Virology 345 (2006) 137 – 147
www.elsevier.com/locate/yviro
Parvovirus uncoating in vitro reveals a mechanism of DNA release without
capsid disassembly and striking differences in encapsidated DNA stability
Carlos Ros a,b,*, Claudia Baltzer a, Bernhard Mani a, Christoph Kempf a,b
a
Department of Chemistry and Biochemistry, University of Bern, Freiestrasse 3, 3012 Bern, Switzerland
b
ZLB Behring AG, Wankdorfstrasse 10, 3000 Bern 22, Switzerland
Received 17 June 2005; returned to author for revision 9 August 2005; accepted 8 September 2005
Available online 20 October 2005
Abstract
The uncoating mechanism of parvoviruses is unknown. Their capsid robustness and increasing experimental data would suggest an uncoating
mechanism without capsid disassembly. We have developed an in vitro system to detect and quantify viral DNA externalization and applied the
assay on two parvoviruses with important differences in capsid structure, human B19 and minute virus of mice (MVM). Upon briefly treating the
capsids to increasing temperatures, the viral genome became accessible in its full-length in a growing proportion of virions. Capsid disassembly
started at temperatures above 60 -C for B19 and 70 -C for MVM. For both viruses, the externalization followed an all-or-nothing mechanism,
without transitions exposing only a particular genomic region. However, the heat-induced DNA accessibility was remarkably more pronounced in
B19 than in MVM. This difference was also evident under conditions mimicking endosomal acidification (pH 6.5 to 5), which triggered the
externalization of B19-DNA but not of MVM-DNA. The externalized ssDNA was a suitable template for the full second-strand synthesis.
Immunoprecipitation with antibodies against conformational epitopes and quantitative PCR revealed that the DNA externalized by heat was
mostly dissociated from its capsid, however, the low pH-induced DNA externalization of B19 was predominantly capsid-associated. These results
provide new insights into parvovirus uncoating suggesting a mechanism by which the full-length viral genome is released without capsid
disassembly. The remarkable instability of the encapsidated B19 DNA, which is easily released from its capsid, would also explain the faster heat
inactivation of B19 when compared to other parvoviruses.
D 2005 Elsevier Inc. All rights reserved.
Keywords: Parvovirus; B19; MVM; Uncoating; Capsid stability; Disassembly
Introduction
Parvoviruses are nonenveloped icosahedral viruses with a
single-stranded DNA genome of approximately 5 kb. Human
parvovirus B19 and minute virus of mice (MVM) are two
distantly related members of the family Parvoviridae. B19 is a
member of the Erythrovirus genus and the only parvovirus
known to cause disease in humans, notably a mild disease
known as erythema infectiosum or fifth disease. Other more
severe syndromes associated with B19 infections are polyarthropathy, transient aplastic crisis, hydrops fetalis and persistent
anemia (Heegaard and Brown, 2002). MVM is a member of the
genus Parvovirus (Siegl et al., 1985) and is frequently used in
* Corresponding author. Department of Chemistry and Biochemistry,
University of Bern, Freiestrasse 3, 3012 Bern, Switzerland. Fax: +41 31
6314887.
E-mail address: carlos.ros@ibc.unibe.ch (C. Ros).
0042-6822/$ - see front matter D 2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.virol.2005.09.030
research as parvovirus model. MVM causes lethal infections in
newborn and immunodeficient mice (Brownstein et al., 1991).
The three-dimensional capsid structures of several parvoviruses has been determined, human B19 (Agbandje et al.,
1994; Kaufmann et al., 2004); canine parvovirus (CPV) (Tsao
et al., 1991; Xie and Chapman, 1996); feline panleukopenia
virus (FPV) (Agbandje et al., 1993); MVM (Llamas-Saiz et al.,
1997); Galleria mellonella densovirus (Simpson et al., 1998);
adeno-associated virus 2 (AAV-2) (Xie et al., 2002); AAV-4
(Padron et al., 2005); and porcine parvovirus (PPV) (Simpson
et al., 2002). While the capsid inner surface is structurally
similar among parvoviruses, the outer surface has important
differences. B19 is structurally most similar to AAV-2 and
MVM to CPV and FPV. A common feature of the icosahedral
T = 1 parvovirus capsids is that they are highly resistant to
many physicochemical agents. In the extracellular environment, this resistance provides an effective protection to the
fragile highly condensed ssDNA genome and ensures trans-
138
C. Ros et al. / Virology 345 (2006) 137 – 147
mission between hosts. However, once inside the cell, the
capsid should dissociate or modify its structure sufficiently to
allow the release of the viral genome, a process known as
uncoating. How and at which stage of the infection the robust
parvovirus capsid releases the genome for replication is not
known. It is still a matter of discussion whether parvoviruses
uncoat in endosomes, cytosol, nucleus or at various locations.
Increasing evidence suggests that parvoviruses enter the
nucleus still assembled (Bartlett et al., 2000; Hansen et al.,
2001a,b; Sanlioglu et al., 2000; Seisenberger et al., 2001; Xiao
et al., 2002). It is also unknown whether full disassembly of the
tough parvovirus capsid is required to release the viral genome
or instead the DNA is released form assembled capsids after
conformational rearrangements triggered by cellular factors.
This question has remained largely elusive, mainly due to the
difficulty to study in vivo the structural changes of the
infectious particles leading to DNA release. Not all incoming
DNA-containing particles follow the same intracellular pathway. It has been shown that a proportion of AAV incoming
particles are degraded by the proteasomes (Douar et al., 2001;
Duan et al., 2000; Yan et al., 2002) and a large proportion of
particles accumulate in a perinuclear region (Bartlett et al.,
2000). Some of the perinuclear particles are slowly transported
into the nucleus where it seems that only few are able to release
the DNA, while the rest of particles remain intact (Hauck et al.,
2004; Thomas et al., 2004). This diversity makes difficult to
discriminate the structural rearrangements of the infectious
particles leading to the release of the genome from those which
are degraded or do not uncoat.
Parvoviruses are very resistant to inactivation. It has
previously been shown that MVM and AAV capsids only
disassemble at temperatures above 70– 75 -C (Bleker et al.,
2005; Carreira et al., 2004; Kronenberg et al., 2005).
Considering the elevated energy required to disassemble the
parvovirus capsid, an alternative uncoating model would be a
mechanism of DNA release without capsid disassembly. In this
model, intracellular structural transitions of the incoming
capsid would trigger the externalization of the viral genome.
Although direct evidence of this notion is still lacking, there is
increasing evidence that support such a mechanism. The
structural arrangement of the capsid proteins of parvoviruses
as well as that of other icosahedral viruses, leaves open pores
whose functions are still not well understood. It has been
shown that the 5-fold axes pore is the site of genome
encapsidation as well as the site of N-VP1 externalization
(Bleker et al., 2005; Farr and Tattersall, 2004; Reguera et al.,
2004). The diameter of the pore is large enough to allow the
transit of macromolecules in their linear conformation. It has
been shown that exposure of MVM to mild temperatures
externalized N-VP1 and increased the accessibility of the viral
DNA to externally applied enzymes while the capsid remained
essentially intact (Cotmore et al., 1999). Similarly, AAV
capsids treated at 65 -C maintained their structural integrity
but a proportion of virions became empty (Bleker et al., 2005).
The function of open pores as channels for macromolecule
traffic has been described for several icosahedral viruses. A 4%
expansion of the picornavirus capsid and an iris-type move-
ment of VP1 open a channel on the fivefold axis through which
the RNA genome is released. (Belnap et al., 2000; Hewat et al.,
2002; Hewat and Blaas, 2004; Smyth and Martin, 2002).
Conformational changes in the reoviruses capsids open pores to
allow the diffusion of substrates for transcription and exit of
newly synthesized mRNA segments (Reinisch et al., 2000; Xia
et al., 2003; Zhou et al., 2003).
The aim of this study was to gain new insights into the
uncoating process of parvoviruses and particularly define the
conditions that are required to release the viral genome and
their implications on the capsid integrity. We have examined
and compared two distantly related parvoviruses with important structural differences, human B19 and MVM. The results
showed that upon briefly heating the capsids, both parvovirus
released their genomes without capsid disassembly and without
transitions exposing partially a genomic region. Genome
release was more manifest in B19 than in MVM. The released
ss-DNA was a suitable template for the full-length secondstrand synthesis. Interestingly, exposure of B19 capsids to mild
acidification conditions, similar to those of the endocytic
pathway, was enough to trigger the externalization of the viral
DNA, which remained mostly capsid-associated, however, low
pH had no effect on the encapsidated MVM DNA.
Results
Detection of parvovirus ss-DNA externalization
By using the hybridization/extension assay developed in the
present studies (outlined in Fig. 1), it was possible to detect and
quantify parvovirus ssDNA sequences that become exposed
outside of the capsid shell. Since the reaction is performed in
PBS at 37 -C, the integrity of the viral particle is ensured. The
difference in T m between the short region of the probe specific
for the viral DNA (low T m) and its long unrelated 5V tail (high
T m) allowed a subsequent quantification of the extended DNA
molecule by PCR without interference of the viral DNA. By
simply changing the sequence of the 3V viral specific region of
Fig. 1. Hybridization/extension assay for the detection and quantification of
virus ss-DNA externalization. Viral particles are briefly exposed to heat or low
pH. A probe with a 3V virus-specific sequence and 5V virus-unrelated tail is
hybridized to the exposed ss-DNA. The hybridized probe is extended by a
polymerase. The probe-extended DNA is detected and quantified by real-time
PCR. The forward primer hybridizing the virus-unrelated sequence of the
probe-extended DNA and the reverse primer hybridizing a downstream viral
sequence.
C. Ros et al. / Virology 345 (2006) 137 – 147
139
the probe it was possible to study the exposure of any region of
the viral genome. While the hybridization of the probe
demonstrates the accessibility of a particular sequence stretch,
the subsequent extension reaction allows determining the
accessibility and integrity of the DNA sequences downstream
the probe target sequence.
Comparison of the capsid disassembly kinetics of B19 and
MVM
The integrity of B19 and MVM capsids following heat
treatment was analyzed by immunoprecipitation with MAb
860-55 and MAb D10, respectively. Both antibodies only
recognize conformational epitopes (Cotmore et al., 1999;
Gigler et al., 1999) and do not react with denatured proteins.
Heat-treated B19 particles retained their integrity up to 60 -C.
A small proportion of capsids were still assembled at 70 -C
(Fig. 2A). Heat-induced capsid disintegration of MVM has
previously been shown to occur at temperatures above 70 -C
(Carreira et al., 2004; Cotmore et al., 1999). Under our
experimental conditions, MVM capsid integrity is retained
similarly up to 70 -C (Figs. 2A and 4B).
Quantitative determination of B19 and MVM 3V genome
externalization at increasing temperatures
Both, B19 and MVM progressively exposed the 3V region of
the DNA at increasing temperatures. However, the degree of
DNA externalization in response to temperature treatment was
remarkably different for both viruses. At 40 -C, the externalization of B19-DNA was already evident (5%), while that of
MVM was only 0.15%. At 55 -C, the amount of accessible B19
and MVM DNA was approximately 75% and 10% of the total,
respectively. An accessibility of 50% was only achieved in
MVM at temperatures above 70 -C. Interestingly, B19 capsids
remained intact at 60 -C but nearly 90% of them exposed the
genome. The specificity of the quantitative PCR was confirmed
by a melting curve analysis (data not shown) and by agarose gel
electrophoresis (Fig. 2C). No amplification product was detected
in the samples where incubation with the polymerase was
immediately stopped after addition of the enzyme (Figs. 2B and
C). The amount of ‘‘contaminant’’ accessible DNA was near to
10% of the total for B19 and less than 1% for MVM untreated
stocks. These amounts were substantially reduced by preclearing the samples with silica magnetic particles (Novagen).
Nevertheless, the presence of non-encapsidated viral DNA did
not interfere with the evaluation of viral DNA externalization
since the expressed values represented always the intensification
of the signal over the background at 37 -C.
The heat-treated B19 and MVM virions expose the DNA in its
full-length without detectable transitions
It was of interest to analyze whether the observed
externalization involves other regions of the viral genome
apart from the 3V terminus. To study this question, we applied
three probes covering the 3V, central and 5V regions of the B19
Fig. 2. (A) Structural integrity of heat-treated B19 and MVM capsids. Viruses
were treated at increasing temperatures for 3 min (85 -C; 10 min). After
temperature treatment, the capsids that remained assembled were immunoprecipitated by an antibody against a conformational epitope (B19; MAb 860-55 and
MVM; D10). (B) Quantitative determination of B19 and MVM 3V genome
externalization at increasing temperatures by real-time PCR. The concentration
of MVM and B19 viruses was adjusted to 3 106 DNA-containing particles per
microliter in PBS. Viral suspensions were heat-treated for 3 min (85 -C; 10 min).
Subsequently, the presence of externalized DNA was examined by the
hybridization/extension assay (as described in Materials and methods). The
sample 37 -C and 85 -C were considered as 0 and 100% externalization,
respectively. All samples were incubated with the polymerase for 10 min except
for the 85 -C negative control that was incubated for few seconds. (C) B19 and
MVM 3V genome externalization at increasing temperatures analyzed by standard
PCR and agarose gel electrophoresis to examine the specificity of the PCR.
and MVM genomes (Fig. 3A). All the probes proved specific
for their respective genomic regions when applied on viral
suspensions treated at 85 -C for 10 min (Fig. 3B). When the
probes were applied to detect DNA externalization at increas-
140
C. Ros et al. / Virology 345 (2006) 137 – 147
competent, the 3V probe was incubated with the polymerase for
a longer time (45 min) to allow, if accessible and intact, the full
synthesis of the second strand. As shown in Fig. 3D, the fulllength second strand was achieved. No amplification product
was detected where incubation of capsids with sequenase was
immediately stopped after addition of the enzyme.
Fig. 3. The heat-treated B19 and MVM virions expose the DNA in its fulllength without detectable transitions. (A) Genomic map of B19 and MVM
showing the regions covered by the 3V, central and 5V hybridization/extension
assays. (B) Specificity of the different hybridization/extension assays tested by
PCR and agarose gel electrophoresis on viral suspensions treated at 85 -C for
10 min. (C) Quantitative comparison of 3V, central and 5V genome
externalization by real-time PCR at increasing temperatures from assembled
B19 and MVM capsids. (D) Full-length DNA second-strand synthesis.
Subsequent to the temperature treatment, the externalization of the intact fulllength genome was examined by the 3V hybridization/extension assay with a
longer extension time (45 min) and subsequent detection with a reverse primer
from the 5V region of the genome. As negative control, capsids were treated at
60 -C for 3 min and incubated with the polymerase for only few seconds. Pol.,
polymerase. C, central region. Size marker, 1-kb ladder.
ing temperatures, the results obtained were practically identical, indicating that the three regions are similarly and
simultaneously exposed in response to heat treatment (Fig.
3C). Transitions exposing only partially a particular region of
the genome were not observed in any of the two viruses. To
further confirm that the externalization involves the whole ssDNA and that the exposed genome is intact and replication-
Fig. 4. B19 and MVM release the DNA before capsid disassembly. Following
heat treatment (3 min), the B19 and MVM capsids were immunoprecipitated
with the antibodies 860-55 and D10, respectively. The amounts of viral proteins
and viral DNA present in the immunoprecipitated and supernatant fractions
were analyzed by SDS – 10% PAGE and real-time PCR, respectively. (A) B19
DNA-capsid dissociation at increasing temperatures. (B) MVM DNA-capsid
dissociation at increasing temperatures. (C) MVM DNA-capsid dissociation at
increasing temperatures (longer temperature incubation time, 20 min). IP,
immunoprecipitated. SN, supernatant.
C. Ros et al. / Virology 345 (2006) 137 – 147
Human B19 and MVM release their genome before capsid
disassembly
We next examined the connection of the fully exposed
MVM genome with its capsid. Following heat treatment, B19
and MVM virions were immunoprecipitated with the antibodies 860-55 and D10, respectively, as indicated above. The
amount of capsids and viral DNA present in the immunoprecipitated and supernatant fractions was analyzed by SDSPAGE and quantitative PCR, respectively. The results showed
that heat treatment triggers the externalization of the genome,
which before particle disassembly became mostly dissociated
from the capsid. As shown in Fig. 4, the amount of B19 and
MVM DNA immunoprecipitated with the capsids progressively decreased with rising temperatures while increased in the
supernatant. Since the amount of exposed MVM DNA was
considerably less than that of B19, a longer incubation time of
20 min was performed for MVM. The longer incubation time
did not have effect on the capsid integrity, however, the amount
of released viral DNA increased significantly (Fig. 4C). Thus,
before capsid disintegration, the B19 and MVM genome is
ejected leaving an empty but still assembled particle.
Endosomal/lysosomal acidification alone is sufficient to trigger
viral DNA externalization in B19 but not in MVM virions
Parvoviruses enter the cell through receptor-mediated
endocytosis. The low pH-dependent conformational changes
that occur within endosomal compartments are required for the
141
internalization, uncoating, and trafficking of many viruses. We
have previously shown that MVM entry involves a low pHdependent entry pathway (Ros et al., 2002). Similar requirement has been observed for CPV and AAV (Bartlett et al.,
2000; Parker and Parrish, 2000; Vihinen-Ranta et al., 1998).
Therefore, it was of interest to examine the effect of low pH in
DNA release. We have observed that exposure of B19 capsids
to acidification conditions (pH 6.5 to 5) similar to those of
endosomes/lysosomes destabilized the capsids and the genome
became exposed (Figs. 5A and B), but the integrity of the
capsids was maintained (Fig. 5C). Interestingly and in clear
contrast with the DNA externalized by heat, which was mostly
dissociated from its capsid, the low pH-induced DNA
externalization of B19 was predominantly capsid-associated
(Fig. 5D). Under low pH conditions, the DNA of MVM
remained stably encapsidated and only if the capsids were
heated the DNA became exposed (Figs. 6A and B). Additionally, exposure to low pH did not change the heat-induced DNA
externalization pattern in MVM (Fig. 6C). These results clearly
indicate that the exposure of B19 capsids to a low pH similar to
that of endosomes/lysosomes is sufficient to trigger the
uncoating of the virus.
N-VP2 cleavage and MVM DNA externalization
The cleavage of the N-terminal of VP2 occurs during the
entry process of MVM. It has been recently shown that the NVP2 plays a role in the export of ‘‘de novo’’ particles out of the
nucleus (Maroto et al., 2004). However, it is not known
Fig. 5. Acidification triggers the genome externalization of B19. (A) Externalization of B19 3V DNA at pH 5. (B) Externalization of B19 3V DNA under various pH
conditions. (C) Structural integrity of low pH-treated B19 capsids. After pH treatment, the assembled capsids were immunoprecipitated by an antibody against a
conformational epitope of B19 (MAb 860-55). (D) B19 DNA externalized by low pH treatment remained capsid-associated. Following low pH treatment and reneutralization, B19 capsids were treated at 37 -C or 85 -C and immunoprecipitated with MAb 860-55. The amount of B19 DNA in the immunoprecipitated and
supernatant fractions was determined by real-time PCR. IP, immunoprecipitated. SN, supernatant.
142
C. Ros et al. / Virology 345 (2006) 137 – 147
that helps maintain their structural integrity facilitating the
transmission between hosts, and an intracellular flexibility to
allow delivery of the viral DNA for replication. How
parvoviruses integrate stability and flexibility is not well
understood. Certain viruses deliver their genomes after an
extensive and complex disassembly (Whittaker et al., 2000).
Other viruses, like picornavirus, deliver their viral nucleic acid
through the fivefold axis without capsid disassembly (Smyth
and Martin, 2002). The upper limit in particle diameter for
transport through the nuclear pore complex (NPC) is 39 nm
(Pante and Kann, 2002). Therefore, having a diameter of 18–
25 nm, parvoviruses can potentially pass through the nuclear
pore in intact form. Increasing evidence support that parvovirus
particles enter the nucleus still assembled (Bartlett et al., 2000;
Sanlioglu et al., 2000; Seisenberger et al., 2001; Xiao et al.,
2002), and it has been suggested to occur independently of the
NPC (Hansen et al., 2001a, 2001b). Considering these
observations, parvovirus uncoating would have to take place
inside the nucleus. Another possibility is that a proportion of
the intact parvovirus particles entering into the nucleus have
the ss-DNA already accessible to the replication machinery.
Despite the detection of incoming assembled virions inside the
nucleus, disassembly of the infectious capsids has not been
observed so far. This could be due to a very limited rate of
nuclear translocation and/or uncoating, as it has been observed
for AAV (Hauck et al., 2004; Thomas et al., 2004; Zhong et al.,
2004) or to the possibility that the disassembly pathway does
not exist and instead the genome becomes accessible after
specific conformational rearrangements triggered by one or
various cellular factors, like receptor binding, the low
endosomal pH or interactions with the NPC.
We have attempted to shed light on this process and mimic
aspects of the uncoating mechanism by exposure of virions to
an external energy source like heat or low pH. Such treatments
have been widely used because they can trigger conformational
transitions, which are similar, if not identical, to those induced
by cellular factors (Brabec et al., 2003; Chow et al., 1997;
Giranda et al., 1992; Hoover-Litty and Greve, 1993; Meyer et
Fig. 6. Acidification has no effect on the encapsidated MVM DNA. (A)
Externalization of MVM 3V DNA at pH 5. (B) Externalization of MVM 3V DNA
at pH 5 measured by the DNase I assay (as described in Materials and methods).
(C) Influence of pH 4.5 on the kinetics of MVM DNA externalization.
whether the cleavage is also part of the uncoating program of
MVM. We hypothesized that cleavage of VP2 to VP3 might
render the particle more flexible and facilitate the extrusion of
the DNA. To examine this hypothesis, we compared the
capacity of native and pre-cleaved particles to expose the
genome under the same thermal conditions. The results showed
that the cleavage of the N-terminal of VP2 facilitated only
moderately the externalization of the viral DNA (Fig. 7).
Discussion
Parvovirus capsids have developed structural solutions to
integrate two opposite features, a high extracellular resistance
Fig. 7. Influence of VP2 to VP3 cleavage on MVM DNA externalization.
MVM capsids with undetectable levels of VP3 were incubated with achymotrypsin. The presence of VP3 in the cleaved and uncleaved capsids was
analyzed by SDS – 10% PAGE. Lane 1, chymotrypsin and chymostatin were
added at the same time and incubated for 1 h at 30 -C. Lane 2, chymotrypsin
was added and after 1 h at 30 -C, the reaction was stopped by adding
chymostatin. The effect of the cleavage on the kinetics of MVM DNA
externalization was examined with a probe for the 3V region of the MVM
genome as specified in Materials and methods.
C. Ros et al. / Virology 345 (2006) 137 – 147
al., 1992). The final goal was to define the conditions required
to release the parvovirus replication-competent genomes and
the implications of those conditions on the capsid integrity. A
similar approach to study conformational transitions in MVM
showed that brief exposure of MVM to heat triggered the
externalization of N-VP1 and increased the accessibility of the
viral genome to externally applied enzymes (Cotmore et al.,
1999). Similarly, the N-VP1 of CPV and AAV can be
externalized by heat (Kronenberg et al., 2005; Vihinen-Ranta
et al., 2002). These conformational transitions occurred without
capsid disassembly.
Our approach consisted in the exposure of capsids to heat
and low pH and the subsequent application of a hybridization/
extension assay to detect and quantify DNA sequences that
became exposed outside of the virion. This method could be
applied to study the uncoating of any single-stranded DNA
virus, after minor modifications. We used MAbs against
conformational epitopes to monitor the capsid integrity. Two
distantly related parvoviruses were examined, MVM and B19,
which have been classified into different groups according to
their structure (Padron et al., 2005). The results showed that
upon briefly exposing the capsids to increasing temperatures,
the viral genome became accessible in its full length in a
growing proportion of virions without capsid disassembly
(Figs. 2 and 3). The viral DNA externalization followed an allor-nothing mechanism, without transitions exposing a partial
genomic region (Fig. 3). The encapsidated B19 DNA was very
instable and the energy required to release the viral genome
from its capsid was much lower than that required for MVM.
Compared with viruses in general, B19 is very resistant to
inactivation, but still it is much faster inactivated that the
majority of parvoviruses (Boschetti et al., 2004; Yunoki et al.,
2003). In line with these observations, we showed that capsid
disintegration of B19 occurred at lower temperatures than
MVM (Fig. 2A). Interestingly, heating B19 capsids to 60 -C
for few min has been shown to efficiently reduce the infectivity
of the virus (Yunoki et al., 2003). At this temperature, the
capsid integrity of B19 was maintained (Fig. 2A), but nearly
90% of the viral DNA was released (Fig. 2B), leaving most of
the virions empty (Fig. 4A). These results emphasize that the
stability of the parvovirus particle and the stability of the viral
DNA in its encapsidated form are strictly different.
Parvoviruses enter the cell via receptor-mediated endocytosis and inside the endosomal vesicles the virus particles
encounter a low pH environment, which is required for
infection (Bartlett et al., 2000; Basak and Turner, 1992;
Hansen et al., 2001a, 2001b; Parker and Parrish, 2000; Ros et
al., 2002). However, the exact role of the low endosomal pH
is still not clear. For many viruses, the low endosomal pH
triggers structural rearrangements essential for penetration and
uncoating (Helenius et al., 1980; Marsh and Helenius, 1989;
Martin and Helenius, 1991). Uncoating of the minor-group
human rhinovirus is triggered by the low pH of the late
endosome (Prchla et al., 1994). Viral particles found in
purified endosomes of infected cells were mostly empty. It
was therefore of interest to study the influence of low
endosomal pH conditions on parvovirus DNA externalization
143
and capsid integrity. The results showed, that mild acidification destabilized B19 capsids, triggering the externalization of
the viral DNA (Figs. 5A and B) without affecting the capsid
integrity (Fig. 5C). In sharp contrast, acidification alone did
not destabilize the MVM capsid and the viral DNA remained
firmly encapsidated (Fig. 6). Among the structure differences
between B19 and MVM that could explain this striking
difference is the topographical disposition of the N-terminal
of VP1. In many parvoviruses, N-VP1 has a large number of
basic amino acids, and its internal disposition would partially
neutralize the negative charge of the viral DNA contributing
to the stabilization of the encapsidated genome (Tsao et al.,
1991). In MVM, N-VP1 is internal and becomes externalized
during the infection (Ros and Kempf, 2004; Vihinen-Ranta et
al., 2002), however, N-VP1 of B19 is already exposed on the
surface of the virion after assembly (Rosenfeld et al., 1992).
Moreover, increasing experimental evidence would suggest
that the same conformational change leading to N-VP1
externalization would also lead to DNA externalization
(Bleker et al., 2005; Cotmore et al., 1999). Sustaining this
notion is the observation that under mild acidification
conditions, MVM neither externalizes N-VP1 (Cotmore et
al., 1999), nor the viral DNA (present results). N-VP1 plays a
central role in parvovirus biology. It harbors NLS motifs
required for nuclear transport (Lombardo et al., 2002;
Vihinen-Ranta et al., 2002) and phospholipase A2 (PLA2)
motif required for endosomal escape (Canaan et al., 2004;
Dorsch et al., 2002; Girod et al., 2002; Zadori et al., 2001).
For this reason, N-VP1 has to be externalized during the
cytoplasmic trafficking and blocking the externalization also
blocks the infection. A direct link between endosomal
acidification and N-VP1 externalization has so far not been
found. Treatment of cells with lysosomotropic drugs did not
prevent the externalization of CPV N-VP1 and infection with
heat-treated viruses with exposed N-VP1 was still sensitive to
lysosomotropic drugs, suggesting that there might be some
other low-pH dependent factors, which are required for the
infection (Suikkanen et al., 2003). The low pH-induced B19
DNA externalization has an important particularity in that the
DNA is not released but instead remains associated to the
capsid (Fig. 5D). This result would suggest an uncoating
mechanism in vivo by which the low endosomal pH alone is
enough to trigger the externalization of the B19 DNA, while
MVM-DNA would need additional capsid rearrangements
(possibly N-VP1 externalization).
Another intracellularly modulated capsid rearrangement of
MVM is the cleavage of the N-terminal of VP2. Different to
MVM, the VP2 of B19 is not cleaved. It has been recently
shown that the N-VP2 of MVM is required for nuclear export
of the newly assembled capsids (Maroto et al., 2004). The
cleavage can be achieved in vitro by trypsin or chymotrypsin.
Since the proteolytic processing of many viruses is part of their
uncoating program, it was of interest to study the cleavage of
VP2 in the context of MVM uncoating. The results showed that
the in vitro cleavage facilitated only moderately the externalization of the viral DNA and therefore its role as part of the
uncoating program is not conclusive (Fig. 7).
144
C. Ros et al. / Virology 345 (2006) 137 – 147
Our results on the in vitro uncoating of two distantly related
parvoviruses support an uncoating mechanism in vivo by
which the parvovirus genome is exposed to the replication
machinery of the cell after conformational rearrangements
which do not involve capsid disassembly. This study shows
similarities to previous observations on picornavirus uncoating
in which the viral genome is hypothesized to exit via the
fivefold axis channel without the requirement to disassemble
the capsid (Smyth and Martin, 2002). Understanding the
conditions required for the conformational rearrangements
leading to the release of the viral genome would help to
understand the underlying mechanism of the uncoating
process. It would also assist the design of novel strategies for
B19 inactivation in the context of blood product safety or
increase the efficiency of parvovirus uncoating in the context
of gene therapy.
suspensions were mixed with nucleic acid-binding magnetic
silica particles (Novagen, Merck, Darmstadt, Germany) to
minimize the amount of non-encapsidated viral DNA.
Subsequently, 50 Al viral suspensions were heat-treated in
thin-walled tubes for 3 min in a pre-heated thermoblock. A
probe was used to monitor the temperature of the suspension.
After temperature treatment, the samples were rapidly cooled
on ice and immediately used for subsequent reactions. When
total particle disintegration was intended, the 50-Al viral
suspensions were treated at 85 -C for 10 min. For pH
treatments, the viral suspension (3 108 DNA-containing
particles per microliter) was acidified by adding HCl and the
pH was monitored. After the treatment, the pH of the viral
suspension was neutralized by dilution (1:100) in PBS (for
the hybridization/extension assay) or Tris – HCl (for the
DNase I assay).
Materials and methods
Hybridization/extension and DNase I assays
Cells and viruses
Subsequent to the temperature or pH treatments, the
presence of externalized DNA was examined by a hybridization reaction with a probe consisting of a 3V virus-specific 16
nucleotides (specific for a sequence stretch of the 3V, central or
5V regions) and a 5V virus-unrelated 21 to 23 nucleotides tail
(Table 1, Fig. 1). The hybridization reaction was performed in
10 Al volumes containing 7 Al viral suspension, 2 Al 5 hybridization buffer (40 mM Tris – HCl, pH 7.5, 20 mM MgCl2
and 50 mM NaCl) and 1 Al probe (0.5 pmol), at 37 -C for 10
min. The hybridized probe was extended by adding 1 Al DTT
(100 mM), 1 Al dNTPs (200 AM each) and 2 Al of sequenase
(3.25 U; USB, Cleveland, OH) and incubated at 37 -C for 10
min (partial extension), 45 min (full-length genome extension)
or few seconds (negative control). The reaction was stopped
and DNA was purified by using the QIAquick PCR purification
kit (Qiagen, Valencia, CA). The probe-extended DNA was
quantified by real-time PCR, as specified bellow. Additionally,
Mouse A9 fibroblast cells were propagated in Dulbecco
modified Eagle’s medium (DMEM) supplemented with 10%
of heat inactivated fetal bovine serum. Stocks of MVM were
propagated on A9 cell monolayers, purified and concentrated
by ultracentrifugation through 20% sucrose. Human B19 was
concentrated from infected serum by ultracentrifugation
through 20% sucrose. The MVM and B19 titers were
determined by quantitative PCR, as DNA containing particles
per microliter.
Exposure of viral particles to heat and low pH
The concentration of MVM and B19 viruses was adjusted
to 3 106 DNA-containing particles per microliter in PBS by
using quantitative PCR. Prior to any treatment, the viral
Table 1
List of probes and primers used for hybridization/extension assay and PCR
Probes
Region
5V-virus unrelated sequence
3V-virus specific sequence
Length (nt)
B19
3V
central
5V
3V
central
5V
CGATCCGACTCACACCTGGACC. . .
GCTGAGTGCCAACGGTGACAA. . .
CCTCGCAGCGTACCGTTAGCA. . .
GGGGATGCGGGGAGTGTACGGGC. . .
CCGACGGACGCTGGACACCTG. . .
CGCCCAGACATCATAGCAGTAGC. . .
CCGCCTTATGCAAATG
GGGAAAGTGATGATGA
CCGTGGGAATTATGAC
GATAAGCGGTTCAGGG
GCTACTGACTCTGAAC
CCAAACGGAGCCACA
38
37
37
39
37
38
Primers
Target
Sequence (forward)
Sequence (reverse)
Size (bp)
B19
Extended 3V probe
Extended central probe
Extended 5V probe
Extended 3V probe (FL)
B19 DNA
Extended 3V probe
Extended central probe
Extended 5V probe
Extended 3V probe (FL)
MVM DNA
CGATCCGACTCACACCTGGACC
GCTGAGTGCCAACGGTGACAA
CCTCGCAGCGTACCGTTAGCA
CGATCCGACTCACACCTGGACC
TGGGGCAGCATGTGTTAAA
GGGGATGCGGGGAGTGTACGGGC
CCGACGGACGCTGGACACCTG
CGCCCAGACATCATAGCAGTAGC
CGGGGAGTGTACGGGCGATA
GACGCACAGAAAGAGAGTAACCAA
CCCCGGTAAGGTCAAGCTTAGAAGC
TGCCAGGCCCAACATAGTTAGTACC
GCGCAACAACATAATTTTTTAACC
GCGCAACAACATAATTTTTTAACC
CACAGGTACTCCAGGCACAG
CCAACCATCTGATCCAGTAAACAT
AGCCAAACTCCCCAAGCATTAGCATCC
CCACCCTTCCACCCTTTTATTCA
CAGTTGGTTCACTGAATAGACAGTAGT
CCAACCATCTGCTCCAGTAAACAT
418
399
482
4,834
314
640
527
540
4,840
502
MVM
MVM
FL (full-length); bp (base pairs); nt (nucleotides).
C. Ros et al. / Virology 345 (2006) 137 – 147
the presence of accessible DNA was analyzed by treatments of
the viral suspension with DNase I (10 U; Amersham
Biosciences) for 1 h at 37 -C in a buffer containing 40 mM
Tris –HCl, pH 7.9, 10 mM NaCl, 6 mM MgCl2 and 1 mM
CaCl2. The reaction was stopped and the viral DNA was
purified by using the DNeasy tissue kit (Qiagen).
145
MVM capsids were immunoprecipitated with the antibodies
860-55 and D10, respectively as indicated above. The amount
of viral capsids and viral DNA present in the immunoprecipitated and supernatant fractions was analyzed by SDS-PAGE
and quantitative PCR, respectively.
In vitro cleavage of MVM capsids
Quantitative PCR
Amplification and real-time detection of PCR products were
performed on the DNA samples generated by the hybridization/
extension and DNase I assays using the Lightcycler system
(Roche Diagnostics, Rotkreuz, Switzerland) with SYBR Green
(Roche). PCR was carried out using the FastStart DNA SYBR
Green kit (Roche) following the manufacturer’s instructions.
For detection and quantification of the probe-extended DNA
generated from the hybridization/extension reaction, a primer
specific for the 5V virus-unrelated tail of the probe and a
downstream virus-specific primer were used (Fig. 1). The
melting temperature (T m) of the PCR primers was much higher
than that of the 3V viral-specific region of the probe, allowing
an annealing temperature during PCR sufficiently high to avoid
re-annealing of the probe. In addition, most of the remaining
free probe was removed before the PCR by the QIAquick PCR
purification kit (Qiagen). For amplification of the viral DNA
prepared from the DNase I assay, two virus-specific primers
were employed. All probes and primers used are shown in
Table 1.
Determination of B19 and MVM capsid integrity
The structural integrity of the B19 and MVM capsids was
examined after heat and low pH exposure. The particles were
immunoprecipitated by an antibody against assembled capsids.
Human anti-B19 capsids (MAb 860 – 55; against a conformational epitope of B19) was kindly provided by S. Modrow
(Gigler et al., 1999) and rabbit anti-MVM capsids (MAb D10;
recognizing only intact capsids) was kindly provided by P.
Tattersall (Cotmore et al., 1999). After overnight incubation at
4 -C in the presence of 20 Al of protein G PLUS-agarose (Santa
Cruz Biotechnology, Santa Cruz, CA), the supernatant was
carefully removed and the beads were washed five times with 1
ml of ice-cold PBS. Proteins present in the supernatant and the
beads were resolved by sodium dodecyl sulfate (SDS) –10%
polyacrylamide gel electrophoresis (PAGE). After transfer to a
PVDF membrane, the blot was probed with a mouse anti-B19
VPs antibody (1:500; US biologicals, Swampscott, MA) and a
rabbit anti-MVM VPs antibody (1:2,000; kindly provided by
J. M. Almendral), followed by a horseradish peroxidase-conjugated secondary antibody (1:20,000 dilution). The viral
structural proteins were visualized with a chemiluminescence
system (Pierce, Rockford, IL).
Determination of the viral DNA/capsid association
In order to know whether the exposed viral DNA is still
associated to the capsid or otherwise dissociated, the B19 and
MVM capsids with undetectable levels of VP3 were
incubated with a-chymotrypsin (250 Ag/ml; Sigma, St. Louis,
Miss.) for 1 h at 30 -C. The protease reaction was stopped by the
addition of chymostatin (100 AM; Sigma). A mixture of achymotrypsin and chymostatin was added to the uncleaved
control. The presence of VP3 in the cleaved and uncleaved
capsids was analyzed by SDS-PAGE. The effect of the cleavage
on the DNA externalization was examined with a probe for the
3V region of the MVM genome as specified above.
Acknowledgments
The authors thank P. Tattersall and S. Modrow for kindly
providing the antibody D10 and the antibody 860-55,
respectively. Thanks are due to J. M. Almendral for kindly
providing the antibody against denatured MVM proteins.
References
Agbandje, M., McKenna, R., Rossmann, M.G., Strassheim, M.L., Parrish,
C.R., 1993. Structure determination of feline panleukopenia virus empty
particles. Proteins 16, 155 – 171.
Agbandje, M., Kajigaya, S., McKenna, R., Young, N.S., Rossmann, M.G.,
1994. The structure of human parvovirus B19 at 8 A resolution. Virology
203, 106 – 115.
Bartlett, J.S., Wilcher, R., Samulski, R.J., 2000. Infectious entry pathway of
adeno-associated virus and adeno-associated virus vectors. J. Virol. 74,
2777 – 2785.
Basak, S., Turner, H., 1992. Infectious entry pathway for canine parvovirus.
Virology 186, 368 – 376.
Belnap, D.M., Filman, D.J., Trus, B.L., Cheng, N., Booy, F.P., Conway, J.F.,
Curry, S., Hiremath, C.N., Tsang, S.K., Steven, A.C., Hogle, J.M., 2000.
Molecular tectonic model of virus structural transitions: the putative cell
entry states of poliovirus. J. Virol. 74, 1342 – 1354.
Bleker, S., Sonntag, F., Kleinschmidt, J.A., 2005. Mutational analysis of narrow
pores at the fivefold symmetry axes of adeno-associated virus type 2
capsids reveals a dual role in genome packaging and activation of
phospholipase A2 activity. J. Virol. 79, 2528 – 2540.
Boschetti, N., Niederhauser, I., Kempf, C., Stühler, A., Löwer, J., Blümel, J.,
2004. Different susceptibility of B19 virus and mice minute virus to low pH
treatment. Transfusion 44, 1079 – 1086.
Brabec, M., Baravalle, G., Blaas, D., Fuchs, R., 2003. Conformational changes,
plasma membrane penetration, and infection by human rhinovirus type 2:
role of receptors and low pH. J. Virol. 77, 5370 – 5377.
Brownstein, D.G., Smith, A.L., Jacoby, R.O., Johnson, E.A., Hansen, G.,
Tattersall, P., 1991. Pathogenesis of infection with a virulent allotropic
variant of minute virus of mice and regulation by host genotype. Lab.
Invest. 65, 357 – 363.
Canaan, S., Zadori, Z., Ghomashchi, F., Bollinger, J., Sadilek, M., Moreau,
M.E., Tijssen, P., Gelb, M.H., 2004. Interfacial enzymology of parvovirus
phospholipases A2. J. Biol. Chem. 279, 14502 – 14508.
Carreira, A., Menendez, M., Reguera, J., Almendral, J.M., Mateu, M.G.,
2004. In vitro disassembly of a parvovirus capsid and effect on capsid
stability of heterologous peptide insertions in surface loops. J. Biol.
Chem. 279, 6517 – 6525.
146
C. Ros et al. / Virology 345 (2006) 137 – 147
Chow, M., Basavappa, R., Hogle, J.M., 1997. In: Chiu, W., Garcea, R.,
Burnette, R. (Eds.), Structural Biology of Viruses. Oxford Univ. Press,
Oxford, pp. 157 – 186.
Cotmore, S.F., D’abramo Jr., A.M., Ticknor, C.M., Tattersall, P., 1999.
Controlled conformational transitions in the MVM virion expose the VP1
N-terminus and viral genome without particle disassembly. Virology 254,
169 – 181.
Dorsch, S., Liebisch, G., Kaufmann, B., von Landenberg, P., Hoffmann, J.H.,
Drobnik, W., Modrow, S., 2002. The VP1 unique region of parvovirus B19
and its constituent phospholipase A2-like activity. J. Virol. 76, 2014 – 2018.
Douar, A.M., Poulard, K., Stockholm, D., Danos, O., 2001. Intracellular
trafficking of adeno-associated virus vectors: routing to the late endosomal
compartment and proteasome degradation. J. Virol. 75, 1824 – 1833.
Duan, D., Yue, Y., Yan, Z., Yang, J., Engelhardt, J.F., 2000. Endosomal
processing limits gene transfer to polarized airway epithelia by adenoassociated virus. J. Clin. Invest. 105, 1573 – 1587.
Farr, G.A., Tattersall, P., 2004. A conserved leucine that constricts the pore
through the capsid fivefold cylinder plays a central role in parvoviral
infection. Virology 323, 243 – 256.
Gigler, A., Dorsch, S., Hemauer, A., Williams, C., Kim, S., Young, N.S., ZollaPazner, S., Wolf, H., Gorny, M.K., Modrow, S., 1999. Generation of
neutralizing human monoclonal antibodies against parvovirus B19 proteins.
J. Virol. 73, 1974 – 1979.
Giranda, V.L., Heinz, B.A., Oliveira, M.A., Minor, I., Kim, K.H., Kolatkar,
P.R., Rossmann, M.G., Rueckert, R.R., 1992. Acid-induced structural
changes in human rhinovirus 14: possible role in uncoating. Proc. Natl.
Acad. Sci. U.S.A. 89, 10213 – 10217.
Girod, A., Wobus, C.E., Zadori, Z., Ried, M., Leike, K., Tijssen, P.,
Kleinschmidt, J.A., Hallek, M., 2002. The VP1 capsid protein of adenoassociated virus type 2 is carrying a phospholipase A2 domain required for
virus infectivity. J. Gen. Virol. 83, 973 – 978.
Hansen, J., Qing, K., Srivastava, A., 2001. Adeno-associated virus type
2-mediated gene transfer: altered endocytic processing enhances transduction efficiency in murine fibroblasts. J. Virol. 75, 4080 – 4090.
Hansen, J., Qing, K., Srivastava, A., 2001. Infection of purified nuclei by
adeno-associated virus 2. Mol. Ther. 4, 289 – 296.
Hauck, B., Zhao, W., High, K., Xiao, W., 2004. Intracellular viral processing,
not single-stranded DNA accumulation, is crucial for recombinant adenoassociated virus transduction. J. Virol. 78, 13678 – 13686.
Heegaard, E.D., Brown, K.E., 2002. Human parvovirus B19. Clin. Microbiol.
Rev. 15, 485 – 505.
Helenius, A., Kartenbeck, J., Simons, K., Fries, E., 1980. On the entry of
Semliki forest virus into BHK-21 cells. J. Cell Biol. 84, 404 – 420.
Hewat, E.A., Blaas, D., 2004. Cryoelectron microscopy analysis of the
structural changes associated with human rhinovirus type 14 uncoating.
J. Virol. 78, 2935 – 2942.
Hewat, E.A., Neumann, E., Blaas, D., 2002. The concerted conformational changes during human rhinovirus 2 uncoating. Mol. Cell 10,
317 – 326.
Hoover-Litty, H., Greve, J.M., 1993. Formation of rhinovirus-soluble
ICAM-1 complexes and conformational changes in the virion. J. Virol.
67, 390 – 397.
Kaufmann, B., Simpson, A.A., Rossmann, M.G., 2004. The structure of human
parvovirus B19. Proc. Natl. Acad. Sci. U.S.A. 101, 11628 – 11633.
Kronenberg, S., Bottcher, B., von der Lieth, C.W., Bleker, S., Kleinschmidt,
J.A., 2005. A conformational change in the adeno-associated virus type 2
capsid leads to the exposure of hidden VP1 N termini. J. Virol. 79,
5296 – 5303.
Llamas-Saiz, A.L., Agbandje-McKenna, M., Wikof, W.R., Bratton, J.,
Tattersall, P., Rossmann, M.G., 1997. Structure determination of minute
virus of mice. Acta Crystallogr., Sect. D: Biol. Crystallogr. 53, 93 – 102.
Lombardo, E., Ramı́rez, J.C., Garcı́a, J., Almendral, J.M., 2002. Complementary roles of multiple nuclear targeting signals in the capsid proteins of the
parvovirus minute virus of mice during assembly and onset of infection.
J. Virol. 76, 7049 – 7059.
Maroto, B., Valle, N., Saffrich, R., Almendral, J.M., 2004. Nuclear export of
the nonenveloped parvovirus virion is directed by an unordered protein
signal exposed on the capsid surface. J. Virol. 78, 10685 – 10694.
Marsh, M., Helenius, A., 1989. Virus entry into animal cells. Adv. Virus Res.
36, 107 – 151.
Martin, K., Helenius, A., 1991. Nuclear transport of influenza virus
ribonucleoproteins: the viral matrix protein (M1) promotes export and
inhibits import. Cell 67, 117 – 130.
Meyer, W.J., Gidwitz, S., Ayers, V.K., Schoepp, R.J., Johnston, R.E., 1992.
Conformational alteration of Sindbis virion glycoproteins induced by heat,
reducing agents, or low pH. J. Virol. 66, 3504 – 3513.
Padron, E., Bowman, V., Kaludov, N., Govindasamy, L., Levy, H., Nick, P.,
McKenna, R., Muzyczka, N., Chiorini, J.A., Baker, T.S., AgbandjeMcKenna, M., 2005. Structure of adeno-associated virus type 4. J. Virol.
79, 5047 – 5058.
Pante, N., Kann, M., 2002. Nuclear pore complex is able to transport
macromolecules with diameters of about 39 nm. Mol. Biol. Cell 13,
425 – 434.
Parker, J.S., Parrish, C.R., 2000. Cellular uptake and infection by canine
parvovirus involves rapid dynamin-regulated clathrin-mediated endocytosis, followed by slower intracellular trafficking. J. Virol. 74,
1919 – 1930.
Prchla, E., Kuechler, E., Blaas, D., Fuchs, R., 1994. Uncoating of human
rhinovirus serotype 2 from late endosomes. J. Virol. 68, 3713 – 3723.
Reguera, J., Carreira, A., Riolobos, L., Almendral, J.M., Mateu, M.G., 2004.
Role of interfacial amino acid residues in assembly, stability, and
conformation of a spherical virus capsid. Proc. Natl. Acad. Sci. U.S.A.
101, 2724 – 2729.
Reinisch, K.M., Nibert, M.L., Harrison, S.C., 2000. Structure of the reovirus
core at 3.6 A resolution. Nature 404, 960 – 967.
Ros, C., Kempf, C., 2004. The ubiquitin-proteasome machinery is essential for
nuclear translocation of incoming minute virus of mice. Virology 324,
350 – 360.
Ros, C., Burckhardt, C.J., Kempf, C., 2002. Cytoplasmic trafficking of minute
virus of mice: low-pH requirement, routing to late endosomes, and
proteasome interaction. J. Virol. 76, 12634 – 12645.
Rosenfeld, S.J., Yoshimoto, K., Kajigaya, S., Anderson, S., Young, N.S., Field,
A., Warrener, P., Bansal, G., Collett, M.S., 1992. Unique region of the
minor capsid protein of human parvovirus B19 is exposed on the virion
surface. J. Clin. Invest. 89, 2023 – 2029.
Sanlioglu, S., Benson, P.K., Yang, J., Atkinson, E.M., Reynolds, T., Engelhardt,
J.F., 2000. Endocytosis and nuclear trafficking of adeno-associated virus
type 2 are controlled by Rac1 and phosphatidylinositol-3 kinase activation.
J. Virol. 74, 9184 – 9196.
Seisenberger, G., Ried, M.U., Endress, T., Buning, H., Hallek, M., Brauchle,
C., 2001. Real-time single-molecule imaging of the infection pathway of an
adeno-associated virus. Science 294, 1929 – 1932.
Siegl, G., Bates, R.C., Berns, K.I., Carter, B.J., Kelly, D.C., Kurstak, E.,
Tattersall, P., 1985. Characteristics and taxonomy of Parvoviridae. Intervirology 23, 61 – 73.
Simpson, A.A., Chipman, P.R., Baker, T.S., Tijssen, P., Rossmann, M.G., 1998.
The structure of an insect parvovirus (Galleria mellonella densovirus) at 3.7
A resolution. Structure 6, 1355 – 1367.
Simpson, A.A., Hebert, B., Sullivan, G.M., Parrish, C.R., Zadori, Z., Tijssen,
P., Rossmann, M.G., 2002. The structure of porcine parvovirus: comparison
with related viruses. J. Mol. Biol. 315, 1189 – 1198.
Smyth, M.S., Martin, J.H., 2002. Picornavirus uncoating. Mol. Pathol. 55,
214 – 219.
Suikkanen, S., Antila, M., Jaatinen, A., Vihinen-Ranta, M., Vuento, M.,
2003. Release of canine parvovirus from endocytic vesicles. Virology
316, 267 – 280.
Thomas, C.E., Storm, T.A., Huang, Z., Kay, M.A., 2004. Rapid uncoating of
vector genomes is the key to efficient liver transduction with pseudotyped
adeno-associated virus vectors. J. Virol. 78, 3110 – 3122.
Tsao, J., Chapman, M.S., Agbandje, M., Keller, W., Smith, K., Wu, H., Luo,
M., Smith, T.J., Rossmann, M.G., Compans, R.W., Parrish, C.R., 1991. The
three-dimensional structure of canine parvovirus and its functional
implications. Science 251, 1456 – 1464.
Vihinen-Ranta, M., Kalela, A., Mäkinen, P., Kakkola, L., Marjomäki, V.,
Vuento, M., 1998. Intracellular route of canine parvovirus entry. J. Virol. 72,
802 – 806.
C. Ros et al. / Virology 345 (2006) 137 – 147
Vihinen-Ranta, M., Wang, D., Weichert, W.S., Parrish, C.R., 2002. The VP1 Nterminal sequence of canine parvovirus affects nuclear transport of capsids
and efficient cell infection. J. Virol. 76, 1884 – 1891.
Whittaker, G.R., Kann, M., Helenius, A., 2000. Viral entry into the nucleus.
Annu. Rev. Cell Dev. Biol. 16, 627 – 651.
Xia, Q., Jakana, J., Zhang, J.Q., Zhou, Z.H., 2003. Structural comparisons of
empty and full cytoplasmic polyhedrosis virus: protein – RNA interactions
and implications for endogenous RNA transcription mechanism. J. Biol.
Chem. 278, 1094 – 1100.
Xiao, W., Warrington Jr., K.H., Hearing, P., Hughes, J., Muzyczka, N., 2002.
Adenovirus-facilitated nuclear translocation of adeno-associated virus type
2. J. Virol. 76, 11505 – 11517.
Xie, Q., Chapman, M.S., 1996. Canine parvovirus capsid structure, analyzed at
2.9 A resolution. J. Mol. Biol. 264, 497 – 520.
Xie, Q., Bu, W., Bhatia, S., Hare, J., Somasundaram, T., Azzi, A.,
Chapman, M.S., 2002. The atomic structure of adeno-associated virus
(AAV-2), a vector for human gene therapy. Proc. Natl. Acad. Sci.
U.S.A. 99, 10405 – 10410.
Yan, Z., Zak, R., Luxton, G.W., Ritchie, T.C., Bantel-Schaal, U., Engelhardt,
147
J.F., 2002. Ubiquitination of both adeno-associated virus type 2 and 5
capsid proteins affects the transduction efficiency of recombinant vectors.
J. Virol. 76, 2043 – 2053.
Yunoki, M., Tsujikawa, M., Urayama, T., Sasaki, Y., Morita, M., Tanaka, H.,
Hattori, S., Takechi, K., Ikuta, K., 2003. Heat sensitivity of human
parvovirus B19. Vox Sang. 84, 164 – 169.
Zadori, Z., Szelei, J., Lacoste, M.-C., Li, Y., Gariepy, S., Raymond, P., Allaire,
M., Nabi, I.R., Tijssen, P., 2001. A viral phospholipase A2 is required for
parvovirus infectivity. Dev. Cell 1, 291 – 302.
Zhong, L., Li, W., Yang, Z., Qing, K., Tan, M., Hansen, J., Li, Y., Chen, L., Chan,
R.J., Bischof, D., Maina, N., Weigel-Kelley, K.A., Zhao, W., Larsen, S.H.,
Yoder, M.C., Shou, W., Srivastava, A., 2004. Impaired nuclear transport and
uncoating limit recombinant adeno-associated virus 2 vector-mediated
transduction of primary murine hematopoietic cells. Hum. Gene Ther. 15,
1207 – 1218.
Zhou, Z.H., Zhang, H., Jakana, J., Lu, X.Y., Zhang, J.Q., 2003. Cytoplasmic
polyhedrosis virus structure at 8 A by electron cryomicroscopy: structural
basis of capsid stability and mRNA processing regulation. Structure 11,
651 – 663.