syndrome. Hum. Genet. 95,
123-125.
Ludecke, B., Knappskog P.M., Clayton P.T., Surtees R.A.H., Clelland J.D., Heales
S.J.R., Brand M.P., Bartholome K., and Flatmark T. (1996) Recessively
inherited L-dope responsive parkinsonism in infancy caused by a point
mutation (L205P) in the tyrosine hydroxylase gene. Hum. Mol. Gen. 7, 10231028.
Manuck, S.B., Flory, J.D., Ferrell, R.E., Dent, K.M., Mann, J.J., and Muldoon, M.F.
(1999) Aggression and anger-related traits associated with a polymorphism
of the tryptophan hydroxylase gene. Biol. Psych. 45, 603-614.
29
Martinez A., Knappskog P.M., and Haavik J. (2001) A structural approach into
human tryptophan hydroxylase and its implications for the regulation of
serotonin biosyntheis. Curr. Med. Chem. 8, 1077-1091.
McKinney J., Teigen K., Froystein N.A., Salaun C., Knappskog P.M., Haavik J., and
Martinez A. (2001) Conformation of the substrate and pterin cofactor bound
to human tryptophan hydroxylase. Important role of Phe313 in substrate
specificity. Biochemistry 40, 15591-601.
Miranda FF, Teigen K, Thorolfsson M, Svebak RM, Knappskog PM, Flatmark T,
and Martinez A. (2002) Phosphorylation and mutations of Ser(16) in human
phenylalanine hydroxylase. Kinetic and structural effects. J. Biol. Chem. 277,
40937-40943.
Mockus S.M., Kumer S.C., Vrana K.E. (1997a) Carboxyl terminal deletion analysis
of tryptophan hydroxylase. Biochim. Biophys. Acta, 1342, 132-140.
Mockus S.M., Kumer S.C., Vrana K.E. (1997b) A chimeric tyrosine/tryptophan
hydroxylase: The tyrosine hydroxylase regulatory domain serves to stabilize
enzyme activity. J. Mol. Neurosci. 9, 35-48.
Mockus S.M., Yohrling IV, G.J., and Vrana K.E. (1998) Tyrosine hydroxylase and
tryptophan hydroxylase do not form heterotetramers. 10, 45-51.
Mockus S.M. and Vrana K.E. (1998) Advances in the molecular characterization of
tryptophan hydroxylase. J. Mol. Neurosci. 10, 163-179.
Moran G.R., Daubner S.C., and Fitzpatrick P.L. (1998) Expression and
characterization of the catalytic core of tryptophan hydroxylase. J. Biol.
Chem. 273, 12259-12266.
Moran G.R., Fitzpatrick P.F. (1999). A continuous fluorescence assay for tryptophan
hydroxylase. Anal. Biochem. 266,148-52.
Nakata H, and Fujisawa H. (1981) Simple and rapid purification of tryptophan 5monooxygenase from rabbit brain by affinity chromatography. J. Biochem.
90, 567-569.
Nakata H., and Fujisawa H. (1982a) Purification and properties of tryptophan 5monoxygenase from rat brainstem. Eur. J. Biochem. 122, 41-47.
Nakata H, and Fujisawa H. (1982b) Tryptophan 5-monooxygenase from mouse
mastocytoma P815. A simple purification and general properties. Eur. J.
Biochem. 124, 595-601.
30
Neckameyer W.S., and White K. (1992) A single locus encodes both phenylalanine
hydroxylase and tryptophan hydroxylase activities in Drosophila. J. Biol.
Chem. 267, 4199-4206.
Nielsen, D.A., Goldman, D., Virkkunen, M., Tokola, R., Rawlings, R., and Linnoila,
M. (1994) Suicidality and 5-hydroxyindoleacetic acid concentration
associated with a tryptophan hydroxylase polymorphism. Arch. Gen. Psych.
51, 34-38.
Nowacki, P., Byck, S., Prevost, L., and Scriver, C.R. (1997) The PAH mutation
analysis consortium database: update 1996. Nucleic Acids Res. 25, 139142.
Nukiwa T., Toyama C., Okita C., Kataoka T., and Ichiyama A. (1974) Purification
and some properties of bovine pineal tryptophan 5-monooxygenase.
Biochem. Biophys. Res. Commun. 60, 1029-1035.
Olivier, B., Mos, J., van Oorschot, R., and Hen, R. (1995) Serotonin receptors and
animal models of aggressive behavior. Pharmacopsych. 28 Suppl 2, 80-90.
Park D.H., Stone D.M., Kim K.S., and Joh T.H. (1994) Characterization of
recombinant mouse tryptophan hydroxylase expressed in Escherichia coli.
Mol. Cell. Neurosci. 5, 87-93.
Privat K., Brisson C., Jouvet A., Chesneau D., Ravault J.P., and Fevre-Montange M.
(2002) Evidence for implication of tryptophan hydroxylase in the regulation of
melatonin synthesis in ovine pinealocytes in culture. Cell. Mol. Neurobiol. 22,
417-29.
Ramaekers V.T., Senderek J., Hausler M., Haring M., Abeling N., Zerres K.,
Bergmann C., Heimann G., and Blau N. (2001) A novel neurodevelopmental
syndrome responsive to 5-hydroxytryptophan and carbidopa. Mol. Genet.
Metab. 73,179-87.
Regier D.A., Narrow W.E., Rae D.S., Manderscheid R.W., Locke B.Z., and Goodwin
F.K. (1993) The de facto mental and addictive disorders service system.
Epidemiologic Catchment Area prospective 1-year prevalence rates of
disorders and services. Archives of General Psychiatry 50, 85-94.
Reinhard Jr J.F, Smith G.K., Nichol C.A. (1986) A rapid and sensitive assay for
tyrosine-3-monooxygenase based upon the release of 3H2O and adsorption
of [3H]-tyrosine by charcoal. Life Sci. 39, 2185-2189.
Sawada M., and Nagatsu T. (1986) Stimulation of the serotonin autoreceptor
prevents the calcium-calmodulin-dependent increase of serotonin
biosynthesis in rat raphe slices. J. Neurochem. 46, 963-967.
31
Tong J.H., and Kaufman S. (1975) Tryptophan hydroxylase: purification and some
properties of the enzyme from rabbit hindbrain. J. Biol. Chem. 250, 41524158.
Van den Heuvel L.P., Luiten B., Smeitink J.A.M., de Rijk-van Andel J.F., Hyland K.,
Steenbergen-Spanjers G.C., Janssen R.J., and Wevers R.A. (1998). A
common point mutation in the tyrosine hydroxylase gene in autosomal
recessive L-DOPA-responsive dystonia in the Dutch population. Hum. Genet.
102, 644-646.
Vrana K.E. (1999) How the regulatory and catalytic domains get together. Nat.
Struct. Biol. 6, 401-402.
Vrana, S.L., Dworkin, S.I., and Vrana, K.E. (1993) Radioenzymatic assay for
tryptophan hydroxylase: [3H]H2O release assessed by charcoal adsorption.
J. Neurosci. Meth. 48, 123-129.
Walker S.J., Liu X., Roskoski R. Jr., and Vrana K.E. (1994) Catalytic core of rat
tyrosine hydroxylase: Terminal deletion analysis of bacterially-expressed
enzyme. Biochim. Biophys. Acta 1206, 113-119.
Wang, G.A., Coon, S.L., and Kaufman, S. (1998) Alternative splicing at the 3'-cDNA
of human tryptophan hydroxylase. J. Neurochem. 71, 1769-1762.
Wang G.A., Gu P., and Kaufman S. (2001) Mutagenesis of the regulatory domain of
phenylalanine hydroxylase. Proc. Natl. Acad. Sci. 98, 1537-1542.
Wang L., Erlandsen H., Haavik J., Knappskog P.M., and Stevens R.C. (2002).
Three-dimensional structure of human tryptophan hydroxylase and its
implications for the biosynthesis of the neurotransmitters serotonin and
melatonin. Biochem. 41, 12569-12574.
Wevers R.A., de Ruk-van Andel J.F., Bräutigam C., Guertz B., van den Heuvel L.P.,
Steenergen-Spanjers G.C., Smeitink J.A., Hoffman G.F., and Gabreels F.J.
(1999). A review of biochemical and molecular genetic aspects of tyrosine
hydroxylase deficiency including a novel mutation (291delC). J. Inherit.
Metab. Dis. 22, 364-373.
Widmer F., Mutus B., RamaMurthy J., Sniedkus V.A., and Viswanatha T. (1975)
Partial purification of rabbit hind brain tryptophan hydroxylase by affinity
chromatography. Life Sci. 17, 1297-1302.
Yang X.J., and Kaufman S. (1994) High-level expression and deletion mutagenesis
of human tryptophan hydroxylase. Proc. Natl. Acad. Sci. USA 91, 6659-6663.
32
Yohrling IV, G.J., Mockus, S.M., and Vrana, K.E. (1999) Identification of aminoterminal sequences contributing to tryptophan hydroxylase tetramer
formation. J. Mol. Neurosci. 12, 23-34.
Yohrling IV G.J., Jiang G.C., Mockus S.M., and Vrana K.E. (2000) Intersubunit
binding domains within tyrosine hydroxylase and tryptophan hydroxylase. J.
Neurosci. Res. 61,:313-20.
Youdim M.B., Hamon M., and Bourgoin S. (1974) Purification of pig brainstem
tryptophan hydroxylase and some of its properties. Adv. Biochem.
Psychopharmacol. 11, 13-17.
Youdim M.B., Hamon M., and Bourgoin S. (1975) Properties of partially purified pig
brain stem tryptophan hydroxylase. J. Neurochem. 25, 407-414.
33
STATEMENT OF PURPOSE
The goal of this dissertation research was to utilize recombinant DNA
technologies as well as homology-based computer modeling to more fully
understand the structure and function of human TPH. The studies presented in the
next chapters are intended to advance our characterization of TPH, and the subtle
role that mutations in the enzyme may play in disease.
The first objective was to generate a hypothetical three-dimensional model of
human TPH using homology-based molecular modeling in the absence of an
experimentally-determined crystal structure. Previous in vitro structural data of TPH
and the other AAAHs were mapped to this model. Our hypothetical model revealed
information regarding the differential regulation and function of TPH when compared
to previously determined structures for TH and PAH. Thereafter, we performed sitedirected mutagenesis to identify previously unidentified functional domains within the
TPH protein, and to validate the hypothetical model.
The second objective was to perform in vitro expression analysis of a
naturally-occuring mutation in human TPH. The rationale for doing so is the same as
those behind the analysis of PAH polymorphisms related to the metabolic condition
PKU. That is, to confirm that a “disease-associated” mutation is truly pathogenic, to
assess the severity of a mutation’s impact, and to elucidate the molecular
mechanisms involved by understanding how a mutation exerts its deleterious
effects. In the course of these experiments, we developed a bacterial expression
system that permits the rapid purification of the human TPH enyme.
34
Overall, these studies have revealed that the structure of TPH closely
resembles other members of the AAAH superfamily, and have illuminated new
insights into the structural and functional aspects of the protein. Additionally, these
studies indicate that the first described coding region polymorphism of TPH may
have a minimal impact on enzyme activity. However, it has identified what is
important new information on structural determinants of the TPH active site.
CHAPTER II
IDENTIFICATION OF SUBSTRATE ORIENTING AND PHOSPHORYLATION
SITES WITHIN TRYPTOPHAN HYDROXYLASE USING HOMOLOGY-BASED
MOLECULAR MODELING
George C.-T. Jiang, George J. Yohrling IV, Jeffrey D. Schmitt,
and Kent E. Vrana
The following chapter is a paper published in Journal of Molecular Biology, volume
302, pages 1005-1017 (2000). The materials have been reprinted with permission.
Stylistic variations are due to the requirements of the journal. The original proposal
and concept for these studies were those of George Jiang, George Yohrling, and
Kent Vrana. George Jiang and George Yohrling contributed equally to construction
of the hypothetical model and preparation of the manuscript. Dr. Kent E. Vrana
served in an advisory position on experimental design and manuscript preparation.
Dr. Jeffrey D. Schmitt (Targacept Inc.) provided technical assistance and scientific
advice with the molecular modeling software and aided with construction of the
hypothetical model. All final energy minimizations of the model were performed by
Dr. Schmitt.
35
36
Abstract
Tryptophan hydroxylase (TPH) is the initial and rate-limiting enzyme in the
biosynthesis of serotonin (5-HT). The inherent instability of TPH has prevented a
crystallographic structure from being resolved. For this reason, multiple sequence
alignment-based molecular modeling was utilized to generate a full-length model of
human TPH. Previously determined crystal coordinates of two highly homologous
proteins, phenylalanine hydroxylase (PAH) and tyrosine hydroxylase (TH), were
used as templates. Analysis of the model aided rational mutagenesis studies to
further dissect the regulation and catalysis of TPH. Using rational site-directed
mutagenesis, it was determined that Tyr235 (Y235), within the active site of TPH,
appears to be involved as a tryptophan substrate orienting residue. The mutants
Y235A and Y235L displayed reduced specific activity compared to wild-type TPH
(≈5% residual activity). The Km of tryptophan for the Y235A (564 µM) and Y235L
(96 µM) mutant was significantly increased compared to wild-type TPH (42 µM). In
addition, kinetic analyses were performed on wild-type TPH and a deletion construct
that lacks the amino terminal autoregulatory sequence (TPH N ∆15). This sequence
in phenylalanine hydroxylase (residues 19-33) has previously been proposed to act
as a steric regulator of substrate accessibility to the active site. Changes in the
steady-state kinetics for tetrahydrobiopterin (BH4) and tryptophan for TPH N ∆15
were not observed. Finally, it was demonstrated that both Ser58 and Ser260 are
substrates for Ca2+/calmodulin-dependent protein kinase II. Additional analysis of
this model will aid in deciphering the regulation and substrate specificity of TPH, as
37
well as providing a basis to understand as yet to be identified polymorphisms.
38
Introduction
Tryptophan hydroxylase (TPH; EC 1.14.16.4) is a member of the aromatic
amino acid hydroxylase superfamily (Fitzpatrick, 1999). The other members of this
family include tyrosine hydroxylase (TH; EC 1.14.16.2) and phenylalanine
hydroxylase (PAH; EC 1.14.16.1). The enzymes share approximately 50% amino
acid sequence identity and are thought to have evolved from a common progenitor
(Grenett et al., 1987; Neckameyer & White, 1992). TPH serves as the rate-limiting
enzyme in the biosynthesis of the neurotransmitter serotonin (5-HT), and as a nonlimiting component of the melatonin synthetic pathway within the pineal gland.
Recent evidence has shown TPH to be rate-limiting for melatonin biosynthesis in the
retina (Thomas et al., 1998). Within the central nervous system, TPH is localized in
the raphe nuclei, as well as in various peripheral locations such as the pineal gland,
enteric neurons of the gut, and the enterochromaffin mast cells of the intestine and
pancreas (Mockus & Vrana, 1998). Serotonin is an important monoamine that has
been implicated in a wide variety of central nervous system functions including
temperature control, aggression, pain, and memory (Kandasamy & Williams, 1984;
Brentegani & Lico, 1982; Cornwell-Jones et al., 1989; Olivier at al., 1995).
Aberrations in 5-HT synthesis and regulation have been linked to a diverse group of
neurological and psychiatric disorders such as Parkinson’s disease, Gilles de la
Tourette’s syndrome, multiple sclerosis, depression, and obsessive compulsive
disorder (Volicier et al., 1985; Schauenburg & Dressler; 1992; Tabaddor et al., 1978;
Mann et al., 1997; Delgado & Moreno, 1998).
TPH could be a potential
39
pharmacotherapeutic target in the etiology of several of these neurological diseases.
The hydroxylases are composed of an amino terminal regulatory domain and
a carboxyl terminal catalytic domain (Grenett et al., 1987; Ledley et al., 1985;
Darmon et al., 1988; Daubner et al., 1993). It is presumed that the regulatory
domains of the enzymes act to modulate activity. Ser58, the one documented
phosphorylation site in TPH resides in this regulatory domain (Kuhn et al., 1997;
Kumer et al., 1997).
The active sites reside within the catalytic domain and are
responsible for the hydroxylation of their respective aromatic amino acid residues.
Chimeric hydroxylases have been created to demonstrate that substrate specificity
is controlled by the catalytic domain (Mockus et al., 1997b; Daubner et al., 1997).
Table 1 summarizes all of the published recombinant TPH mutants that have been
created to dissect the structure, function, and regulatory mechanisms of TPH.
TPH is known to exist both in vivo and in vitro as a homotetramer (reviewed in
Hufton et al., 1995). Recently, this laboratory has identified intersubunit binding
domains in both the regulatory and catalytic domains of the rabbit TPH protein
(Mockus et al., 1997a; Yohrling et al., 1999). These interactions are thought to be
hydrophobic and necessary for the proper macromolecular assembly of TPH.
Despite the high level of protein sequence identity in the catalytic domains of TH and
TPH, they do not form heterotetramers (Mockus et al., 1998). It is hypothesized that
there are additional structural domains within TPH that work in tandem with those
already identified, to allow for its regulation. This is an additional reason that
crystallization or theoretical modeling of TPH is of particular significance.
Knowledge (or prediction) of a detailed quaternary structure will enable design of
40
potential pharmacotherapeutics to modulate TPH activity. Moreover, a detailed
tertiary and quaternary structure of TPH will provide insight into the factors
governing differential substrate specificity among the aromatic amino acid
hydroxylases.
41
42
It has long been known that point mutations within the PAH gene lead to
insufficient PAH activity and the build-up of the amino acid phenylalanine. This
leads to the metabolic imbalances and mental retardation that are characteristic of
phenylketonuria (PKU). There are in excess of 300 known distinct mutations in PAH
that lead to PKU (Eisensmith & Woo, 1991). Recently, point mutations in the
catalytic domain of TH have been linked to Segawa’s syndrome and L-dopa
responsive Parkinsonism (Ludecke et al., 1995, 1996; Knappskog et al., 1995). In
addition, an intronic polymorphism in the human TPH gene has been discovered
that is associated with suicidality and variable 5-hydroxyindolacetic acid (5-HIAA)
concentrations in Finnish Caucasians (Nielsen et al., 1992, 1994). To date, it is
unclear what, if any, such an intronic polymorphism would have on TPH regulation.
However, the genetic findings in PAH and TH suggest that point mutations in critical
regulatory and structural domains of TPH will be discovered and that these
mutations may explain selected neurological disorders associated with aberrant
serotonergic levels.
It is unfortunate that research advances on TPH have lagged behind that of
the other aromatic amino acid hydroxylases. The extreme instability of TPH has
precluded its purification in large quantities (Kuhn et al., 1980; D’Sa et al., 1996a,b;
Cash, 1998; Moran et al., 1998), and without adequate purification, a complete
crystallographic model for TPH will not be elucidated. For this reason, it has
become important to apply the existing information on the related aromatic amino
acid hydroxylases (PAH and TH) to aid in characterizing the structure and regulation
of TPH. The recent crystallization of both PAH and TH provide much of this
43
information (PAH; Erlandsen et al., 1997a,b, 1998, 2000; TH; Goodwill et al., 1997,
1999).
Here, we present a detailed structural model of human TPH, based on the
existing structural coordinates for TH and PAH (1TOH and both 1PHZ and 1PAH,
respectively; Research Collaboratory for Structural Bioinfomatics Protein Databank;
RCSB-PDB) generated using multiple sequence alignment homology modeling
techniques (Blundell et al., 1988; Sutcliffe et al., 1987). In addition to being stable
relative to molecular mechanics, our model was utilized to successfully predict
aspects of TPH assembly and function.
44
Results
General topography of the hypothetical TPH model
The fully minimized, hypothetical human TPH model is shown in Figure 1.
The monomeric unit contains both the amino terminal regulatory domain and the
carboxy terminal catalytic domain. The amino terminal end of the protein lacks an
organized secondary structure. Previously determined structural and regulatory
moieties are evident on the model. A Ramachandran plot (PROCHECK analysis at
2.0 Å) indicates that 84.7, 14.0, 1.0, and 0.3% of non-glycine and non-proline
residues reside in most favorable, additionally allowed, generously allowed and
disallowed regions respectively. Notably, the last category (disallowed) is composed
of a single amino acid (Ile 2) at the disordered amino terminus. In Figure 2, the high
degree of secondary and tertiary structural identity between TPH, PAH and TH is
evident in a side-by-side comparison of all three structures.
Slight structural
variations are present between the regulatory domains of PAH and TPH. Figure 3
depicts a theoretical tetramer of human TPH. The tetramer is anchored by the Cterminal tetramerization domain that is composed of hydrophobic, coiled-coil
interactions. The regulatory domain of a given monomer forms intersubunit contacts
with both the tetramerization domain and regulatory domain of an adjacent subunit.
45
Figure 1: Hypothetical model of human TPH (monomer). A 3-D model of the
monomeric subunit of human TPH is depicted. All amino acids were modeled
except for the initial methionine residue. Secondary structure is identified by color:
β-sheets (yellow), α-helix (pink), and random coil (white). The locations of Ser58,
Ser260, and Tyr235 are indicated. The amino terminus of TPH begins with a nonstructured random coil formation termed the active-site gate. The carboxy terminal
helix (tetramerization domain) and the amino terminal 4,3-repeat have previously
been identified as structural motifs required for the proper macromolecular assembly
of TPH. A proposed interface domain between the regulatory and catalytic domain
of TPH is also indicated.
The model was generated on a Silicon Graphics
Workstation with the modeling program Sybyl 6.5 (Tripos Inc., St. Louis, MO).
46
47
Figure 2: Side by side comparison of TH, PAH, and hypothetical TPH. The
previously resolved crystal structures for rat PAH (1PHZ) and rat TH (1TOH) are
shown along with the full length human TPH model.
The X-ray diffraction
coordinates for both 1PHZ and 1TOH were used to perform homology based
modeling. A high degree of secondary and tertiary structure identity among all the
hydroxylase models is evident.
48
49
Figure 3: Tetramer of hypothetical TPH. Each monomer of TPH is shown in a
different color. The tetramer is anchored by a carboxy terminal leucine zipper and
additional intersubunit hydrophobic interactions between the regulatory domains.
The model was created using an alignment based on the previously reported
tetramer for TH (Goodwill et al., 1997).
50
51
TABLE 2. Steady-state kinetic parameters of wild-type TPH and mutants
Enzyme
BH4 Km (µM)
L-tryptophan Km (µM)
wt TPH
61 ± 19
30 ± 16
N ∆ 15
50 ± 6
41 ± 13
C ∆ 17
55 ± 4
30 ± 6
wt TPH
78 ± 0.4
42 ± 2
Y235A
34 ± 11
564 ± 85*
Y235L
56 ± 9
96 ± 5*
TPH activity was determined (see Materials and Methods) and the kinetic constants were
calculated by non-linear regression analysis. The substrate concentrations were 100 µM
BH4 (tryptophan variable) and 50 µM tryptophan (BH4 variable). The mean values for BH4
and tryptophan were compared independently of each other. * One-way ANOVA, followed
by a Student’s Newman-Keuls test at 95% confidence indicated that the kinetic differences
observed were statistically significant (p < 0.05).
52
Figure 4: Phosphorylation and immunodetection of TPH. (a) SDS-PAGE analysis of
CaMPKII phosphorylated TPH proteins. Lane1: pET-21c negative control; lane 2:
wild-type TPH; lane 3: S58A; lane 4: S260A; lane 5: S58A/S260A. A decrease in
the amount of incorporated phosphate is observed in the double point mutant
S58A/S260A. (b) Immunoblot of phosphorylated TPH. Immunoreactive proteins
were detected with a monoclonal antibody (WH3) at a 1:1000 dilution followed by an
anti-mouse IgG-HRP from sheep at a 1:1500 dilution. Each protein migrated with a
molecular weight of 51 kDa. No immunoreactive protein was detected in the pET 21c control.
53
54
Kinetic analysis of autoregulatory sequence
Amino terminal deletion of the proposed active-site guard (residues 1-15;
N∆15) and subsequent kinetic analysis produced no change in the Km of TPH for
tryptophan (41(±13) µM) when compared to wild-type TPH (30(±16) µM; Table 2).
Likewise, no alteration in the Km for BH4 was observed in N ∆15 when compared to
TPH. A similar analysis was performed on a TPH mutant that lacked the C-terminal
tetramerization domain.
Non-significant changes in the Km for both BH4 and
tryptophan were observed for the truncated mutant enzyme (see Table 2).
Phosphorylation of TPH by CaMPKII
The hypothetical model indicates that Ser260 resides on the exterior of the
TPH monomer. It has been postulated that Ser260 may serve as a substrate for
phosphorylation by CaMPKII (56) because it is located within the consensus motif
for this kinase (Pearson & Kemp, 1991).
To determine whether Ser260 is
phosphorylated by CaMPKII, a series of point mutations were created to identify the
phosphoryl accepting residue. In Figure 4(a), a phosphorylated band at 51 kDa,
corresponding to the molecular weight of TPH is observed for wild-type TPH, S58A,
and S260A. However, little phosphorylation is apparent in the mutant S58A/S260A.
An unknown bacterial protein (≈49 kDa) was phosphorylated (Figure 4(a)), but
lacked immunoreactivity (Figure 4(b)). The data indicate that both Ser58 and Ser260
are substrates for CaMPKII. The corresponding western blot for the phosphorylation
reaction is depicted in Figure 4(b) and demonstrates that comparable amounts of
55
TPH protein are present in all samples (even the unlabeled S58A/S260A double
point mutation), and all TPH proteins migrated with a molecular weight of 51 kDa.
Rational site-directed mutagenesis
Analysis of the TPH model and a PAH structure with bound inhibitor (6PAH;
Erlandsen et al., 1998) identified Tyr235 (Y235) in TPH as a potential tryptophan
substrate orienting residue.
It was determined that the side-chain of the
corresponding active-site residue in 6PAH (L248) is 5.6 Å from the bound catechol
inhibitor (Erlandsen et al., 1998). Site-directed mutagenesis of Y235 to an alanine
residue (Y235A) and Y235 to a leucine residue (Y235L) significantly reduced TPH
enzymatic activity when compared to wild-type TPH at near saturating substrate
concentrations (p < 0.0005). Figure 5 shows the specific activities for wild-type
TPH, Y235L, and Y235A. The values have been normalized for the amount of
immunoreactive protein present via densitometric analysis (hence enzyme activity
units of nmol hr-1 ROD-1). Steady-state kinetic analyses were then performed to
investigate the nature of the reduction in activities for the Y235 mutations. The Km
of Y235A (564(± 85) µM) and Y235L (96(± 5) µM) for tryptophan were both
dramatically increased over wild-type TPH (42(± 2) µM). Moreover, the Km of the
mutants, for BH4, were unchanged (wild-type TPH, 78(± 0.4) µM; Y235A, 34(± 11)
µM; Y235L, 56(± 9) µM) (see Table 2). Tryptophan substrate inhibition was not
observed in Y235A (Figure 6) or Y235L (data not shown).
56
Figure 5: Specific activities of TPH active-site mutations. Mutation of tyrosine 235
to an alanine residue (Y235A) and a leucine residue (Y235L) reduced the specific
activity (nmol hr-1 ROD-1) of TPH by 94 and 95%, respectively. To determine these
values, constant amounts of the three recombinant enzymes (as determined via a
radioenzymatic activity assay) were applied to a SDS-PAGE gel and electroblotted.
The blot was probed with a monoclonal anti-TPH antibody (WH3; Sigma) followed
by a sheep anti-mouse IgG HRP-coupled secondary antibody (Amersham). The
activity was then normalized for the amount of immunoreactive protein present in
each sample by densitometric analyses (O’Neill et al., 1989). This method accounts
for differences in bacterial expression and/or liberation of the recombinant proteins
such that enzymatic activities can be directly compared. Shown here is the specific
activity mean ± S.E.M. from three independent experiments.
57
58
Figure 6: Lineweaver-Burk analysis of wild-type TPH and TPH Y235A. Shown is a
representative Lineweaver-Burk plot for wild-type TPH (solid circles z) and TPH
Y235A (solid triangles ▼). Tryptophan concentrations ranged from 10 µM to 1mM.
For wild-type TPH, regression analysis was performed after omitting the activity
values recorded at 400 µM and 1mM due to significant TPH inhibition at these
concentrations. For Y235A (this plot) and Y235L (data not shown), no inhibition of
TPH activity was recorded at tryptophan concentrations of 400 µM or 1mM. In this
particular experiment, TPH had a Km for tryptophan of 44 µM, while Y235A was 730
µM.
59
60
Discussion
Our understanding of the aromatic amino acid hydroxylases has increased
greatly in recent years. This progress culminated in the crystallization of the
catalytic core of TH (Goodwil et al., 1997) and the first crystallization of a PAH
regulatory domain (Kobe et al., 1999). Due to the extreme instability of TPH and the
resulting inability to obtain significant amounts of purified protein, a crystal structure
for TPH remains elusive. TPH shares a high degree of sequence identity with both
TH and PAH (Grenett et al., 1987; Neckameyer & White, 1992). For this reason, we
have utilized the crystal coordinates for both TH (1TOH) and PAH (1PHZ and 1PAH)
to perform multiple sequence alignment-based molecular modeling of the human
and rabbit TPH proteins. A Blast comparison (Altschul et al., 1990) of the rabbit and
human protein sequences, yields 97% overall sequence identity. Only 11 out of the
444 amino acid residues are different and only four of these amino acid residues are
non-conservative substitutions. With such a high degree of sequence identity, and
no mutations in the active-site region which could cause putative changes in
structure/function, only the human TPH model was subjected to further energy
minimizations to make predictions with respect to aspects of catalysis and
regulation.
It is noteworthy to mention that Swiss-Model, the automated protein modeling
server, (GlaxoWellcome Experimental Research Center in Geneva, Switzerland) has
previously generated a model of TPH (Guex & Peitsch, 1997; Peitsch, 1995, 1996).
This model is based on several phenylalanine hydroxylase structures (1PHZ, 2PHM,
61
1PAH, 3PAH, 4PAH), but is truncated at the carboxy terminus. Furthermore, it was
generated without human intervention and interpretation. PROCHECK analysis
indicates similar Ramachandran properties as our manually predicted human TPH
model (85.1% most favored, 11.7% additionally allowed, 2.4% generously allowed,
and 0.8% in disallowed regions) but with a greater number of residues in generously
allowed and disallowed regions. In addition, the Swiss-Model structure has 46 bad
contacts, a significantly greater number than the 2 that our model exhibits.
The human 3-D TPH model presented here is the first full-length TPH
structure to be reported. As expected from the modeling approach, the human TPH
monomer has significant structural identity to the previously crystallized proteins, TH
and PAH (Figure 2). The monomer of TPH has an amino terminal regulatory
domain (residues 2-106), a carboxy terminal catalytic domain (residues 107-423),
and a tetramerization domain (424-444). This regulatory and catalytic domain
organization is consistent with experimental observations of the independent
catalytic activity of the C-terminal portion of the enzyme (Kumer et al., 1997; D’Sa et
al., 1996a; Yang & Kaufman, 1994).
The tetramerization domain of TPH is
composed of an extreme C-terminal 4,3-hydrophobic repeat. Interspersed within
this repeat is a leucine zipper that was originally postulated by Liu and Vrana (1991)
to be important for the tetramerization of the AAAH. Deletion mutagenesis of this
domain resulted in dimers and monomers of TPH that retained activity (Mockus et
al., 1997a; D’Sa et al., 1996b). Kinetic analysis of the mutant C ∆17 TPH, that lacks
this tetramerization domain, failed to show a significant change in the Km of C ∆17
TPH for BH4 or tryptophan (Table 2). These data suggest that the tetramerization
62
domain of TPH is a structural motif that is not required for activity. The role of
oligomerization in regulatory mechanisms of TPH and the other hydroxylases remain
to be determined.
Our human TPH model predicts an alternative regulatory domain orientation,
relative to PAH and the Swiss-model predicted TPH structure. According to the
model, the entire regulatory domain is rotated away from the catalytic domain. In
PAH (1PHZ), three regions of interfacial contact are observed (46-65, 107-117, 412414 possessing 55%, 75%, and 67% sequence identity to TPH, respectively). Our
findings suggest that the numerous interfacial domain contacts are more solvent
exposed in TPH. The absence of these interface interactions in TPH may be a
result of the multiple sequence alignment-based modeling. It was least successful in
generating the former two regions where loop searching was required to fill the gaps
(Figure 7). If this alternative N-terminal domain orientation proves to be correct, it
could have implications for protein stability (Mockus et al., 1997b; Daubner et al.,
1997) and/or regulation.
Kobe et al. (1997a) have hypothesized that an amino terminal autoregulatory
sequence is present in PAH. These amino acids in PAH (19 to 33) work to limit
substrate accessibility into the active site. This sequence is homologous to amino
acids 1 to 15 in TPH. Upon the deletion of the proposed active-site gate in TPH (as
with the mutant N ∆15), the entrance proposed by Kobe and colleagues is no longer
sterically inhibited. This should permit free substrate access and increase the
chances of the slow step of BH4 binding to occur as previously described for TH
(Fitzpatrick, 1988). However, such a mutation did not alter the steady-state kinetics
63
of TPH. Therefore, it is unlikely that an autoregulatory sequence, as observed in
PAH functions in TPH. Instead, it appears as though access to the active site can
be accomplished from the opposite side of the catalytic domain in addition to the
previously described 12 Å active-site entrance for TH (Goodwill et al., 1997). This
ready access may explain why no alteration in Michaelis-Menten constants was
observed. However, more rigorous analyses are needed to verify this hypothesis.
Similar studies in PAH must be performed to determine the exact function of its
amino terminal autoregulatory sequence.
Recent studies of the AAAH have identified several structural motifs important
in macromolecular assembly. It has been proposed that a 4,3-hydrophobic repeat in
the regulatory domain of TPH (residues 21-41) exists as an alpha helix to permit
intersubunit hydrophobic interactions that support assembly (Yohrling et al., 1999).
The present model verifies this earlier prediction that a portion of these amino acid
residues exist as an alpha helix on the exterior of the subunit (Figure 1). In a similar
way, the tetramerization domain (leucine zipper) that was hypothesized by Liu and
Vrana (1991) to exist has been demonstrated for both TH (Goodwill et al., 1997) and
PAH (Fusetti et al., 1998). The model also predicts that a parallel alpha helix within
the regulatory domain (amino acid residues 76-85) could function as an intersubunit
binding domain to allow for the tetramerization of TPH. A Blast comparison (Altschul
et al., 1990) of the TH and TPH protein sequences yields only 30% overall sequence
identity in this region. The structure of the homologous region in TH remains to be
determined. However, such differences in amino acid identity could account for the
64
homotetramerization of TH and TPH, as could the different splice variants of human
tyrosine hydroxylase.
Numerous studies have shown TPH to be phosphorylated and/or activated by
CaMPKII (Kuhn et al., 1980; Furukawa et al., 1993; Ichimura et al., 1987; Ehret et
al., 1989; Yamauchi et al., 1981). However, TPH activation requires the presence of
the activator protein 14-3-3 (Ichimura et al., 1987; Yamauchi et al., 1981). So far,
no studies have identified the specific CaMPKII substrate residue(s) within TPH.
The human TPH model and the initial rabbit TPH structure (data not shown) suggest
that Ser260 could be a substrate for CaMPKII, due to its external orientation on the
TPH monomer (Figure 1). The phosphorylation studies presented here verify these
predictions by demonstrating that Ser58 and Ser260 are phosphorylated by
CaMPKII. The double point mutant S58A/S260A appears to incorporate a minimal
amount of phosphate. This may result from the partial phosphorylation of Ser443 in
denatured TPH. Ser443 also resides in the midst of a consensus sequence for
CaMPKII (Hufton et al., 1995).
However, Ser443 is engaged in the strong
hydrophobic interactions of the tetramerization domain. It is therefore unlikely that
CaMPKII has ready access to this residue under non-denaturing conditions. The in
vitro activation of recombinantly expressed TPH and its mutants, in the presence of
both CaMPKII and 14-3-3 remains inconclusive (data not shown).
The human TPH model presented here was successful in predicting an
aspect of TPH active-site structure and specificity. Based on previous findings in TH
and PAH, as well as primary sequence alignments, the predicted TPH active-site
topology suggested that Y235 (corresponding to L294 in TH and L248 in PAH) could
65
serve to interact with and orient the tryptophan substrate. Mutagenesis of Y235
resulted in a significant reduction of TPH activity (≈95%).
Kinetic analyses
confirmed our hypothesis that Y235 is a tryptophan orienting residue. Both mutants
(Y235A and Y235L) exhibit a dramatic increase in the Michaelis constant for
tryptophan, but not BH4. Mutagenesis of this residue also eliminates the substrate
inhibition of TPH observed at high levels (>200 µM) of tryptophan (Figure 6). The
corresponding identity of Y235 in both TH and PAH is leucine. TPH Y235 is located
in a region of 21 amino acid residues, at the entrance of the active site (active site
loop and α6), that exhibits an extraordinary amount of amino acid identity (86%) for
all aromatic amino acid hydroxylases (Figure 8). It is hypothesized that the longer
side chain of leucine is required to hold the smaller amino acid substrates,
phenylalanine and tyrosine, in the optimal orientation within the active sites of PAH
and TH respectively. The aromatic ring of Tyr235 in TPH may form a π-stacking
interaction with tryptophan. This type of interaction appears to play a significant role
in mediating substrate specificity of TPH.
In addition to the data presented here, the hypothetical model of human TPH
will serve numerous other capacities. First, the molecular model will aid in the
development of novel pharmacotherapeutics. The availability of a detailed active
site conformation could help identify a new generation of highly specific inhibitors of
TPH for the potential treatment of CNS disorders associated with excessive
serotonergic activity (e.g., restless leg syndrome). Secondly, detailed modeling of
TPH will assist biogenic amine research by identifying a list of potentially interesting
residues that may be involved in the regulation and activity of TPH, thus assisting
66
rational site-directed mutagenesis studies. Third, the new model may function as
the template on which as yet to be identified polymorphisms can be explained.
Single nucleotide polymorphisms (SNPs) are known to play a pivotal role in human
health and disease (Tomita-Mitchell et al., 1998; Uglialoro et al., 1998). This is
particularly true of PAH where 330 independent polymorphisms have been reported
that alter enzyme activity (Kobe et al., 1999). The present model provides a
platform on which to base structural predictors for TPH following identification of the
mutations. It is hoped that one day, clinical screening will be available to identify
potentially deleterious polymorphisms in TPH to aid in the prevention and treatment
of the numerous neurological diseases associated with aberrant 5-HT and TPH.
67
Figure 7: Multiple sequence alignment. A multiple sequence alignment of the
template crystal structures 1PHZ, 1PAH and 1TOH and human TPH (1TPH). This
alignment was generated by the Composer module of Sybyl 6.5 (Tripos Inc., St.
Louis, MO) and used to construct the hypothetical human TPH model. Residues in
red indicate where a gap resulted in the preliminary model, which were subsequently
completed by the loop search function. Bolded residues indicate amino acids within
the interface between the regulatory and catalytic domains as observed in PAH
(1PHZ). Residue numbering is according to the human TPH amino acid sequence.
68
69
Figure 8: Sequence alignment of the aromatic amino acid hydroxylases. Amino
acid alignments for human TPH (Accession number; P17752), rabbit TPH (P17290),
rat TH (P04177), human TH (P07101), rat PAH (P04176), and human PAH
(P00439) for a 21 amino acid stretch that spans the beginning of the active sites for
each of the enzymes. 86% amino acid identity is observed in this region. The
overall identity of the catalytic domains of the hydroxylases is significantly lower
(≈50%). Tyrosine 235 (Y235) of rabbit TPH was mutated to both an alanine and a
leucine residue.
Above the amino acid residues, lines indicate the regions
corresponding to the active-site loop and alpha helix 6 (α6). The active sites of the
hydroxylases are thought to contain helices α6-α9 (Erlandsen et al., 1997a).
70
71
Materials and Methods
Materials
All materials were obtained from the Sigma Chemical Company (St. Louis,
MO) with the following exceptions: restriction and DNA modifying enzymes were
supplied by Promega Corporation (Madison, WI) and New England Biolabs (NEB;
Beverly, MA); L-[5-3H] tryptophan and [γ-32P] ATP from Du Pont NEN Research
Products (Boston, MA); IPTG, ampicillin, and activated charcoal (Darco G-60) from
Fisher Scientific (Pittsburgh, PA). The pET-21c vector and BL21[DE3](F- OmpTrBmB-) competent cells were acquired from Novagen Corporation (Madison, WI).
Reinforced nitrocellulose (Duralose-UVTM) and the QuikChangeTM site-directed
mutagenesis kit was purchased from Stratagene (La Jolla, CA). The Benchmark
prestained protein ladder was purchased from Life Technologies (Gaithersburg,
MD). Chemiluminescent reagents (RenaissanceTM) were purchased from NEN
Research Products (Boston, MA). The mouse anti-TPH monoclonal antibody (WH3)
was obtained from Sigma-RBI (St.Louis, MO).
The sheep anti-mouse IgG HRP-
coupled secondary antibody was purchased from Amersham Life Sciences
(Arlington Heights, Il). Ca2+/Calmodulin-dependent protein kinase II α-subunit was
purchased from Calbiochem (San Diego, CA).
Finally, all sequencing was
performed by the DNA Sequencing and Gene Analysis Facility of the Molecular
Genetics Program (Wake Forest University School of Medicine) using a Perkin
Elmer/Applied Biosystems 377 Prism automated DNA sequencer.
72
Molecular modeling
The three-dimensional models of human and rabbit tryptophan hydroxylase
(accession numbers NP_004170 and P17290 respectively) were generated using
the multiple sequence alignment modeling approach in the “Composer” module of
Sybyl 6.5 (Tripos Inc., St. Louis, MO). The experimentally-solved structures of
phenylalanine hydroxylase (1PHZ and 1PAH) (Kobe et al., 1999; Erlandsen et al.,
1997b) and tyrosine hydroxylase (1TOH) (Goodwill et al., 1997) were used as
template molecules in a modular method to provide the most complete model.
Initially, human TPH and rabbit TPH were predicted based on 1PHZ, 1PAH and
1TOH. This yielded initial structures with gaps at positions 1, 65 to 66, 100 to 101,
and 411 to 444 (Figure 7). The gaps that resulted within the protein (residues 65 to
66, and 100 to 101) were bridged using the “Loop Search” functionality in the Sybyl
biopolymer module. Before the loop search, each gap was enlarged by the removal
of two amino acids flanking the gap. Loop candidates were visually evaluated and
chosen on the basis of complementarity to the existing structure. In order to provide
a complete model, human and rabbit TPH were separately predicted based solely
on 1TOH and the carboxy terminus of the resulting structure (residues 411 to 444)
was then merged with the ir respective continuous, but truncated TPH model based
on 1PHZ, 1PAH, and 1TOH.
The resulting full-length human TPH model (missing only the initiator
methionine residue) was subjected to further refinement using the program
PROCHECK to assess progress (Laskowski et al., 1993). First, polar hydrogen
atoms were added, then proline and sidechain conformations were fixed and
73
relieved of bad contacts. Next, the peptide backbone was constrained and the
model was subjected to convergent minimization, without electrostatics, in the Tripos
forcefield (Clark et al., 1989). All the remaining valencies were hydrogen-filled and
the model was again minimized to convergence. Backbone constraints were then
removed and the model was minimized to a high level of convergence (gradient
0.005 kcal / mol⋅Å). Kollman charges (Weiner et al., 1984) were then added
followed by five cycles of minimization, during which time the dielectric constant was
gradually decreased from ε = 80 to ε = 20. The final minimization step was carried
out to convergence at a high level (gradient 0.005 kcal / mol⋅Å).
Bacterial expression of TPH
A full length cDNA clone for rabbit tryptophan hydroxylase has previously
been developed for prokaryotic expression (Vrana et al., 1993). The coding region
of the parent clone (prbTRH479) (Grenett et al., 1987) was amplified by PCR to
create a 5' NdeI site and a 3' BamHI site and subsequently subcloned into a pET21c prokaryotic expression vector. All recombinant proteins were expressed using
the approach detailed by Yohrling et al. (1999).
TPH deletion and point mutation constructs
Polymerase chain reaction was utilized to create a number of different
deletion mutations to examine TPH structure/function predictions from the human
TPH model. For example, to generate the N∆15 mutant (N ∆ denotes an amino
terminal deletion followed by the number of amino acid residues deleted from the
74
construct), a 5' primer was designed to introduce an NdeI consensus sequence
(CATATG) followed by the sequences for amino acid residues 16 to 20. Details for
the construction and characterization of the carboxy terminal mutant (C ∆17) are
outlined in (Mockus et al., 1997a). In addition, the S58A mutant utilized in this report
has been previously reported (Kumer et al., 1997). To elucidate a possible role for
S260 as a substrate for phosphorylation by CaMPKII, the mutants S260A and
S58A/S260A were created with the QuikChangeTM Site-Directed mutagenesis kit
from Stratagene. Wild-type TPH and S58A (25 ng) were used as the respective
DNA templates to create S260A and S58A/S260A. The conditions utilized are
outlined in (Yohrling et al., 1999; Vrana et al., 1994). The primers used (but not
previously reported) were as follows:
TPH N ∆15: 5'- CTCAATAGTCCATATGGGAAGAGCAAGTCTC -3'
TPH S260A Sense: 5'- GTGAGACACAGTGCAGACCCCTTCTATACC-3'
Antisense: 5'- GGTATAGAAGGGGTCTGCACTGTGTCTCAC -3'
TPH Y235A Sense: 5'- CGTCCTGTGGCTGGTGCCTTATCACCAAGAG -3'
Antisense: 5'- CTCTTGGTGATAAGGCACCAGCCACAGGACG -3'
TPH Y235L Sense: 5'- CGTCCTGTGGCTGGTCTCTTATCACCAAGAG-3'
Antisense: 5'- CTCTTGGTGATAAGAGACCAGCCACAGGACG -3'
The nucleotides underlined correspond to the NdeI recognition site. The bold
nucleotides highlight the mutated codons for amino acid residues 260 and 235,
respectively. Complete DNA sequencing was performed to verify the presence of
the appropriate mutation in the coding sequences of all recombinant proteins. This
also established that the PCR-based mutagenesis (N∆15) and non-PCR-based
75
mutagenesis (S260A, S58A/S260A, Y235A, and Y235L) did not introduce
extraneous mutations.
Kinetic analyses and TPH activity assay
Michaelis-Menten constants for two of the cosubstrates, BH4 and tryptophan,
were determined for wild-type TPH, TPH N ∆15, C ∆17, Y235A, and Y235L. First,
bacterial pellets containing the various proteins were sonicated in a HEPES-based
resuspension buffer and centrifuged at 50,000 x g to create a high speed
supernatant (Yohrling et al., 1999). The Km values of each recombinant protein for
BH4 were determined on comparable amounts of activity by performing a
radioenzymatic TPH activity assay with BH4 concentrations ranging from 9 µM -220
µM (Beevers et al., 1983; Vrana et al., 1993). Likewise, the Km of each enzyme for
tryptophan was calculated in the presence of tryptophan concentrations ranging
from 20 µM-1 mM. The activity values recorded at 400 µM and 1 mM of tryptophan
for wild-type TPH were not taken into account when determining the Michaelis
constant because of substrate inhibition. Stock solutions of L-tryptophan were
prepared in 200 mM Tris-HCl (pH 7.0). Activity values derived from each assay are
expressed as nmol product ⋅ hr-1 ⋅ mg total protein-1. All kinetic data were fitted to the
Michaelis-Menten equation using GraphPad Prism® version 3.0 (GraphPad
Software, San Diego, CA, www.graphpad.com).
76
Phosphorylation of native and mutant TPH
Bacterial supernatants of TPH and the mutants S58A, S260A, and
S58A/S260A were subjected to phosphorylating conditions to ascertain whether
S58A and/or S260 are phosphorylated by CaMPKII. Both amino acids reside in the
consensus motif for CaMPKII (Arg-X-X-Ser), and are predicted, by the hypothetical
model, to reside on the surface of the protein. Homogenates were incubated at
30°C for five minutes with 50 mM MgCl2, 3 mM CaCl2, 1µCi [γ-32P] ATP, 40 µM ATP,
0.75 µg calmodulin, and 400 units of CaMPKII. The reactions were terminated by
adding 5 µl of 6X sample buffer [0.5M Tris-HCl (pH 6.8), 30% (v/v) glycerol, 10%
(w/v) SDS, 0.6M DTT, and 0.012% bromophenol blue.
The samples were
immediately denatured at 100°C for ten minutes and then subjected to denaturing
polyacrylamide gel electrophoresis (SDS-PAGE).
TPH protein analysis and enzyme activity
Denaturing polyacrylamide gel electrophoresis (10% acrylamide, 0.27% bisacrylamide) (Laemmli et al., 1970) was performed on phosphorylation reactions as
outlined by Kumer et al. (1997).
Following transfer of the proteins, radioactive
proteins were visualized with a phosphoimager (Fuji Medical Systems).
Immunoreactive TPH proteins were detected by probing with a 1:1000 dilution of
affinity-purified mouse anti-TPH monoclonal antibody from mouse (WH3) followed
by a 1:1500 dilution (1.5 µg / ml) of sheep anti-mouse IgG coupled with HRP. The
incubation and wash conditions for western analysis are outlined in Mockus et al.
(1997b). Immune complexes were visualized using enhanced chemiluminescence
77
(NEN Research Products, Boston, MA) and exposed to X-ray film (Kodak Biomax
MR2) at exposure times (10 sec to 4 min) where the radioactivity signal was
negligent.
Acknowledgments
We would like to thank both Dr. Mark O. Lively (Wake Forest University) and
Dr. Susan M. Mockus (University of Washington) for their technical input. This work
was supported by PHS Grant RO1 GM-38931 to K.E.V.
78
References
Beevers, S.J., Knowles, R.G., and Pogson, C.I. (1983) J. Neurochem. 40, 894-897.
Blundell, T.L., Carney, D.P., Gardner, S., Hayes, F.R.F., Howlin, B., Hubbard,
T.J.P., Overington, J.P., Singh, D.A., Sibanda, B.L., and Sutcliffe, M.J. (1988)
Eur. J. Biochem. 172, 513-520.
Brentegani, L.G. and Lico, M.C. (1982) Phys. and Behav. 28, 49-52.
Cash, C.D. (1998) Gen. Pharmacol. 30, 569-574.
Clark, M., Cramer, III, R.D., Van Opdenbosch, N. (1989) J. Comp. Chem. 10, 9821012.
Cornwell-Jones, C.A., Decker, M.W., Chang, J.W., Cole, B., Goltz, K.M., Tran, T,,
and McGaugh, J.L. (1989) Brain Res. 493, 258-68.
D’Sa, C.M., Arthur, R.E. Jr., Jennings, I.., Cotton, R.G.H., and Kuhn, D.M. (1996a)
J. Neurosci. Meth. 69, 149-153.
D’Sa, C.M., Arthur, R.E.Jr., and Kuhn, D.M. (1996b) J. Neurochem. 67, 917-926.
Darmon, M.C., Guibert, B., Leviel, V., Ehret, M., Maitre, M., and Mallet, J. (1988) J.
Neurochem. 51, 312-316.
Daubner, S.C., Lohse, D.L., and Fitzpatrick P.F. (1993) Protein Sci. 2, 1452-1460.
Daubner, S.C., Hillas, P.J., Fitzpatrick, P.F. (1997) Biochem. 36, 11574-11582.
Delgado, P.L. and Moreno, F.A. (1998) J. Psychoactive Drugs 30, 359-366.
Ehret, M., Cash, C.D., Hamon, M., and Maitre, M. (1989) J. Neurochem. 52, 18861891.
Eisensmith, R.C. and Woo, S.L. (1991) Mol. Biol. and Med. 8 (1), 3-18.
Erlandsen, H., Fusetti, F., Martinez, A., Hough, E., Flatmark, T., Stevens, R. C.
(1997) Nature Struct. Biol. 4, 995-1000.
Erlandsen, H., Martinez, A., Knappskog, P.M., Haavik, J., Hough, E., and Flatmark,
T. (1997) FEBS Letters 406, 171-174.
Erlandsen, H., Flatmark, T., Stevens, R.C., and Hough, E. (1998) Biochem. 37(45),
15638-15646.
79
Erlandsen, H., Bjorgo, E., Flatmark, T., and Stevens, R.C. (2000) Biochem. 39,
2208-2217.
Fitzpatrick, P.F. (1988) J. Biol. Chem. 263 (31), 16058-16062.
Fitzpatrick, P.F. (1999) Annu. Rev. Biochem. 68, 355-381.
Furukawa, Y., Ikuta, N., Omata, S., Yamauchi, T., Isobe, T., and Ichimure, T. (1993)
Biochem. Biophys. Res. Commun. 194, 144-149.
Fusetti, F., Erlandsen, H., Flatmark, T., and Stevens, R.C. (1998) J. Biol. Chem. 273
(27),: 16962-16967.
Goodwill, K.E., Sabatier, C., Marks, C., Raag, R., Fitzpatrick, P.F., and Stevens,
R.C. (1997) Nature Struct. Biol. 4(7), 578-585.
Goodwill, K.E., Sabatier, C., Stevens, R.C. (1998) Biochem, 37(39), 13437-13445.
Grenett, H.E., Ledley, F.D., Reed, L.L., and Woo, S.L.C. (1987) Proc. Natl. Acad.
Sci. USA, 84, 5503-5534.
Guex, N. and Peitsch, M. C. (1997) Electrophoresis 18, 2714-2723.
Hufton, S.E., Jennings, I.G., and Cotton, R.G.H. (1995) Biochem. J. 311, 353-366.
Hufton, S.E., Jennings, I.G., and Cotton, R.G.H. (1998) Biochim. Biophys. Acta,
1382, 295-304.
Ichimura, T., Isobe, T., Okuyama, T., Yamauchi, T., and Fujisawa, H. (1987) FEBS
Lett. 219, 79-82.
Kandasamy, S.B. and Williams, B.A. (1984) Neuropharmacology 23: 49-53.
Knappskog, P.M., Flatmark, T., Mallet, J., Ludecke, B., and Bartholome, K. (1995)
Hum. Mol. Genet. 4, 1209-1212.
Kobe, B, Jennings, I.G., House, C.M., Feil, S.C., Michell, B.J., Tiganis, T., Parker,
M.W., Cotton, R.G.H., and Kemp, B.E. (1997) Prot. Sci. 6, 1352-1357.
Kobe, B, Jennings, I.G., House, C.M., Michell, B.J., Goodwill, K.E., Santarsiero,
B.D., Stevens, R.C., Cotton, R.G.H., and Kemp, B.E. (1999) Nature Struct.
Biol. 6(5), 442-448.
Kuhn, D.M., Ruskin, B., and Lovenberg, W. (1980) J. Biol. Chem. 255, 4137-4143.
Kuhn, D.M., Arthus, R., Jr., States, J.C. (1997) J. Neurochem. 68, 2220-2223.
80
Kumer, S.C., Mockus, S.M., Rucker, P.J., and Vrana K.E. (1997) J. Neurochem. 69,
1738-1745.
Laemmli, U.K. (1970) Nature 227, 680-685.
Laskowski, R.A., MacArthur, M.W., Moss, D.S. and Thornthon, J.M. (1993) J. Appl.
Crystallogr. 26, 283-291.
Ledley, F.D., DiLella, A.G., Kwok, C.M., and Woo, S.L.C. (1985) Biochemistry, 24,
3389-3394.
Liu, X. and Vrana, K.E. (1991) Neurochem. Int. 18, 27-31.
Ludecke, B., Dworniczak, B., and Bartholome, K. (1995) Hum. Genet. 95, 123-125.
Ludecke, B., Knappskog, P.M., Clayton, P.T., Surtees, R.A.H., Clelland, J.D.,
Heales,S.J.R., Brand, M.P., Bartholome, K., and Flatmark. T. (1996) Hum.
Mol. Genet. 5, 1023-1028.
Mann, J.J., Malone, K.M., Nielsen, D.A., Goldman, D., Erdos, J., Gelernter, J.
(1997) Amer. J. Psych. 154, 1451-1453.
Mockus, S.M., Kumer, S.C., and Vrana, K.E. (1997a) Biochim. Biophys. Acta, 1342,
132-140.
Mockus, S.M., Kumer, S.C., and Vrana K.E. (1997b) J. Mol. Neurosci. 9, 35-48.
Mockus, S.M., Yohrling, IV, G.J., Vrana, K.E. (1998) J. Mol. Neurosci. 10, 45-51.
Mockus, S.M. and Vrana, K.E. (1998) J. Mol. Neurosci. 10(3), 163-179.
Moran, G.R., Daubner, S.C., and Fitzpatrick, P.L. (1998) J. Biol. Chem. 273, 1225912266.
Neckameyer, W.S., and White, K. (1992) J. Biol. Chem. 267, 4199-4206.
Nielsen, D.A., Dean, M., and Goldman, D. (1992) Amer. J. Hum. Genet. 51, 13661371.
Nielsen, D.A., Goldman, D., Virkkunen, M., Tokola, R., Rawlings, R., and Linnoila,
M. (1994) Arch. Gen. Psych. 51, 34-38.
O’Neill, R.R., Mitchell, L.G., Merril, C.R., and Rasband, W.S. (1989) Appl. Theor.
Electrophor. 1, 163-167.
81
Olivier, B., Mos, J., van Oorschot, R., and Hen, R. (1995) Pharmacopsych. 28 Suppl
2, 80-90.
Pearson, R.B. and Kemp, B.E. (1991) Methods Enzymol. 200, 62-81.
Peitsch, M.C. (1995) Bio/Technology 13, 658-660.
Peitsch, M.C (1996) Biochem. Soc. Trans. 24, 274-279.
Schauenburg, H. and Dressler, D. (1992) Nervearzt 63, 453-461.
Sutcliffe, M.J., Haneef, I., Carney, D.P., and Blundell, T.L. (1987) Prot. Eng. 1, 377.
Tabaddor, K., Wolfson, L.I., Sharpless, N.S. (1978) Neurology 28, 1249-1253.
Thomas, K.B., Brown, A.D., and Iuvone, P.M., (1998) Neuroreport 9, 4041-4044.
Tomita-Mitchell, A., Muniappan, B.P., Herrero-Jimenez, P., Zarbl, H., Thilly, W.G.
(1998) Gene, 223, 381-391.
Uglialoro, A.M., Turbay, D., Pesavento, P.A., Delgado, J.C., McKenzie, F.E.,
Gribben, J.G., Hartl, D., Yunis, E.J., Goldfeld, A.E. (1998) Tissue Antigens.
52, 359-67.
Volicer, L., Direnfeld, L.K., Freedman, M., Albert, M., Langlias, P.J., Bird, E.D.
(1985) Arch. of Neurol. 42, 127-29.
Vrana, S.L., Dworkin, S.I., and Vrana, K.E. (1993) J. Neuorsci. Meth. 48, 123-129.
Vrana, K.E., Rucker, P., and Kumer S.C. (1994a) Life Sci. 55, 1045-1052.
Wang, G.A., Coon, S.L., Kaufman, S. (1998) J. Neurochem. 71, 1769-1772.
Weiner, S.J., Kollman, P.A., Case, D.A., Singh, U.C., Ghio, C., Alagona, G., Profeta,
S., Weiner, P. (1984) J. Amer. Chem. Soc. 106, 765-784.
Yamauchi, T., Nakata, H., and Fujisawa H. (1981) J. Biol. Chem. 256, 5404-5409.
Yang, X.J. and Kaufman, S. (1994) Proc. Natl. Acad. Sci. USA 91, 6659-6663.
Yohrling, IV, G.J., Mockus, S.M., and Vrana, K.E. (1999) J. Mol. Neurosci. 12,
23-34.
Yohrling, IV, GJ, Jiang, G.C-T., Mockus, S.M., and Vrana, K.E. (2000) J. Neurosci.
Res. 61, 313-320.
CHAPTER III
FUNCTIONAL ANALYSIS OF THE V177I CODING REGION POLYMORPHISM
IN HUMAN TRYPTOPHAN HYDROXYLASE (TPH1)
George C-T. Jiang, Amanda C. Domer, and Kent E. Vrana
The following manuscript is in preparation for submission to the Journal of
Neurochemistry. Stylistic variations are due to the requirements of this journal. The
original proposal and concept for these studies were those of George C.-T. Jiang.
Dr. Kent E. Vrana served in an advisory position on experimental design and
manuscript preparation. Amanda Domer assisted in the creation of point mutants,
protein expression and purification, and TPH activity assays.
82
83
Abstract
The aromatic amino acid hydroxylase (AAAH) superfamily consists of three
important enzymes: phenylalanine hydroxylase (PH), tyrosine hydroxylase (TH) and
tryptophan hydroxylase (TPH). These enzymes are rate-limiting in phenylalanine
catabolism, catecholamine biosynthesis, and serotonin biosynthesis, respectively.
Numerous polymorphisms in PH and TH have been described that have been
associated with phenylketonuria and dystonias, respectively, while few
polymorphisms have been described for TPH. Recently, the first human TPH coding
region polymorphism has been described. This paper analyzes the functional
implications of this polymorphism using site-directed mutagenesis, recombinant
bacterial expression, and purified enzyme. The Michaelis-Menten constant for
tetrahydrobiopterin was unchanged for V177I (Km,
BH4
= 14.8 ± 0.9 µM), while the
enzyme’s Michaelis constant for the tryptophan substrate (Km, Trp = 41.1 ± 6.5 µM)
was increased 55% compared to wild-type enzyme (Km, BH4 = 15.8 ± 1.2 µM, Km, Trp
= 26.5 ± 3.3 µM). Our results indicate that the subtle V177I mutation results in a
somewhat less-efficient enzyme due to compromised tryptophan substrate binding.
Additional mutational analysis of V177 indicates that the identity of this residue
appears to be critical for proper enzyme function in that substitution of nearly any
amino acid at this position (except alanine, V177A) produces enzyme with little, or
no, activity. Therefore, while the specific polymorphism has a modest impact on
enzyme activity, it highlights a region of considerable importance to enzyme
structure and function.
84
Introduction
The aromatic amino acid hydroxylase (AAAH) superfamily is a group of
tetrahydrobiopterin-dependent monooxygenases with specificity for the benzeneand indole-containing amino acids.
The members of this family include
phenylalanine hydroxylase (PH; EC 1.14.16.1), tyrosine hydroxylase (TH; EC
1.14.16.2), and tryptophan hydroxylase (TPH; EC 1.14.16.4). These enzymes share
approximately 50% amino acid sequence identity and are thought to have evolved
from a common progenitor (Grenett et al., 1987; Neckameyer and White, 1992).
Each AAAH enzyme catalyzes the hydroxylation reaction of its respective amino
acid substrate in the presence of tetrahydrobiopterin (BH4) and molecular oxygen
(O2) co-substrates, and a ferrous iron (Fe2+) cofactor. The catalytic mechanisms of
the hydroxylases are believed to be sequential in nature with BH4 binding first and
forming part of the amino acid substrate-binding pocket, followed by binding of either
the molecular oxygen or the respective aromatic amino acid substrate (Fitzpatrick,
1991; Fitzpatrick, 1993; Andersen et al., 2002; Bassan et al., 2003). Recently,
Volner et al. (2003) have conclusively established that the mechanism for bacterial
PH is a fully-ordered ter-bi sequential mechanism.
The AAAHs are all composed of an amino terminal regulatory domain and a
carboxyl terminal catalytic domain (Grenett et al., 1987; Ledley et al., 1985; Darmon
et al., 1988; Daubner et al., 1993; Walker et al., 1994; Kumer et al., 1997). The
regulatory domains of the enzymes act to modulate activity.
Documented
phosphorylation sites in all AAAHs reside in this regulatory domain (Kuhn et al.,
1997; Kumer et al., 1997; reviewed in Fitzpatrick, 2000). The active sites reside
85
within the catalytic domain and are responsible for the hydroxylation of their
respective aromatic amino acids. Chimeric hydroxylases have been created to
demonstrate that substrate specificity is conferred exclusively by the catalytic
domain (Mockus et al., 1997; Kumer et al., 1997). Crystal structures are available
for TH and PH (Goodwill et al., 1997; Goodwill et al., 1998; Erlandsen et al., 1997a;
Erlandsen et al., 1997b; Erlandsen et al., 1998; Fusetti et al., 1998; Erlandsen et al.,
2000; Erlandsen et al., 2002), while only one crystal structure is available for TPH
(Wang et al., 2002). The TPH crystal structure (Wang et al., 2002), hypothetical
AAAH models based on crystal structures (Jiang et al., 2000; McKinney et al., 2001;
Andersen et al., 2002), and NMR studies with TPH and bound substrates by
McKinney and colleagues (2001) predict to the residues involved in substrate
binding in TPH, and confirm the hypothesis of two binding pockets in the active site
– one for the aromatic amino acid substrate, and one for the tetrahydrobiopterin cosubstrate (BH4).
These data are in agreement with the presumed catalytic
mechanisms of the AAAHs.
AAAHs have been implicated in several important clinical conditions. In the
case of PH, over 400 polymorphisms have been described that result in
phenylketonuria (PKU). A number of TH coding region polymorphisms have been
described that are associated with L-DOPA responsive parkinsonism (L205P,
Ludecke et al., 1996), dystonias (Q381K, Knappskog et al., 1995), and Segawa’s
Disease (Ludecke et al., 1995).
However, due to the complexity involved in
diagnosing patients with serotonin aberrations, only one coding region
polymorphism has been described for TPH (Ramaekers et al., 2001).
This
86
polymorphism is a heterozygous missense mutation within exon 6 (G529A) of the
TPH gene causing a substitution of isoleucine for valine at codon 177 (V177I). This
has been interpreted as a rare DNA variant because the pedigree analysis of that
individual did not provide direct genotype-phenotype correlation. This polymorphism
was discovered in a single member of a patient population that exhibited novel
neurodevelopment symptoms that were responsive to 5-hydroxytryptophan and
carbidopa treatment. In the other four patients, the TPH gene analysis was normal.
Notably, however, the individual exhibiting the TPH polymorphism also had another
commonly
found
polymorphism
(C677T
heterozygous
mutation)
in
the
methylenetetrahydrofolate reductase (MTHFR) gene. The functional consequence
of this V177I mutation on TPH remains unclear. Moreover, because of the lack of
functional data, it is unclear if the serotonergic imbalances seen in the patients are
due to compromised TPH enzymes, inactivated TPH enzymes, or the selective loss
of serotonergic neurons. Structurally, we have localized the V177I polymorphism to
the catalytic domain of TPH, at a position near the tryptophan substrate-binding
pocket of the active site. Based on a TPH crystal structure (Wang et al., 2002) and
hypothetical TPH model (Jiang et al., 2000), Val177 is located approximately 3-4 Å
from Arg257 and approximately 5-6 Å from Ser336. These two residues are
conserved among the hydroxylases and have been implicated, within the other
AAAHs, in binding the alpha carboxyl group of the aromatic amino acid substrate
(Moran et al., 1998) and decoupling oxygen-oxygen bond cleavage and tyrosine
hydroxylation (Ellis et al., 2000), respectively.
To examine the functional significance of the TPH polymorphism, we used
87
site-directed mutagenesis to introduce this mutation into a recombinant human TPH
expression construct. The codon for valine 177 was altered to encode glycine,
alanine, isoleucine, leucine, phenylalanine, serine, threonine, arginine, and
glutamate. Mutant proteins were then expressed as hexa-histidine-tagged proteins,
purified, and assayed for tryptophan hydroxylation in order to determine the
biochemical consequences of the substitutions on TPH.
88
Materials and Methods
Materials
All materials were obtained from the Sigma Chemical Company (St. Louis,
MO) with the following exceptions: restriction and DNA modifying enzymes were
supplied by Promega Corporation (Madison, WI) and New England Biolabs (NEB;
Beverly, MA); L-[5-3H] tryptophan, and Ni2+ chelating columns from Amersham
Pharmacia Biotech (Piscataway, NJ); isopropyl-thio-β-D-galactopyranoside (IPTG),
ampicillin, and activated charcoal (Darco G-60) from Fisher Scientific (Pittsburgh,
PA). The pET-15b prokaryotic expression vector, and BL21(DE3)pLysS (F- OmpTrBmB-) competent cells were acquired from Novagen Corporation (Madison, WI).
Reinforced nitrocellulose (Duralose-UVTM) and the QuickChangeTM Site-Directed
Mutagenesis kit was purchased from Stratagene (La Jolla, CA). Benchmark
Prestained Protein Ladder, Mark 12™ Unstained Standard and Colloidal Blue
Staining Kit was purchased from Invitrogen (Carlsbad, CA). Chemiluminescence
reagents (RenaissanceTM) were purchased from NEN Research Products (Boston,
MA). The mouse anti-TPH monoclonal antibody (WH3) was obtained from SigmaRBI (St. Louis, MO). The sheep anti-mouse IgG HRP-coupled secondary antibody
was purchased from Amersham Life Sciences (Arlington Heights, Il). Qiagen
Miniprep and Hi-Speed Midiprep kits were purchased from Qiagen (Valencia, CA).
Finally, all sequencing was performed by the DNA Sequencing and Gene Analysis
Facility of the Molecular Genetics Program (Wake Forest University School of
Medicine) using a Perkin Elmer/Applied Biosystems 377 Prism automated DNA
89
sequencer.
TPH Point-Mutant Constructs
The methods used for the construction of the various TPH point-mutants are
similar to those outlined in Yohrling et al., 1998. The primers used are shown in
Table I. Briefly, mutations were made with the Stratagene QuikChangeTM SiteDirected Mutagenesis kit using the pET-15b/hTPH plasmid as the template.
Thermocycler conditions were set as follows: 20 cycles of 94°C, 30s, 45°C, 30s,
72°C, 12m; 25 cycles of 94°C, 30s, 55°C, 30s, 72°C, 12m; 4°C. 2 µl DpnI-treated
products were used to transform supercompetent XL1-Blue cells. Random colonies
were selected to determine if the desired mutation was present. Complete DNA
sequencing was performed to verify the presence of the appropriate mutation in the
coding sequences of all recombinant proteins and to discount the presence of
spurious sequence mutations.
90
Table I – Site-directed mutagenesis primers
h-V177Is
5’- G ACC TGG GGA GCC ATT TTC CAA GAG C -3’
h-V177Ia
5’- G CTC TTG GAA AAT GGC TCC CCA GGT C-3’
h-V177As
5’- G ACC TGG GGA GCC GCA TTC CAA GAG C -3’
h-V177Aa
5’- G CTC TTG GAA TGC GGC TCC CCA GGT C-3’
h-V177Rs
5’- G ACC TGG GGA GCC CGA TTC CAA GAG C -3’
h-V177Ra
5’- G CTC TTG GAA TCG GGC TCC CCA GGT C-3’
h-V177Es
5’- G ACC TGG GGA GCC GAA TTC CAA GAG C -3’
h-V177Ea
5’- G CTC TTG GAA TTC GGC TCC CCA GGT C-3’
h-V177Ls
5’- G ACC TGG GGA GCC CTT TTC CAA GAG C -3’
h-V177La
5’- G CTC TTG GAA AAG GGC TCC CCA GGT C-3’
h-V177Fs
5’- G ACC TGG GGA GCC TTT TTC CAA GAG C -3’
h-V177Fa
5’- G CTC TTG GAA AAA GGC TCC CCA GGT C-3’
h-V177Ga
5’- G ACC TGG GGA GCC GGT TTC CAA GAG C -3
h-V177Ga
5’- G CTC TTG GAA ACC GGC TCC CCA GGT C-3
h-V177Ss
5’- G ACC TGG GGA GCC TCT TTC CAA GAG C -3’
h-V177Sa
5’- G CTC TTG GAA AGA GGC TCC CCA GGT C-3’
h-V177Ts
5’- G ACC TGG GGA GCC ACT TTC CAA GAG C -3’
h-V177Ta
5’- G CTC TTG GAA AGT GGC TCC CCA GGT C-3’
Bolded nucleotides corresponding to the codon which yields an altered amino acid.
91
Protein Expression and Purification of Human TPH
Human tryptophan hydroxylase (hTPH) cDNA was a generous gift of Dr.
Jacques Mallet (Centre National de la Recherche Scientifique, Paris, France).
Based on the recent report of Walther et al. (2003), this is the peripherallyexpressed isoform of the enzyme and might more accurately be described as TPH1.
PCR primers integrating NdeI and BamHI sites were utilized to modify the
respective 5’ and 3’ ends of the hTPH gene to enable subcloning into pET
prokaryotic expression vectors (Novagen, Inc., Madison, WI). PCR products were
digested with both restriction enzymes and then ligated into a similarly digested
pET-15b expression vector that encodes an amino-terminal hexa-histidine tag.
Clones were verified by complete DNA sequencing.
This sequence analysis
confirmed clone identity and eliminates any extraneous mutations that may have
occurred during the PCR modification step.
All recombinant proteins were expressed using the approach detailed in
(Yohrling et al., 1999). Briefly, recombinant human TPH (hTPH) was expressed in
bacteria by transforming the BL21(DE3)pLysS strain of Escherichia coli (E. coli).
Bacteria were grown until they reached mid-log phase as determined by a
spectrophotometer reading of OD600 = 0.4. Bacteria were then induced by the
addition of isopropyl-thio-β-D-galactopyranoside (IPTG) to express hTPH for 2.5
hours at 30°C.
Bacterial cells were harvested by low speed centrifugation.
Recovery of recombinant protein was achieved by lysis of the cells via sonication in
a HEPES-based resuspension buffer, centrifugation at 50,000 x g, and subsequent
collection of the supernatant.
92
The clarified lysate (high speed supernatant) was then subject to a one-step
metal chelate affinity chromatography procedure using an AktaFPLC automated
workstation (Amersham Pharmacia Biotech, Piscataway, NJ) and an optimized
protocol for the HisTrap Kit (Amerham Pharmacia Biotech, Piscataway, NJ). Our
modifications to the purification protocol include the addition of 100mM imidazole in
the start and wash buffers, and elution of the His-tagged protein in a buffer
containing 300mM imidazole, all performed on a 5ml Ni2+-chelating column at a flow
rate of 3ml/min. Purified protein was immediately assayed or stored at –80°C in a
storage buffer consisting of 50mM HEPES (pH 7.5), 0.2M NaCl, 10% glycerol,
0.05% Tween 20, and 1mM dithiothreitol and protease inhibitors (Hamdan and
Ribeiro, 1999).
Kinetic Analyses and TPH activity assay
TPH enzyme activity was determined using a radioenzymatic assay as
previously described with substrate concentrations of 100 µM BH4 and 50 µM
tryptophan (Beevers et al., 1983; Vrana et al., 1993; Jiang et al., 2000). MichaelisMenten constants for two of the co-substrates, BH4 and tryptophan, were
determined for wild-type hTPH, and the hTPH V177 mutants. The Km values of
each recombinant protein for BH4 were determined on comparable amounts of
activity by performing a radioenzymatic TPH activity assay with BH4 concentrations
ranging from 6-110 µM (at 50 µM tryptophan) (Beevers et al., 1983; Vrana et al.,
1993; Jiang et al., 2000). Likewise, the Km of each enzyme for tryptophan was
calculated in the presence of tryptophan concentrations ranging from 2µM-2mM (at
93
100 µM BH4) (Jiang et al., 2000). Activity values, derived from each assay, are
expressed as nmol H2O product • min-1 • mg-1. Because 5-hydroxytryptophan
production is equimolar with water production, the nmol of product are considered
identical.
All kinetic data were fitted to the Michaelis-Menten equation using
GraphPad Prism version 3.03 (GraphPad Software, San Diego, CA,
www.graphpad.com).
94
Results
Expression and purification of wild-type and mutant enzymes was not
significantly different (Table II and Figure 2). All active enzymes demonstrated
similar half-lives and stability (activity retention) in storage buffer (data not shown),
though initial baseline activity may have been different (Table II and III). The
V177G, V177S, V177T, V177R, V177E, V177L and V177F mutants demonstrated
significantly compromised enzyme activity compared to the wild-type enzyme, with
the V177R and V177E mutants having no detectable activity.
The experimental kinetic data for wild-type and active mutant enzymes are
shown in Table III. Wild-type TPH exhibited a Michaelis-Menten constant for
tetrahydrobiopterin (Km, BH4) of 15.8 ± 1.2 µM, and a Km, Trp = 26.5 ± 3.3 µM. The
mutant V177I, which is the polymorphism described by Ramaekers and colleagues
(2002), showed no change with respect to its Michaelis-Menten constant for
tetrahydrobiopterin (Km,
BH4
= 14.8 ± 0.9 µM), but demonstrated an apparent
decrease in Vmax when assayed for its Km, BH4 at a fixed tryptophan concentration of
50 µM.
This apparent decrease in Vmax was not observed when varying
concentrations of BH4 were assayed with a higher tryptophan substrate
concentration (500 µM). Conversely, the Michaelis-Menten constant for the actual
tryptophan substrate increased (Km, Trp = 41.1 ± 6.5 µM) with no significant change
in Vmax. Similarly, the V177A mutant did not exhibit a change in Km, BH4 (16.7 ± 2.5
µM) or in Km,
Trp
(31.6 ± 1.4 µM) with no significant changes in Vmax. Kinetic
observations for V177G, V177S, V177T, V177L, V177F, V177R, and V177E were
95
unable to be determined as all of these mutants demonstrated little or no activitiy
following purification (<5% of wild-type activity).
96
Discussion
There is considerable similarity among the AAAH in terms of sequence
identity, overall structure and catalytic reaction. Therefore, it has been suggested
that the TPH active site is comprised of two distinct binding regions – one for
tetrahydrobiopterin and one for tryptophan – and that TPH exhibits a comparable
catalytic mechanism to the other AAAH. Namely, TPH would utilize an ordered terbi sequential binding order with tetrahydrobiopterin binding first followed by either
oxygen or tryptophan (Fitzpatrick, 1991; Fitzpatrick, 1993; Andersen et al., 2002;
Bassan et al., 2003; Volner et al., 2003).
This mechanism, along with the
hypothetical TPH models (Jiang et al., 2000; McKinney et al., 2001; Martinez et al.,
2001) and TPH crystal structure (Wang et al., 2002), assist in interpreting the
experimental data obtained with the V177 mutants. Specifically, our hypothetical
model of TPH (Jiang et al., 2000), predictions based on NMR data (McKinney et al.,
2001), and x-ray crystallography data (Wang et al., 2002) suggest a structural
situation presented in Figure 1. Namely, that arginine 257 (R257) is actively
engaged in orienting binding of the alpha-carboxyl of the tryptophan substrate, as in
TH (Moran et al., 1998). While not directly involved in substrate binding, V177 is
close enough to R257 (3-4 Å) to influence its orientation.
Replacement of the valine residue with a slightly larger isoleucine residue
mimics the coding region polymorphism of TPH (Ramaekers et al., 2001), and
results in a decrease in Vmax (observed at lower fixed concentrations of tryptophan
substrate) with no change in Km, BH4. However, this subtle mutation seems to hinder
the binding and/or utilization of the tryptophan substrate as demonstrated by the
97
increase in Km, Trp with no change in Vmax. This change can be explained by the
steric hindrance provided by the bulkier isoleucine residue to either the substrate
itself or the position of the surrounding residues. Further support for this hypothesis
is given by the data obtained from analysis of the valine to alanine substitution at
residue 177 (V177A), which did not adversely affect the performance of the enzyme
with respect to BH4 or tryptophan. However, a further reduction in side chain size
and hydrophobicity, through construction of the V177G point mutant, is detrimental
to enzymatic activity. In fact, this mutation nearly abolished enzyme activity. This
can be explained by the lack of any steric hindrance, thus resulting in conformational
flexibility that could dramatically perturb the size and shape of the active site pocket.
Similarly, V177S and V177T, mutants exhibiting side chains similar in size to
alanine and valine, respectively, but with hydrophilic properties, also exhibited little
enzyme activity.
Unexpectedly, the V177L mutant also had little enzyme activity.
Our
hypothesis was that this mutation would result in an enzyme that had activity with no
change in Km,
BH4,
and an increase in the Km,
Trp
compared to V177I. Though
typically considered a relatively conservative mutation, it is plausible that the
addition of a methylene group could constrain the positioning of residue 177 and
shift the orientation of surrounding residues (such as R257), thereby preventing
optimal residue placement and decreasing normal enzyme function. In contrast, the
lack of activity of the V177F mutant was expected as we hypothesized that the bulk
and hydrophobicity of the phenylalanine side chain would perturb the local structure
and/or proper binding of the tryptophan substrate to such a great extent that the
98
enzyme would not be able to function. Together, these mutagenesis experiments
provide further support for a theory that this residue plays a critical, but indirect, role
in the proper positioning of the tryptophan substrate.
Replacement of the valine residue with charged residues, namely arginine
and glutamate, resulted in point mutants that had no detectable activity. These
results from V177R and V177E are not unexpected as these residues introduce a
charge into the hydrophobic core of the enzyme, which could easily perturb local
structure and thereby prevent proper binding and subsequent catalysis. Structural
models of these mutants allowed for theoretical visualization of the residue at
position 177 potentially interacting with the nearby arginine 257 residue (3-4Å). In
the case of V177R, the close proximity of the side chains would result in Van der
Waals repulsive forces, while a potential salt bridge could form between V177E and
R257, all of which would perturb proper tryptophan substrate binding if R257 is
indeed involved in coordinating the alpha carboxyl carbon of the amino acid
substrate as in TH (Moran et al., 1998).
Typically, a valine to isoleucine substitution is considered a subtle change.
Our data indicate that this mutation at residue 177 (V177I) is not completely
deleterious to TPH enzyme activity, and suggest that this polymorphism could exist
in the population but remain undiagnosed as long as tryptophan substrate levels are
high. Physiologically, such a mutation would exhibit itself only in the presence of an
additional metabolism-related defect. This coincides with the findings of Ramaekers
and colleagues, where only one out of the 5 patients that exhibited aberrant
serotonin neurochemistry and the neurodevelopment problems possessed the TPH
99
polymorphism. Overall, our data give credence to the theory that the decrease in
serotonin levels in these neurodevelopmentally-challenged patients results from a
loss in serotonergic neurons rather than a decrease in serotonin levels due to a
change in tryptophan hydroxylase activity.
Complicating the explanation of the potential functional role of the V177I
mutation is the recent discovery of a brain-specific isoform of TPH gene, Tph2
(Walther et al., 2003). This novel isoform, Tph2, encodes a TPH enzyme that
predominates in the central nervous system, and resembles the TPH enzyme
encoded by Tph1 (Boularand et al., 1990; Boularand et al., 1995), studied in
Ramaekers et al. (2002), and reportedly to be located in the periphery (Walther et
al., 2003).
It is logical to assume that the neuronal-specific TPH (TPH2, Walther et al.,
2003) plays the dominant role in the regulation of normal neurological development
and function. Based on the fact that the V177I polymorphism was observed in only
1 out of 5 patients, coupled with the recent report that the TPH harboring this
polymorphism is the peripheral enzyme, it is likely that V177I is coincidentally
associated with the novel neurodevelopmental disorder. It is important to note,
however, that the presence of this polymorphism highlighted a residue which has
proven to be pivotally important to the structure of the active site. Without evidence
of this polymorphism, there would have been no reason a priori to select valine 177
for mutational analysis. Fully understanding this neurodevelopmental disorder will
have to await the characterization of TPH2 in these patients, as well as an
understanding of its interrelationship with TPH1.
It seems unlikely that a
100
polymorphism in the peripheral version of TPH would not play some role in a
behavioral syndrome that is corrected with treatment with 5-hydroxytryptophan and
carbidopa supplementation and is characterized by reduced serotonin metabolites.
Acknowledgments
We would like to thank Dr. Jacques Mallet (Centre National de la Recherche
Scientifique, Paris, France) for the generous gift of human tryptophan hydroxylase
(hTPH1). We would like to thank Dr. Linda C. McPhail, Dr. Mark O. Lively, Dr.
Leslie B. Poole, and Dr. William E. Sonntag (Wake Forest University) for their
technical input. This work was supported by PHS grant R01 GM-38931 (to K.E.V.).
101
Figure 1 – Structural depictions of Val177 mutations. A closeup view of the active
site site pocket of the hypothetical model of human TPH is depicted (Jiang et al.,
2000). Secondary structure is identified by color: β-sheets (yellow), α-helix (pink),
and random coil (white). The locations of Tyr235, Arg257, Ser260, and Ser336 are
indicated.
A) The typical active site conformation and positioning of Val177;
Predicted structural changes resulting from V177 substitutions are represented on
the hypothetical TPH model in B) Val177Gly; C) Val177Ser; D) Val177Thr; E)
Val177Ala;
F) Val177Ile;
G) Val177Leu; H) Val177Phe;
I) Val177Arg;
J)
Val177Glu. These images were generated on a Silicon Graphics Workstation with
the modeling program Sybyl 6.8 (Tripos Inc., St. Louis, MO).
102
A
B
C
D
E
F
G
H
I
J
103
Table II - Purification data for wild-type and mutant enzymes
Yield (µg) a
Specific Activity b
Fold purification c
Wild-type
160
21.9
661
V177G
155
0.41
120
V177S
165
0.66
2.88
V177T
175
1.04
447
V177A
150
44.4
500
V177I
154
28.6
3920
V177L
180
0.99
102
V177F
171
ND
-
V177R
140
ND
-
V177E
106
ND
-
Protein
a
Yield of purified protein from 250ml of bacterial culture (average 25 mg total protein).
b
Units of specific activity were nmol 5-OH-Trp produced / min-mg. TPH enzymatic
activity was determined (see Materials and Methods) using substrate concentrations of
100 µM BH4 and 50 µM tryptophan.
c
Fold purification was determined using specific activity values determined from enzyme
activity in the crude bacterial extract and purified fraction.
ND – No detectable activity.
104
Figure 2 - Coomassie and immunoblots of purified proteins. Human TPH was
expressed in E. coli (BL21) as an amino-terminal oligohistidine fusion protein and
purified to apparent homogeneity by affinity chromatography. 1 µg purified protein
was subject to SDS-PAGE. (A) Colloidal Blue staining of purified TPH proteins.
Lane L: Mark 12™ Unstained Standard; lane1: V177G; lane 2: V177S; lane 3:
V177T; lane 4: V177A; lane 5: wild-type TPH; lane 6: V177I; lane 7: V177L; lane 8:
V177F; lane 9: V177R; lane 10: V177E; lane 11: 1 µg BSA; lane 12: 5 µg BSA; lane
13: 10µg BSA. (B) Immunoblot of purified TPH proteins. Lane1: V177G; lane 2:
V177S; lane 3: V177T; lane 4: V177A; lane 5: wild-type TPH; lane 6: V177I; lane 7:
V177L; lane 8: V177F; lane 9: V177R; lane 10: V177E. Immunoreactive proteins
were detected with a monoclonal antibody (WH3) at a 1:1000 dilution followed by an
anti-mouse IgG-HRP from sheep at a 1:1500 dilution. Each protein migrated with an
apparent molecular mass of 51 kDa.
105
106
Table III - Steady-state kinetic parameters of wild-type TPH and mutants
Enzyme
Km, BH4 (µM)
Km, Trp (µM)
Specific Activity
Wild-type
15.8 ± 1.2
26.4 ± 3.3
21.9
V177A
16.7 ± 2.5
31.6 ± 1.4
44.4
V177I
14.8 ± 0.9
41.1 ± 6.5 *
28.6
V177G
NR
-
0.41
V177S
NR
-
0.66
V177T
NR
-
1.04
V177L
-
-
0.99
V177F
-
-
0.02
V177R
-
-
-
V177E
-
-
-
(nmol/min/mg)
NR – Not Reliable. Activity levels were too low to provide accurate Km determinations, but
values ranged from (17.5 µM to 55 µM). Cells denoted with “-“ provided no kinetic values.
TPH activity was determined (see Materials and Methods) and the kinetic constants were
calculated by direct fit to the Michaelis-Menten equation and non-linear regression analysis
using GraphPad Prism version 3.03 (GraphPad Software, San Diego, CA,
www.graphpad.com). Kinetic determinations used substrate concentrations at 100 µM BH4
(tryptophan variable) and 50 µM or 500 µM tryptophan (BH4 variable). The mean values for
BH4 and tryptophan were compared independently of each other (n = 6 to 11). Specific
activity was determined at substrate concentrations of 100 µM BH4 and 50 µM tryptophan.
*One-way ANOVA, followed by a Student’s Newman-Keuls test at 95% confidence indicated
that the kinetic differences observed were statistically significant (p = 0.004).
107
References
Andersen O.A., Flatmark T., and Hough E. (2002) Crystal structure of the ternary
complex of the catalytic domain of human phenylalanine hydroxylase with
tetrahydrobiopterin and 3-(2-thienyl)-L-alanine, and its implications for the
mechanism of catalysis and substrate activation. J. Mol. Biol. 320, 10951108.
Bassan A., Blomberg M.R., and Siegbahn P.E. (2003) Mechanism of dioxygen
cleavage in tetrahydrobiopterin-dependent amino acid hydroxylases.
Chemistry 9, 106-115.
Beevers S.J., Knowles R.G., and Pogson C.I. 1983. A sensitive radiometric assay
for tryptophan hydroxylase applicable to crude extracts. J. Neurochem. 40:
894-897.
Boularand S., Darmon M.C., Ganem Y., Launay J.M., and Mallet J. (1990)
Complete coding sequence of human tryptophan hydroxylase. Nucleic Acids
Res. 18, 4257.
Boularand S., Darmon M.C., and Mallet J. (1995) The human tryptophan
hydroxylase gene. An unusual splicing complexity in the 5'-untranslated
region. J. Biol. Chem. 270, 3748-56.
Cornwell-Jones C.A., Decker M.W., Chang J.W., Cole B., Goltz K.M., Tran T., and
McGaugh J.L. (1989) Neonatal 6-hydroxydopa, but not DSP-4, elevates
brainstem monoamines and impairs inhibitory avoidance learning in
developing rats. Brain Res. 493, 258-68.
Daubner S.C., Lohse D.L., and Fitzpatrick P.F. (1993)
Expression and
characterization of catalytic and regulatory domains of rat tyrosine
hydroxylase. Protein Sci. 2, 1452-1460.
Darmon M.C., Guibert B., Leviel V., Ehret M., Maitre M., and Mallet J. (1988)
Sequence of two mRNAs encoding active rat tryptophan hydroxylase. J.
Neurochem. 51, 312-316.
Delgado P.L. and Moreno F.A. (1998) Hallucinogens, serotonin and obsessive
compulsive disorder. J. Psychoactive Drugs 30, 359-366.
D’Sa C.M., Arthur R.E. Jr, Jennings I., Cotton R.G.H., and Kuhn D.M. (1996a)
Tryptophan hydroxylase: Purification by affinity chromatography on
calmodulin-Sepharose. J. Neurosci. Meth. 69, 149-153.
108
D’Sa C.M., Arthur R.E. Jr, and Kuhn D.M. (1996b) Expression and deletion
mutagenesis of tryptophan hydroxylase fusion proteins: delineation of the
enzyme catalytic core. J. Neurochem. 67, 917-926.
Ellis H.R., Daubner S.C., and Fitzpatrick P.F. (2000) Mutation of serine 395 of
tyrosine hydroxylase decouples oxygen-oxygen bond cleavage and tyrosine
hydroxylation. Biochemistry. 39, 4174-4181.
Erlandsen, H., Martinez A., Knappskog P.M., Haavik, J., Hough, E. and Flatmark, T.
(1997a) Crystallization and preliminary diffraction analysis of a truncated
homodimer of human phenylalanine hydroxylase. FEBS Letters. 406, 171174.
Erlandsen, H., Fusetti F., Martinez A., Hough E., Flatmark, T. and Stevens R.C.
(1997b) Crystal structure of human phenylalanine hydroxylase reveals the
structural basis for phenylketonuria. Nat. Struct. Biol. 4, 995-1000.
Erlandsen H., Flatmark T., Stevens R.C., and Hough E. (1998) Crystallographic
analysis of the human phenylalanine hydroxylase catalytic domain with
bound catechol inhibitors at 2.0A resolution. Biochem. 37, 15638-15646.
Erlandsen H., Bjorgo E., Flatmark T., and Stevens R.C. (2000) Crystal structure and
site-specific mutagenesis of pterin-bound human phenylalanine hydroxylase.
Biochem. 39, 2208-2217.
Erlandsen H., Kim J.Y., Patch M.G., Han A., Volner A., Abu-Omar M.M., and
Stevens R.C. (2002) Structural comparison of bacterial and human irondependent phenylalanine hydroxylases: Similar fold, different stability and
reaction rates. J. Mol. Biol. 320, 645-661.
Fitzpatrick P.F. (1991) Steady-state kinetic mechanism of rat tyrosine hydroxylase.
Biochem. 30, 3658-3662.
Fitzpatrick P.F. (1993) Mechanistic studies of tyrosine hydroxylase. Adv. Exp. Med.
Biol. 338, 81-86.
Fitzpatrick P.F. (2000) The aromatic amino acid hydroxylases. Adv. Enzymol. Relat.
Areas Mol. Biol. 74, 235-294.
Fusetti F., Erlandsen H., Flatmark T., and Stevens R.C. (1998) Structure of
tetrameric phenylalanine hydroxylase and its implications for phenylketonuria.
J. Biol. Chem. 273, 16962-16967.
Goodwill K.E., Sabatier C., Marks C., Raag R., Fitzpatrick P.F, and Stevens R.C.
(1997) Crystal structure of tyrosine hydroxylase at 2.3 A and its implication
for inherited neurodegenerative diseases. Nature Struct. Biol. 4, 578-585.
109
Goodwill K.E., Sabatier C., and Stevens R.C. (1998) Crystal structure of tyrosine
hydroxylase with bound cofactor analogue and iron at 2.3 A resolution: Selfhydroxylation of Phe300 and the pterin-binding site. Biochem. 37, 1343713445.
Grenett H.E., Ledley F.D., Reed L.L., and Woo S.L.C. (1987) Full-length cDNA for
rabbit tryptophan hydroxylase: Functional domains and evolution of aromatic
amino acid hydroxylases. Proc. Natl. Acad. Sci. USA, 84, 5503-5534.
Grima B., Lamouroux A., Blanot F., Biguet N.F., and Mallet J. (1985) Complete
coding sequence of rat tyrosine hydroxylase cDNA. Proc. Natl. Acad. Sci.
USA, 82, 617-621.
Hamdan F.F., and Ribeiro P. (1999) Characterization of a stable form of tryptophan
hydroxylase from the human parasite Schistosoma mansoni. J. Biol. Chem.
274, 21746-21754.
Hufton S.E., Jennings I.G., and Cotton R.G.H. (1998) Structure/function analysis of
the domains required for the multimerisation of phenylalanine hydroxylase.
Biochim. Biophys. Acta., 1382, 295-304.
Jiang G.C.-T., Yohrling IV G.J., Schmitt J.D., and Vrana K.E. (2000). Identification of
substrate orienting and phosphorylation sites within tryptophan hydroxylase
using homology-based molecular modeling. J. Mol. Biol. 302, 1005-1017.
Kandasamy S.B. and Williams B.A. (1984) Hypothermic and anti-pyretic effects of
ACTH (1-24) and alpha-melanotropin in guinea pigs. Neuropharmacology
23, 49-53.
Knappskog P.M., Flatmark T., Mallet J., Ludecke B., and Bartholome K. (1995)
Recessively inherited L-dopa-responsive dystonia caused by a point mutation
(Q381K) in the tyrosine hydroxylase gene. Human Mol. Genet. 4, 12091212.
Knappskog P.M., Flatmark T., Aarden J.M., Haavik J., and Martinez A. (1996)
Structure/function relationships in human phenylalanine hydroxylase. Effect
of terminal deletions on the oligomerization, activation and cooperativity of
substrate binding to the enzyme. Eur. J. Biochem. 242, 813-821.
Kobe B., Jennings I.G., House C.M., Feil S.C., Michell B.J., Tiganis T., Parker M.W.,
Cotton R.G.H., and Kemp B.E. (1997) Regulation and crystallization of
phosphorylated and dephosphorylated forms of truncated dimeric
phenylalanine hydroxylase. Protein Science 6, 1352-1357.
110
Kobe B., Jennings I.G., House C.M., Michell B.J., Goodwill K.E., Santarsiero B.D.,
Stevens R.C., Cotton R.G.H., and Kemp BE. (1999) Structural basis of auto
regulation of phenylalanine hydroxylase. Nature Struct. Biol. 6, 442-448.
Kuhn D.M., Ruskin B., and Lovenberg W. (1980) Tryptophan hydroxylase: the role
of oxygen, iron, and sulfhydryl groups as determinants of stability and
catalytic activity. J. Biol. Chem. 255, 4137-4143.
Kumer S.C., Mockus S.M., Rucker P.J., and Vrana K.E. (1997) Amino terminal
deletion analysis of tryptophan hydroxylase: PKA phosphorylation occus at
serine-58. J. Neurochem. 69,1738-1745.
Kwok S.C., Ledley F.D., DiLella A.G., Robson K.J., and Woo S.L. (1985)
Nucleotide sequence of a full-length complimentary DNA clone and amino
acid sequence of human phenylalanine hydroxylase. Biochem. 24, 556-561.
Laemmli U.K. (1970) Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227, 680-685.
Ledley F.D., DiLella A.G., Kwok C.M., and Woo S.L.C. (1985) Homology between
phenylalanine hydroxylase and tyrosine hydroxylase reveals common
structural and functional domains. Biochemistry, 24, 3389-3394.
Liu X. and Vrana K.E. (1991) Leucine zippers and coiled-coils in the aromatic
amino acid hydroxylases. Neurochem. Int. 18, 27-31.
Lohse D.L., and Fitzpatrick P.F. (1993) Identification of the intersubunit binding
region in rat tyrosine hydroxylase. Biochem. Biophys. Res. Commun. 197,
1543-1548.
Ludecke B., Dworniczak B., and Bartholome K. (1995) A point mutation in the
tyrosine hydroxylase gene associated with Segawa’s syndrome. Hum.
Genet. 95, 123-125.
Ludecke, B., Knappskog P.M., Clayton P.T., Surtees R.A.H., Clelland J.D., Heales
S.J.R., Brand M.P., Bartholome K., and Flatmark T. (1996) Recessively
inherited L-dope responsive parkinsonism in infancy caused by a point
mutation (L205P) in the tyrosine hydroxylase gene. Hum. Mol. Gen. 5, 10231028.
McKinney J., Teigen K., Froystein N.A., Salaun C., Knappskog P.M., Haavik J., and
Martinez A. (2001) Conformation of the substrate and pterin cofactor bound
to human tryptophan hydroxylase. Important role of Phe313 in substrate
specificity. Biochemistry 40, 15591-601.
111
Mann J.J., Malone K.M., Nielsen D.A., Goldman D., Erdos J., and Gelernter J.
(1997) Possible association of the tryptophan hydroxylase gene and suicidal
behavior in depressed patients. Amer. J. Psych. 154, 1451-1453.
Martinez A., Knappskog P.M., and Haavik J. (2001) A structural approach into
human tryptophan hydroxylase and its implications for the regulation of
serotonin biosyntheis. Curr. Med. Chem. 8, 1077-1091.
Mockus S.M., Kumer S.C., and Vrana K.E. (1997a) Carboxyl terminal deletion
analysis of tryptophan hydroxylase. Biochim. Biophys. Acta. 1342, 132-140.
Mockus S.M., Kumer S.C., and Vrana K.E. (1997b) A chimeric tyrosine/tryptophan
hydroxylase: The tyrosine hydroxylase regulatory domain serves to stabilize
enzyme activity. J. Mol. Neurosci. 9, 35-48.
Mockus S.M. and Vrana K.E. (1998) Advances in the molecular characterization of
tryptophan hydroxylase. J. Mol. Neurosci. 10, 163-179.
Moran G.R., Daubner S.C., and Fitzpatrick P.L. (1998) Expression and
characterization of the catalytic core of tryptophan hydroxylase. J. Biol.
Chem. 273, 12259-12266.
Nielsen D.A., Dean M., and Goldman D. (1992) Genetic mapping of the human
tryptophan hydroxylase gene on chromosome 11, using and intronic
conformational polymorphism. Amer. J. Human Genet. 51, 1366-1371.
Nielsen D.A., Goldman D., Virkkunen M., Tokola R., Rawlings R., and Linnoila M.
(1994) Suicidality and 5-hydroxyindoleacetic acid concentration associated
with a tryptophan hydroxylase polymorphism. Arch. Gen. Psych. 51, 34-38.
Reinhard J.F., Smith G.K., and Nichol C.A. (1986) A rapid and sensitive assay for
tyrosine-3-monooxygenase based upon the release of 3H2O and adsorption
of [3H]-tyrosine by charcoal. Life. Sci. 39, 2185-2189.
Schauenburg H. and Dressler D. (1992) Gilles de la Tourette Syndrome. Nervearzt
63, 453-461.
Sindelar C.V., Hendsch Z.S., and Tidor B. (1998) Effects of salt bridges on protein
structure and design. Protein Sci. 7, 1898-1914.
Tabaddor K., Wolfson L.I., and Sharpless N.S. (1978) Ventricular fluid homovanillic
acid and 5-hydroxyindolacetic acid concentrations in patients with movement
disorders. Neurology 28, 1249-1253.
112
Volicer L., Direnfeld L.K., Freedman M., Albert M., Langlias P.J., Bird E.D. (1985)
Serotonin and 5-hydroxyindolacetic acid in CSF. Difference in Parkinson’s
disease and dementia of the Alzheimer’s type. Archives of Neurology 42,
127-29.
Volner A., Zoidakis J., and Abu-Omar M.M. (2003) Order of substrate binding in
bacterial phenylalanine hydroxylase and its mechanistic implication for pterindependent oxygenases. J. Biol. Inorg. Chem. 8, 121-128.
Vrana S.L., Dworkin S.I., and Vrana K.E. (1993) Radioenzymatic assay for
tryptophan hydroxylase: [3H2O] release assessed by charcoal adsorption. J.
Neurosci. Meth. 48, 123-129.
Vrana K.E., Rucker P., Kumer S.C. (1994a) Recombinant rabbit tryptophan
hydroxylase is a substrate cAMP-dependent protein kinase. Life Sci. 55,
1045-1052.
Vrana K.E., Walker S.J., Rucker P., and Liu X. (1994b) A carboxyl terminal leucine
zipper is required for tyrosine hydroxylase tetramer formation.
J.
Neurochem. 63, 2014-2020.
Walker S.J., Liu X., Roskoski R. Jr, and Vrana K.E. (1994) Catalytic core of rat
tyrosine hydroxylase: Terminal deletion analysis of bacterially-expressed
enzyme. Biochim. Biophys. Acta. 1206, 113-119.
Walther D.J., Peter J.U., Bashammakh S., Hortnagl H., Voits M., Fink H., and Bader
M. (2003) Synthesis of serotonin by a second tryptophan hydroxylase
isoform. Science 299, 76.
Wang L., Erlandsen H., Haavik J., Knappskog P.M., and Stevens R.C. (2002).
Three-dimensional structure of human tryptophan hydroxylase and its
implications for the biosynthesis of the neurotransmitters serotonin and
melatonin. Biochem. 41, 12569-12574.
Yohrling IV, G.J., Mockus S.M., and Vrana K.E. (1999) Identification of aminoterminal sequences contributing to tryptophan hydroxylase tetramer
formation. J. Mol. Neurosci. 12, 23-34.
CHAPTER IV
SUMMARY AND CONCLUSIONS
George C.-T. Jiang
113
114
Tryptophan hydroxylase (TPH) catalyzes the rate-limiting step in the
formation of the neurotransmitter serotonin (5-HT, Grahame-Smith, 1964;
Lovenberg et al., 1967), and also plays a role in the subsequent biosynthesis of
melatonin (Chanut et al., 2002; Privat et al., 2002; reviewed in Martinez et al., 2001).
TPH is localized predominantly within the raphe nuclei of the midbrain and is also
peripherally located in the pineal gland, retina, and enteric neurons of the gut
(Jequier et al., 1969; Joh et al., 1975; Austin and O’Donnell, 1999; reviewed in
Mockus and Vrana, 1998). Recent studies reveal that this may be explained by the
existence of two distinct isoforms of TPH that are differentially expressed in the CNS
and periphery (Walther et al., 2003). Serotonin, and therefore TPH by inference,
play important roles in a variety of physiological processes. Serotonin is implicated
in a variety of CNS functions such as temperature control, aggression, pain and
memory (Kandasamy and Williams, 1984; reviewed in Oliver et al., 1995; Brentegani
and Lico, 1982; Cornwell-Jones et al., 1989). Aberrations in serotonin synthesis,
regulation, and homeostasis have been associated with numerous psychiatric
illnesses including depression, anxiety, obsessive-compulsive disorder (OCD),
bulimia, migraines, and drug abuse (reviewed in Mockus and Vrana, 1998).
The present work has encompassed the development of a hypothetical TPH
model (Jiang et al., 2000), studies to validate the model and identify amino acid
residues of importance (Jiang et al., 2000), and studies that address the significance
of a TPH polymorphism found in one individual (Jiang et al., in preparation) (see
Figure 1). The hypothetical model has served as an excellent tool to visualize
structure and function relationships, and aided in mutagenesis studies, in lieu of a
115
TPH crystal structure that was only recently released (Wang et al., 2002). The
recent publication and release of the TPH crystal structure definitively illustrates the
molecular structure in the catalytic domain and further validates the hypothetical
model, and the experimental studies conducted in this work. An “iterative magic fit”
of the TPH crystal structure and hypothetical model using Swiss-PdbViewer (Guex
and Peitsch, 1997) indicate a root mean square deviation (RMSD) of 1.02 Å
between the carbon backbones of the structures. This demonstates the high degree
of similarity between both structures considering rms deviations between models of
homologous protein structures and real ones are typically between 2 and 4 Å, even
in the best cases (Petsko, 2000).
116
Figure 1 – Structural location of the functional residues of interest in the present
work. A view of the hypothetical model of human TPH is depicted (Jiang et al.,
2000). Secondary structure is identified by color: β-sheets (yellow), α-helix (pink),
and random coil (white). Residues of note include Ser58, Val177, Tyr235, Ser260,
and Ser443. This image was generated on a Silicon Graphics Workstation with the
modeling program Sybyl 6.8 (Tripos Inc., St. Louis, MO).
117
118
The present work has identified CaMPKII phosphorylation sites in TPH. The
substrate amino acid residues include Ser58, Ser260, and Ser443. Mutagenesis
studies with Ser58Ala and Ser260Ala mutants indicate that phosphorylation can
occur at either residue and only minimally at Ser443. We surmise that Ser443 is
only a potential CaMPKII phosphorylation site, and probably plays a minimal role in
in vivo regulation of TPH as it is located in the extreme carboxy terminus
tetramerization domain of the enzyme and would therefore normally be buried deep
within the protein. The small amount of phosphorylation that was observed in the
double point mutant (Ser58Ala/Ser260Ala) was, in all probability, a result of the
presence of monomeric or denatured TPH in solution.
The development of a hypothetical TPH structure has been useful in further
understanding structure/function relationships in this important biosynthetic enzyme
by assisting in the selection of amino acid residues for mutagenesis studies.
Mutagenesis experiments and subsequent characterization have identified and
confirmed the importance of Val177 and Tyr235 in the catalytic domain of TPH.
Site-directed mutagenesis of Val177 allowed the correlation of functional data for a
naturally-occurring coding region polymorphism associated with a developmentallyimpaired patient (Ramaekers et al., 2001). Our in vitro studies with recombinantlyexpressed human TPH indicate that Val177 plays a role in tryptophan substrate
utilization and the identity of the residue is critical for proper enzyme structure and
function (Jiang et al., in preparation). Similarly, mutagenesis studies on Tyr235
reveal that the residue plays an integral role in the BH4 binding pocket that
119
dramatically affects subsequent tryptophan hydroxylation (Jiang et al., 2000;
McKinney et al., 2001; Wang et al., 2002; reviewed in Martinez et al., 2001).
Recently, a genetic knock-out of the known TPH gene was created in mice
(Walther et al., 2003). Interestingly, the knock-out mice (Tph-/-) still had normal
serotonin (5-HT) levels in classically serotonergic brain regions in the central
nervous system, while they lacked 5-HT in the periphery. This led the authors to
identify a new isoform of TPH (Tph2) in mice, and subsequently in rat and human
species. The knockout mice (Tph1-/-) exhibited no significant behavioral differences
in elevated plus maze and hole board tests, which are indicative of 5-HT-related
behaviors. These data from mice are different from the C. elegans TPH knockout
that was previously generated (Sze et al., 2000). These TPH deletion mutant worms
were viable, but did not synthesize serotonin, and exhibited alterations in their
behavior and metabolism, including decreased feeding and egg laying rates, and an
increase in fat storage (Sze et al., 2000). Comparisons between the amino acid
sequences of Tph1, Tph2, and C. elegans Tph reveal that the bulk of the differences
lie in the amino terminal regulatory domain, but do not identify the C. elegans TPH
gene more closely with either of the mammalian genes.
The recent identification of the new TPH isoform in vertebrates, which
predominates in the central nervous system, raises interesting new questions
regarding the regulation of serotonin biosynthesis in animals, and the possibility for
potential intervention with novel pharmacotherapies specific for CNS TPH or
peripheral TPH. This could have dramatic implications for future treatment of
serotonergic disorders. One can envision using genetic therapies by engineering the
120
necessary TPH gene to either increase or decrease the protein’s inherent enzyme
stability or perhaps its basal activity. The full-length human TPH model and crystal
structure have been useful in filling some of the gaps in our knowledge of the
structure, function, and regulation of TPH, and will continue to do so in the fuure.
In conclusion, the AAAH are highly homologous proteins, but subtle nuances
exist between the enzymes that determine substrate specificity, stability, and
enzyme regulation. Though the short half-life of TPH and minute quantity available
in a single animal have historically impeded progress on the research of TPH, these
challenges are slowly being conquered. The recent advances in protein expression
technologies has helped to overcome problems with enzyme purification, while the
identification of a stable form of TPH in Schistosoma mansoni (Hamdan and Ribeiro,
1999) has provided new insights to TPH enzyme stability and regulation. Moreover,
the development of a hypothetical TPH structure and the subsequent crystallization
provide new tools to further expand the knowledge base regarding TPH structure
and function. It is hoped that information from this thesis, and future studies using
the contemporary tools and approaches available will assist in addressing the
important issues and intricate details that remain about serotonin biosynthesis and
TPH regulation in human health and disease.
121
REFERENCES
Austin, M.C. and O’Donnell, S.M. (1999) Regional distribution and cellular
expression of tryptophan hydroxylase messenger RNA in postmortem human
brainstem and pineal gland. J. Neurochem. 72, 2065-2073.
Brentegani, L.G. and Lico, M.C. (1982) Dental pain and the injection of agents into
the trigeminal nerve of guinea pigs. Phys. and Behav. 28, 49-52.
Chanut E., Nguyen-Legros J., Labarthe B., Trouvin J.H., and Versaux-Botteri C.
(2002) Serotonin synthesis and its light-dark variation in the rat retina. J.
Neurochem. 83, 863-869.
Cornwell-Jones, C.A., Decker, M.W., Chang, J.W., Cole, B., Goltz, K.M., Tran, T,,
and McGaugh, J.L. (1989) Neonatal 6-hydroxydopa, but not DSP-4, elevates
brainstem monoamines and impairs inhibitory avoidance learning in
developing rats. Brain Res. 493, 258-68.
Grahame-Smith, D.G. (1964) Tryptophan hydroxylation in brain. Biochem Biophys
Res Commun 16, 586-592.
Guex, N. and Peitsch, M.C. (1997) SWISS-MODEL and the Swiss-PdbViewer: An
environment for comparative protein modeling. Electrophoresis 18, 27142723.
Hamdan, F.F., and Ribeiro P. (1999) Characterization of a stable form of tryptophan
hydroxylase from the human parasite Schistosoma mansoni. J. Biol. Chem.
274, 21746-21754.
Jequier E., Robinson D.S., Lovenberg W., and Sjoerdsma A. (1969) Further studies
on tryptophan hydroxylase in rat brain stem and beef pineal. Biochem.
Pharmacol. 18, 1071-1081.
Jiang G.C.-T., Yohrling IV G.J., Schmitt J.D., and Vrana K.E. (2000). Identification of
substrate orienting and phosphorylation sites within tryptophan hydroxylase
using homology-based molecular modeling. J. Mol. Biol. 302, 1005-1017.
Joh, T.H., Shikimi, T., Pickel, V.M., and Reis, D.J. (1975) Brain tryptophan
hydroxylase: Purification of, production of antibodies to, and cellular and
ultrastructural localization in serotonergic neurons of rat midbrain. Proc. Natl.
Acad. Sci. 72, 3575-3579.
122
Kandasamy, S.B. and Williams, B.A. (1984) Hypothermic and anti-pyretic effects of
ACTH (1-24) and alpha-melanotropin in guinea pigs. Neuropharmacology 23,
49-53.
Lovenberg W., Jequier E., and Sjoerdsma A. (1967) Tryptophan hydroxylation:
Measurement in pineal gland, brain stem and carcinoid tumor. Science 155,
217-219.
Ludecke, B., Dworniczak, B., Bartholome, K. (1995) A point mutation in the tyrosine
hydroxylase gene associated with Segawa’s syndrome. Hum. Genet. 95,
123-125.
Martinez A., Knappskog P.M., and Haavik J. (2001) A structural approach into
human tryptophan hydroxylase and its implications for the regulation of
serotonin biosyntheis. Curr. Med. Chem. 8, 1077-1091.
McKinney J., Teigen K., Froystein N.A., Salaun C., Knappskog P.M., Haavik J., and
Martinez A. (2001) Conformation of the substrate and pterin cofactor bound
to human tryptophan hydroxylase. Important role of Phe313 in substrate
specificity. Biochemistry 40, 15591-601.
Mockus S.M. and Vrana K.E. (1998) Advances in the molecular characterization of
tryptophan hydroxylase. J. Mol. Neurosci. 10, 163-179.
Olivier, B., Mos, J., van Oorschot, R., and Hen, R. (1995) Serotonin receptors and
animal models of aggressive behavior. Pharmacopsych. 28 Suppl 2, 80-90.
Petsko G.A. (2000) The Grail problem. Genome Biol. 1, comment002
Privat K., Brisson C., Jouvet A., Chesneau D., Ravault J.P., and Fevre-Montange M.
(2002) Evidence for implication of tryptophan hydroxylase in the regulation of
melatonin synthesis in ovine pinealocytes in culture. Cell. Mol. Neurobiol. 22,
417-29.
Ramaekers V.T., Senderek J., Hausler M., Haring M., Abeling N., Zerres K.,
Bergmann C., Heimann G., and Blau N. (2001) A novel neurodevelopmental
syndrome responsive to 5-hydroxytryptophan and carbidopa. Mol. Genet.
Metab. 73,179-87.
Sze J.Y., Victor M., Loer C., Shi Y., and Ruvkun G. (2000) Food and metabolic
signalling defects in a Caenorhabditis elegans serotonin-synthesis mutant.
Nature 403, 560-564.
Walther D.J., Peter J.U., Bashammakh S., Hortnagl H., Voits M., Fink H., and Bader
M. (2003) Synthesis of serotonin by a second tryptophan hydroxylase
isoform. Science 299, 76.
123
Wang L., Erlandsen H., Haavik J., Knappskog P.M., and Stevens R.C. (2002).
Three-dimensional structure of human tryptophan hydroxylase and its
implications for the biosynthesis of the neurotransmitters serotonin and
melatonin. Biochem. 41, 12569-12574.
APPENDIX
PHENYLKETONURIA
George C-T. Jiang, George J. Yohrling IV, and Kent E. Vrana
The following educational review article is in press for publication in the
Encyclopedia of Life Sciences and is reprinted with permission from the Nature
Publishing Group, www.els.net. Stylistic variations are due to the requirements of
this journal. The manuscript was prepared and edited by George C.-T. Jiang.
Authorship is shared with George J. Yohrling IV and Dr. Kent E. Vrana. George J.
Yohrling IV wrote the initial draft of the Future Treatments for Phenylketonuria
section. Dr. Kent E. Vrana served as a scientific advisor/editor for this project.
124
125
Introduction
Metabolic disorders can adversely affect the body’s natural homeostatic or
steady state and lead to chemical imbalances and severe pathological conditions.
Phenylketonuria is such an example in which the normal conversion of the dietary
amino acid phenylalanine to tyrosine is blocked.
The resulting build-up of
phenylalanine and its metabolites in young patients produces a number of severe
side effects including intellectual impairment and cutaneous changes. This article
reviews the autosomal recessive metabolic disorder of phenylketonuria, covering
clinical diagnoses, typical and atypical causes, as well as current and potential
treatments.
Phenylketonuria, also known as PKU, is a disorder that affects 1 in 12,000–
15,000 births. In most cases, the cause is a deficiency in the enzyme phenylalanine
hydroxylase (PH). This genetic condition results in numerous complications due to
the incomplete metabolism of the essential amino acid phenylalanine. Clinical
manifestations, if the disease is left untreated, include developmental delay and
severe intellectual impairment, seizures, autism, eczema, hyperactivity, aggressive
behaviour and scleroderma-like skin changes with dilution of hair and skin colour.
PKU is implicated in about 0.64% of institutionalized patients worldwide. Early
diagnosis after birth is critical and treatment with a phenylalanine-restricted diet will
prevent onset of intellectual impairment and neurological abnormalities. Routine
paediatric screening for PKU began in the United States in 1961, and the success of
screening has spurred the development of similar procedures for other genetic
metabolic disorders.
126
Clinical Signs and Conditions
PKU is caused by a deficiency in the enzyme PH or reduction in the synthesis
or regeneration of a critical co-substrate for the enzyme. In patients afflicted with
PKU, this results in a build-up of phenylalanine, as it is not converted to tyrosine.
Collectively, the various forms of PKU are also referred to as hyperphenylalaninemia
owing to the increased circulating levels of the amino acid.
The excess
phenylalanine is metabolized to abnormal breakdown products (the phenylketones)
accounting for the common name of the disorder, phenylketonuria. Increased levels
of phenylalanine and its metabolites cause irreparable damage to the developing
central nervous system unless the condition is diagnosed and treated within the first
3-6 weeks of life. Furthermore, this biochemical defect can result in a variety of
cutaneous abnormalities, including diffuse hypopigmentation, eczema, and
photosensitivity. These cutaneous changes may result from the toxic effects of
phenylalanine and its decomposition products in the skin (Figure 1).
128
129
Normally, the essential amino acid phenylalanine is converted to tyrosine by
the enzyme PH. The resulting tyrosine can then be converted, via independent
pathways, to catecholamines (the neurotransmitters dopamine, noradrenaline
(norepinephrine) and adrenaline (epinephrine)), melanin, or thyroid hormone. In
addition, tyrosine can be incorporated, as a fundamental building block, into new
proteins. Because tyrosine is itself a nonessential amino acid, PKU is not fatal since
a diet high in tyrosine can make up for the lack of PH activity. Reduced synthesis of
the cosubstrate tetrahydrobiopterin, or a deficiency in the regenerating enzyme
dihydropteridine reductase may also result in phenylketonuria. However, such
cases are rarer and are referred to as non-classical PKU.
With the aid of routine paediatric screening, a diagnosis of PKU is usually
established soon after birth. The newborn screening test that is performed involves
the measurement of blood phenylalanine levels by the Guthrie test, a bacterial
inhibition assay. Normally, blood phenylalanine levels are below 2mg/dL-1. A blood
phenylalanine concentration of greater than 20mg/dL-1 with a normal or reduced
concentration of tyrosine is diagnostic of classical PKU. For the confirmation of
PKU, all amino acid levels must be measured by a quantitative technique and
screening programmes often request repeat specimens in any infant with a blood
phenylalanine level greater than normal.
The essential neurological symptoms are intellectual impairment, which may
cause corresponding changes in electroencephalogram, disturbed gait, ataxia,
extrapyramidal symptoms, focalized or generalized epileptiform seizures.
In
general, if treatment of PKU is instituted by 3 weeks of age, prevention of intellectual
130
impairment and neurologic abnormalities is seen. However, learning disabilities
have been reported in even well-treated patients. Today, it is recommended that
patients with PKU continue a phenylalanine-restricted diet indefinitely because of
several reports of decreased intellectual ability in children who were taken off the
diet at 5 or 6 years of age. Continuation of the diet also aids in prevention of
complications that are seen in genetically normal infants of women with PKU
(maternal PKU).
These complications include microcephaly, congenital heart
disease and intrauterine growth delay.
In patients with PKU, cutaneous changes can result from the toxic effects of
phenylalanine and its decomposition products in the skin.
Changes include
reduction of skin, hair, and eye colour with increased photosensitivity, although
photosensitivity is not universal. Dermatitis is also seen in up to 50% of patients.
This dermatitis is virtually indistinguishable from the true atopic dermatitis, a chronic
skin condition characterised by red itchy skin. Some are indeed true cases, but
others only mimic such lesions. Hair and skin darkening and other skin change
reversals may occur with dietary restriction of phenylalanine intake. However, when
a diet with normal levels of phenylalanine is resumed, facial eczema may reappear
within 24 h.
The current treatment for patients afflicted with PKU is a strict dietary regimen
that is restricted in phenylalanine intake yet provides all the other amino acids. The
earlier the treatment is started, the more beneficial the effects. While on dietary
treatment, patients with PKU need to be wary of products that contain the artificial
sweetener aspartame (Nutrasweet).
Aspartame, chemically known as N-
131
aspartylphenylalanine methyl ester, is commonly used in sweetened drinks, and the
amount in a litre of sweetened drink can be equivalent to the amount of
phenylalanine normally obtained from the daily diet. Uninformed patients may
therefore be at risk for contradicting their phenylalanine-reduced diet.
132
Classical Phenylketonuria
Typically, the term classical PKU refers to hyperphenylalaninemias resulting
from a deficient PH enzyme. If left untreated, classical PKU can lead to severe
intellectual impairment. As stated previously, PH is the mixed function oxidase
which, in its central reaction mechanism, converts the essential amino acid Lphenylalanine to L-tyrosine in the presence of the co-substrates tetrahydrobiopterin
and molecular oxygen.
The recognition that PH was the cause of the
hyperphenylalaninemia was not made until the late 1940s, over 20 years after
classical PKU was initially characterised by Asbjörn Fölling in 1934. It is important
to note that PKU does not necessarily result from a lack of the entire PH gene.
Assays to detect the PH protein show that patients with PKU can produce the
enzyme and kinetic studies provide evidence for enzymatic deficiencies.
The human PH gene was first cloned in 1985; since then many researchers
have studied it to determine the molecular basis for PKU. The PH gene comprises
13 exons and spans approximately 90 kilobases on the human chromosomes.
Many different defects in the PH gene have been observed and reported for patients
with PKU. These polymorphisms include single nucleotide base changes or point
mutations, deletions, splice variants, premature stop signals and insertions. Most of
the identified polymorphisms are single nucleotide changes that result in a protein
with one amino acid substituted by another. These missense mutations constitute
approximately 60% of all the known mutations that have been characterized.
Splicing mutations and deletions each constitute about 13% of all the mutations. In
these cases, a mutation results in defective ribonucleic acid processing (splicing).
133
This can produce an absence of PH or a defective form of the enzyme. Nonsense
mutations (inappropriate protein synthesis stop signals) and insertions make up the
remainder of the polymorphisms. The majority of the mutations (approximately
80%) lie in the central catalytic domain of the protein between exons 5 and 12, but
mutations have been seen in all the different exons. Table 1 lists the various causes
of PKU.
134
Table 1 Genetic defects and substrate deficiencies in phenylketonuria.
135
136
The frequencies at which different populations exhibit distinct polymorphisms vary
greatly. Caucasians tend to have a mutation in the splice site of intron 12 where an
adenosine is substituted for a guanosine (G→A), resulting in a truncated form of PH
that is missing the last 52 amino acids. Asians, on the other hand, do not have such
a general genotype. Based on these types of geographic localizations, it is clear
that PKU has evolved from numerous independent mutations.
137
Nonclassical Phenylketonuria
In addition to the classical forms of PKU involving mutations in the PH gene,
there are a number of examples of the disease (1-3% of the PKU cases) where the
underlying defect is in other systems. Notably, these involve mutations in the
dihydropteridine reductase (DHPR), or in the biosynthetic enzymes responsible for
biopterin synthesis (see Figure 1). For this reason, neonatal patients exhibiting
hyperphenylalaninemia must also be tested for urinary pteridines, blood DHPR, and
additional biogenic amines.
tetrahydrobiopterin
(BH4)
This last test is necessary because defects in
synthesis
or
regeneration
(from
quinonoid
dihydrobiopterin; q-BH2) will affect other key biosynthetic enzymes, including
tyrosine hydroxylase (rate-limiting enzyme in dopamine, noradrenaline and
adrenaline biosynthesis) and tryptophan hydroxylase (rate-limiting enzyme in
serotonin biosynthesis). Unfortunately, these patients are subject to a much more
severe prognosis than those with classical PKU.
Disruption of these other
neurotransmitter systems produces mental health problems and motor problems
(similar to Parkinson disease).
Infants with nonclassical PKU (pterin cosubstrate deficiencies) will require
additional therapeutic interventions.
First, they require limitations in dietary
phenylalanine to prevent the build-up of the amino acid and its phenylketone
metabolites.
However, this will further exacerbate the deficiency in the
catecholamine neurotransmitters (dopamine, noradrenaline and adrenaline).
Therefore, patients with biopterin defects are also treated with precursors to the
catecholamines that bypass the tyrosine hydroxylase step (L-dopamine; the same
139
Future Treatments for Phenylketonuria
As stated above, the current therapeutic regimen for the majority of the
patients with PKU is the dietary restriction of the amino acid, phenylalanine. This
can reduce the blood levels of phenylalanine and help prevent the severe intellectual
impairment common with this disease. Regardless of the successes with this
intervention, there are problems with this approach. Dietary restriction is often
difficult and lends itself to non-compliance. This is particularly true in those cases
where dietary phenylalanine restriction is recommended for life.
It has been
reported, for instance, that a decline in intellectual function and behavioural
performance is evident in adults with PKU who have not maintained a low
phenylalanine diet.
Dietary management is particularly important in pregnant women with
classical PKU who have previously curtailed phenylalanine restriction. Dietary noncompliance during pregnancy can produce PKU-like symptoms in their genetically
unaffected (heterozygous) offspring. This syndrome is referred to as “maternal
PKU”. In addition to the intellectual impairments of their offspring, low birth weight
and congenital heart disease are often present. To prevent this, dietary treatment
must be commenced before the pregnancy even begins, and rigidly maintained for
the duration of the pregnancy.
While dietary treatment for PKU is effective and non-hazardous, additional
developments in the field are needed in order to find a “cure” for PKU. There are
several different mechanisms that are amenable to clinical intervention.
For
example, drugs could be designed that would prevent phenylalanine absorption from
140
the gut. This would cause ingested phenylalanine to be excreted and may prevent
its damaging effects. Enzyme therapies may also be utilized. Insertion of active PH
into a “fatty” liposome carrier or administration of regular enzyme injections may
serve potential roles in the treatment of PKU.
Additional attention needs to be paid to PH, the primary enzyme in the
metabolism of phenylalanine. As stated above, PH hydroxylates phenylalanine in
the presence of the necessary substrates to form the amino acid tyrosine.
Numerous defects in the gene encoding PH lead to an inactive enzyme and the
systemic build-up of phenylalanine in the body. The recent X-ray crystallographic
analysis of PH structure has supplied valuable information regarding the structure of
the
protein.
These
data
may
assist
researchers
in
the
design
of
pharmacotherapeutic interventions to treat PKU by accelerating the metabolism of
phenylalanine to tyrosine. Further structural and functional studies, such as these,
are necessary if we hope to eradicate PKU completely.
Recently, researchers using rodent models found that use of oral enzyme
therapy, with the enzyme phenylalanine ammonia lyase (PAL), combined with a low
protein diet has the potential to replace the traditional phenylalanine-restricted
dietary regimen. PAL is an enzyme that does not require a cofactor to convert
phenylalanine to trans-cinnamic acid and insignificant amounts of ammonia. Transcinnamic acid is a harmless metabolite that is further converted to benzoic acid and
then to hippurate which is excreted in urine. In theory, patients on PAL could break
down phenylalanine such that phenylalanine ingestion could be tolerated. In rodent
models, it was found that oral administration of PAL attenuated PKU. When
141
humans were used as test subjects, similar results were observed. However, only
limited data are available from the studies because of the costs necessary to obtain
sufficient amounts of PAL. Further research must be performed before the general
population can use PAL, but these studies indicate that oral administration of PAL
appears to have great potential as a future treatment for PKU. The costs of
acquiring PAL must decrease however.
Research indicates that PKU is primarily the result of single gene
malfunctions. Therefore, a promising alternative to dietary restriction of
phenylalanine in the management of PKU is somatic gene therapy. This would
involve the insertion of a normal PH gene into a chromosomal location in the
nucleus of liver cells (hepatocytes). The normal PH would then be expressed in
place of, or in addition to, the mutated PH. Hepatocytes would be the appropriate
targets for gene therapy since PH is known to be expressed predominantly within
the liver.
In order to get the normal gene to its proper target, the deoxyribonucleic acid
(DNA) needs to be inserted into a vector or “carrier” system. To date, the use of
three different vector systems has been explored. They include recombinant
retroviral vectors, recombinant adenoviral vectors, and DNA-protein complexes.
Numerous studies have shown these gene carriers to be successful in lowering
blood phenylalanine levels. However, all have serious limitations, such as low
transduction efficiencies and the inability to integrate into non-dividing cells.
Additionally, these vectors may eventually lead to immune responses, or become
inactive, which limits long-term efficacy. All of these limitations must first be
142
overcome if genetic therapy for PKU is to become a reality.
143
Summary
Phenylketonuria (hyperphenylalaninemia) is one of the more common genetic
disorders of intermediary metabolism.
Disruption of the normal metabolic
conversion of phenylalanine to tyrosine results in increased circulating levels of
phenylalanine and its metabolic breakdown products. In the developing neonate,
these metabolic imbalances produce dramatic clinical problems including severe
intellectual impairment. In most cases, the genetic culprit in this problem is a defect
in the biosynthetic enzyme PH. In a minority of the cases, there is an alternative
problem in the biosynthesis or regeneration of a pivotal co-substrate of the PH
reaction (BH4). Luckily, if properly diagnosed soon after birth, PKU can be managed
through dietary interventions that decrease the levels of circulating phenylalanine.
Knowing the molecular biology of the disorder provides a long-term hope of “curing”
the disease through gene replacement strategies. These approaches may well
become routinely available in the future.
144
Further Reading
Bremer, H.J., Duran, D., Kamerling, J.P., Przyrembel, H., Wadman, S.K. (1981)
Clinical Chemistry and Diagnosis of Inherited Diseases. Disturbances of
Amino Acid Metabolism: Clinical Chemistry and Diagnosis. pp. 307-327.
Baltimore: Urban & Scwharzenberg. [Chapter on clinical chemistry and
diagnosis of inherited diseases.]
Eisensmith R.C. and Woo, S.L.C. (1995) Molecular Genetics of Phenylketonuria:
From Molecular Anthropology to Gene Therapy. Advances in Genetics 32,
199-271.
Hoang L., Byck S., Prevost L., Scriver C.R. (1996) PAH Mutation Analysis
Consortium Database: a database for disease-producing and other allelic
variation at the human PAH locus. Nucleic Acids Research, 24(1):127-131.
Kaufman, S. (1997) Tetrahydrobiopterin. pp. 262-322. Baltimore: John Hopkins
University Press. [Chapter on phenylketonuria and its variants.]
Nowacki P.M., Byck S., Prevost L., Scriver C.R. (1997) The PAH Mutation Analysis
Consortium Database Update 1996. Nucleic Acids Research 25(1):139-142.
Wurtman, R. and Ritter-Walker, E. (1988) Dietary Phenylalanine and Brain Function.
Boston, MA: Birkhäuser.
CURRICULUM VITA
George Chih-Thai Jiang
BORN:
June 12, 1978
Bangkok, Thailand
EDUCATION:
Wake Forest University School of Medicine
Winston-Salem, North Carolina
M.S., Molecular Genetics, 2003
Wake Forest University
Winston-Salem, North Carolina
M.B.A., 2003
University of Maryland, College Park
College Park, Maryland
B.S., General Biology, 1998
SCHOLASTIC AND PROFESSIONAL EXPERIENCE:
Howard Hughes Undergraduate Research Fellow,
Department of Microbiology and Imuunology,
University of Maryland, College Park, College Park,
MD, 1997-1998.
Advisor: Dr. Elisabeth Gantt
Research Assistant, Department of Plant Biology,
University of Maryland, College Park, College Park,
MD, 1994-1997.
Advisor: Dr. Elisabeth Gantt
Research Assistant, Department of Gastroenterology,
Walter Reed Army Institute of Research, Washington,
D.C., 1994-1995.
Advisor: Dr Yuan-Heng Tai
145
146
HONORS and AWARDS:
Dean’s Fellowship, Wake Forest University Graduate School of Arts and
Sciences, 1998-1999.
Bacock Scholarship, Wake Forest University Babcock School of
Management, 2001-2002.
2nd Place Graduate Student Poster Award, Western North Carolina
Society for Neuroscience, 2001.
PROFESSIONAL APPOINTMENTS AND ACTIVITIES:
Graduate School Activities
Volunteer, Community Public Affairs Committee,
1999-present
Representative, Graduate Student Association, 1999present
President, Graduate Student Association, 2001-2002
Member, Wake Forest University Graduate Council,
2001-2002
Graduate Teaching Experience
Laboratory Instructor – Recombinant DNA
Technologies, 1999, 2000
Course Coordinator – Drug Discovery and
Development, 2002
Ad hoc reviewer:
Journal of Biological Chemistry
Journal of Genetics and Development
Journal of Neurochemistry
Nature Structural Biology
Proceedings of the National Academy of Sciences
Structure
PROFESSIONAL MEMBERSHIPS:
Society for Neuroscience, 1999-present.
Western North Carolina Society for Neuroscience, 2000-present.
American Society for Biochemistry and Molecular Biology, 2000-present.
National Association of Graduate Professional Students, 2001-present.
147
BIBLIOGRAPHY:
JOURNAL ARTICLES:
Yohrling IV GJ, Jiang GC-T, Mockus SM, and Vrana KE (2000). Intersubunit
binding domains within tyrosine hydroxylase and tryptophan hydroxylase. J.
Neurosci. Res. 61(3): 313-320.
Jiang GC-T, Yohrling IV GJ, Schmitt JD, and Vrana KE (2000). Identification of
substrate orienting and phosphorylation sites within tryptophan hydroxylase
using homology-based molecular modeling. J. Mol. Biol. 302(4): 1005-1017.
Blanchard-Fillion B, Souza JM, Friel T, Jiang GC-T, Vrana KE, Sharov V, Barón L,
Schöneich C, Quijano C, Alvarez B, Radi R, Przedborski S, Fernando GS,
Horwitz J, and Ischiropoulos H (2001). Nitration and Inactivation of Tyrosine
Hydroxylase by Peroxynitrite. J. Biol. Chem. 276: 46017-46023.
Yohrling IV GJ, Jiang GC-T, DeJohn MM, Robertson DJ, Vrana KE, Cha JH-J
(2002). Inhibition of Tryptophan Hydroxylase Activity and Decreased 5-HT1A
Receptor Binding in a Mouse Model of Huntington’s Disease. J. Neurochem.
82:1416-1423.
Stredrick DL, Jiang GC-T, Suber L, Mockus S, Aschner M, and Vrana KE.
Manganese-Mediated Inhibition of Tyrosine Hydroxylase in CATH.a Cells.
Mol. Brain Res. (in revision).
Yohrling IV GJ, Jiang GC-T, DeJohn MM, Miller DW, Young AB, Vrana KE, Cha JHJ. Analysis of Cellular, Transgenic and Human Models of Huntington’s
Disease Reveals Tyrosine Hydroxylase Alterations in Substantia Nigra
Neuropathology. J. Neurosci. (submitted).
Jiang GC-T, Domer AC, and Vrana KE. Functional Analysis of the V177I Coding
Region Polymorphism in Human Tryptophan Hydroxylase (TPH1). (in
preparation).
BOOK CHAPTERS:
Jiang GC-T, Yohrling IV GJ, and Vrana KE. (March 2000). Phenylketonuria. In:
Encyclopedia of Life Sciences. Vol. 14, pp. 150-154. London: NatureScientific American Publishing Group. http://www.els.net (invited review).
148
Yohrling IV GJ, Jiang GC-T, and Vrana KE. (August 2000). Control of Enzymatic
Activity. In: Encyclopedia of Life Sciences. London: Nature-Scientific
American Publishing Group. http://www.els.net (invited review).
ABSTRACTS:
Yohrling IV GJ, Jiang GC-T, Mockus SM, and Vrana KE. Site-directed
mutagenesis of tryptophan hydroxylase reveals K111-E223 to be an
intersubunit dimerization bridge. Soc. Neurosci. Abst. 25: 178, 1999.
Jiang GC-T, Yohrling IV GJ, Schmitt JD, and Vrana KE. Molecular modeling of
human tryptophan hydroxylase: Implications for subunit assembly and drug
development. FASEB J. 14(8): A1453, 2000.
Yohrling IV GJ, Jiang, GC-T, Schmitt, JD, and Vrana KE. Identification of a
tryptophan orienting residue in the active site of tryptophan hydroxylase.
Soc. Neurosci. Abst. 26: 2000.
Robertson DJ, Allen JW, Freeman WM, Jiang GC-T, Walker SJ, Hyyta P, Kiianmaa
K, Sampson HH and Vrana KE. Changes in VTA gene expression following
ethanol self-administration in AA/ANA rats. RSA Abst. 2000.
Yohrling IV GJ, Jiang GC-T, Schmitt JD, and Vrana KE. Identification of a
tryptophan orienting residue in the active site of tryptophan hydroxylase. Soc.
Neurosci. Abst. 26:400, 2000.
Jiang GC-T, Freeman WM, Vrana KE, Caron MG, and Jones SR. Functional
neurogenomics and biochemical analyses of enzymatic differences in
dopamine transporter knockout mice. Soc. Neurosci. Abst. 27, 2001.
Yohrling IV GJ, Jiang GC-T, Robertson DJ, Vrana KE, and Cha J-HJ. Biochemical
Analyses of Tyrosine and Tryptophan Hydroxylase in the R6/2 Mouse Model
of Huntington’s Disease. Soc. Neurosci. Abst. 27, 2001.
Jiang GC-T, Yohrling IV GJ, Miller DW, DeJohn MM, Vrana KE, and Cha J-HJ.
Tyrosine hydroxylase activity and mRNA changes in Huntington’s disease.
Soc. Neurosci. Abst. 28, 2002.