University of Miami
Scholarly Repository
Open Access Dissertations
Electronic Theses and Dissertations
2013-01-27
Retinal Ganglion Cell Differentiation and
Transplantation
Jonathan Hertz
University of Miami, jhertz32@gmail.com
Follow this and additional works at: http://scholarlyrepository.miami.edu/oa_dissertations
Recommended Citation
Hertz, Jonathan, "Retinal Ganglion Cell Differentiation and Transplantation" (2013). Open Access Dissertations. Paper 1142.
This Embargoed is brought to you for free and open access by the Electronic Theses and Dissertations at Scholarly Repository. It has been accepted for
inclusion in Open Access Dissertations by an authorized administrator of Scholarly Repository. For more information, please contact
repository.library@miami.edu.
UNIVERSITY OF MIAMI
RETINAL GANGLION CELL DIFFERENTIATION AND TRANSPLANTATION
By
Jonathan Hertz
A DISSERTATION
Submitted to the Faculty
of the University of Miami
in partial fulfillment of the requirements for
the degree of Doctor of Philosophy
Coral Gables, Florida
December 2013
©2013
Jonathan Hertz
All Rights Reserved
UNIVERSITY OF MIAMI
A dissertation submitted in partial fulfillment of
the requirements for the degree of
Doctor of Philosophy
RETINAL GANGLION CELL DIFFERENTIATION AND TRANSPLANTATION
Jonathan Hertz
Approved:
________________
Jeffrey L. Goldberg, M.D., Ph.D.
Adjunct Associate Professor, Ophthalmology
Professor of Ophthalmology, University of
California San Diego
_________________
Kenneth J. Muller, Ph.D.
Professor of Biophysics and
Physiology
________________
Mary B. Bunge, Ph.D.
Professor of Cell Biology &
Anatomy, Neurological Surgery
and Neurology
_________________
Vladlen Z. Slepak, Ph.D.
Professor of Molecular
and Cellular Pharmacology
________________
Evan Y. Snyder, M.D., Ph.D.
Professor of Neuroscience, Aging
and Stem Cell Research
Sanford Burnham Medical Research Institute
________________
M. Brian Blake, Ph.D.
Dean of the Graduate School
HERTZ, JONATHAN
Retinal Ganglion Cell Differentiation and Transplantation
(Ph.D., Neuroscience)
(December 2013)
Abstract of a dissertation at the University of Miami.
Dissertation supervised by Professor Jeffrey L. Goldberg
No. of pages in text. (196)
Adult central nervous system (CNS) neurons fail to regenerate following
injury, and there is no repair or replacement of cells lost after injury or in
neurodegenerative diseases. There is much interest in transplanting stem cellderived neurons into the injured nervous system and enhancing the
differentiation of donor cells into mature, integrated and functional neurons. Little
is known, however, about what signals control the differentiation and integration
of neurons, either during development or in the adult. Generating appropriate
types of donor neurons from stem cells has been challenging because the
signals that regulate neural subtype-specific fates are largely unknown.
Therefore, it remains unclear what instructive signals work in parallel with the
RGC-permissive transcription factor Math5 to control RGC fate specification.
Here we report a new molecular pathway involving Sox4/Sox11 in parallel to
GDF-11/Math5 signaling that is required for RGC differentiation from RPCs in
vitro
and
in
vivo
and
sufficient
to
potentiate
the
differentiation
of
electrophysiologically active human RGCs from induced pluripotent stem (iPS)
cells. We further describe regulation of Sox4 by REST and the TGFβ family
member GDF-15, and SUMOylation-dependent regulation of compensatory
Sox11 activity by Sox4. Through this work we also uncovered a mechanism for
SUMOylation regulation of Sox11 localization and function. These data define a
novel molecular network necessary and sufficient for RGC fate specification and
suggest a pro-RGC molecular manipulation which may provide potential promise
for cell replacement-based therapies.
My other work focused on the challenges of translating my findings on RGC
cell fate specficiation in mouse to more clinically relevant models. For example, I
made progress developing methodologies for the in vitro derivation of RGCs from
both human ciliary margin biopsy samples and from human induced pluripotent
stem cells. I further demonstrated the capcity of RGCs to integrate into the retina
following transplantation in vivo and made progress in improving delivery
methods using hydorgell to mimic extracellular environments. Taken together, my
work represents a multi-prong approach towards advancing RGC stem basedtherapies towards the clinic.
`
To Ima and Aba
iii
Acknowledgements
This work is the culmination of years of dedication and focus. However,
none of this would be at all possible without the unbending support of my family,
my mentor, my friends and my labmates.
To my parents and my sister: I thank you with all of my heart for your
strong support and encouragement through my trials and tribulations in scientific
exploration.
To my mentor Jeff: You have given me three gifts that will remain with me
for the rest of my life; how to write, how to speak and how to think. I am eternally
grateful for your support and look forward to future collaborations. Also, I would
like to thank my committee for their support, feedback and guidance.
As is the sign of a great lab environment, my friends and labmates are
intertwined and I feel blessed to have been able to take part in the weddings’ of
Noelia, Darcie and Tommy. I have learned so much from my co-workers and
collaborators and I look forward to remaining friends and colleagues in the future.
iv
TABLE OF CONTENTS
Page
LIST OF FIGURES ........................................................................................
vii
LIST OF TABLES ..........................................................................................
viii
LIST OF PUBLICATIONS ..............................................................................
ix
Chapter
1 Retinal ganglion cell differentiation and transplantation ......................
Introduction .........................................................................................
RGC fate determination ......................................................................
Transcription factors regulate RGC fate .............................................
Secreted factors regulate RGC fate .....................................................
Cell choices for transplantation ............................................................
Cell transplantation for retinal ganglion cell replacement ....................
Cell transplantation for retinal ganglion cell neuroprotection ...............
1
1
3
7
16
19
24
28
2 Novel regulatory mechanism for the SoxC transcriptional network
required for visual pathway development ..........................................
Motivation ...........................................................................................
Materials and methods .......................................................................
Results ...............................................................................................
Discussion ..........................................................................................
32
32
35
47
66
3 Retinal ganglion cell transplantation .................................................... 74
Motivation ............................................................................................ 75
Materials and methods ....................................................................... 78
Results ............................................................................................... 82
Discussion .......................................................................................... 103
4 Tunable hydrogel-based scaffold for retinal repair .............................
Motivation ............................................................................................
Materials and methods .......................................................................
Results ...............................................................................................
Discussion ..........................................................................................
109
109
111
116
124
5 Human ciliary margin stem cell proliferation and differentiation .......... 130
v
Motivation ............................................................................................
Materials and methods .......................................................................
Results ...............................................................................................
Discussion ..........................................................................................
130
132
136
145
6 Discussion and conclusion...................................................................
Retinal ganglion cell differentiation and transplantation ......................
SoxC transcription factors regulate RGC fate determination ..............
REST repression of RGC fate determination is Sox4-dependent .......
TGFβ superfamily member regulate Sox genes and RGC fate ..........
The role of cell fate and differentiation in regulating cell
transplantation and integration………………………………………….. .
Human ciliary margin stem cells …………………………….......... .......
Induced pluripotent stem cells ………………………………….............
Tunable hydrogel scaffolds for studying neural integration
and retinal repair ……………………………………………………….....
Conclusion ………………………………………………………………. ...
151
151
152
158
160
162
163
164
167
170
WORKS CITED……………………………………………………………………. 172
vi
LIST OF FIGURES
Chapter
Page
1 Figure 1.1 ............................................................................................
Figure 1.2 ............................................................................................
Figure 1.3 ............................................................................................
Figure 1.4 ............................................................................................
4
8
11
23
2 Figure 2.1 ............................................................................................
Figure 2.2 ............................................................................................
Figure 2.3 ............................................................................................
Figure 2.4 ............................................................................................
Figure 2.5 ............................................................................................
Figure 2.6 ............................................................................................
Figure 2.7 ............................................................................................
Figure 2.8 ............................................................................................
Figure 2.9 ............................................................................................
48
50
53
57
60
62
64
65
67
3 Figure 3.1 ............................................................................................ 83
Figure 3.2 ............................................................................................ 85
Figure 3.3 ............................................................................................ 87
Figure 3.4 ............................................................................................ 90
Figure 3.5 ............................................................................................ 93
Figure 3.6 ............................................................................................ 95
Figure 3.7 ............................................................................................ 98
Figure 3.8 ............................................................................................ 100
Figure 3.9 ............................................................................................ 102
4 Figure 4.1 ............................................................................................
Figure 4.2 ............................................................................................
Figure 4.3 ............................................................................................
Figure 4.4 ............................................................................................
Figure 4.5 ............................................................................................
Figure 4.6 ............................................................................................
112
117
119
120
121
123
5 Figure 5.1 ............................................................................................
Figure 5.2 ............................................................................................
Figure 5.3 ............................................................................................
Figure 5.4 ............................................................................................
Figure 5.5 ............................................................................................
Figure 5.6 ............................................................................................
137
139
140
142
143
144
vii
LIST OF TABLES
Chapter
Page
4 Table 4.1 ............................................................................................. 118
5 Table 5.1 ............................................................................................. 146
viii
LIST OF PUBLICATIONS
Chapter 1: This chapter is published as a chapter of a text book titled Stem Cell
Biology and Regenerative Medicine in Ophthalmology.
Hertz, J., and Goldberg, J.L. (2012). Stem Cells In Glaucoma. In Stem Cell
Biology and Regenerative Medicine, S. Tsang, ed. (New York: Humana Press).
I prepared and wrote the chapter, designed the illustrations, and my
mentor, Jeffrey Goldberg directed the focus of the chapter and edited the
chapter.
Chapter 2: This chapter has been submitted to the Journal of Neuroscience
Hertz J, Jin XL, Derosa BA, Li JY, Venugopalan P, Valenzuela DL, Patel RD,
Russano KR, Alshamekh SA, Velmeshev D, Cheng Y, Boyce TM, Dreyfuss A,
Uddin MS, Muller KJ, Lefebvre V, Dykxhoorn DM, Goldberg JL (2012) Novel
regulatory mechanisms for the SoxC transcriptional network required for visual
pathway development Under consideration by the Journal of Neuroscience.
My mentor Jeffrey Goldberg and I designed the research. My mentor was
extremely helpful in designing the research and I prepared and wrote this paper. I
developed the RGC differentiation overexpression screen, conducted the
majority of cell culture experiments and along with Xiao-Lu Jin generated the
cDNA clones for overexpression assays and ran RT-PCRs, Western Blots, and
Co-IPs. Xiao-Lu Jin played an instrumental role in developing and conducting the
SUMOylation Co-IP experiments and SUMO point mutation cloning. Brooke
Derosa contributed greatly to Fig. 8 and helped develop the IPS culture protocols
and cultured the human IPS stem cells up to the point of retinal differentiation.
Janet Li helped to develop the overexpression screen and conducted some of
the cell culture work in Fig. 1. Praseeda Venugopalan recorded from human IPS
ix
cell-derived RGCs using patch clamp electrophysiology in Fig. 8. Daniel
Valenzuela and Roshni Patel conducted many of the immunostaining, imaging
and quantifying of retinal sections and retinal explants found in Figs. 1-3. Kristina
Russano bred and genotyped all the transgenic mice used throughout the paper.
Shomoukh Alshamekh immunostained the IPS cells for stem cell and neuronal
markers in Fig. 9. Dmitri Velmeshev helped overexpress Sox11 and K91A Sox11
in HEK cells, imaged and quantified the data found in Fig. 5. Yuyan Chen
immunostained, imaged, and quantified the retinal explants for melanopsin in Fig.
3C. Timothy Boyce helped with the bioinformatics for developing the candidate
gene list. Alexanda Dreyfuss optimized the immunostaining of the retinal sections
and retina cells in culture for Sox4 found in Fig. 2. Mohammed Uddin imaged and
quantified the differentiated RGCs in the human IPS stem cell differentiation
experiments in Fig. 8. Kenneth Muller supervised Praseeda and helped setup the
appropriate electrophysiology rig for making these recordings possible.
Veronique Lefebvre generated and generously gifted us the floxed Sox4
transgenic mice and the floxed Sox4, floxed Sox11, Sox12 KO triple SoxC KO
mice. Derek Dykxhoorn supervised Brooke DeRosa’s IPS cell work and provided
experimental design plans for Fig. 8. My mentor, Jeffrey Goldberg analyzed data,
edited the paper and supervised all the work.
x
Chapter 3: This chapter has been accepted to the journal Cell Transplantation.
Hertz, J., Qu, B., Hu, Y., Patel, R.D., Valenzuela, D.A., and Goldberg, J.L.
(2013). Survival and Integration of Developing and Progenitor-Derived Retinal
Ganglion Cells Following Transplantation. Cell transplantation.
My mentor Jeffrey Goldberg and I designed the research. My mentor was
extremely helpful in designing the research and I prepared and wrote this paper. I
conducted the majority work of the paper for the original submission to Cell
Transplantation. Ying Hu performed the optic nerve crush experiments for the
original submission. The editors gave us specific and feasible revision
suggestions and with the help of Bo Qu, Roshni Patel and Daniel Valenzuela, we
conducted the majority of suggested experiments and resubmitted on November
2012. Bo Qu performed the intravitreal injections of RGCs for the in vivo
experiments. Bo Qu and Roshni Patel performed a majority of the explants for
the ex vivo experiments. Daniel Valenzuela developed the protocol for
determining the level of neurite orientation using ImageJ. Daniel analyzed the
data and assembled Fig. 8.
Chapter 4: This chapter has been accepted by ACTA Biomateriala
Hertz, J., Robinson, R., Valenzuela, D.A., Lavik, E.B., and Goldberg, J.L. (2013).
A tunable synthetic hydrogel system for culture of retinal ganglion cells and
amacrine cells. Acta Biomateriala 9, 7622-7629.
My mentor Jeffrey Goldberg and I designed the research. My mentor was
extremely helpful in designing the research and I prepared and co-wrote this
paper with Rebecca (co-first author). I wrote all the sections on the biology
experiments and Rebecca wrote all the sections on the biomaterials. I conducted
all the cell culture experiments and Rebecca developed and generated the library
xi
of hydrogel scaffolds under the supervision of her PhD thesis mentor Erin Lavik.
Rebecca Robinson, Erin Lavik and Jeffrey Goldberg edited the paper.
Chapter 5: This chapter is being prepared for submission.
My mentor Jeffrey Goldberg and I designed the research. My mentor was
extremely helpful in designing the research and I prepared and co-wrote the
manuscript.
Chapter 6: This chapter was written by me and edited by my mentor. This
chapter has not been submitted for peer review.
xii
Chapter 1
Retinal ganglion cell differentiation and transplantation
Introduction
Central nervous system (CNS) neurons fail to regenerate following injury
or disease. Furthermore, neurons lost from injury or disease will not be replaced
through endogenously generated ‘replacement neurons’. For example, the optic
neuropathy glaucoma, is the most common neurodegenerative disease of the
inner retina and optic nerve, affects more than 60 million people worldwide
(Quigley and Broman, 2006), and results in the dysfunction and death of retinal
ganglion cells. The onset of glaucoma is elusive and the progressive
degeneration is slow. Because of this, diagnosis often ensues only after cell
degeneration and some loss of visual function (Quigley and Broman, 2006). RGC
loss is irreversible and advancing vision damage leads to bilateral blindness in as
many as 14% of all diagnosed patients (Shields, 2008).
The only current
treatment for slowing the degeneration of RGCs has been lowering intraocular
pressure (IOP) (Much et al., 2008); however, in some patients, ocular
hypotensive-based therapies fail to stop the loss of RGCs and progressive visual
dysfunction. Stem cell-based therapies provide new hope for treating glaucoma
and other optic neuropathies. Transplanting stem cells or stem cell-derived cells
into the retina could provide neuro-protective support to surviving neurons or
potentially replace neurons that have already been lost in order to restore visual
function. However, before these therapies reach patients, there is a need to
identify the appropriate donor cell type(s) to use, as well as how best to
1
2
differentiate and deliver these cells, to maximize integration, neuroprotection, and
functional recovery in the injured retina. Here we review progress towards these
goals and critical next steps to bringing stem cell therapies to glaucoma.
Stem and progenitor cells
Stem cells are defined by two key properties: the ability to self-renew and
the capacity to differentiate into multiple cell types (Thomson et al., 1995; Wianny
et al., 2011). During development, pluripotent embryonic stem cells (ESCs)
mature into three distinct germ layers and restrict their cell fate competence to
specific progenitor cell lineage (Thomson et al., 1998) (Marshall et al., 2001)
(Jones and Thomson, 2000). ESCs derived from the blastocyst inner cell mass,
once in culture, possess nearly unlimited proliferative and self-renewal capacity
(Thomson et al., 1995). One step more restricted, neural stem cells (NSCs) can
differentiate into the diverse array of neural and glia subtypes found in the CNS.
In the retina, retinal progenitor cells (RPCs) self-renew and remain multipotent
but cell fate is limited to retinal neurons and glia (Brand and Livesey;
Hatakeyama and Kageyama, 2004; Turner and Cepko, 1987; Turner et al.,
1990). Thus, it remains unknown which level of lineage restriction or to what
extent cells must be differentiated towards the RGC fate prior to transplantation
will maximize either neuroprotection of and/or integration into the glaucomatous
retina. By better understanding how RGCs develop, we may recapitulate such
signals ex vivo, to generate appropriate cell types for either neuroprotective or
cell replacement based therapies in the retina to treat glaucoma and other CNS
diseases.
3
Retinal Ganglion Cell Fate Determination
RPCs generate all six major types of neurons—rods, cones, horizontal
cells, bipolar cells, amacrine cells, and RGCs—and Müller glia found in the retina
(Fig. 1.1). Each cell type is functionally and morphologically distinct and resides
at a stereotyped location in the retina. Rod and cone photoreceptors absorb
photons and convert these signals to electrical signals that are further processed
by interneurons (amacrine, bipolar, and horizontal cells) which connect
synaptically to RGCs. RGCs then carry all visual information to the brain along
their axons (Sernagor et al., 2001).
How does a developing RGC integrate into its environment? RGCs are
among the first neurons to arise from a common pool of multipotent retinal
progenitors in the retinal neuroblast during embryonic development. After exiting
the cell cycle, RGCs migrate across the retina to the ganglion cell layer (GCL). In
the GCL, RGCs extend axons towards the optic nerve head, and form the optic
nerve, which ultimately connects the retina to the brain. RGCs proceed to form
synaptic connections with presynaptic amacrine and bipolar interneurons
(Sernagor et al., 2001) (Kirby and Steineke, 1996) (Hendrickson, 1996). It
remains unclear what signals regulate neural integration, or to what degree each
step—cell fate specification, survival, migration, neurite growth and synaptic
integration—depends on the preceding one (Fig. 1.1).
What signals regulate retinal progenitor competence to specify RGC fate
determination? Through seminal ‘birth-dating’ experiments, two well-defined but
overlapping RPC competence states for generating specific types of neurons,
4
Figure 1.1 Summary graphic describing the stages of progenitor cell (blue) to
retinal ganglion cell (green) transition, and the transcription factors and extrinsic,
environmental signals known to be associated with each stage. Math5 and Notch
are known to regulate cell cycle exit but are not sufficient on their own to specify RGC
fate (see text and Figure 2).
5
including RGCs, were identified (Price et al., 1987). ‘Early’ embryonic retinal
progenitors differentiate into early-born retinal neurons beginning with RGCs and
amacrine, cone photoreceptor and horizontal cells (Livesey and Cepko, 2001)
(Okano and Temple, 2009). This is followed by an overlapping shift in cell
competence to commit to late-born retinal cells, including rod photoreceptors,
bipolar, and Müller glia (Turner et al., 1990). How these competence changes
occur is not well understood but evidence suggests that these differential
competence states are strongly influenced by intrinsic mechanisms. Time-lapse
experiments suggest that RPC competence is intrinsically programmed and
linked directly to temporal context, albeit with some stochastic component
(Gomes et al.). Heterochronic transplantation experiments in both chick and
rodents, in which progenitors from different stages of development transplanted
to an environment of a different age/context (either earlier or later) support this
premise (Cayouette et al., 2003). For example, early chick progenitors, which
normally generate RGCs in vivo, retain their competence for RGCs irrespective
of the age of the surrounding environment. Experiments with cultured rat
progenitors showed that early progenitors that typically generate RGCs,
amacrine cells and cone photoreceptors do not lose this competence when
cultured in different environments known to secrete inductive signals for other
neural fates (Cayouette et al., 2003). This suggests that RPC competence to
produce distinct types of cells differs depending on the stages of development,
independent of environmental context. Similarly controlled spatiotemporal waves
of changing cell competence have been observed in many areas of the CNS,
6
including cortex and hippocampus. While early RPCs retain their early-born
neuron competence, late RPCs can be influenced by environmental signals. Late
progenitors cultured in the presence of early retinal conditioned media were
coaxed into the RGC fate, demonstrating that cell competence changes can
change in specific directions (James et al., 2003). Taken together, cell
competence for the RGC fate is intrinsic to the early retinal progenitor, and
decreases during development in a discrete temporal window in order to
establish the appropriate cell numbers.
Besides cell competence, cell cycle and cell division mechanisms in retinal
progenitors also change during development and influence cell number and fate.
Cell-cycle duration doubles throughout retinal neurogenesis (Alexiades and
Cepko, 1996). Furthermore, the type of cell division shifts over time in retinal
progenitors. During early retinal development there is considerable generation of
mitotic progenitors, as large numbers of cells divide symmetrically, each giving
rise to two progenitors. As development progresses the generation of new
progenitors decreases, concomitant with the increased generation of post-mitotic
neurons. Cell polarity and the orientation of the cell division plane correlate with
proliferation and cell determination in the developing cortex and in the retina
(Morin et al., 2007). Thus, asymmetric segregation of cell-fate determinants
during cell division may play an important part in generating cell diversity in
vertebrate retina. For example, the asymmetric segregation of the protein numb,
occurring only in a precise cell division plane, plays a role in cell fate
determination in the rat retina (Cayouette and Raff, 2003). Thus, cell competence
7
for specific neural subtypes, including RGCs, is dynamically regulated by cell
autonomous, environmental, and cell polarity signals which work in concert to
define the temporal window in which specific cells are born. As reviewed below,
disruption of any of these signals has adverse effects on retinal development.
Transcription factors regulate RGC fate
Through numerous gain and loss of function experiments both in vitro and
in vivo, transcription factors and secreted factors have been shown to regulate
the specification and differentiation of RGCs, but precise instructive signals
remain unknown (Fig 1.1,1.2). On the cell-autonomous side, transcription factors
are master regulator proteins which regulate expression of downstream gene
targets. Transcription factors, particularly the basic helix loop helix (bHLH) and
homeodomain families, have been shown to control the differentiation and
patterning of many of the diverse cell types in the CNS, and specific gene
regulatory pathways are required to complete and progress through a series of
developmental stages. In a hierarchical manner, transcription factors regulating
early developmental processes are important early, while transcription factors
regulating terminal differentiation and later maturation processes are important
later. Some of the main transcriptional regulators within this hierarchy, including
Pax6, Six3, Rx, Chx10, Notch, Ath5, and the Brn3 family of transcription factors,
have been identified and examined extensively, but the genes these transcription
factors target and how these signals work in together remains unknown.
8
Figure 1.2 Math5-positive progenitor cells (green, left) differentiate into RGCs and
many other retinal neurons found in the mature retina (green, right), suggesting
that Math5 is not sufficient on its own to specify RGC fate (NFL, nerve fiber layer;
GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer
plexiform layer; ONL, outer nuclear layer).
9
Pax6
Loss-of-function studies with knockout mice have placed certain
homeobox-containing transcription factors at the top of gene regulatory networks
controlling retinal development. These genes include Pax6, Rx, Chx10 and Six3,
which are all expressed in RPCs in the retinal neuroblast. These homeobox
genes are expressed in all RPCs in the beginning of retinogenesis and are
required for the specification of RGCs as well as other retinal cell types. Pax6 is
required for eye field specification during the early stages of eye development
(Chow et al., 1999) and also for generating cell types in the developing retina
(Marquardt et al., 2001). In seminal gain of function experiments in drosophila,
later shown in vertebrates, Pax6 was sufficient to trigger the cascade of signals
required for eye formation (Chow et al., 1999). Conversely, elimination of Pax6
function by a conditional knockout in the developing retina led to a loss in the
specification of all retinal cell types excluding amacrine cells. Pax6 functions, at
least in part, to promote the expression of the bHLH proneural genes in retinal
neuroblasts, as loss of Pax6 results in the decreased expression of genes
encoding the proneural bHLH factors Ath5, Ath3, and neurogenin (Marquardt et
al., 2001). NeuroD expression is unaffected by the loss of Pax6, consistent with
evidence from knockout mice establishing that NeuroD is crucial for amacrine cell
differentiation (Inoue et al., 2002). Taken together, these data demonstrate that
multiple sets of transcription factors regulate RPC proliferation and differentiation
during retinal neurogenesis, which begins with RGCs, and corresponds with the
up-regulation of Ath5 expression.
10
Ath5
Through loss of function experiments in mouse, the proneural bHLH gene
Ath5 (also called Xath5 in Xenopus, Cath5 in chick and Math5 in mouse) was
demonstrated to be necessary but not sufficient for RGC fate (Fig 1.3). During
development, Ath5 is expressed almost exclusively in the retina. In the mouse
retina, Math5 expression begins directly before the birth of the first RGC and its
expression decreases in daughter RGCs soon after RGC precursors exit the cell
cycle (Brown et al., 1998). The importance of Ath5 in the RGC lineage was
recognized through both gain- and loss-of-function studies. Overexpression of
Cath5 in chick retinas (Ma et al., 2004) and Xath5 (Brown et al., 1998) (Kanekar
et al., 1997) in Xenopus retinas stimulates RGC production at the cost of
generation of other retinal cell types. Null mutations in Ath5 in mice (Brown et al.,
2001; Wang et al., 2001) and zebrafish (Kay et al., 2001) lead to almost complete
absence of RGCs. Although Ath5 is essential for RGC formation, evidence
suggests that it is probably upstream of the instructive signals for RGC
specification, as lineage-tracing experiments show that Ath5-expressing RPCs
give rise to multiple cell types (Wang et al., 2001). Ath5 likely acts as a proneural
gene to promote the establishment of a field of progenitor cells that are
competent to turn into RGCs but not to specify the RGC lineage. Ath5
overexpression, which increases the number of RGCs, may do so by generating
a larger pool of RGC progenitors competent to then differentiate into RGCs.
Taken together, evidence suggests that Ath5 is necessary but not sufficient to
specify RGC fate, and that Ath5 may not specify a particular cell type at all, but
11
Figure 1.3 General overview of known factors regulating retinal ganglion cell fate
specification. See text for details.
12
rather is more involved in multiple steps of retinal neurogenesis, including the
differentiation of RGCs and other cell types in the retina.
Notch
During development, pro-neurogenic signals compete with opposing
signals to coordinate the generation, distribution and patterning of newly born
neurons. Opposing RGC fate, Notch has been shown to be a key regulator of cell
fate in the CNS and plays an important role as a negative regulator of RGC
production (Austin et al., 1995; Dorsky et al., 1995). The Notch signaling pathway
is activated by the binding of ligands such as Delta, typically through neighboring
cell-cell interaction. Activation of this pathway leads to the proteolytic cleavage of
Notch and the release of a Notch intracellular domain (NICD). NICD translocates
to the nucleus and binds to the highly conserved DNA-binding transcription factor
CSL to activate target genes, including the Hairy-Enhancer of Split (HES) family
of bHLH genes (Baron, 2003; Selkoe and Kopan, 2003). Evidence from
Drosophila studies demonstrates that the Notch pathway negatively regulates
neurogenesis in the developing eye through lateral inhibition resulting in the
repression of the proneural bHLH gene atonal (Li et al., 2001). In the vertebrate
retina, the Notch pathway is similarly positioned at the top of the regulatory
hierarchy in RGC generation and inhibits in RGC production through lateral
inhibition. Pax6 and the Notch pathway compete with each other in regulating
downstream genes required for the generation of the RGC lineage. Pax6 is
required for the activation Ath5 (Riesenberg et al., 2009), which is required for
the RGC lineage. Conversely, Notch signaling inhibits Ath5 expression through
13
its downstream target transcription factors Hes1 and Hes5. It is unknown whether
Ath5 is a direct transcriptional target of Pax6 and/or Notch-CSL, or whether other
regulating signals are required in these pathways. Taken together, these data
suggest that Pax6- and Notch-dependent mechanisms, in concert with other
signals, fine tune the proper levels of Ath5 expression in a subset of progenitor
cells that become competent for RGC specification.
Brn3
Downstream of these pathways, Brn3 proteins (also called XBrn3 in
Xenopus) Brn3a, b, and c are class IV POU domain transcription factors and one
of the initial and most specific markers for RGC differentiation during
development (Gan et al., 1999). Around 80% of RGC precursors express Brn3b
immediately after cell cycle exit, and 24 hours later the closely related Brn3a and
Brn3c genes are expressed in ~80% and ~20% of developing RGCs,
respectively. These latter two subsets of RGCs significantly overlap the subset of
Brn3b expressing RGCs (Pan et al., 2005) (Quina et al., 2005) (Xiang, 1998)
(Xiang et al., 1995). These transcription factors have been shown to control
dendritic stratification, axonal structure and target selection during the terminal
differentiation stage and their expression patterning may control the development
of unique subtypes of RGCs (Fig1.1) (Badea and Nathans).
Of the Brn3 proteins, Brn3b has been best studied, and gain and loss of
function experiment indicates that Brn3b is directly downstream of ath5 in the
regulatory
hierarchy
for
RGC
differentiation.
Although
Brn3b
when
overexpressed can promote the expression of certain RGC markers (Liu et al.,
14
2001), there is strong evidence that demonstrates that Brn3b itself is not a
required cell fate specification gene for RGCs. In Brn3b-null retinas, the number
of RGCs born initially resembles that observed in wild-type retinas while still in
early development (Gan et al., 1999). Therefore, this suggests that there are
probably unknown gene regulatory pathways that function in parallel to Math5
and upstream of Brn3b.
In Math5-null retinas, Brn3b expression is greatly reduced (Brown et al.,
2001; Wang et al., 2001), consistent with the absence of RGCs. However, it
remains unknown whether Math5 directly regulates Brn3b expression. In the
retina, the spatial and temporal expression patterns of Math5 and Brn3b are
largely non-overlapping. Furthermore, Math5 is expressed in proliferating
progenitor cells and Brn3b is expressed in post mitotic RGC precursors and
mature RGCs (Gan et al., 1999; Wang et al., 2001). If Math5 directly up regulates
Brn3b expression early on, other mechanisms must be responsible for
maintaining high levels of Brn3b expression after Math5 expression declines
during retinal development. In Brn3b-null retinas, lacZ knocked into the Brn3b
locus mirrors the normal expression pattern of Brn3b (Gan et al., 1999). These
findings suggest that maintenance of Brn3b expression is not likely controlled by
autoregulation. It is possible that genes required for RGC specification lie in
between and/or parallel to Ath5 and Brn3b in the regulatory hierarchy and that
these unknown specification genes either collaborate with or function
independently of Ath5 to regulate expression of Brn3b. Interestingly, knocking out
both Math5 and the transcriptional repressor RE-1 silencing transcription factor
15
(REST) in mouse retina leads to the generation of ectopic Brn3b/Islet1 doublepositive RGCs (Mao et al.). This further demonstrates that Brn3b expression
does not depend entirely on Math5 expression. Currently it is unknown if REST is
repressing uncharacterized cell fate specifying transcription factors, but evidence
from experiments in other parts of the CNS suggest this hypothesis (Mao et al.).
Wt1
The Wilms’ tumor gene (Wt1) which encodes a zinc-finger transcription
factor, was found to function directly upstream of Brn3b in the retina (Wagner et
al., 2002). Wt1-null mice have a major loss of RGCs in the retina which, similar
to Brn3b-null mice, initially generates RGCs that are later lost by apoptosis. Wt1
expression does not overlap with Ath5 expression and it is not clear whether
Ath5 regulates Wt1. Wt1-dependent activation of Brn3b could be part of an Ath5independent signaling cascade regulating RGC differentiation. Although Brn3
family members and Wt1 transcription factors do not play role in specifying RGC
fate from RPCs, it is likely that they signal important downstream targets for the
full RGC phenotype, which may need to be up regulated in stem cell-derived
RGCs if transplantation is to be considered (discussed further below). Thus there
remains a gap in our understanding of RGC fate regulation between upstream
transcription factors like Ath5 and Pax6 that are necessary but not sufficient, and
downstream transcription factors required for RGC maintenance or survival.
16
Secreted molecules regulate RGC fate in concert with transcription factors
During development, secreted molecules from the local environment work
in concert with transcription factors to induce commitment to subsequent steps in
differentiation (Edlund and Jessell, 1999). Secreted factors such as fibroblast
growth factors (FGFs), sonic hedgehog (Shh), and transforming growth factor
beta (TGF-β) superfamily molecules, have been shown to regulate cell number
and the timing of neural differentiation by regulating transcription factor
expression (Kim et al., 2005; Wallace and Raff, 1999; Yang, 2004).
Basic fibroblast growth factor (bFGF)
The trophic factor and mitogen bFGF has been shown to potentiate RGC
fate determination in mammalian retinal progenitors (Fischer and Reh, 2002;
Guillemot and Cepko, 1992). In an RPE transdifferentiation assay, bFGF elicits
the expression of RGC marker RA4, although the extent of differentiation may be
very limited (Ma et al., 2004; Yan and Wang, 2004), because those cells did not
express many other RGC markers. Expression of these markers was detected in
bFGF-primed RPE cultures infected with RCAS–Ath5 or RCAS–NSCL1 (Ma et
al., 2004), suggesting that the bHLH hierarchy may integrate input from bFGF to
promote RGC differentiation and development. Consistent with previous findings
that FGF promotes the retinal neurogenic pathway (Guillemot and Cepko, 1992;
McFarlane et al., 1998), blocking of FGF receptor activation in chick interferes
with the progressive wave of RGC differentiation from the central retina towards
the periphery (McCabe et al., 1999).
Sonic hedgehog (Shh)
17
Sonic hedgehog is another extrinsic factor shown to regulate proliferation
and RGC generation and differentiation (Masai, 2000; Neumann and NuessleinVolhard, 2000; Spence et al., 2004; Stenkamp and Frey, 2003). Recent studies
have established a mitogenic role for Shh signaling in CNS progenitor cells. For
example, cerebellar granule cell precursors depend on Shh secreted by Purkinje
cells to proliferate in vitro and in vivo (Dahmane and Ruiz i Altaba, 1999; Wallace
and Raff, 1999; Wechsler-Reya and Scott, 1999). In early retinogenesis, Shh
derived from the first-born RGCs promotes propagation of the neurogenic wave
front (Neumann and Nuesslein-Volhard, 2000) but suppresses RGC genesis as
these neurons accumulate, as discovered in zebrafish (Neumann and NuessleinVolhard, 2000). Shh secreted by RGCs appears to also inhibits RGC generation
through a different feedback system (Zhang and Yang, 2001). Thus Shh
regulates the precise number of RGCs generated during development through at
least two mechanisms. It is unclear whether or not the morphogenic property of
Shh observed in other areas of CNS development regulates these contrasting
modes of function in the retina. Shh signals also appear to influence the growth
and trajectory of RGC axons (Kolpak et al., 2005; Sanchez-Camacho and
Bovolenta, 2008). In zebrafish, reduction of Hh activities affects differentiation of
late cell types including Müller glia, bipolar cells, GABAergic amacrine cells, and
photoreceptors (Shkumatava et al., 2004; Stenkamp and Frey, 2003).
Furthermore, laminar organization of the retina is disrupted in Shh mutants
(Shkumatava et al., 2004; Wang et al., 2002). Recently, Shh has also been
implicated in adult neural stem cell proliferation (Lai et al., 2003). Mice with a
18
single functional allele of the Shh receptor patched have an increased
percentage of proliferating cells in their retinas throughout the first postnatal
week. In addition, the mice have a population of dividing cells at the retinal
margin reminiscent of the CMZ of lower vertebrates (Moshiri and Reh, 2004).
This suggests that Shh signaling is important for controlling retinal progenitor
proliferation and may regulate adult neurogenesis in the mammalian eye. Taken
together, Hh signaling, perhaps due to its morphogenic properties, is
fundamentally important to many facets of RGC differentiation, including
postembryonic ocular growth, but how these mechanisms function together
remains unknown.
Growth differentiation factor 11 (GDF11)
In the retina, feedback regulation of neural cell number, mediated by
secreted factors, has been shown to alter the fates of multipotent progenitor by
controlling the timing of transcription factor expression. For example, the
secreted TGF-β molecule GDF11 negatively regulates the number of neuron
generated by controlling the period during which retinal progenitor cells are
competent to produce particular progeny The GDF11 KO mouse has aberrantly
persistent Math5 expression throughout postnatal development resulting in the
generation of excessive numbers of RGCs. (Kim et al., 2005). Conversely,
exposing retinal explants to GDF results in the decrease in Math5 expression
resulting in retinas with less RGCs. It is currently unknown which cell type(s)
secrete GDF11 as well as whether other GDFs play roles in retinal development.
19
Manipulation of these signaling pathways could provide insight into improving the
methods for the generation of donor RGCs for transplantation.
Cell Choices for Transplantation
What types of stem or progenitor cells can be used for RGC therapies in
glaucoma or other optic neuropathies? The most comprehensively studied donor
cell candidate for cell-based therapies in the retina have been embryonic stem
cells (ESCs) which proliferate, self-renew and differentiate into all cell types. In
culture, ESCs retain all of these features. ESCs have been differentiated in
culture into most retinal cell types including RGCs (Meyer et al., 2009) (Aoki et
al., 2009; Osakada et al., 2009).
However,
transplantation
studies
of
undifferentiated
ESCs
have
demonstrated that these cells fail to receive the proper instructive cues for
correct cell fate specification. Transplanting an uncommitted stem cell will rely
heavily on the host tissue to provide differentiation cues to the grafted cells and
so far for RGCs, this has yielded only minimal re-integration with no evidence for
any functional restoration. Further limitations to using ESCs directly come from
observations in some studies in which the cells formed tumors due to
uncontrolled proliferation following transplantation (Osakada et al.). Other
challenges may include immune rejection, teratogenic properties, and ethical
concerns over the cell source. Thus, control of proliferation and differentiation of
these cells is critical before ESCs are safely and ethically used as a cell source
for therapeutic transplants.
20
Neurons and neural stem cells (NSCs) induced from ESCs and
transplanted into the injured eye may show more promise for retinal integration
(Reynolds and Weiss, 1992) (Gamm et al., 2007; Lund et al., 2007; Wang et al.,
2008). Similarly, ESCs differentiated into retinal stem cells (RSCs) as well as
various
neuronal
phenotypes
differentiated
by
exposure
to
pro-neural
differentiation factors in vitro prior to transplantation were investigated in a retinal
transplantation model (Reh and Fischer, 2001; Reh and Levine, 1998). RSCs
subretinally transplanted into young mice survived, migrated, integrated, and
differentiated into retinal cell types, particularly rod photoreceptors. However, in
adults, transplanted RSCs preferentially expressed RGC or glial markers. These
findings provide evidence that RSC differentiation following transplantation hinges
on the pre-transplantation conditions of both the donor RSCs and the host retina.
NSCs from other areas of the CNS, particularly forebrain, have also been
investigated as potential donor cell sources to the retina. Upon transplantation to
the retina, forebrain-derived NSCs survive, express some retinal cell specific
markers, and exhibit retinal cell-like morphologies. Overall, the rate of integration
was low and many of the cells were localized in aberrant retinal layers. As with
RSCs, the extent of differentiation and integration depend heavily on the age and
type of injury to the host retina {Francis 2009}. Hippocampal-derived NSCs
incorporate into injured retina and differentiate into both microtubule-associated
proteins 2 (map2) positive and GFAP-positive cells, suggesting differentiation into
both major types of cell lineages. Although neurons and glial markers were
present, no retinal-specific subtype markers were observed, demonstrating that
21
the local retinal environment, either normal or injured, is not sufficient to coax
hippocampal NSCs towards retinal cell types.
Bone marrow stem cells (BMSCs), which are far more easily obtained than
ESCs, also have restricted potential and offer potential therapeutic promise
(Ankeny et al., 2004; Kamada et al., 2005; Lu et al., 2005; Neuhuber et al.,
2005). Even though BMSCs are not linked to neural lineages, they have been
coaxed to produce neuron-like cells which express some retinal markers (Sun et
al.). Following transplantation into the subretinal space, BMSCs generate progeny
that express limited retinal markers (Lu et al.). However, there is substantially more
promise in using BMSCs to produce blood vessels, which may be useful to replace
vasculature lost in various retinal disease or to support the survival of degenerating
neurons. For example, following transplantation of BMSCs into the retina,
profound revascularization of retina was observed, which resulted in enhanced
survival of retinal neurons in models of retinal injury (Li et al., 2009; Yu et al., 2006;
Zhang and Wang). Evidence from these studies further suggests that the improved
circulation in these ischemic animal models provide an enhanced conduit for
trophic factor delivery which can enhance neuroprotection.
The adult human eye itself contains progenitor cells, which may be
influenced towards RGC fate (Ahmad et al.; Ballios and van der Kooy, 2010). In
lower vertebrates, such as teleosts, the ciliary marginal zone (CMZ) contains
stem cells that persist following development and generate new neurons in the
continually growing adult teleost retina (Easter and Malicki, 2002). Similarly, cells
in the ciliary body and a subpopulation of Müller cells in the human retina have
22
been shown to exhibit stem cell-like properties (Coles et al., 2004; Tropepe et al.,
2000) (Bhatia et al.). In injury models in lower vertebrates, Müller cells generate
new RGCs that then regenerate their axons down the optic nerve (Fischer et al.,
2002; Fischer and Reh, 2003). In mammals, unlike astrocytes, neither ciliary
body nor Müller cells proliferate in response to retinal injury However, they
display proliferative and multipotent capacity in vitro (Karl and Reh), and in adult
mice, optic nerve injury by transection or crush increases cell proliferation and
the expression of RPC markers in both the ciliary body and in Müller glial cells
and astrocytes in the retina (Lamba et al., 2010) (Bringmann et al., 2006). Thus,
stem cells residing in adult tissue, when expanded in vitro and differentiated into
the appropriate cells, may enable autologous transplantation-based therapy by
using the patient’s own eye as the donor cell source.
Patient-specific induced pluripotent stem cells (iPSCs) as a donor cell source are
reviewed in chapter 6.
Thus a number of stem cell sources may be available for therapeutic
development for glaucoma. They may have different advantages and
disadvantages including accessibility, reproducibility, patient-specificity, and,
importantly, potential for toxicity. As important will be figuring out what capacity
each has to help in RGC degenerative disease, and for that, stem cells may have
two important uses: replacing RGCs, which will require differentiation and
integration into the retina and visual pathway, or protecting RGCs from death, i.e.
neuroprotection (Fig. 1.4). Next we address progress being made on these two
fronts.
23
Figure 1.4 Retinal ganglion cells degenerate and die in glaucoma and other optic
neuropathies (middle and right), leaving fewer RGCs than in the normal retina
(left). Stem cells or cell therapies (red) for glaucoma or other retinal ganglion cell
degenerations could be used for neuroprotection of residual RGCs (green cells) through
trophic support (red triangles) or for cell replacement therapy (right). (NFL, nerve fiber
layer; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL,
outer plexiform layer; ONL, outer nuclear layer).
24
Cell Transplantation for RGC Replacement
The majority the research on retinal cell transplantation has concentrated
on pathologies involving photoreceptor degeneration (Gamm et al., 2007; Lund
et al., 2007; MacLaren et al., 2006; Wang et al., 2008). Lessons from recent
studies on photoreceptor replacement approaches suggest that cells further
along in differentiation may be more promising than stem and progenitor cells in
neuronal cell replacement therapy (Antin et al., 1991; Macklis, 1993; MacLaren et
al., 2006; Sheen and Macklis, 1995). For example, MacLaren et al. transplanted
dissociated retinal cells, including progenitors and post-mitotic retinal cells, from
various donor ages subretinally in mouse and found that that the post-mitotic rod
precursors rather than multipotent progenitors were capable of synaptically
reintegrating in the photoreceptor layer. They found that donor cells from ages
which marked the peak birthdates of rods had the most profound highly
structured morphological and synaptic integration. The transplantation of Nrl+
immature rod cells was capable of improving visually evoked potentials in genetic
models of mouse photoreceptor degeneration. Thus, we are only beginning to
understand the importance of the spatiotemporal state of a cell which can be
exploited to generate donor cells with the greatest potential for neuroprotection
and/or integration.
Compared to photoreceptors, we have made less progress in integrating
donor cells for RGC replacement. Transplantation of retinal progenitors from
various donor ages do not appear to generate newly born and integrated RGCs
in vivo (Goldberg et al., 2002) (Takahashi et al., 1998) (Young et al., 2000)
25
(Chacko et al., 2000) (Van Hoffelen et al., 2003). Unlike photoreceptors, RGCs
extend lengthy axons to specific targets in the brain in addition to making
complex
dendritic
connections
with
their
synaptic
partners
in
the
retina. Additionally, in order to be clinically applicable, enhancing graft integration
by altering the host retina must be accomplished without disturbing regular retinal
function. To add to the complexity, there are many different types of RGCs, each
with highly specialized properties which coordinate complex visual functions and
likely
draw
on
synaptic
plasticity
for
wiring
during
development.
Successful replacement of RGCs may require differentiation into specific cell
sub-types with highly specialized properties, the establishment of numerous
synaptic inputs, and the extension of an extremely long axon to precise brain
targets in a manner that preserves the retinotopic map. As such, various groups
are currently trying to understand how to coax cells in vitro to produce cells that
are further along in differentiation, on the premise they may be a more
transplantable cell source (MacLaren et al., 2006). It has not been addressed
whether purified RGCs, obtained acutely from the retina or derived from stem
cells in vitro, can integrate into the normal or injured adult retina, or what age or
stage during post-mitotic development maximizes donor RGC integration
following intraocular transplantation.
However, effective delivery of these cells is required before any of these
complex set of processes is accomplished. Can cells transplanted into the vitreal
surface of the retina get to the ganglion cell layer? Through an abundant array of
transplantation studies, intravitreally transplanted cells have been shown to
26
migrate in very close proximity with the inner retinal surface but rarely progress
past the inner limiting membrane (ILM) (Johnson et al.). Peeling away the ILM
prior to transplantation results in a dramatic increase in the migration of engrafted
cells into the retina (Johnson et al.). This suggests that a major impediment to
cell migration exists within the ILM. Is it the extracellular matrix or the Müller glial
endfeet? By degrading various component of the ILM selectively it was
determined that the integrity of the inner basal lamina is neither required nor
sufficient to stop grafted-cell infiltration into the retina. In contrast, suppression of
Müller cell reactivity dramatically enhanced graft integration (Johnson et al.). Is
migration or neurite growth inhibited in the adult retina, for example by signals
found elsewhere in an adult inhibitory CNS environment, such as chondroitin
sulfate proteoglycans? For example, treatment with chondroitinase ABC, digests
chondroitin sulfate proteoglycans (CSPGs) and promotes neurite outgrowth in
the spinal cord and in the retina (Nakamae et al., 2009) (Monnier et al.,
2003). Thus, achieving optimal neural integration may require manipulating the
host retina either prior to, in conjunction with, or following cell transplantation to
create a more permissive environment.
Although there has only been limited success in delivering cells to the
inner retina, many developmentally expressed molecular signals persist in the
adult retina, including netrin, an RGC axon chemoattractant, (Ellezam et al.,
2001); N-CAM (Doherty et al., 1990); and laminin along Müller glial endfeet in the
nerve fiber layer (Wolburg et al., 1991). During development, these signals
coordinate intra-retinal axon pathfinding as well directing axons to their targets in
27
the brain. These factors may provide the signals sufficient for supporting the
growth of new neurite fibers towards the optic nerve head and perhaps even
towards targets in the brain. Therefore, the persisting presence of these
developmentally critical signals is promising and could potentially be exploited to
signal newly integrated immature donor cells as occurs during development.
In order for newly integrated neurons to communicate and make functional
connections with the host retina, synapses must be formed between these cells.
Signals for RGC synapse formation such as thrombospondin (Christopherson et
al., 2005) may be downregulated during normal development but may be reexpressed in an injured retina. This suggests that many of the players involved in
the complex wiring of the retina during development may still be exploited to
guide the incorporation of new neurons following transplantation. Combinatorial
therapies that enhance migration, neurite growth, and synaptogenesis may be
required to capitalize on the integration potential of transplanted cells.
Does the degenerating retina enhance integration of donor cells through
signaling changes? Targeted apoptotic neurodegeneration has been used to
produce highly controlled spatially and temporally specific cell death of selected
types of projection neurons within defined regions of the cortex. Photo-activated
induction of cell death in the neocortex affects migration and differentiation of
transplanted neurons as well as transplanted neural precursors (Madison and
Macklis, 1993; Sheen and Macklis, 1994; Shin et al., 2000; Snyder et al., 1997).
In these experiments, later-stage and region-specific immature neurons
integrated when transplanted back into injured adult cortex where they usually
28
are located more efficiently than after transplantation to ectopic regions of injured
cortex. However, at postnatal stages of development, limits in the survival of the
donor, immature cortical neurons offset this improved efficiency (Fricker-Gates et
al., 2002). Thus, it remains largely unknown how the retina with glaucoma or
other optic neuropathies responds to cell-based therapies compared to normal
retina but understanding the changes following injury will provide insight to
answering some of these questions.
Cell Transplantation for RGC Neuroprotection
Cell-based neuroprotective therapies geared to providing nourishment and
support to surrounding host neurons are more straightforward compared to cell
replacement therapies that attempt to replace and functionally re-integrate neural
circuits. To provide a neuroprotective benefit, transplanted cells must survive and
secrete trophic factors into the host tissue. There is strong evidence that
demonstrates that intraocular cell transplantation could benefit a variety of optic
neuropathies by providing trophic support to surviving tissue or by encouraging
endogenous neuroprotective pathways (Lund et al., 2007). Cellular therapy could
provide long-lasting and potentially chronic neuroprotection, a potential
advantage over pharmacological approaches that require more frequent dosing.
Furthermore, specific cues could be exploited to guide stem cell migration to
appropriate
areas
for
focal
delivery
with
far
better
resolution
than
pharmacological injection. Complex contact-mediated mechanisms, which would
be difficult to mimic synthetically, could be exploited to further support and
protect persisting neurons in optic neuropathies. Such stem cell behavior has
29
been observed in various neuropathological models, and has been particularly
well-characterized following stroke (Felling and Levison, 2003; Tai and
Svendsen, 2004).
In addition to supplying trophic factors, transplanted cells may also be able
to modify the pathological environment to promote neuronal survival. As an
example, stem cells derived from the subventricular zone have been found to
modify the local environment directly through immunomodulatory mechanisms
(Pluchino et al., 2005) or by influencing gene expression in surrounding neurons
(Madhavan et al., 2008). In addition, integration of glial precursor cells, which
possess active glutamate transporters, into organotypic spinal cord cultures
enhanced glutamate uptake and reduced motor neuron cell death, possibly
through reducing glutamate excitotoxicity (Maragakis et al., 2005). Furthermore,
unlike in the peripheral nervous system, CNS neurite outgrowth following injury is
very limited. This lack of regeneration after injury appears to be due to the
combination of a lack of neurotrophic signals in the adult CNS, which promote
regenerative growth, and presence of inhibitory cues in the CNS environment.
The production and release of neurotrophic factors by neural stem cells promotes
axonal regrowth in the adult injured spinal cord (Bankfalvi et al., 2003) and,
therefore, release of neurotrophic factors by engrafted cells might have beneficial
consequences beyond neuroprotection alone. As mentioned earlier, BMSCs, in
numerous studies, provided trophic support resulting in increased neuronal
sparing in multiple injury models although the mechanism(s) at work remain only
speculative. Perhaps combinational cell type therapies consisting of neuronal-
30
induced cells and BMSCs and will work in concert to produce and efficiently
deliver trophic factors to degenerating neurons.
Advances in the efficacy and safety of gene delivery to stem cells have
increased interest in generating genetically modified stem cells donor cells that
can be designed to secrete even more neuroprotective factors. Outside the
retina, evidence from a Parkinson's disease mouse model demonstrates that the
engraftment of neural stem cells engineered to express GDNF was found to
improve the degeneration of dopaminergic neurons following injury (Akerud et al.,
2001) which resulted in significant and lasting improvements in the behavioral
impairments associated with this injury model. A number of groups have now
demonstrated substantial protection by engineered stem cells in various models
of ischemic disease. For example, a significant improvement in reducing
neurological degeneration was observed in a rat transient focal cerebral ischemia
model following the engraftment of neural stem cells, modified in vitro to express
VEGF compared to naive NSCs (Zhu et al., 2005). Furthermore, the
transplantation of human neural stem cells overexpressing VEGF into the cortex
overlying an intracerebral hemorrhage lesion has been shown to improve survival
of engrafted cells, stimulate host angiogenesis and recover functional loss in
mice (Lee et al., 2007). In a similar set of experiments, the introduction of
mesenchymal stem cells (MSCs) transfected to express BDNF after permanent
middle cerebral artery obstruction was found to reduce lesion size and improve
function (Nomura et al., 2005). Furthermore, in this model, stem cells engineered
to produce BDNF provided greater neuroprotection than that observed following
31
the delivery of naive cells. While these techniques are yet to be applied to model
of glaucoma, there is new evidence which demonstrates that the transplantation
of BDNF-secreting MSCs provides neuroprotection in chronically hypertensive rat
eyes. Further investigation will need to be done to see whether this attractive
therapeutic approach holds promise the treatment of chronic neurodegenerative
retinal and optic neuropathies.
Conclusions
Thus stem cell transplantation provides new therapeutic avenues to
combat the irreversible loss of RGCs associated with glaucoma and other CNS
diseases. For treatments to reach patients, many obstacles must be overcome,
including the regulation of differentiation, integration, lasting survival, as well
issues regarding efficacy and safety. For now, the retina provides an accessible
window into important questions about how cell-based therapies could be
harnessed to fight neurodegeneration throughout the CNS. With deeper
understanding of the cellular and molecular basis of these complex processes,
the true potential of stem cell-based therapy in retinal repair will be realized, and
with time and careful consideration, transitioned into the clinic.
Chapter 2
Novel regulatory mechanisms for the SoxC transcriptional network
required for visual pathway development
Chapter summary
The mechanisms sufficient to specify retinal ganglion cell (RGC) fate in
the developing retina remain largely obscure. Here we report on mechanisms by
which a new molecular pathway involving Sox4/Sox11 required for RGC
differentiation and for optic nerve formation in vivo, and sufficient to differentiate
human induced pluripotent stem cells into electrophysiologically active RGCs.
We show REST inhibition of differentiation depends on suppression of Sox4
expression, and provide evidence for a novel soluble regulator, TGFβ family
member GDF-15, which also acts through Sox4 to induce RGC differentiation.
These data further describe a Sox4-regulated SUMOylation site in Sox11, the
first SUMO site identified in the SoxC family, which decreases Sox11’s nuclear
localization
and
suppresses
its
pro-RGC
activity,
explaining
familial
compensation. These data define novel regulatory mechanisms for this SoxC
molecular network, and suggest pro-RGC molecular manipulations which may
provide potential promise for cell replacement-based therapies for glaucoma and
other optic neuropathies.
Motivation
What are the molecular signals that regulate neural cell fate? For example,
retinal ganglion cells (RGCs) are born from multipotent retinal progenitor cells
(RPCs) during embryonic development, but little is known about the cell
32
33
autonomous mechanisms and environmental signals that specify RGC fate. The
bHLH transcription factor Math5 is necessary but not sufficient for RGC fate, as
Math5 expression is found in RPCs that differentiate into nearly all the cell types
in the retina (Brown et al., 2001; Wang et al., 2001). Later, the POU-domain
transcription factor Brn3b is directly downstream of Math5 in the regulatory
hierarchy for RGC differentiation (Gan et al., 1996), and is a highly specific
marker for RGCs in the retina. However, although Brn3b can promote the
expression of certain RGC markers when overexpressed and is required for RGC
survival after initial differentiation, Brn3b itself is not required for RGC cell fate
specification (Badea et al., 2009; Gan et al., 1999), as the number of RGCs born
in Brn3b-null retinas resembles that observed in wild-type retinas (Gan et al.,
1999).
Repressors of RGC differentiation have also been identified. The
repression of Math5 by secreted Growth/Differentiation Factor-11 (GDF-11)
determines the time window for RGC fate determination (Kim et al., 2005).
REST/NRSF also negatively regulates RGC differentiation, as a REST knockout
increases RGC numbers even in a Math5-null retina (Mao et al., 2011) ,
suggesting a Math5-independent regulatory pathway must exist that promotes
RGC differentiation. Together these data suggest that unknown regulatory
pathways function in parallel to Math5 and upstream of Brn3b.
The SoxC family, consisting of the three closely related transcription
factors Sox4, -11, and -12, are critical oncogenes that are among the most highly
expressed genes in a number of cancers (Penzo-Mendez, 2010). They also play
34
a role in differentiation in the nervous system (Dy et al., 2008), where they have
been identified as regulators of spinal motorneurons (Thein et al., 2010) and of
adult hippocampal neurogenesis (Mu et al., 2012). In both of these cases,
phenotypes from knocking out single SoxC family members were mild; knocking
out expression of at least two family members has been required to see
significant loss of neuronal differentiation, but molecular mechanisms for this
cross-compensation have not been proposed. Sox4 and Sox11 were explored in
retinal development; effects on RGC differentiation were missed in one case
(Usui et al., 2013a; Usui et al., 2013b), as the Sox11 knockout is embryonic
lethal and demonstrates numerous other developmental defects including
microphthalmia and cardiovascular maldevelopment (Penzo-Mendez, 2010).
By using floxed alleles of Sox4 and Sox11, we now identify these
transcription factors as necessary and sufficient for RGC differentiation and optic
nerve formation in vitro and in vivo, consistent with another recent report (Jiang
et al., 2013). We go beyond this observation to identify a regulatory network,
providing evidence that Sox4 is the missing transcription factor target of REST as
well as of a novel pro-RGC factor GDF-15, and promotes RGC development
without regulating Math5 expression. Furthermore, we identify a novel molecular
mechanism for compensatory activity of Sox11 in the absence of Sox4, through a
newly identified SUMOylation biochemistry that regulates Sox11 nuclear
localization and activity in a Sox4-dependent manner. The conservation of this
pro-RGC activity in human induced pluripotent stem cells (iPSCs) suggests a
robust phenotype that may have implications for therapeutic approaches.
35
Material and Methods
Animals
All use of animals conformed to the Association for Research in Vision
and Ophthalmology (ARVO) Statement for the Use of Animals in Research, and
was approved by the Institutional Animal Care and Use Committee (IACUC) and
the Institutional Biosafety Committee of the University of Miami. Sprague-Dawley
rats of varying ages were obtained from Harlan Laboratories. Mice were bred
from the following strains: C57BL/6-Tg(CAG-EGFP)10sb/J (Stock #003291,
Jackson Laboratory), Math5-Cre (generous gift from Lin Gan), floxed Sox4,
floxed Sox11, floxed Sox4/11 dKO (generous gift from Veronique Lefebvre),
Chx10-cre (Stock #005105, Jackson Laboratory).
Mice genotyping
Genotyping
was
performed
using
standard
tail-derived
genomic
DNA
preparations, followed by PCR as follows. Sox4 (Penzo-Mendez et al., 2007):
FP1:
5-GAAGGAGGCGGAGAGTAGACGG,
RP:
5-
CATAGCTCAACACAAATGCCAACGC; standard buffer supplemented with 2%
DMSO; a denaturation step at 94C for 1.5 min was followed by 35 cycles at 94°C
for 30 s, 65°C for 75 s, and 72°C for 90 s, and an extension step for 10 min at
72°C. The Sox4+ PCR product is 450 bp, the Sox4 floxed PCR product is 520
bp. Sox11 (Bhattaram et al., 2010): FPA: TTCGTGATTGCAACAAAGGCGGAG;
RPA: GCTCCCTGCAGTTTAAGAAATCGG; standard buffer supplemented with
2 mM MgCl2. A denaturation step at 94C for 3 min was followed by 35 cycles of
94°C for 30 sec, 65°C for 75 sec and 72°C for 60 sec, followed by a final
36
extension step at 72°C for 7 min. The Sox11+ PCR product was 319 bp, the
Sox11 floxed PCR product 467 bp. Sox12 (Bhattaram et al., 2010): FPA:
CCTTCTTGCGCATGCTTGATGCTT; RP: GGAAATCAAGTTTCCGGCGACCAA;
standard buffer supplemented with 2.75 mM MgCl2. A denaturation step at 94°C
for 3 min was followed by 35 cycles of 94°C for 30 sec, 65°C for 75 sec and 72°C
for 60 sec, followed by a final extension step at 72°C for 7 min. The Sox12+ PCR
product is 324 bp. Math5-cre (Brown et al., 2001): For Math5 WT Allele: F: CGC
CGC ATG CAG GGG CTC AAC ACG; R: GAT TGA GTT TTC TCC CCT AAG
ACC C; 2% DMSO in 10X MasterAmp (Epicentre), with a denaturation step at
94°C for 5 min followed by 40 cycles at 94°C for 30 sec, 60°C for 1 min, and
72°C for 1 min, and an extension step for 7 min at 72°C. The Math5 PCR product
is 243 bp. For Cre (Moore et al., 2009) and cre genotyping from Jackson
Labs, http://jaxmice.jax.org/protocolsdb/f?p=116:2:2962341307852512::NO:2:P2
_MASTER_PROTOCOL_ID,P2_JRS_CODE:288,006143) oIMR0042: CTA GGC
CAC AGA ATT GAA AGA TCT; oIMR0043: GTA GGT GGA AAT TCT AGC ATC
ATC C; oIMR1084: GCG GTC TGG CAG TAA AAA CTA TC; oIMR1085: GTG
AAA CAG CAT TGC TGT CAC TT. A denaturation step at 94°C for 3 min was
followed by 35 cycles at 94°C for 30 sec, 51.7°C for 1 min, and 72°C for 1 min,
and an extension step for 2 min at 72°C. The Cre transgene PCR product is
~100 bp, the internal positive control is 324 bp. CHX10-cre PCR as above, F:
GCG GTC TGG CAG TAA AAA CTA TC; R: GTG AAA CAG CAT TGC TGT
CAC TT.
37
Retinal cell dissociation
Embryonic retina from timed-pregnant animals and postnatal mice were
euthanized and retinas were dissected and dissociated with papain (Worthington)
in DPBS (Invitrogen). Retinas were incubated at 37C for 30m. Retinas were then
gently triturated into single cell suspension with ovomucoid inhibiters (Roche).
The cell suspensions were counted by hemocytometer and spun down and
resuspended in either media for cell culture or protein lysis buffer for protein
analysis (see below). Detailed protocols are available on request.
Lipofectamine-based overexpression
Following dissociation, retinal cells were plated at 100 cells/µl on poly-Dlysine (PDL) (70 kDa, 10 µg/ml; Sigma) and laminin (2 mg/ml; Telios/Invitrogen)
coated dishes in a serum-free, defined medium as described containing BDNF
(50 ng/mL; Peprotech), CNTF (10 ng/mL; Peprotech), insulin (5 µg/mL;
Invitrogen), and forskolin (5 µM; Sigma).(Barres et al., 1988; Meyer-Franke et
al.). Following overnight culture, cells were transfected with either GFP plasmid
for control or double transfected with GFP and gene of interest with
Lipofectamine LTX (Invitrogen). Cells were cultured for 4 days, fixed with PFA,
counterstained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) for nuclei
and for the RGC marker Brn3 (Santa Cruz) (see below for immunostaining
protocol). Cells were imaged under fluorescence microscopy (Zeiss) and the
Brn3+,GFP+ out of total GFP+ cells were quantified. Detailed protocols are
available on request.
38
Lentiviral-based overexpression and shRNA knockdown
For viral transduction-based overexpression, retinal cells were plated at 50
cells/µl on poly-D-lysine (PDL) (70 kDa, 10 µg/ml; Sigma) and laminin (2 mg/ml;
Telios/Invitrogen) coated dishes in a serum-free, defined medium as described
containing BDNF (50 ng/mL; Peprotech), CNTF (10 ng/mL; Peprotech), insulin (5
µg/mL; Invitrogen), forskolin (5 µM; Sigma) and EdU (5 μM, Invitrogen) (Barres et
al., 1988; Meyer-Franke et al.). Following overnight culture, cells were exposed
to GFP (control) or gene of interest viral particles (about 1 µL virus with titers 107108 into each 24 well plate well) for overexpression experiments, followed by a
rinse into fresh media at 6 hours. For knockdown experiments, scrambled shRNA
(Santa Cruz) were used as control and commercially available shRNA lentiviral
particles against Sox11 mRNA were used at an MOI of ?(see below for viral
particle production and titer determination). Cells were cultured for 5 days, fixed
with PFA, counterstained with DAPI (4′,6-diamidino-2-phenylindole, Invitrogen),
Brn3 (Santa Cruz) and EdU (Invitrogen) (see below for immunostaining and EdU
Click-it protocol). Cells were imaged under fluorescence microscopy (Zeiss) and
the Brn3+, EdU+, GFP+ out of total Edu+,GFP+ cells and the Brn3+, Edu-,GFP+
out of GFP+ were quantified. Detailed protocols are available on request.
Exogenous factor differentiation assay
To test the effects of exogenous factors on RGC differentiation, cells were
cultured at 50 cells/µl on poly-D-lysine (PDL) (70 kDa, 10 µg/ml; Sigma) and
laminin (2 mg/ml; Telios/Invitrogen) coated dishes in a serum-free, defined
medium as described containing BDNF (50 ng/mL; Peprotech), CNTF (10 ng/mL;
39
Peprotech), insulin (5 µg/mL; Invitrogen), forskolin (5 µM; Sigma) and EdU (5 uM,
Invitrogen). Cell were plated in the presence of vehicle for control (PBS) or 50
ng/mL GDF-11 (Peprotech) or 50 ng/mL GDF-15 (Peprotech). Cells were
cultured for 5 days, fixed with PFA, counterstained with DAPI (4′,6-diamidino-2phenylindole, Invitrogen), Brn3 (Santa Cruz) and EdU (Invitrogen) (see below for
immunostaining and EdU Click-it protocol).
Cells were imaged under
fluorescence microscopy (Zeiss) and the Brn3+, EdU+ out of total Edu+ were
quantified.
Immunostaining
Cells in culture were fixed with room temperature 4% PFA for 15 mins and
washed 3x with PBS. were rinsed three times with PBS. Cells were
permeabilized with 0.1% Triton-X100 along with the primary antibodies (see table
for specific antibody and concentration) and incubated overnight at 4°C.
Secondary detection was performed with fluorescent antibodies at a 1:500
(Alexa-488, 596, 647; Invitrogen) which were incubated overnight at 4°C. Nuclei
were counterstained with DAPI (blue) in PBS for 5 mins before a 3x rinse with
PBS
(Carl
Zeiss
Meditec,
Inc.)
removed
unbound
secondary.
Cells
immunostained with the same antibody were exposed to the same fluorescence
intensity. Cells were imaged under fluorescence microscopy (Zeiss) and
exposure was carefully controlled to maximize comparison between control and
experimental groups.
Flatmount retinas were fixed in 4% paraformaldehyde for 30 minutes and
either placed on glass slides or further processed for cryosectioning. The
40
samples isolated for cryosectioning were incubated in 30% sucrose overnight
and then frozen in Optimal Cutting Temperature solution (OCT; TissueTek) using
liquid nitrogen. Both flatmount samples as well as retinal sections were
simultaneously blocked and permeabilized with 20% donkey serum and 0.4%
Triton X-100, respectively, for 30 mins. Flatmount retinas and retinal sections
were then incubated in primary antibodies, including Anti-Brn-3 (1: 200;
SantaCruz;
goat
polyclonal),
anti-βIII
tubulin
(1:200;
Covance;
mouse
monoclonal) and rat anti-melanopsin (1:100; generous gift from K.-W. Yau).
Retinal samples were rinsed three times with PBS and incubated with the
matching secondary antibody for ON at 4° C. Fluorophore conjugated secondary
antibodies (1:500; Invitrogen) were used to label primary antibodies. The retinal
samples were then sealed with coverslips on slides with Vecta-Shield (Vector
Labs) solution containing DAPI nuclear stain. EdU staining was conducted using
the Click-iT® EdU cell proliferation assay (Invitrogen). Other antibodies included
Sox4 (1:100, Santa Cruz); Sox11 (1:100, Santa Cruz); Chx10 (1:100, Millipore);
Pax6 (1:100, DSHB); Glutamine Syntase (1:10,000, Sigma); Cone-specific
arrestin (1:100, generous gift from Cheryl Craft); Recoverin (1:500, Millipore).
In vivo EdU tagging
E16 timed pregnant animals were injected with 1 mL of 10 mM EdU
solution. Animals were sacrificed 1 hour later. Embryos were fixed in 4% PFA,
embedded in OCT and cryosectioned. EdU staining was conducted using the
Click-iT® EdU cell proliferation assay (Invitrogen) in conjunction with Brn3
staining (see immunostaining protocol)
41
Retinal explant immunostaining
Retinal explant culture was performed as described previously (Johnson
and Martin, 2008). Briefly following mouse sacrifice, adult mouse eyes were
enucleated and transferred to cold 4% PFA for 1 hour. Eyes were then rinsed in
PBS 3x for 5 minutes each. The cornea and lens were removed and the neural
retina was teased off the retinal pigment epithelium with special care taken not to
disturb the retinal ganglion cell side of the retina. The retinas were than mounted
onto slides with the ganglion cell layer upwards. The chamber was transferred to
a six-well culture plate containing RGC medium as above. Fixed retina were
counterstained with DAPI to highlight nuclei and immunostained with Brn3
(1:100, SantaCruz) and βIII-tubulin (1:200, Covance) and imaged using confocal
microscopy (Leica). Confocal microscopy was used because neurite outgrowth
occurred in 3-dimensions, and tissue sections would only contain a limited view
of the neurite outgrowth of each cell. Thus, whole mount retinas were imaged to
allow a broader, clearer image in the xy plane while retaining z-plane capabilities.
RGC Purification and Culture
RGCs
were
acutely
purified dissociated
retina
(see
above)
by
immunopanning with anti-the CD90 (Thy1.2; AbD Serotec) antibody, yielding
99.5% pure RGCs (Goldberg et al.; Meyer-Franke et al.). Purified primary RGCs
were cultured overnight in serum-free, defined medium as described containing
BDNF (50 ng/mL; Peprotech), CNTF (10 ng/mL; Peprotech), insulin (5 µg/mL;
Invitrogen), and forskolin (5 µM; Sigma).(Barres et al., 1988; Meyer-Franke et
al.). Cells were fixed and immunostained following protocol described above.
42
Quantitative RT-PCR
RNA was isolated from mouse RPCs (E14) with RNeasy Kit (QIAGEN).
DNase treatment was performed for all the RNA samples before RT. Then the
equal amount of RNAs was used for RT reaction according to manufacturer’s
instruction (iScript, cDNA Synthesis Kit, Bio-Rad). The qPCR was performed
using primers listed below and the SYBR Green Master Mix Kit (iQ SYBR Green,
Bio-Rad) in “iQ5 Multicolor Real-Time PCR Detection System” (Bio-Rad). Gene
expression levels were normalized to reference gene Cyclophilin A. Primer pairs
used for QPCR: Sox4: Forward: 5’- atgaacgcctttatggtgtggtcg -3’, Reverse: 5’ acggaatcttgtcgctgtccttga -3’; Brn3b: Forward: 5’–tctgcaaccagaggcagaaacaga -3’;
Reverse:
5’- tggtctgggttcacatttaccgga – 3’. Cyclophilin A: Forward:
5’-
agcatacaggtcctggcatc -3’; Reverse: 5’ – ttcaccttcccaaagaccac -3’;
SUMOylation prediction
FASTA sequences for mouse Sox4 and Sox11 were acquired from
EntrezGene and entered into SUMOsp2.0 SUMOylation prediction software
(CUCKOO, Japan). Scores were tabulated and compared to known SUMOylated
sample
proteins.
The
SUMOsp
2.0
software
is
freely
available
at: http://sumosp.biocuckoo.org.
Co-Immunoprecipitation
Mouse RPCs (E14-E15) were resuspended and lysed in lysis buffer
(125mM Tris-HCl, pH7.5, 100mM NaCl, 0.1% genapol C-100, 0.1% Trehalose),
supplemented with 20mM N-ethylmaleimide (Sigma), 10mM iodoacetamide
(Sigma) and protease Inhibitor (Roche Applied Science). After incubated on ice
43
for 5 minutes, the protein lysates were spin at 4C and 15,000 rpm for 5 minutes,
and the supernatants were collected. For Co-immunoprecipitation , the cell
extracts were incubated with anti-Sumo-1 antibody (Santa Cruz Biotechnology)
at 4C overnight, then with protein-G sepharose beads (EMD Millipore) 2-4 hours.
The beads were washed 3 times with lysis buffer and the proteins were eluted in
2x Laemmli Buffer. For Western Blots, the samples were boiled at 100C for 5
minutes, equal amount of proteins from cell lysates were loaded on the SDS
PAGE. Then proteins were transferred to PVDF membrane and incubated with
primary antibody anti-Sox11 (Santa Cruz Biotechnology) or anti-Sox4 (Santa
Cruz Biotechnology) at 4C overnight. The chemiluminescent detection of
horseradish peroxidase-conjugated secondary antibodies was performed using
the West Pico or West Femto Substrate Kit (Thermo-Pierce) according to the
manufacturer’s instructions.
Sox4, Sox11 and Math5 Lentiviral plasmids construction and Sox11 Mutagenesis
The 1323 bp Sox4 (GenBank accession: NM_009238) or the 450 bp
Math5 (GenBank accession: BC092234) coding region sequences were
subcloned into Lentiviral expression vector “pLenti-RRLsinPPT” respectively. The
cloning sites were XbaI and AgeI. And the reporter gene “m-cheery” was fused
in-frame into the 3’ end Sox4 or Math5 at AgeI and SalI sites to replace “EGFP”
gene. For Sox11, coding region sequence (GenBank accession: NM_009234)
was subcloned into Lentiviral expression vector “pLenti-Jess2A” 5’ end of the
GFP gene. The insertion sites were BamHI and SalI, which replaced the “mcherry”. The Sox11 point mutant (K91A Sox11) was generated using the “Quick II
44
XL Site-Directed Mutagenesis Kit” (Stratagene). The WT Sox11 plasmid was
used as a template to construct the N-terminal mutation at encoding amino acid
sequence 91 changing from Lys to Arg (nuclear acid coding sequence from
“AAG” to “AGG”). Then “K91A Sox11” was cloned into “pLenti-Jess2A” vector
with restriction sites at BamHI and SalI. Also, the Sox4 coding region gene was
cloned into the same “pLenti-Jess2A” plasmid at the same BamHI and SalI
restriction sides too. All the constructs were verified by sequencing and all the
empty Lentiviral vectors were the generous gifts from the “Viral Vector Core
Facility”, which is located at University of Miami Medical Campus. All the oligo
primers used for DNA constructs and generation of mutant are as follows: Sox4
(with
pLenti-RRLsinPPT
vector)
accgactctagagccatggtacaacagaccaacaac
Forward:
-
catggtaccggtgtaggtgaagaccaggttagagatgc
–
accgactctagaatgaagtcggcctgcaaaccc
-3’,
catggtaccggtgctggccatggggaagg
–
3’;
gccagcaccggtaccatggtgagcaagggc
–
ttgattgtcgacctacttgtacagctcgtccatgcc
-
gctaggctccaggtagaccctgag
ggcattaaagcagcgtatccacatag
–
–
3’;
Reverse:
Math5
3’,
Forward:
5’
Forward:
Sequencing
5’
5’
Sequencing
–
–
primer#1
primer
–
5’-
Reverse:
Sequencing
3’;
5’-
Reverse:
mCherry
3’;
3’;
3’,
5’-
5’
–
#2
5’
–
primer#3
5’
–
tcgaactcgtggccgttcacggagc – 3’; Sox4 (with pLenti-Jess-2A vector); Forward: 5’
–
cgtacgggatccgccatggtacaacagaccaacaac
cttccgactagtgtaggtgaagaccaggttagagatgc
ggcgtacgggatccatggtgcagcaggccga
–
–
–
3’;
3’,
3’,
Sox11
Reverse:
5’
Forward:
Reverse:
5’
5’
–
–
–
45
ggtaccccggtcgacatacgtgaacaccaggtcggaga – 3’; K91ASox11 (to make Sox11
mutant) Forward: 5’ – cgctggaagatgctgagggacagcgagaagatcccg – 3’, Reverse:
5’ – cgggatcttctcgctgaccctcagcatcttccagcg – 3’; Sequencing primer#1 5’ –
acacgctgaacttgtggccgtttacg
–
3’;
Sequencing
primer
#2
5’
–
ggcattaaagcagcgtatccacatag – 3’.
Overexpression in HEK cells
293T cells (ATCC) were cultured in 10% FBS/DMEM (Invitrogen) until
80% confluency was reached. Cells were than transfected with the gene of
interest using the Lipofectamine LTX kit (Invitrogen). Cells were cultured for 2
days and then either fixed for immunostaining or lysed for protein.
Human IPS cell culture and RGC differentiation
Commercially available iPScs (System Biosciences) derived from human
foreskin fibroblasts were cultured on (A) Mouse Eradicated Fibroblast (MEF)
feeder layers (GlobalStem) and in (B) feeder-free conditions on BD Matrigel in
mTesr1 medium (Stem Cell Technologies) supplemented with ROCK inhibitor
(10 μm Y-27632 (StemGent) and 1 μm Thiazovivin (StemGent). iPS colonies
were dissociated to single cell suspension in ultra-low adherence wells. Media
was supplemented with Lefty A (R&D Systems) and DKK1 (R&D Systems). To
confirm RPC induction, a subset of cells were fixed and immunostained for the
RPC markers Pax6 (DSHB) and Rx (Santa Cruz). Embyroid bodies were
dissociated into ≤ 100 µm aggregates and single cells by a 1:1 ratio treatment
with Accutase and Accumax (StemGent) and plated onto PDL- and laminincoated 35 mm dishes and 24-well plates. Cells were then infected with 6 µL of
46
lentiviral particles (3.5X107 pg/ml p24) containing either Lenti-eGFP (control
virus), Lenti-Math5-RFP, Lenti-SOX4-2A-eGFP, or Lenti-Math5-RFP plus LentiSOX4-2A-eGFP at a 1:1 ratio. Cells were cultured in serum-free, defined medium
as described containing BDNF (50 ng/mL; Peprotech), CNTF (10 ng/mL;
Peprotech), insulin (5 µg/mL; Invitrogen), and forskolin (5 µM; Sigma).(Barres et
al., 1988; Meyer-Franke et al.). Following 7 days in culture, cells were fixed and
immunostained for the RGC marker Brn3 (see immunostaining section)
Patch clamp electrophysiology
Whole cell patch clamp recordings were performed on Math5 and Sox4overexpressing iPSC-derived neurons cultured on tissue culture plates coated
with poly-D-lysine and laminin. The pipettes were made from borosilicate glass
pulled on a Sutter P-97 (Sutter Instrument, CA) to tip resistances of 4 to 6 MΩ.
The external bath solution contained (in mM): NaCl 140, CaCl 2 2, MgCl 2 1,
HEPES 5, dextrose 3; the pipette solution contained (in mM): K-gluconate 100,
CaCl 2 5, EGTA 10, HEPES 10. Current clamp recordings were made using an
Axopatch 200B amplifier (Molecular Devices, CA), filtered at 10 kHz with a low
pass Bessel filter (Ithaco, Ithaca, NY), and digitized with a Digitimer (Molecular
Devices, CA). Pipette resistance was compensated by adjusting pipette offset.
After break-in, the cells were held at -60 mV and stimulated with 10 ms and 200
ms current pulses over a range of amplitudes. Traces were analyzed using
Clampfit 9.2 (Molecular Devices, CA).
47
Results
To identify novel candidate transcription factors, we first explored
developmental microarray expression data derived from acutely purified
embryonic, postnatal and adult RGCs (Mu et al., 2005; Wang et al., 2007).
Genes were selected that were defined by Gene Ontology database to be
regulators of transcription and strongly expressed in embryonic RGCs. To test
these transcription factors for their potential regulation of RGC differentiation, we
performed a high throughput in vitro RPC overexpression screen (Fig. 2.1A and
B). The screen uncovered Sox4 and the closely related Sox11 transcription
factors to be potential regulators of RGC differentiation (Fig. 2.1C). To determine
that the effect of Sox4 and Sox11 overexpression on RGC differentiation occurs
before RPCs exit their final cell cycle, retinal cells were cultured with the
thymidine analog EdU. Sox4 and Sox11 overexpression of EdU-tagged
embryonic RPCs increased RGC differentiation compared with control GFP
overexpression (Fig. 2.1D). In both assays, Sox4 had a significantly stronger
positive effect on RGC differentiation compared to Sox11. Neither Sox4 nor
Sox11 overexpression in EdU-/Brn3+ RGCs (primary RGCs differentiated in vivo
before plating into culture) affected RGC numbers (Fig. 2.1E), suggesting no
effect on survival of differentiated RGCs. Taken together, the increase in
differentiated RGCs following Sox4 and Sox11 overexpression suggests that the
SoxC subfamily of transcription factors are sufficient for directing embryonic
RPCs towards the RGC fate and that these transcription factors may be
important for RGC development.
48
Figure 2.1 Sox4 and Sox11 overexpression is sufficient to potentiate RGC
differentiation. (A to B) Nestin+ (red) embryonic day 14 (E14) retinal progenitor cells
(RPCs) were transfected with a GFP reporter plasmid (green, transfected cells) and the
gene of interest and counterstained with DAPI (4′,6-diamidino-2-phenylindole) for nuclei
(blue) and for the RGC marker Brn3 (red), as marked. (C) Following transfection with
genes as marked, RPCs were cultured in pro-RGC survival conditions for 4 days, fixed
and immunostained, and Brn3+,GFP+ out of total GFP+ cells were quantified.
Overexpression of Math5, Sox4, and Sox11 increased the total number of GFP+,Brn3+
cells (mean ± SEM, *P < 0.01, N=3, ANOVA with post hoc Dunnett’s test, mean ± SEM).
(D) RPCs were differentiated in the presence of EdU (5uM) for 5 days and
immunostained for the RGC marker Brn3 and EdU. Sox4 and Sox11 overexpression
with lentivirus increased RGC differentiation (Brn3+,GFP+,EdU+ cells) of proliferative,
transfected RPCs (GFP+,EdU+) compared with control GFP overexpression. (*p<0.02,
paired t test; mean ± SEM; all samples differ significantly from each other) (E) Sox4 and
Sox11 overepxression with lentivirus had no effect on the survival or total number of
RGCs that were post-mitotic in vivo and then placed in culture (Brn3+, GFP+, EdUcells) (*p<0.02, paired t test; mean ± SEM).
49
We next asked if Sox4 and Sox11 mRNA and protein are present in the
developing retina. In situ hybridization for Sox4 (Fig. 2.2A) and Sox11 (Fig. 2.2D)
mRNA demonstrated that both genes are expressed in embryonic retina and
concentrate in the innermost part of the developing retina where the ganglion cell
layer (GCL) will emerge (image courtesy of www.genepaint.org). Developmental
expression profiling of acutely purified RGCs revealed high embryonic Sox4 (Fig.
2.2C) and Sox11 (Fig. 2.2F) mRNA expression that went down throughout
development but remained expressed in postnatal and adult RGCs (Wang et al.,
2007). We next examined the spatiotemporal expression of Sox4 and Sox11
protein through retinal development. At P10, Sox4 and Sox11 were
immunodetected in cells positive for the RGC marker Brn3 (Fig. 2.2C, F);
antibody specificity was confirmed using Sox4 knockout tissues as negative
controls (Fig. 2.2G). Interestingly, we observed Sox4 mostly present in RGC
nuclei (Fig. 2.2C, right) while Sox11 was observed in RGC cytoplasm (Fig. 2.2F,
right). We also observed Sox4 and Sox11 in displaced amacrine cells in the
ganglion cell layer (GCL) and in amacrine cells of the inner nuclear layer (INL)
(Fig. 2.2G). In cultured E14 retinal cell suspension, Sox4 was co-expressed only
in βIII-tubulin-positive cells (~30% of the total cells) (Fig. 2.2H) and co-localized
with Brn3 (Fig. 2.2I) in the nuclei of RGCs (which are ~15% of the retinal cells at
this stage in development). In purified mouse P2 RGCs, Sox11 was present
mostly in RGCs’ cytoplasm (Fig. 2.2J, right). Furthermore, western blot of
embryonic retinal lysate for Sox4 (Fig. 2.2K) showed a single 47 kDa band and
western blot for Sox11 (Fig. 2.1O, right) demonstrated multiple bands including
50
Figure 2.2 Sox4 and Sox11 are developmentally regulated in retinal ganglion cells
Sox4 and Sox11 are detected in RGCs by in situ hybridization of E14 embryos (A, D;
www.genepaint.com), by microarray (B, E; (Wang et al., 2007)), and by
immunofluorescence in P10 retinal sections (C,F). (G) Sox4 antibody specificity was
confirmed by immunostaining on control and Sox4 KO tissue. (H,I) Dissociated E14
retinal cells were cultured overnight (8 hours), fixed and immunostained for either the
neuronal marker βIII-tubulin or Brn 3 as marked. (J) Sox11 was immunodetected
primarily cytoplasmically in E18 RGCs. (K) Western blot of E14 retinal protein lysates
detects Sox4 and Sox11. Scale bars, 30 µm.
51
60, 90, 120, 160 kDa bands. The dissimilar subcellular compartmentalization of
Sox4 (nuclei) and Sox11 (cytoplasm) observed both in vivo and in vitro as well as
the disparate number of molecular weight forms raised interesting questions
about whether each performs specific, overlapping or redundant roles during
development (addressed below).
We next tested whether Sox4 is required for RGC development. Because
Sox4-null mice die prenatally, we used a cre/lox strategy to target Sox4KO to the
retina. We hypothesized that because Math5 is required for RGC specification
and is expressed only transiently in retinal development (Brzezinski et al., 2012;
Prasov and Glaser, 2012; Prasov et al., 2012), Math5 would be an appropriate
promoter for cre expression in RGC progenitors. Immunostaining for RGCspecific markers (Brn3+) and their neurites (βIII-tubulin+) in E16 and P2 retinal
sections (Fig. 2.3A) demonstrated a significant loss (~25%) in the number of
RGCs in both E16 and P2 Math5-cre/Sox4fl/fl mice in vivo (Fig. 2.3B). Next, we
asked if the loss of Sox4 has an effect on the proliferation rate of embryonic
RPCs in vivo by injecting EdU into timed-pregnant animals. EdU pulse
experiments showed no difference in proliferation rate between control and
Math5-cre/Sox4fl/fl animals (Fig. 2.3B). We also did not find any preferential loss
of melanopsin-expressing intrinsically photosensitive RGCs (Berson et al., 2002;
Hattar et al., 2002; Provencio et al., 2000; Provencio et al., 2002) in the Math5cre/Sox4fl/fl retina (Fig. 2.3C.D). Thus the loss of RGCs is not due to dysfunction
in progenitor cell proliferation, nor preferentially exhibited in at least this one
important subpopulation.
52
Figure 2.3 Sox4 and Sox11 are required for normal RGC differentiation in vivo. (A)
E16 timed-pregnant mice were injected with 50 μM EdU in PBS, sacrificed 1 hour later,
and embryos were fixed and retinal sections were immunostained for EdU (purple), Brn3
(green) and DAPI (blue). (B) There was a significant reduction in the number of RGCs
(Brn3+) noted at E16 and P2, but no change in the number of proliferating (EdU+) cells
(*p<0.02, unpaired t test; mean ± SEM). (C to D) Control and Sox4 cKO retinal explants
were immunostained for melanopsin to label intrinsically photosensitive RGCs (ipRGCs);
there was no preferential loss of melanopsin-expressing ipRGCs in the Sox4 cKO. (E to
G) Control, Sox4 cKO, Sox11 cKO and Sox4/11 dcKO retinal explants were
immunostained for the RGC marker Brn3+ (red) and the neurite marker βIII-tubulin+
(green). By adulthood, a similar decrease in RGCs was detected in Sox4 or Sox11 cKO
mice, and a significantly greater loss of RGCs in the double Sox4/Sox11 KO. Similarly,
the loss of Sox4, Sox11 or both resulted in thinner average intraretinal axon bundle
thickness (*p<0.02 from control; **p<0.02 from control and from single cKO mice; N=3,
ANOVA with post-hoc Dunnett’s Test; mean ± SEM shown). (H) Embryonic retinal cells
from Sox4 cKO mice were differentiated in the presence of control or Sox11 shRNA;
Sox11 knockdown further potentiates the decreased RGC differentiation of control Sox4
cKO progenitors. (I,J) Using markers for amacrine cells (Pax6+) in the inner nuclear
layer (INL), bipolar cells (Chx10+), Muller glia (GS+), cone photoreceptors (CAR+) and
photoreceptors (Recoverin+) in control, single or double KO mice, there was no change
in layer thickness or cell number of any of the other retinal neurons, but there was a
statistically significant increase in the number of Muller glial cells in the double Sox4/11
KO. Scale bars, 30 µm.
53
`
54
Because the other closely related SoxC family members, Sox11 and
Sox12, compensate for the loss of Sox4 in other systems (Bergsland et al., 2006;
Bhattaram et al., 2010; Hong and Saint-Jeannet, 2005; Hoser et al., 2007;
Penzo-Mendez, 2010), we hypothesized that Sox11 and Sox12 might be
responsible for the remaining RGCs found in the Math5-cre/Sox4fl/fl mice. We
found that the Math5-driven conditional loss of Sox11 in the adult retina yielded a
similar phenotype to the loss of Sox4, but the Math5-driven Sox4/11 double cKO
(dcKO) showed a more severe absence of RGCs (~60%) (Fig. 2.3E.F). We also
observed thinner intraretinal axon bundles in both Math5-cre/Sox4fl/fl and Math5cre/Sox11fl/fl cKO animals compared to control, and thinner still in the Math5cre/Sox4fl/fl/Sox11fl/fl dcKO mice (Fig. 2.3E and 2.3G), consistent with the
decrease in RGC number. Similarly, knockdown of Sox11 with shRNA, which
decreased Sox11 expression in cultured Sox4 cKO RPCs by over 75% by qRTPCR, further potentiated the loss of Sox4 in RGC differentiation in vitro (Fig.
2.3H).
Next we asked if other retinal cell types are affected by the loss of Sox4or
Sox11 or both. We used Pax6 for a marker of amacrine cells in the inner nuclear
layer (INL), Chx10 for bipolar cells, glutamine synthetase for Müller glia (GS+),
cone-specific arrestin for cone photoreceptors (CAR+) and recoverin for all
photoreceptors(Fig. 2.3I). There was no change in any of the other retinal
neurons, but there was a statistically significant increase in the number of Müller
glial cells (Fig. 2.3J). RPCs that do not differentiate into neurons throughout
retinal development default to Müller glial cell fate (Jadhav et al., 2009). Since
55
Müller glial cells appear to not express Sox4 or Sox11 we hypothesize that the
ectopic increase in Müller glial cells is derived from the RPC population that
would have differentiated into RGCs.
Finally, we asked whether the Sox4/11 dcKO effect on reducing RGC
differentiation would be exacerbated by earlier and broader retinal cre
expression, using a CHX10-cre line. We found that in the CHX10cre/Sox4fl/fl/Sox11fl/fl mice there was a nearly complete absence of RGCs and a
complete loss of the optic nerve; an intermediate phenotype was again observed
in the single cKO mice (Fig. 2.4A.B). No microphthalmia was observed in these
animals, unlike that seen in the Sox1-null mouse (Wurm et al., 2008). Thus
RGCs and optic nerve development depend on Sox4 and Sox11 expression in
the embryonic retina.
How does the predominantly cytoplasmic Sox11 protein compensate for
the loss of Sox4? Immunolabeling of Sox11 in Math5-cre/Sox4fl/fl cKO mice
demonstrated a shift from cytoplasmic to nuclear localization both in vivo (Fig.
2.5A) and in vitro (Fig. 2.5B). We also examined the protein size of Sox11, which
demonstrated multiple band sizes in wildtype retinal cells (Fig. 2.2K), in Math5cre/Sox4fl/fl cKO retinal cells, and found a loss of the higher 90 kDa band and a
corresponding increase in the 60 kDa form (Fig. 2.5C, right). We thus
hypothesized that the differential protein localization of Sox4 and Sox11 might be
explained by differences in post-translational modifications. Since the Sox11
banding suggested ~30 kDa additions, we explored whether Sox4 and/or Sox11
could be SUMOylated using SUMOsp 2.0t SUMOylation prediction software,
56
Figure 2.4 Earlier Sox4/11 knockout generates more severe RGC phenotype
(A-B) Floxed Sox4/11 animals were crossed with Chx10-Cre line. Control, Sox4 cKO,
Sox11 cKO and Sox4/11 dcKO retinal explants were immunostained for the RGC marker
Brn3+ (red) and the neurite marker βIII-tubulin+ (green). There was a similar decrease in
RGCs detected in Sox4 or Sox11 cKO mice, and a near complete loss of RGCs in the
Sox4/Sox11 cdKO. Similarly, the loss of Sox4, Sox11 or both resulted in thinner
intraretinal axon bundle thicknesses. (C) Control, Sox4 cKO, Sox11 cKO, and Sox 4/11
dcKO, mice were perfused with paraformaldehyde and preserved brains were excised.
Images of the optic tract and optic chiasm reveal a complete loss of optic nerve in the
Sox4/11 dcKO mice. (D-E) Immunofluorescence staining for other retinal cell types, as
marked, confirms decrease in ganglion cell layer Pax6+ cells and a small increase in
Muller glia, without any effect on amacrine cells or photoreceptors.
57
58
which suggested a putative SUMOylation site on Sox11 (K91) not found on Sox4
(Fig. 2.5D). To determine whether Sox4 or Sox11 were SUMOylated, we
performed anti-SUMO immunoprecipitations. A higher molecular weight isoform
of Sox11 but not Sox4 IP’ed from acutely dissociated embryonic retina,
demonstrating the existence of SUMOylated Sox11 in the developing retina (Fig.
2.5E). Furthermore, nuclear fractionation in E14 retinas demonstrated that the
higher MW isoforms of Sox11 were only found in the cytoplasmic fraction, and
that most Sox11 was found in the cytoplasm (Fig. 2.5F). Sox4 was detected only
in the nuclear fraction (Fig. 2.5F). Thus SUMOylated Sox11 is predominantly
cytoplasmic, whereas Sox4, as well as a lesser amount of non-SUMOylated
Sox11 are localized to the nucleus.
To test the physiologic role of SUMOylation at the Lys91 site, we
generated mutant Sox11 cDNA clones with an alanine (K91A) substitution, which
should render the site unable to be SUMOylated. Sox11 or K91A Sox11 was cotransfected with SUMO-1 cDNA in HEK cells, where the mutant form
demonstrated decreased 90 kDa (SUMOylated) expression on western blot and
increased nuclear localization (Fig. 2.5G). This suggests that unSUMOylated
forms of Sox11 protein are more restricted to the nuclei of cells.
When we
overexpressed Sox4, Sox11 or Sox11 (K91A) or control in embryonic RPCs in an
RGC differentiation assay, mutant Sox11 (K91A) showed increased nuclear
localization and increased RGC differentiation compared to normal Sox11, now
similar in both respects to the localization and effect of Sox4 (Fig. 2.5H.I; also
see Fig. 2.2I). Taken together these data suggest that the normal,
59
Figure 2.5 Sox4 regulates Sox11’s subcellular localization and effect on RGC
differentiation through Sox11 SUMOylation. (A-B) Immunostaining for Sox11 in Sox4
cKO retinal sections (A) or in Sox4 cKO embryonic retinal cells in culture (B) reveals
increased Sox11 nuclear localization in the absence of Sox4. Nuclei outlined with
dashed line. Scale bars, 30 µm in (A), 20 µm in (B). (C) Western blot for Sox11 in
control and Sox4 cKO whole retinal protein lysate, as marked. (D) Putative SUMOylation
consensus site (yellow amino acids) and SUMOylated lysine (red “K”) is found in Sox11
but not Sox4. (E) Western blot of embryonic retinal lysate for Sox4 (input, left) revealed
one band at the predicted 47 kDa molecular weight, whereas Sox11 demonstrated
multiple bands including 60, 90 and 150 kDa (input, right). In anti-SUMO coimmunoprecipitations, a higher molecular weight isoform of Sox11 but not Sox4 co-IPed
from acutely dissociated embryonic retina. (F) Nuclear fractionation of RGCs followed by
Western blot against Sox11 demonstrates 60 kDa Sox11 in the nuclear fraction and the
higher, presumably SUMOylated forms, in the cytoplasmic fraction. (G) Mutant Sox11
cDNA clones with an alanine (K91A) substitution, which should render the site unSUMOylatable, preferentially localize to the nucleus, and demonstrate decreased 90
kDa (SUMOylated) expression on western blot, after co-transfection with SUMO in HEK
cells. Scale bars, 30 µm.
(H-I) When overexpressed in embryonic RPCs in an RGC
differentiation assay, mutant K91A Sox11 showed increased nuclear localization (H) and
increased RGC differentiation (I) compared to wildtype Sox11, and was now similar in
both respects to the localization and effect of Sox4 (*p<0.02 from control, Sox4 and
K91A Sox11; **p<0.02 from control and Sox11 alone; N=3, ANOVA with post hoc
Dunnett’s test, mean ± SEM). Scale bar, 30 µm.
60
61
K91-SUMOylated Sox11 is present in the cytoplasm and promotes RGC
differentiation less. Furthermore, in the absence of Sox4, Sox11 protein
expression increases and translocates from the cytoplasm to the nucleus where
it may play a greater role in promoting RGC differentiation. Whether or not tSox4
regulates the expression and subcellular localization of Sox11 by controlling
Sox11 SUMOylation remains for further investigation.
We hypothesized that uncovering regulators controlling SoxC family
spatiotemporal expression may provide further insight into regulation of RGC fate
specification. We first asked whether this novel SoxC pathway for RGC
differentiation interacts with the one other Math5-independent regulatory pathway
suggested by REST/NRSF’s ability to repress RGC differentiation (Mao et al.,
2011). It was not known how REST suppresses RGC fate, although in chick
spinal cord neurons, others have shown that REST represses Sox4 and Sox11
(Bergsland et al., 2006). We found that overexpression of REST in wild type
RPCs decreased RGC differentiation as measured by immunostaining (Fig.
2.6A). REST overexpression in RPCs derived from retinal-specific Sox4 cKO
mice demonstrated no difference in RGC fate specification (Fig. 2.6B). Thus
REST repression of RGC differentiation depends on its ability to repress a Sox4dependent pathway.
As Sox4 is up-regulated by multiple TGFβ ligands in cancer cell lines
(Kuwahara et al., 2012; Zhang et al., 2012), we screened TGFβ superfamily
members for such effects on Sox4 expression and RGC fate specification. GDF11, a TGFβ superfamily member, represses Math5 expression and RG
62
Figure 2.6 REST suppresses RGC differentiation in a Sox4-dependent manner.
(A) Overexpression of REST in wild type RPCs decreased RGC differentiation compared
with control as measured by immunostaining of differentiated RGCs
(Brn3+,EdU+/EdU+). (B) REST overexpression in RPCs derived from retinal-specific
Sox4 cKO mice demonstrated no difference in RGC fate specification.
63
differentiation in vivo (Kim et al., 2005). Differentiating RPCs in culture in the
presence of GDF-11 decreased the expression of Math5 (Fig. 2.7A) and Sox4
(Fig. 2.7B) and decreased the number of differentiated RGCs (Fig. 2.7C),
suggesting that the effect of GDF11 in vivo (Kim et al., 2005) is attributable to
direct effects on RPCs. Remarkably, RPCs exposed to the related protein GDF15 had a near 10-fold increase in Sox4 (Fig. 2.7B)and increased the number of
differentiated RGCs compared with control (Fig. 2.7C). GDF-11 still suppressed
RGC differentiation in Math5-cre/Sox4fl/fl cKO RPCs, but GDF-15 was no longer
able to increase RGC differentiation in the absence of Sox4 (Fig. 2.7D). Taken
together, these data demonstrate that, whereas GDF-11 signaling may work
through a Sox4-independent pathway to suppress RGC differentiation, this novel
role for GDF-15 in increasing RGC differentiation works through Sox4-dependent
signaling. GDF-15 is expressed in the developing retina (RNASeq data not
shown) but it is not yet known whether it is required for RGC fate specification in
vivo.
We next asked, does overexpression of Sox4 alone or in combination with
Math5 potentiate the differentiation of functional RGCs from other stem cell
populations? For example, human iPS cells can generate RGC-like cells in vitro
(Chen et al., 2010; Parameswaran et al., 2010). We found that Math5 and Sox4
alone and combination greatly potentiated the differentiation of RGCs from iPS
cells (Fig. 2.8). The combination of both genes had a synergistic effect in
potentiating the differentiation of RGCs. To test whether these RGC-like neurons
are indeed functional, patch clamp electrophysiology was conducted prior to and
64
Figure 2.7 GDF-15 potentiates differentiation in a Sox4-dependent manner.
(A-C) Differentiating RPCs in culture in the presence of GDF-11 decreased the
expression of Math5 (A) and Sox4 (B), and decreased the number of differentiated
(Brn3+,EdU+/EdU+) RGCs (C). Conversely, RPCs exposed to the related protein GDF15 had no change in Math5 expression (A) and ~10-fold increase in Sox4 expression
(B), and increased the differentiation of RGCs compared with control (C). (D) GDF-11
suppressed RGC differentiation in Sox4 cKO RPCs, but GDF-15 was no longer able to
increase RGC differentiation in the absence of Sox4 (*p<0.02 from control; **p<0.02
from control and from single cKO mice; N=3, ANOVA with post hoc Dunnett’s test, mean
± SEM shown).
65
Figure 2.8 Sox4 promotes human stem cell differentiation into functional RGCs.
(A-D) Human induced pluripotent stem (iPS) cells (A, arrows) cultured on mouse
eradicated fibroblast (MEF) feeder layers (A, asterisks) expressed embryonic stem cell
markers Oct4 (B) and SSEA-4 (C) but not the neuronal marker βIII-tubulin (D). (E)
Embryoid bodies dissociated into ≤100 µm aggregates and single cells and plated on
PDL and laminin for 24 hours showed RPC marker co-expression of Pax6 and Rx. (F)
During 5 days of differentiation, cells were infected with eGFP (control), Math5-RFP,
SOX4-2A-eGFP, or both (example shown in F). (G-I) After 5 days, overexpression of
SOX4-GFP (G) potentiated RGC morphologic differentiation including long neurites
(arrow) with growth cones (arrowhead), and (H to I) increased expression of the RGC
marker Brn3. Math5 and Sox4 co-overexpression in human iPS cells together
synergized in potentiating RGC-like differentiation (*p<0.02 from control; **p<0.02 from
control, Math5 and Sox4 alone conditions; N=3, ANOVA with post hoc Dunnett’s test,
mean ± SEM shown). (J-K) RGC-like progeny generated (J) single and (K) multiple burst
action potentials with properties similar to purified primary rodent RGCs. Scale bars, 30
µm.
66
following RGC differentiation. Prior to differentiation, iPS-derived retinal
progenitor-like cells failed to generate action potentials spontaneously or in
response to current injection (Fig. 2.8F, above). Following differentiation, RGClike progeny generated single and multiple burst action potentials with properties
similar to purified primary rodent RGCs (Fig. 2.8J-K) (Meyer-Franke et al., 1995).
Taken together, these data suggest that Sox4 is sufficient and robust enough to
promote human stem cell differentiation into functional RGC-like neurons at an
efficiency and electrophysiologic function not previously described.
Discussion
SoxC Transcription Factors Are Necessary for RGC and Optic Nerve
Development
Together these data have a number of important implications. First, they
describe a novel signaling pathway for RGC fate specification in vitro and in vivo
through Sox4 and Sox11 (Fig. 2.9A), consistent with a recent report examining a
Six3-cre driven double knockout (Jiang et al., 2013). Previous lineage tracing
experiments demonstrated the necessity but not sufficiency of Math5 in RGC fate
competence: Math5 is required for RGC development, but precursors for most
early born neurons and some late born neurons express Math5, which suggests
that Math5 directs the competence of early RPCs towards multiple cell fates.
Other protein subfamilies such as the Brn3 family of proteins and WT1 are critical
for the later survival but not the initial cell fate specification of RGCs. In contrast,
these data describe a regulatory pathway parallel to Math5 in the production of
RGCs, in which SoxC transcription factors are necessary and sufficient to
67
Figure 2.9 Integrated model for regulatory mechanisms of RGC fate specification.
68
generate RGCs from RPCs, and in their absence there is a complete loss of the
optic nerve. Whether Sox4 or Sox11 can rescue RGC fate specification
downstream of or parallel to Math5 remains to be addressed (Jiang et al., 2013).
Why is there a complete loss of RGCs and optic nerve formation in the
Chx10-cre (this paper or Six3-Cre (Jiang et al., 2013) Sox4fl/fl/Sox11fl/fl line while
the Math5- Cre/Sox4fl/fl/Sox11fl/fl still retain ~40% of their RGCs? We hypothesize
that the stronger phenotype observed is due to the timing of Math5 expression.
Math5 is expressed in progenitors in transition to RGCs, which may be too late to
elicit the full SoxC KO phenotype, especially if there is already sufficient SoxC
protein expression at the time of gene excision.
The importance of early Sox4 or Sox11 knockout is also captured in the
previous failure to identify Sox11 as a regulator of RGC differentiation in Sox11
overexpression experiments in which Sox11 was overexpressed at E17, which
may be too late to revert later RPCs to RGC fate (Usui et al., 2013b). The loss of
Müller glia in those experiments is consistent with the increase in Müller glia seen
in our dcKO data. Similarly, the Sox11-null allele was embryonic lethal with major
cardiovascular system defects, microphthalmia and gross defects in lens
development, but failed to capture the importance of Sox11 in RGC fate
specification. This failure may be due to the presence of Sox4, to additional
indirect effects of microphthalmia and lens maldevelopment, and/or if Sox11 is
responsible for a later-born subset of RGCs, any effect may not have been
observable in these E18 embyronic lethal lines. We observed a loss of RGCs at
P1 which persists into adulthood.
Taken together these data suggest a
69
hypothesis in which RGC fate specification may occur in the earliest stages of
retinal development but not be evidenced until the full wave of RGC generation is
completed, around the time of birth.
REST inhibition of RGC specification depends on suppression of Sox4
expression
The role of SoxC transcription factors have now been implicated in
multiple CNS lineages including RGCs (this paper, and (Bhattaram et al., 2010;
Jiang et al., 2013; Mu et al., 2012), but the regulatory networks and mechanisms
have not been further identified. REST, a zinc-finger transcription factor, was
initially identified as a master repressor of neuronal gene expression in nonneuronal cell types (Chong et al., 1995; Schoenherr and Anderson, 1995). }.
REST inactivation causes aberrant expression of RGC transcription factors in
proliferating RPCs, independent of Math5, resulting in increased RGC formation
(Mao et al., 2011). Interestingly, inactivating REST in Math5-null retinas
presumably releases repression of pro-differentiation target genes and triggers
limited expression of RGC genes (Mao et al., 2011). This provided strong
evidence that a Math5-independent program is critical in the initial activation of
RGC genes, but the repressed, pro-RGC target genes were previously unknown.
Here we provide compelling evidence that Sox4 is a functional target of REST
repression critical to RGC specification. Evidence for REST repression of Sox4
expression has been suggested in chick spinal cord (Bergsland et al., 2006), but
future research characterizing REST repression at this locus in RGCs in vivo
would support this hypothesis.
70
TGFβ superfamily members GDF11 and GDF15 oppositely regulate RGC
fate specification
Furthermore, these data reveal a mechanism involving Sox4 for the novel
GDF-15 activation of RGC fate specification. During retinogenesis, a number of
BMP molecules initially expressed in specific regions adopt layer-specific
expression patterns later in development (Yang, 2004) . In the mouse retina,
inactivation of the GDF11 gene increased RGC production from progenitors,
whereas inactivating the follistatin gene, a TGFβ antagonist, or treating
embryonic retinal explants with Gdf11 reduced RGC numbers (Kim et al., 2005).
Here we provide new data implicating GDF15 as a novel, positive regulator of
RGC differentiation whose function is dependent on Sox4 signaling. We further
show that the previously characterized GDF11 signal directly regulates Math5
expression in RPCs. These data and the REST data suggest that Sox4 and
Math5 are on independent transcriptional cascades and that both are critical for
RGC specification and optic nerve formation. An exploration of whether Sox4
overexpression rescues the Math5 null allele would address the independence of
these cascades directly. The opposing effects of these two TGFβ family
members is an interesting new finding and future experiments characterizing of
how RPCs distinguish pro-RGC GDF-15 signaling through Sox4 and anti-RGC
GDF-11 signaling through Math5 may allow novel insight into the dissection of
TGFβ signaling in this system and more generally.
71
SUMOylation as a novel mechanism for regulating of transcription factor
compensation
How do SoxC transcription factors regulate their compensatory activities?
Here we delineate a new biological interaction whereby Sox4’s normal
expression suppresses Sox11 nuclear localization and function through
SUMOylation, a posttranslational modification that may regulate function of other
Sox transcription factors (Gill, 2005). Ubc9, found in SUMOylation complexes,
has been shown to interact with Sox4 through SUMOylation-independent
interactions (Bergsland et al., 2006). This suggests a potential feedback loop in
which one transcription factor family member, Sox4, controls the SUMOylationdependent subcellular localization of a closely related and highly redundant
transcription factor family member, Sox11. This explanation for compensatory
transcription factor function may similarly apply to the regulation of other
transcription factors including myc (Kessler et al., 2012) and NRL (Roger et al.,
2010). Such compensation raises the hypothesis that Sox4 is less likely to be
found mutated in human optic nerve hypoplasias, if Sox11 activity is increased in
its absence. These data may also explain why, in certain cancers, such as
mantle cell lymphoma, Sox11 protein location changes from cytoplasmic to
nuclear (Ek et al., 2008). Whether such protein regulation in trans is also used
by other transcription factor families to modulate the level of transcriptional
activation or repression may have implications for gene duplication into multigene families during evolution. Indeed amSoxC, one of the evolutionarily oldest
72
SoxC family members found in coral, is not SUMOylated (Shinzato et al.,
2008),nor is Drosophila SoxC (Savare and Girard, 2005).
Sox4 and RGC differentiation for stem cell therapy
Finally, identifying regulatory mechanisms not merely necessary, but also
sufficient to generate RGCs may be a useful strategy to generate RGCs from
human stem cell populations, to enhance cell replacement therapy for
degenerative disease. For example, RGCs degenerate in glaucoma, a leading
cause of worldwide blindness, and stem cell therapies hold promise for replacing
RGCs in glaucoma and other optic neuropathies (Hertz and Goldberg, 2012). In
the eye, subretinal stem cell and retinal progenitor-derived grafts have been used
to achieve functional photoreceptor replacement in mouse models of retinal
degeneration (MacLaren et al., 2006; West et al., 2009) and embryonic stem cellderived RPE has entered human clinical trials (Schwartz et al., 2012). However,
RGC replacement is significantly more challenging as transplanted RGCs would
need to integrate into the more complex circuitry of the inner retina and project a
lengthy axon capable of synapsing at precise brain targets.
Recent advances in enhancing RGC migration into the retina following
intravitreal cell delivery suggests that RGCs may survive, migrate into the
ganglion cell layer, send local dendrites into the inner plexiform layer (IPL), and
elongate axons (Hertz et al., 2013). Furthermore, RGC axons injured in the optic
nerve can be coaxed to regenerate long distances in the optic nerve and to the
brain (de Lima et al., 2012), suggesting that a transplantation therapy may yet be
possible. However, a limitation for RGC cell therapies is the low overall numbers
73
of RGCs that normally differentiate from progenitor or stem cells in normal
development or in vitro, often in the low, single-digit percentages (Chen et al.,
2010; Jagatha et al., 2009; Parameswaran et al., 2010). Manipulation of the
SoxC transcriptional network described here—either by overexpression of SoxC
genes or by providing upstream signals like GDF15—may be used to more
efficiently generate RGC donor cells for cell-based therapies in these debilitating
disease.
Chapter 3
Retinal ganglion cell transplantation
Chapter summary
There is considerable interest in transplanting stem cells or progenitors
into the injured nervous system and enhancing their differentiation into mature,
integrated, functional neurons. Little is known, however, about what intrinsic or
extrinsic signals control the integration of differentiated neurons, either during
development or in the adult. Here we ask whether purified, post-mitotic,
differentiated retinal ganglion cells (RGCs) directly isolated from rat retina or
derived from in vitro-differentiated retinal progenitor cells can survive, migrate,
extend neurites and form morphologic synapses in a host retina, in vivo and ex
vivo. We found that acutely purified primary and in vitro differentiated RGCs
survive transplantation and migrate into deeper retinal layers, including into their
normal environment, the ganglion cell layer (GCL). Transplanted RGCs from a
wide range of developmental ages but not from adults were capable of extending
lengthy neurites in the normal and injured adult rat retina ex vivo and to a lesser
degree after transplantation in vivo. We have also demonstrated that RGCs may
be purified from retinal precursor cultures, and that they share many of the same
cell biological properties as primary RGCs. We have established that progenitorderived RGCs have similar capacity for integration as developing primary RGCs,
but appear to form a lower number pre-synaptic puncta. This work provides
insight for further understanding the integration of developing RGCs into their
normal environment and following injury.
74
75
Motivation
How does a developing neuron integrate into its environment? In the
retina, for example, retinal ganglion cells (RGCs) are among the first neurons to
arise from a common pool of multipotent progenitors during retinal development,
from embryonic day 11.5 (E11.5) to E18 in the rodent (Alexiades and Cepko,
1997). After exiting the cell cycle, RGCs migrate across the retina, forming the
ganglion cell layer (GCL) (Rapaport et al., 2004; Reese and Colello, 1992). In the
GCL, RGCs extend axons towards the optic nerve head, ultimately forming the
optic nerve connecting the eye to the brain. RGCs proceed to form synaptic
connections with presynaptic amacrine and bipolar interneurons (Sernagor et al.,
2001). Little is known about what signals regulate many of the steps involved in
this complex process, or to what degree each step—survival, neurite growth,
migration, and synaptic integration—depends on the preceding one.
These questions are particularly important because there is significant interest in
transplanting stem cells and other multipotent progenitors into the retina as well
as various other regions of the central nervous system (CNS). Under the right
conditions these cells may differentiate into the proper neuronal subtype and
functionally integrate with the host’s pre-existing circuitry. Transplanted
embryonic stem cells, embryonic and adult neural progenitors, and other
proliferating cells have demonstrated only limited success at integrating into
various regions of the central nervous system (Calford et al., 2005; Sohur et al.,
2006; Zaverucha-do-Valle et al., 2011). Several factors, including injury reactivity,
immune response, and a lack of crucial developmental factors in the adult
76
microenvironment are likely to play a role in the failure of these cells to properly
differentiate into appropriate cell types and integrate with surrounding cells
(Warfvinge et al., 2006; Wu et al., 2010) .
Retinal progenitors from various donor ages transplanted to the retina
have thus far not yielded significant differentiation and integration of RGCs.
Indeed, it is not yet known whether actual RGCs are capable of integration into
pre-existing retinal circuitry after transplantation to the adult retina (Hasan et al.,
2010; Sam et al., 2006) . Here we ask whether RGCs purified from developing or
mature retinas, or purified from differentiating retinal progenitor cultures, survive,
extend neurites in the nerve fiber layer, migrate into the GCL, and form
morphologic synapses after transplantation to the adult retina in vivo, ex vivo,
and after optic nerve injury.
Materials and Methods
Animals
All use of animals conformed to the Association for Research in Vision
and Ophthalmology (ARVO) Statement for the Use of Animals in Research, and
was approved by the Institutional Animal Care and Use Committee (IACUC) and
the Institutional Biosafety Committee of the University of Miami. Sprague-Dawley
rats of varying ages were obtained from Harlan Laboratories. Mice were bred
from the following strains: C57BL/6-Tg(CAG-EGFP)10sb/J (Stock # 003291,
Jackson Laboratory).
RGC Purification and Culture
77
RGCs from embryonic day 17 (E17) through postnatal (P) and adult
Sprague-Dawley (SD) rats or postnatal transgenic β-actin-GFP mice were
acutely purified by sequential immunopanning with the T11D7 antibody
(generated in lab from hybridoma cultures) for rat or the CD90 (Thy1.2; AbD
Serotec) antibody for mouse, yielding 99.5% pure RGCs (Goldberg et al., 2002a;
Meyer-Franke et al., 1995). Purified rat primary RGCs were labeled in vitro with
CM-DiI (red; Invitrogen) or with Oregon Green Cell Trace (green; Invitrogen), and
then cultured for 24 hours or 1 week on adult retinal explants in serum-free,
defined medium as described containing BDNF (50 ng/mL; Peprotech), CNTF (10
ng/mL; Peprotech), insulin (5 µg/mL; Invitrogen), and forskolin (5 µM;
Sigma).(Barres et al., 1988; Meyer-Franke et al., 1995). Purified RGCs from βactin-GFP mice did not undergo cell trace or CM-DiI incubation but were further
labeled with anti-GFP antibody immunofluorescence (see below). A subset of
RGCs from each immunopanning preparation were cultured on poly-D-lysine
(PDL) (70 kDa, 10 µg/ml; Sigma) and laminin (2 mg/ml; Telios/Invitrogen) in the
same media used for explants (see above).
Retinal Explants
Retinal explant culture was performed as described previously (Tomita et
al., 1996). Briefly, adult SD rat were euthanized and the eyes were enucleated
and transferred to cold DPBS (Invitrogen). Eyes were rinsed repeatedly and
dissected under sterile conditions. The cornea and lens were removed creating
an eye cup preparation. The neural retina was teased off the retinal pigment
epithelium with special care taken not to disturb the retinal ganglion cell side of
78
the retina. The retinas were adsorbed to Millicell chamber filters (Millipore;
diameter 30 mm, pore size 0.4 um) with the ganglion cell layer upwards. The
chamber was transferred to a six-well culture plate containing RGC medium as
above. After 24 hours or 7 days, retinas were fixed, counterstained with DAPI to
highlight nuclei and imaged using confocal microscopy (Leica). Confocal
microscopy of whole mount retinas was used because neurite outgrowth
occurred in 3-dimensions, and tissue sections would only contain a limited view
of the neurite outgrowth of each cell. Transplanted RGC survival was quantified
by nuclear morphology 24 hours after transplantation; condensed pyknotic nuclei
marked dead cells. Migration was quantified with 3D Z-stack projections using
confocal fluorescence microscopy (Leica).
In Vitro Differentiation of RGCs
Retinas from 5 litters of E14 timed pregnant rats were dissected,
dissociated enzymatically, and cultured in proliferation-promoting media
containing EGF and bFGF (20 ng/mL each; Sigma) for 7 days at clonal density
(10 cells/µl) on non-adherent petri dishes. After seven days, progenitor-enriched
neurospheres were cultured on PDL (70 kDa, 10 µg/ml; Sigma) and laminin (2
mg/ml; Telios/Invitrogen) in RGC growthpromoting serumfree medium, as above,
without EGF or bFGF. After 4 days, the cells were trypsinized off the plates and
Thy1+, in vitro-differentiated RGCs were purified by immunopanning as above.
79
Optic Nerve Axotomy
Optic nerve axotomy was performed as described previously (Hu et al.,
2010; Hu et al., 2005). RGCs from the host retina were first labeled with
fluorogold by prior injection into the superior colliculus (Hu et al., 2010). In some
cases gel foam soaked in Alexa-488-conjugated cholera toxin beta-subunit
(Invitrogen) was placed on the optic nerve stump following transection in order to
retrogradely label host retina ganglion cells. The contralateral eye was used as a
non-injured control.
Ex Vivo Transplantation
RGCs
purified
from
acutely
dissected
retinas
or
derived
from
neurospheres were labeled in vitro with the lipophilic dye CM-DiI or Cell Trace
Oregon Green (Invitrogen). RGCs were diluted in DPBS (Invitrogen) to 2500/µ L
and a total volume of 20 µL (50,000 cells per retina) were transplanted directly
over the center of the retina and allowed to float down to the retina by gravity.
In Vivo Transplantation
RGCs were purified by immunopanning from both rat and β-actin-GFP
mice. The rat RGCs were labeled in vitro with the lipophilic dye CM-DiI (red).
Using a pulled glass pipette, 50,000 labeled RGCs in 2 µl of PBS or 2 µl PBS
alone for controls were injected intravitreally into one eye of an anesthetized
adult rat as previously described (Hu et al., 2010) Three rat eyes were injected
per RGC donor age tested and all sections of each eye were examined.
Remaining RGCs were plated on PDL/laminin coated plates in growth media for
3 hours, after which these extra cells were fixed and immunostained for RGC and
80
neural specific markers (Brn3 and βIII-tubulin respectively) to verify RGC purity
(data not shown), consistent with published data (Goldberg et al., 2002a; MeyerFranke et al., 1995).
Immunostaining
Flatmount retinas were fixed in 4% paraformaldehyde for 30 minutes and
either placed on glass slides or further processed for cryosectioning. The
samples isolated for cryosectioning were incubated in 30% sucrose overnight
and then frozen in Optimum Cutting Temperature solution (OCT; TissueTek)
using liquid nitrogen. Both flatmount samples as well as retinal sections were
simultaneously blocked and permeabilized with 20% donkey serum and 0.4%
Triton X-100, respectively, for 30 mins. Flatmount retinas and retinal sections
were then incubated in primary antibodies, including Anti-Brn-3 (1: 200;
SantaCruz; goat polyclonal), anti-synaptophysin (1:200; SantaCruz rabbit
polyclonal) anti-βIII tubulin (1:200; Covance; mouse monoclonal) and with
purified RGCs from β-actin-GFP mice, anti-GFP (1:200; Invitrogen; rabbit
polyclonal) overnight (ON) at 4° C. Retinal samples were rinsed three times with
PBS and incubated with the matching secondary antibody for ON at 4° C.
Fluorophore conjugated secondary antibodies (1:500; Invitrogen) were used to
label primary antibodies. The retinal samples were then sealed with coverslips on
slides with Vecta-Shield (Vector Labs) solution containing DAPI nuclear stain.
Cell counting
Explanted retina and retinal section were stained with βIII-tubulin and the
nuclear stain DAPI to highlight the different layers of the retina. For retinal
81
sections, lines defining each layer were superimposed over the micrograph
image. For explant confocal micrographs, Z-stack projection movies were
constructed and βIII-tubulin and DAPI were used to demarcate each retina layer.
The location of the nuclei of the transplanted cell in or on the retina was used to
define the each cell body’s localization.
RGC Neurite Direction and Orientation Assay
The orientation of neurites of RGCs on scaffolds were measured using the
ImageJ plugin OrientationJ, written by Daniel Sage and available at
http://bigwww.epfl.ch/demo/orientation/. The ellipses were made using the
‘measure’ function of the plugin with the LaPlacian of Gaussian set to zero. The
eccentricity of the ellipses demonstrates calculated coherence of the direction of
neurites. The narrower the ellipse corresponds with a greater level of coherence.
Furthermore, the direction of the ellipse indicates the direction of lines in the
region of interest measured. A perfect circle would denote a completely random
configuration. The frequency of neurites extending toward the optic nerve head
was measured by the Distribution function of the OrientationJ plugin. The
Gaussian Gradient was used with a sigma value of 1, a minimum coherency of
zero, and a minimum energy of 0. Values from the output were normalized and
then wrapped around 90° for each region to indicate the direction toward the 90°
vertical. Data were partitioned into three bins of 30° each.
Statistical Analysis
82
Student t tests and analysis of variance (ANOVA) statistical tests were conducted
to identify significant differences among control and variable groups in all
experiments (Graphpad and Excel).
Results
Transplanted RGCs survive and migrate following in vivo transplantation
We first asked if primary RGCs survive and migrate into the adult retina
following intravitreal transplantation. Embryonic and postnatal RGCs were
purified by immunopanning, acutely labeled in vitro with CellTrace or CM-DiI and
transplanted intravitreally using a pulled glass capillary. Transplanted RGCs
displayed robust survival, as measured by nuclear morphology (Fig. 3.1). Using
DAPI nuclear staining to define the retinal lamina, we observed that RGCs
migrated away from the initial site of injection into the ganglion cell layer as well
as, less commonly, deeper layers of the retina (Fig. 3.1). When we compared this
capacity between various ages of donor cells, we observed that donor cells
across a broad developmental time window had a similar capacity. Furthermore,
we observed RGCs from both embryonic and postnatal RGCs surviving following
7 days post injection although the viability was significantly reduced compared
with 24 hours (Fig. 3.1E). Adult RGCs, as donor cells, were not tested in these
assays due to relatively lower yields, survival and neurite outgrowth following
immunopanning (see below). Cross sections of the retina revealed that the
transplanted RGCs predominately resided on the vitreous side of the nerve fiber
layer (NFL) with a significantly smaller proportion of cells migrating into the
ganglion cell layer (GCL) or remaining in the vitreous (Fig. 3.1F,G). There was no
83
Figure 3.1 Developing retinal ganglion cells survive and migrate into the adult
retina after transplantation in vivo. Embryonic and postnatal retinal ganglion cells
(RGCs) were purified by immunopanning, labeled in vitro with CM-DiI (red) or CellTrace
(green), or derived from transgenic β-actin-GFP mice and transplanted intravitreally into
adult rat eyes. Nuclear staining (DAPI, blue) defined the retinal lamina (dotted lines).
Purified RGCs survived and extended neurites 24 hours (a-d) and 7 days (d) following
intravitreal transplant (Scale bar, 200 µm for a,b; 100 µm for c,d). P4 RGCs (green)
survived and extend neurites along the nerve fiber layer (arrowheads in b) and in the
ganglion cell layer (arrowheads in c), in the vitreous (arrow in d) and the inner plexiform
layer (arrowhead in d) 24 hours after transplantation. (e) Approximately ~1600 and ~600
cells of 50,000 injected cells survived 24 hours and 7 days after injection, respectively,
demonstrating a significant decrease in survival (N = 3, *P < 0.01, ANOVA with post hoc
Dunnett’s test; mean ± SEM). (f,g) Donor cells were most frequently encountered in the
nerve fiber layer both after 24 hours (f) and 7 days (g) after transplantation. (NFL, nerve
fiber layer; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer)
84
correlation between RGC migration into deeper retinal layers and the needle
injection site. Potential issues and concerns with using a viable Cell Trace dye
were allayed by comparing these results with transplantation experiments using
RGCs derived from β-actin-EGFP mice as the donor cells. GFP-RGCs had
similar survival and migration capacity to Cell Trace dyed RGCs following
transplantation (Fig. 3.1D). In order to ensure our criteria for determining which
layer the donor cell resides, we stained a subset of retinas with βIII-tubulin to
label the nerve fiber layer (NFL) (Fig. 3.1D, bottom). Using this marker as well as
DAPI nuclear labeling as lines of demarcation to define each layer, we found
similar migration results to DAPI nuclear stain-based criteria alone. Taken
together, our results demonstrate that transplanted RGCs can survive and
occasionally migrate into the GCL in vivo, opening new avenues for studying the
integration capacity of neurons transplanted directly into their appropriate region.
RGC Survival Following Ex Vivo Transplantation
In order to observe the capacity of RGCs to integrate into a host retina, we
developed an ex vivo model system taking advantage of our capability to isolate,
purify and label retinal ganglions cells, combined with a well-characterized
organotypic retinal explant culture system (Fig. 3.2) (Johnson and Martin, 2008).
We first investigated RGC viability following transplantation onto a normal adult
retinal explant in serum-free medium that strongly supports RGC survival in vitro
and in vivo (Meyer-Franke et al., 1995; Shen et al., 1999). RGCs purified from a
broad developmental time window he even distribution and survival of RGCs
across the retina was apparent at lower magnifications as well (Fig. 3.3A). The
85
Figure 3.2 Acutely purified RGCs survive following ex vivo transplantation. (a)
RGCs were acutely purified by immunopanning and labeled in vitro with CM-DiI (red, a)
or Cell Trace (green, not shown), or derived from transgenic β-actin-GFP mice and
cultured for 24 hours on adult retinal explants in serum-free growth medium containing
BDNF, CNTF, insulin and forskolin. After 24 hours retinas were fixed, counterstained
with DAPI (blue) to highlight nuclei, and imaged using confocal microscopy. (b) Nuclear
staining (DAPI, blue) was used to identify living (arrow) and dead (condensed,
arrowhead) nuclear morphologies of transplanted RGCs (red) 24 hours after
transplantation. (Scale bar, 100 µm for a; 20 µm for b). (c) Quantification of survival
based on nuclear morphology demonstrated similar survival of transplanted developing
RGCs and reduced survival of transplanted adult RGCs (N = 3, *P < 0.001, ANOVA with
post hoc Dunnett’s test; mean ± SEM).
86
survival of transplanted adult RGCs was significantly lower than all the other
developmental ages tested (Fig. 3.2C), consistent with our observations that
adult RGCs are less likely to survive following purification and culture in vitro
(data not shown). Thus our results demonstrate that the host retinal explant
readily supports RGC survival, providing a system to investigate neurite growth,
migration, and synapse formation.
RGC Neurite Growth Following Ex vivo Transplantation
We next investigated the ability of transplanted neurons to extend neurites
in the host adult retina. RGCs purified from all of the developmental ages tested
were readily capable of extending robust neurites, often greater than 500 µm in
length (Fig. 3.3A, B). Furthermore, RGCs generally displayed dendritic-like
arborization and one long axon containing a growth cone (Fig. 3.3C). Of the
surviving cells, we quantified how many (%) of these cells were capable of
extending at least one 50 µm neurite. Quantification of neurite outgrowth 24
hours after transplantation across the various ages tested demonstrated little
difference among developing RGCs’ ability to extend neurites, although surviving
transplanted adult RGCs had significantly less neurite outgrowth compared to
any of the developmental ages tested (Fig. 3.3D). Using both Z-stack confocal
microscopy as well as cryosections, we found transplanted neurons mostly
extended neurites along the NFL but were also capable of sending neurites
deeper into the inner plexiform layer (IPL; Fig. 3.3E,F). Thus purified primary
RGCs from a range of developmental ages can survive and extend neurites after
transplantation.
87
Figure 3.3 Acutely purified RGCs extend lengthy neurites and migrate into the
ganglion cell layer following transplantation. (a) Postnatal RGCs (red) transplanted
onto retinal explants (blue) under low magnification displaying robust survival and
neurite outgrowth throughout the retinal surface. (b) Postnatal RGCs (green) extended
lengthy neurites along host βIII-tubulin positive (red) neurite tracks. (c) Postnatal RGC
displaying dendritic-like arborization (arrowhead) and one long axon with a growth cone
(arrow) (Scale bar, 100 µm for a,b; 50 µm for c). (d) Quantification of neurite outgrowth
24 hours after transplantation across the various ages tested demonstrated little
difference among developing RGCs’ ability to extend neurites and significantly reduced
neurite outgrowth was observed among surviving adult RGCs (N = 3, *P < 0.001,
ANOVA with post hoc Dunnett’s test; mean ± SEM). (e,f) RGC somas (red) of embryonic
(e) and postnatal (f) were observed in the nerve fiber layer (NFL; arrowhead in e) and
ganglion cell layer (GCL; arrow in e) with processes projecting both deeper into the inner
plexiform layer (IPL, arrow in f) as well as along the NFL (arrowhead in f). (Scale bar, 50
µm for e,f). (g) Migration was quantified with 3D confocal Z-stack projections using DAPI
nuclear morphology as a guide for defining the distinct retina lamina, Approximately 40%
of RGCs migrated into the ganglion cell layer, independent of the age of the immature
donor RGCs and significantly reduced migration was observed in adult RGCs (N = 3, *P
< 0.01, ANOVA with post hoc Dunnett’s test; mean ± SEM). (ONH, Optic Nerve Head).
88
RGC Migration into the Ganglion Cell Layer
The transplanted RGCs are initially transplanted on top of the inner
limiting membrane (ILM) and the nerve fiber layer (NFL). Using DAPI nuclear
staining to define the retinal lamina, we next asked how many of the transplanted
RGCs migrated into deeper layers of the retina, including the GCL, where RGC
cell bodies normally reside. Within the first 24 hours, approximately 40% of the
transplanted developing RGC somas were found in the GCL; on a percentage
basis, adult RGCs were significantly less able to migrate into deeper layers after
transplantation (Fig. 3E.G). As noted above, RGCs in the GCL extended neurites
along the NFL as well as in the deeper IPL (Fig. 3.3E, F). Even though the cells
were transplanted at clonal density (500 cells/mm2), some cells were found
clustered together. We do not know whether or not this reflected RGCs migrating
towards neighboring cells transplanted nearby. Taken together, these data
demonstrate that embryonic and postnatal RGCs have a similar capacity to
migrate deeper in the retina following transplantation.
Prolonged Transplant Culture Results in Donor RGCs with Robust Survival
and Neurite Outgrowth and Increased Ganglion Cell Layer Localization
We next investigated whether transplanted RGCs would continue to
survive, extend long neurites and migrate deeper into the retina one week in
culture. We found robust survival of transplanted RGCs following one week of
retinal explant co-culture. After 24 hours, around 45% of the observed labeled
cells were viable while following one week of culture, around 90% of the
observed labeled cells were viable (Fig. 3.4B). We hypothesize that, similarly to
89
RGCs in culture, a proportion of the cells do not survive past the first 24 hours
following immunopanning, but that the RGCs that do survive past this time point
retain robust survival even in long term cultures.
When next asked whether these surviving cells retain their long and
elaborate neurite outgrowth over one week in culture compared to 24 hours. We
found that, indeed, the cells that survived one week had extensive and long (over
1mm longer) neurites (Fig 3.4A). In certain instances, we observed long RGC
projections directed and even entering the optic nerve head (ONH) (Fig 3.4A, top
and bottom). Although the RGCs projected neurites in all directions, it should be
noted that many of the projections that were directed towards the ONH had
thicker axon-like projections with classic growth cone tips (Fig 3.4A, bottom,
arrowhead).
We examined the location of the transplanted cells using confocal
microscopy, by generating tiled z-stack projection images of the retinal explants
(Fig. 3.4D) beginning above the NFL (slide 1) and ending at the INL (slide 5).
Although we found neurites in all the layers, we only found cell somas on or in
the NFL or among the host soma in the GCL (Fig. 3.4E,F). After 24 hours, most
of the cells (~80%) were either on or embedded in the NFL with only 20% of the
cells localized to the GFL. After one week in culture, we observed significantly
higher proportion of the live cells in the GCL (65%) and less cells in the NFL
(35%) (Fig 3.4G). This suggests that overtime either more cells migrate to the
GCL or that cells that migrate to the GCL are somehow more neuroprotected and
survive more robustly. Taken together, we have shown here that over one week,
90
Figure 3.4 Transplanted GFP+ RGCs demonstrate robust survival and extensive
neurite outgrowth with a majority of cells localized to the GCL following long term
co-culture on retinal explants. GFP+ RGCs were acutely purified by immunopanning
and cultured on adult retinal explants in serum-free growth medium containing BDNF,
CNTF, insulin and forskolin. After 24 hours or 7 days retinas were fixed, immunostained
for GFP (green), βIII-tubulin (red) and counterstained with DAPI (blue) to highlight nuclei,
and imaged using confocal microscopy. Nuclear staining was used to identify living and
dead (condensed) nuclear morphologies of transplanted RGCs (green). (b)
Quantification of survival based on nuclear morphology demonstrated significantly
(P<0.02) higher survival following 7 days in culture compared to 24 hours in culture. We
found extensive neurite outgrowth towards the ONH (a, top, arrowheads) with neurites
displaying prototypical axonal growth cone tips (a, bottom, arrowheads). (c)
Quantification of the percent of live cells extending lengthy neurites demonstrated that
following one week in culture, most (90%) of the cells extended extensive and elaborate
neurites. (d) Z-stack images of the retinal explants were acquired from (d,1) above the
NFL to the (d,5) INL in order to localize the cell soma (green) to a specific layer. Cell
somas were localized (e) on or in the NFL or (f) in the GCL. (g) After 24 hours, most of
the cells (~80%) were either on or embedded in the NFL with only 20% of the cells
localized to the GFL. After one week in culture, we observed significantly (P<0.02)
higher proportion of the live cells in the GCL (65%) and less cells in the NFL (35%).
(Scale bar, 300 µm for a, top; 50 µm for a, bottom; 200 µm for d; 50 µm for e,f. ; N =
3, *P < 0.02, ANOVA with post hoc Dunnett’s test; mean ± SEM).
91
92
transplanted RGCs survive and extend elaborate growth cone-producing neurites
that in some instances project over long distances towards the ONH.
Furthermore, over time we observe more cells in the GCL, which demonstrates
the capacity of transplanted RGCs to migrate into appropriate neural layers.
In Vitro Differentiation and Purification of Retinal Ganglions Cells from
Retinal Progenitors
It is not known whether RGCs differentiated in vitro from retinal progenitor
cells would be similar in their properties to RGCs purified from the richer context
of the developing retina. We proliferated retinal progenitors from the E14 retina
into neurospheres (Fig. 3.5A) which were subsequently induced, through mitogen
withdrawal, to spontaneously differentiate into retinal neurons in culture media
that promotes RGC survival (see methods; Fig. 3.5B) (Meyer-Franke et al.,
1995). After 4 days, cells were trypsinized and presumptive RGCs were isolated
by Thy1 immunopanning. Immunostaining of a subset of cells revealed that after
a 4 day differentiation period, 3% of the total cells were positive for the retinal
ganglion cell marker Brn3 (Fig. 3.5C) and 15% were positive for the neural cell
marker βIII-tubulin (Fig 3-5B). From a total of 180 million cells, 300,000 RGCs
(0.16%) were purified by Thy1 immunopanning. The cells were either
transplanted into our organotypic explant model or plated on poly-D-lysine (PDL)and laminin-coated dishes. The in vitro differentiated RGCs demonstrated similar
morphology to purified primary neurons including the ability to form long axon
93
Figure 3.5 Isolation and purification of in vitro-differentiated RGCs. (a) E14 rat
retinal neurospheres were expanded in culture in the presence of mitogens. (b) Mitogenwithdrawal in culture conditions initiated retinal differentiation from nestin expressing
progenitors (green) to βIII-tubulin expressing neurons (red; nuclei counterstained with
DAPI in blue throughout figure). (c) Approximately 3% of cells in in vitro differentiated
cultures stained positive for Brn-3b (green), an RGC-specific marker. (d) In vitrodifferentiated RGCs after purification by Thy1 immunopanning, labeled with CellTrace
(green) and cultured on Poly-d-lysine/laminin coated dishes. Isolated Thy1+ cells
demonstrated RGC morphology, and almost all cells stained positive for βIII-tubulin (e,g)
and Brn-3 (f,h) (Scale bar, 50 µm for a,b,c; 30 µm for d,e,f ; N = 3, *P < 0.001, ANOVA
with post hoc Dunnett’s test; mean ± SEM).
94
and dendrite-like structures (Fig. 3.5D). Furthermore, all of the purified cells
stained positive for the neuronal marker βIII-tubulin and the RGC specific marker
Brn-3, and none of the cells stained positive for the neural progenitor marker
Nestin demonstrating the efficiency of immunopanning in isolating progenitorderived RGCs away from progenitor cells or other derived progeny (Fig. 3.5E-H).
Thus large numbers of RGCs may be differentiated and purified from retinal
progenitor cell cultures.
In Vitro Differentiated RGC Survival, Neurite Outgrowth, and Migration
Following Transplantation onto Retinal Explants
We next asked how these in vitro-derived RGCs compare to primary
RGCs in their ability to survive, elaborate neurites, and form synapses after
transplantation. Immediately after isolation, in vitro-differentiated, purified RGCs
were acutely labeled with CellTrace Oregon Green (pseudocolored red) and
transplanted using the ex vivo model as described above. Compared to RGCs
purified
directly
from
developing
retinas,
in
vitro-differentiated
RGCs
demonstrated reduced survival in retinal explants (Fig. 3.6A-E); similarly reduced
survival was also observed when plated in vitro on plastic dishes (data not
shown). In contrast, quantification of neurite outgrowth of surviving in vitroderived RGCs demonstrated little difference compared to that of developing
primary RGCs (Fig. 6A.D,F). Approximately 40% of in vitro differentiated RGCs
migrated into the GCL, similar to the migration observed with primary RGCs and
considerably more than the significant reduction in migration observed with adult
RGCs (data not shown). Thus, other than reduced survival, in vitro-differentiated
95
Figure 3.6 Acutely purified and in vitro-differentiated RGC survival, neurite
outgrowth, and migration into the ganglion cell layer improves in retinal explants
28 days after optic nerve axotomy. (a,b,c,d) RGCs labeled with CellTrace
(pseudocolored red) were transplanted onto ex vivo retinas explanted after sham
surgery (a,c,c’) or 7, 14, or 28 days after optic nerve axotomy (b,d,d’). Host retinas were
subsequently labeled with βIII-tubulin (pseudocolored blue); note the relative absence of
host RGC cell bodies at 28 days after axotomy (d’) compared to the control retina
(arrows in c’). (Scale bar, 30 µm for a,b). (e,f) Acutely purified and in vitro-differentiated
RGC survival and neurite outgrowth was increased in retinal explants at 28 days after
optic nerve axotomy (N = 3, *P < 0.001, ANOVA with post hoc Dunnett’s test; mean ±
SEM; i.v.-RGCs were only tested in the sham and 28-day conditions).
96
RGCs exhibit similar capacity for neurite growth and migration in the adult retina
compared to primary RGCs.
RGC Transplantation into Injured Adult Retina
An injured host environment may influence the integration capacity of
transplanted cells (Emsley et al., 2004). The specific degeneration of RGCs
following optic nerve axotomy follows a well-characterized degeneration rate in
which ~40% of RGCs have died after 7 days, 95% have died after 14 days, and
98% of RGCs have died 28 days after axotomy (Berkelaar et al., 1994). We first
asked whether the injured adult retina would provide a more or less supportive
environment for survival, neurite growth, or migration of transplanted RGCs.
Adult rat RGCs were retrogradely labeled with fluorogold prior to optic nerve
axotomy. Retinas were then explanted at 7, 14 and 28 days after axotomy for the
ex vivo RGC transplantation paradigm as above. We found that retinas from 7and 14-days post-axotomy supported transplanted primary RGCs’ survival as
well as control, uninjured retinas (Fig 3.6A,C,C’,E). Similar levels of survival were
observed for both embryonic (E20) and postnatal (P3) transplanted RGCs as well
as in vitro-differentiated RGCs. However, we found that E20, P3 and in vitrodifferentiated donor RGC survival was significantly (P<0.001) greater when
transplanted onto retinas explanted 28 days post-axotomy (Fig. 3.6B,D,D’,E).
Primary and in vitro-differentiated RGCs transplanted into the 28 days postaxotomy host retina also displayed enhanced neurite outgrowth (Fig 3.6F). Taken
together, these results suggest that the retina becomes more supportive of
97
transplanted RGC integration only after significant host RGC degeneration,
irrespective of whether the donor RGC are primary or in vitro-derived.
Transplanted RGC Neurites Orient Along Host Retinal Neurites
After observing that transplanted neurons mostly extended their neurites
along the nerve fiber layer (NFL), we investigated in what directions the
transplanted neurons were sending neurites in relation to host axons, by
immunostaining with βIII-tubulin (Fig. 3.7A,B) to highlight all neurites. By labeling
both host and donor neurites, we found that some of the transplanted RGCs
appeared to orient their neurites with host axons directed towards the optic nerve
head. When we quantified how many of the surviving transplanted RGCs
oriented their neurites with host neuronal projections we found that roughly 40%
of E20, P3 RGCs as well in vitro-differentiated RGCs had neurites that oriented
along the nerve fiber path towards the optic nerve head (Fig. 3.7C). Interestingly,
there was a significant (P<0.01) increase (~58%) in neurite orientation observed
among all donor sources when transplanted into explants of 28 day postaxotomized retinas (Fig. 3.6C). Thus transplanted RGCs tend to elongate their
axons along the host RGC axon bundles, and this effect is more pronounced
after host RGC/NFL degeneration.
Transplanted RGCs’ Neurites are Slightly Oriented to Intra-Retinal Axons
Using the OrientationJ plugin (see methods for details) for ImageJ, we
next asked if all the combined processes of the transplanted cells were
completely random in direction or whether they orient towards the ONH (Fig.
3.8A,B). We found that in the central, middle and peripheral areas of the eye,
98
Figure 3.7 Purified primary and in vitro-differentiated RGCs orient along host
neurites. (a,b) RGCs (green) transplanted onto retinal explants oriented with (arrows) or
across (arrowheads) host retinal neurites (stained with βIII-tubulin, red) (Scale bar, 50
µm for a,b). (c) Quantification demonstrated that donor RGCs oriented with host neurites
independent of donor source, but RGCs transplanted into 28 day post-axotomized
retinas demonstrated significantly increased neurite orientation (N = 3, *P < 0.02,
ANOVA with post hoc Dunnett’s test; mean ± SEM).
99
Figure 3.8 Total transplanted RGC neurites orient to intra-retinal axon tracts of the
host retina. (a,b) GFP+ RGC neurites were imaged and assigned net orientations
(ellipses; see Methods). Furthermore, the retinal explant was divided into central, middle
and peripheral regions of interest. (c) The frequency of neurites extending in each
direction, partitioned into three bins of 30°. There was a significant difference comparing
0-30° and 30-60° as well as comparing 0-30° and 60-90°, indicating some degree of
alignment of transplanted RGC neurite growth with the host retina. (Scale bar, 300 µm
for a, 200 µm for b, left and 50 µm for b, right; N = 3, *P < 0.02, ANOVA with post hoc
Dunnett’s test; mean ± SEM).
100
101
there was a significantly (P<0.02) higher proportion of neurites oriented 0-30
degrees away from the ONH compared with 30-60 or 60-90 degrees (Fig. 3-.C).
These data suggest that all three regions of the retina support a similar level of
neurite orientation towards the ONH.
Synapse Formation onto Primary and In Vitro-Differentiated RGCs
Following Transplantation onto Adult Retinal Explants
Finally, we asked whether we could detect morphologic pre-synaptic
puncta following RGC transplantation. Purified primary and in vitro-differentiated
RGCs were transplanted onto ex vivo adult rat retinas as above. The presynaptic
marker synaptophysin was found immediately adjacent to the neurites and cell
bodies of transplanted RGCs (Fig. 3-9). Interestingly, primary postnatal donor
RGCs were surrounded by significantly more (P<0.001) synaptophysin-positive
puncta compared with in vitro-differentiated donor RGCs (Fig. 3.9). These data
suggest that purified primary neurons may more readily synaptically integrate into
the host retinal environment compared with neurons which were purified from
retinal progenitor cells differentiated in vitro, or that the in vitro differentiated
RGCs are less mature and require more time to receive as many pre-synaptic
connections.
102
Figure 2.9 Acutely purified and in vitro-differentiated transplanted RGCs form
morphologic pre-synaptic puncta in retina. Purified primary (a, b) and in vitrodifferentiated (c) RGC neurites and somas (green) localized with the pre-synaptic
marker synaptophysin (purple; co-localization shown with white arrows). (Scale bar, 15
µm for a, b). (d) Transplanted primary postnatal RGCs showed more pre-synaptic
marker co-localization then in vitro-differentiated RGCs (*p<0.01, paired t test; mean ±
SEM, N=3).
103
Discussion
These data reflect three main findings. First, we have created an explant
model of retinal transplantation that allows detailed examination of RGC-retinal
morphologic integration. Second, we have demonstrated that RGCs may be
purified from retinal precursor cultures, and that they share many of the same cell
biological properties as primary RGCs. Third, we have established that
progenitor-derived RGCs have similar capacity for integration as developing
primary RGCs, but appear to form a lower number of morphologic synapses.
Transplantation of Primary Neurons
Here we examined the short-term survival, migration, neurite growth, and
morphological synapse formation of retinal ganglion cells after transplantation
into the adult retina in an ex vivo explant model, and in vivo. An advantage to this
explant model is that it allowed us to provide an optimal media for survival and
growth, and to carefully control for factors like cell density. This model system
also allows us to transplant RGCs in close proximity to the GCL by culturing the
donor cells on top of and directly adjacent to the GCL, and avoiding the need to
forcibly inject the cells into tissue, which may also decrease initial survival.
Longer-term studies and further application to in vivo work may benefit from
advances made in such ex vivo models.
To our knowledge, this is the first report studying the transplantation of a
purified, identified neuron to its host tissue, and also the first report to purify a
specific neuron type from in vitro-differentiated progenitor cells. With both primary
RGCs purified from a range of developmental ages, and RGCs immunopanned
104
from differentiating retinal progenitor neurosphere cultures, we found that RGCs
survive transplantation and migrate into the GCL in similar fashion. The
transplanted RGCs were capable of extending long neurites in the normal and
injured adult rat retina ex vivo. Overall, we found that transplanted RGCs mainly
resided on the NFL, although this may have been due to relatively shorter culture
times, or to the strongly trophic media provided on the outside of the retina.
Recent
findings
demonstrate
how
the
extracellular
matrix
and
other
environmental signals limit the integration of transplanted cells (Zhang et al.,
2007), and the degradation of some of these molecules with enzymes such as
MMP2 has been shown to support integration and retinal repopulation following
transplantation (Suzuki et al., 2007). Even so, limited migration may not
necessarily limit integration with the host retina. Indeed our explant model
demonstrates that transplanted RGCs that reside on the NFL project long
neurites which fasciculate with and form morphologic pre-synapses with host
intra-retinal axon tracts.
There were three experimental manipulations in which we could identify
more optimal “integration”: (1) developing primary RGCs and in vitrodifferentiated RGCs consistently demonstrated higher levels of survival and
migration than adult primary RGCs; (2) primary RGCs formed more morphologic
synapses than in vitro-differentiated RGCs; and (3) the degeneration of host
retinal RGCs after optic nerve injury only enhanced donor RGC survival after 28
days, but not at 7 or 14 days when RGC degeneration was still ongoing.
105
Developing RGCs Integrate Better Than Adult RGCs
We found that postmitotic RGCs isolated across a broad developmental
window display similar capacities to survive, migrate deeper into the retina, and
extend long neurites in the adult retina in vivo and ex vivo. Donor RGCs from a
wide range of developmental ages equally extended neurites along the nerve
fiber layer with some neurites growing deeper into the inner plexiform layer,
where RGC dendrites normally reside. These findings differ slightly from prior
photoreceptor and cortical transplantation experiments which found that donor
cells isolated at a developmental period close to the peak birthdate in vivo had
the greatest capacity for integration, and this capacity fell off very rapidly, even
while still in early development (Hernit-Grant and Macklis, 1996; MacLaren et al.,
2006) . MacLaren and colleagues transplanted dissociated retinal cells from
various donor ages subretinally in mouse and found that postmitotic rod
precursor were capable of reintegrating synaptically in the photoreceptor layer
better than multipotent progenitors, and that donor cells from rods’ peak retinal
birthdate had the most highly structured morphological and synaptic integration.
The transplantation of these immature rod cells was capable of improving visually
evoked potentials in genetic models of mouse photoreceptor degeneration, either
by synaptically reintegrating into the pre-existing adult circuitry, or by attenuating
the ongoing degeneration and enhancing the function of the residual
photoreceptors (MacLaren et al., 2006; Suzuki et al., 2007) . It is not yet known
whether similar developmental differences in integrative capacity will be found
among other long projection neurons in the central nervous system.
106
The equal capacity for neurite extension among all the developmental
ages tested matches previous work in RGCs, where both E20 and P8 RGCs can
elaborate axons in this optimized growth medium (Goldberg et al., 2002b).The
prior finding that intrinsic ability to rapidly extend axons is downregulated across
development was not addressed in these studies, as we did not measure neurite
lengths after transplantation, but we did observe that donor primary RGCs from
postnatal day 2 (P2) had more neurite fasciculation with host axons compared
with P8 donor RGCs. The long fasciculating neurites projecting from the donor
RGCs will have to be further analyzed to determine whether these are indeed
axonal or dendritic. An interest in donor axons growing along host fascicles
towards the optic nerve head might argue for the use of younger primary RGCs,
based on these data.
In Vitro-Differentiated RGCs Demonstrate Decreased Synapse Formation
Immature neurons pre-differentiated in culture from stem cells may
potentially be the best candidates for neuronal re-integration, however the
prospect of successful neural transplantation will require an improved
understanding of the intrinsic properties of the donor cells, as well as how these
properties change during increasingly restricted neuronal differentiation.
Interestingly, we observed that primary RGCs from any developmental age
consistently aligned with more synaptophysin-positive puncta than did in vitrodifferentiated RGCs. Perhaps in vitro differentiated RGCs are more immature
and are less competent to receive synapses, or the environment does not
support synapse formation due to a lack of necessary signals, for example from
107
mature glial cells (Pfrieger and Barres, 1997), or synapse formation is merely
delayed (Barker et al., 2008). Furthermore, it is unknown how these
differentiation conditions affect the communication of the donor cells with
extrinsic signals in the host environment, especially in an injured or degenerating
host environment.
Future work including electrophysiological recording and
identification of the host cells involved should help elucidate the correlation
between the marker staining seen here and the function of these synapses.
The Degenerating Retina Enhances RGC Transplant Survival
Targeted apoptotic neurodegeneration has been used to produce highly
controlled spatially and temporally specific cell death of selected types of
projection neurons within defined regions of the cortex. Photo-activated induction
of cell death in the neocortex has been shown to affect migration and
differentiation of transplanted neurons as well as transplanted neural precursors
(Madison and Macklis, 1993; Sheen et al., 1992; Sheen and Macklis, 1994; Shin
et al., 2000; Snyder et al., 1997). In these experiments, later-stage and regionspecific immature neurons integrated when transplanted back into injured adult
cortex where they usually are located more efficiently than after transplantation to
ectopic regions of injured cortex. However, at postnatal stages of development,
limits in the survival of the donor, immature cortical neurons offset this improved
efficiency (Fricker-Gates et al., 2002). Experiments transplanting RGCs into other
regions of the CNS or perhaps transplanting cortical neurons into the retina may
better elucidate whether neurons are more “universal” or more “specific” in their
capacity to integrate into adult neural circuits.
108
Molecular Signals Critical to Integration of Transplanted Neurons
Are there sufficient signals in the adult retina, or perhaps increased in the
injured adult retina that can facilitate survival, migration, neurite outgrowth and
guidance, and synapse formation of transplanted RGCs? Many developmentally
expressed molecular signals persist in the adult retina, including netrin, an RGC
axon chemoattractant, and its receptor DCC on RGC neurites (Ellezam et al.,
2001); N-CAM (Doherty et al., 1990); and laminin along Muller glial endfeet in the
nerve fiber layer (Wolburg et al., 1991). Other signals for RGC synapse formation
such as thrombospondin (Christopherson et al., 2005) may be downregulated
during normal development but could be re-expressed after transplant or in an
injured tissue. As CNS neurons largely fail to regenerate from endogenous
precursors after injury, stem cell-based cell replacement therapies are being
actively investigated. The decision of whether and to what extent neurons are
differentiated before transplantation will be influenced by a better understanding
of
the
cellular
and
molecular
biology
of
neuronal
integration.
Chapter 4
Tunable hydrogel-based scaffold for retinal repair
Chapter summary
The central nervous system consists of complex groups of individual cells that
receive electrical, chemical and physical signals from their local environment.
Standard in vitro cell culture methods rely on two dimensional (2-D) substrates
that poorly simulate in vivo neural architecture. Neural cells grown in threedimensional (3-D) culture systems may provide an opportunity to study more
accurate representations of the in vivo environment than 2-D cultures.
Furthermore, each specific type of neuron depends on discrete compositions and
physical properties of their local environment. Previously, we developed a library
of hydrogels composed of poly (ethylene glycol) and poly (L-lysine) which exhibit
a wide range of mechanical properties. Here, we identified specific scaffolds from
this library that readily support the survival, migration and neurite outgrowth of
purified retinal ganglion cells and amacrine cells. These data address important
biological questions about the interaction of neurons with the physical and
chemical properties of their local environment and provide further insight for
engineering neural tissue for cell replacement therapies following injury.
Motivation
Two-dimensional (2D) culture systems provide a practical solution for
studying survival and neurite outgrowth of neurons in culture, however threedimensional (3D) culture systems can potentially deliver higher degrees of
control and organization of cellular environments, more physiologically relevant
109
110
cell migration, and support the formation of more extensive 3D networks of cellcell interactions(Griffith and Swartz,
2006;
Lutolf
and Hubbell,
2005).
Furthermore, cells alone are often not capable of recreating complex tissues on
their own although stem and progenitor cells may form 3D tissues under certain
conditions (Eiraku et al., 2011). Nevertheless, on a 3D scaffold, cells may
recapitulate features of complex tissues not otherwise observed in 2D cultures.
Hydrogels are excellent candidates for 3D scaffolds for ex vivo culture of
mammalian cells. Hydrogels demonstrate mechanical properties that parallel the
properties of soft tissues(Tibbitt and Anseth, 2009). The hydrogel’s aqueous
environment protects cells, allows for transport of nutrients and metabolite
exchange, permits physical, chemical, and biological modification, and
demonstrates a generally high biocompatibility.
In our previous work we developed a library of two-component hydrogels
composed of poly(ethylene glycol) (PEG) and poly(L-lysine) (PLL) as candidates
for synthetic tissue matrices(Hynes et al., 2008). Our library of PEG/PLL
hydrogels exhibits a wide range of mechanical, chemical, and biologic properties
that can be varied independently to mimic the ECM. Our previous research has
shown that certain hydrogels in this library greatly influence migration and
differentiation of mouse neural stem cells (NSCs)(Hynes et al., 2008). To ask if
these scaffolds can support survival and neurite growth of mature neurons, we
screened the library of hydrogels, beginning with those identified as good
substrates for NSCs. In the appropriate hydrogel environment, we found that
acutely purified retinal ganglion cells (RGCs) and amacrine cells (ACs) readily
111
survive and extend extensive neurite outgrowth following seeding onto PEG/PLLbased hydrogel scaffolds.
Material and methods
Materials
Four-arm poly(ethylene glycol) (PEG Mn 2000 g/mol and 10,000 g/mol) was
obtained from Nektar Therapeutics (Huntsville, AL). Poly (L-lysine) hydrobromide
(PLL MW 70–150 kDa and 150–300 kDa) and all other reagents were obtained
from Sigma (St. Louis, MO) and used as received. SpectraPor dialysis
membranes (MWCO 1000 Da and 6000–8000 Da) were obtained from Spectrum
Laboratories (Rancho Dominguez, CA) and rinsed thoroughly with deionized
water before use.
Synthesis of Activated PEG
Carbamate cross-links between PEG and PLL macromers (Fig. 4.1A) were
created through N, N-carbonyldiimidazole (CDI) activation of PEG as described
previously (Ford et al., 2006; Hynes et al., 2008). Briefly, PEG was dissolved in
an excess of dioxane at 37°C. For every hydroxyl present on PEG, a 1:8 molar
excess of CDI was added. The resulting mixture was stirred under argon for 2 h
at 37°C. Unreacted CDI was removed by dialysis in deionized water for 48 h. The
resulting solution was flash frozen in liquid nitrogen and lyophilized for 3 days.
Activated PEG was stored in a desiccator at −20°C.
112
Figure 4.1 General experimental procedures. (A) Simple chemical reaction scheme
for the chemically cross-linked hydrogels used in the in vitro studies. (B) Schematic
showing the hydrogel preparation procedures and experimental plan for cell seeding and
analysis.
113
Fabrication of Hydrogels
All hydrogels were fabricated as 10% w/v polymer in 1X phosphate buffer
solution (PBS). A range of PLL and activated PEG ratios were dissolved in 1X
PBS, mixed vigorously, and allowed cure/cross-link at room temperature for 2436 h. The PLL and activated PEG ratios chosen were based on a subset of gels
from the library of gels previously created(Hynes et al., 2008). These particular
gels were chosen for two reasons: (1) their ability to polymerize without additional
chemical modification, and (2) their ability to influence neural stem cell survival
and differentiation(Hynes et al., 2008).
Hydrogel Morphology
To ensure the swollen architecture of the hydrogel would be maintained for
imaging, a multi-step dehydration process was used. Gels were swollen in 1X
PBS for 12-18 h, frozen overnight at −20°C, placed in a liquid nitrogen bath for 1
h, and then lyophilized for 24 h. Gel cross-section samples were mounted and
sputter coated with gold for 30 s at 40 mA. The morphology of the hydrogels was
then evaluated by scanning electron microscopy (SEM, Philips XL-30
environmental SEM operating at 10 kV).
Rheology
Elastic
moduli
for
swollen
hydrogels
was
determined
as
previously
described(Hynes et al., 2008). Briefly, hydrogels were cured and then swollen
overnight in 1X PBS. 20-mm discs were then cut from the swollen hydrogel and
tested. Elastic moduli were obtained using a Stress Control Rotational Shear
Rheometer-AR1000 (TA Instruments, New Castle, DE) with acrylic 20-mm
114
diameter parallel plate geometry. Moduli were measured with a constant normal
force of 2 N.
Preparation of Hydrogels for Cell Studies
Hydrogels were swollen in DPBS 18 h to allow for equilibrium swelling. Following
swelling, uncoated gels (1 mm × 5 mm) were sterilized by UV exposure (30 min,
5 mW/cm2). To enhance attachment of RGCs and ACs, the gels were coated
with sterile laminin (2 mg/mL; Telios/Invitrogen). Gels were thoroughly rinsed with
sterile DPBS prior to cell seeding (Fig. 4.1B).
RGC and AC Purification and Culture
RGCs and ACs were purified by immunopanning as previously described (Barres
et al., 1988; Meyer-Franke et al., 1995). Briefly, postnatal rat retinas were
dissociated with papain (Worthington) and mechanically triturated to obtain a
single-cell suspension. The retinal suspensions were first depleted of rat
macrophages by immunopanning (1:75, AI A51240; Accurate Chemical,
Westbury, NY. Using T11d7 (Thy-1) coated dishes, RGCs were purified to over
99% purity as confirmed by RGC specific markers (data not shown). Enrichment
of ACs to 88% purity was achieved after depleting rat macrophages and T11d7and Ox7-positive cells and immunopanning for VC1.1-positive cells (Kunzevitzky
et al., 2010). Cells were released from cell culture dishes with a combination of
trypsin (0.02% in DPBS) and mechanical trituration. RGCs and ACs were seeded
at 50,000 cells per hydrogel or on 24 well plates coated with poly-D-lysine (PDL)
(70 kDa, 10 µg/ml; Sigma) and laminin (2 mg/ml; Telios/Invitrogen) in serum-free
defined medium containing BDNF (50 ng/mL; Peprotech), CNTF (10 ng/mL;
115
Peprotech), insulin (5 µg/mL; Sigma), and forskolin (5 µM)(Barres et al., 1988;
Meyer-Franke et al., 1995).
RGC and AC Survival Assay
After four days in culture, growth media was replaced with neural growth media
containing 1 μm calcein-AM (Invitrogen, Carlsbad, CA) and 4 μM propidium
iodide (Invitrogen) for 5 minutes in a 37°C 10% C0 2 incubator. The culture media
was then removed and replaced with fresh neural cell growth media. Live cells
were immediately imaged under confocal microscopy (Leica TCS SP5 Confocal
Microscope). Using a 10x dipping objective, 50-µm Z-stack projections were
acquired under fluorescence confocal microscopy. Three visual fields were
randomly sampled from each scaffold; at least 100 cells were counted from each
field, and three scaffold replicates were analyzed for each condition. Live
(calcein-positive, PI-negative) and dead (PI-positive) cells were manually
counted.
RGC Neurite Direction and Orientation Assay
The orientation of neurites of RGCs on scaffolds were measured using the
ImageJ plugin OrientationJ, written by Daniel Sage and available at
http://bigwww.epfl.ch/demo/orientation/. The ellipses were made using the
‘measure’ function of the plugin with the LaPlacian of Gaussian set to zero. The
eccentricity of the ellipses demonstrates calculated coherence of the direction of
neurites. The narrower the ellipse the higher the coherence and the direction of
the ellipse also indicates the direction of lines in the region of interest measured.
A perfect circle would denote a completely random configuration. The frequency
116
of neurites extending toward an arbitrary direction was measured by the
Distribution function of the OrientationJ plugin. The Gaussian Gradient was used
with a sigma value of 1, a minimum coherency of zero, and a minimum energy of
0. Values from the output were normalized and then wrapped around 90° for
each region to indicate the direction toward the 90° vertical. Data were
partitioned into three bins of 30° each. The Shannon entropy of the θ distribution
from the histograms is calculated as H θ =-Σp n ln(p n ). This value quantifies the
uncertainty of the θ distribution and measures the extent to which neurite growth
is oriented to a particular angle. The greater the amount of entropy, the higher
amount of randomness.
Results
Hydrogel Morphology and Elasticity
Selected hydrogels (Table 4.1) from the library were synthesized and their
morphology was characterized. SEM of the swollen synthesized hydrogels
revealed an open, porous network with pores on the order of 20-200 µm (Fig.
4.2). Elastic moduli of the hydrogels, as determined by rheology in the previous
study(Hynes et al., 2008), varied from 1406±139 Pa for hydrogel D1b to
23146±1547 Pa for hydrogel D4c (Fig. 4.3).
RGCs and ACs Survive and Extend Elaborate Neurites on PEG/PLL
Hydrogels
We first asked whether primary RGCs and/or ACs could survive following
transplantation onto hydrogel scaffolds. A library of scaffolds was generated to
screen for physical and chemical properties which best supports RGC and AC
117
Figure 4.2 Hydrogel rheology. Column graph of the elastic moduli (G’) of each of
hydrogels synthesized with PLL MW 70-150 kDa (A); column graph of the elastic moduli
(G’) of each of hydrogels synthesized with PLL MW 150-300 kDa (B) Data represented
as mean±SEM.
118
NH 3 :OH
4-arm
PEG
(Mn
g/mol)
(D)
2000
(E)
10,000
6:1
PLL (MW in
kDa)
4:1
PLL (MW in
kDa)
3:1
PLL (MW in
kDa)
1:1
PLL (MW in
kDa)
(b)
70150
(c)
150300
(b) 70150
(c) 150300
(b)
70150
(c)
150300
(b)
70150
(c)
150300
D6b
D6c
D4b
D4c
D3b
D3c
D1b
D1c
E6b
E6c
E4b
E4c
E3b
E3c
Table 4.1 PEG/PLL hydrogels analyzed for RGC and AC survival.
119
Figure 4.3 Hydrogel morphology. (A) SEM image of a cross section of swollen E4b
hydrogel showing the porous nature of the gel. (B) Higher magnification SEM image of
swollen E4b hydrogel showing a network of pores approximately 200 µm and smaller.
120
Figure 4.4 RGCs and ACs prefer specific hydrogels. RGCs and ACs were seeded
onto hydrogels and stained using calcein-AM (green) and propidium iodide (red)
to mark living and dead cells, respectively. (A) RGCs on a hydrogel (D1c) that poorly
supports survival. Note the high proportion of dead (red) cells. (B) RGCs on a hydrogel
(E4c) that increases the proportion of surviving (green) cells. (C,D) RGC (C) and AC (D)
neurite outgrowth is elaborate over the surface of the E3b hydrogel. (E) Column graph of
the percent survival of RGCs and ACs on laminin-coated hydrogels. Data represented
as mean ± SD. (Scale bar = 50 µm.)
121
Figure 4.5 RGCs and ACs cells migrate into hydrogels and readily extend
elaborate neurites in three dimensions. RGCs and ACs were seeded onto hydrogels
and stained using calcein-AM (green) to label cell somas and neurites. Live confocal zstack images were acquired. RGCs (A) and ACs (B) retained their stereotyped
morphology. (D) Percent of cells capable of extending at least one neurite over 200 lm.
(Scale bar = 50 lm for A, B, 200 lm for C.)
122
survival. Postnatal RGCs and ACs were purified to homogeneity by
immunopanning, and pipetted directly on the surface of each specific scaffold
type. We observed robust survival of both RGCs and ACs on specific types of
scaffolds (Fig. 4.4B), while other scaffolds failed entirely to support neuronal
survival (Fig. 4.4A). Closer examination of these data revealed a preference for
specific chemical characteristics of the hydrogels. RGCs and ACs have better
survival, 50% or greater, on hydrogels composed of high molecular weight PEG
and a ratio of 3:1 or 4:1 amines to hydroxyls (Fig 4.4C and Table 4.2). These
hydrogels that demonstrated superior cell survival had a range in elastic moduli,
from approximately 3800 Pa to 5800 Pa. No correlation between survival and
moduli was found.
We next asked if surviving RGCs and ACs could extend neurites on the
hydrogel scaffolds. Using confocal microscopy, we observed that purified RGCs
and ACs were capable of extending lengthy neurites, often greater than 500 µm
in length. RGCs generally displayed dendritic-like arborization around the soma
and one long axon containing a growth cone, similarly to what is observed both in
vivo and in vitro on 2D, PDL/laminin-coated dishes (Fig 4.5C). ACs displayed
dendritic-like arborization with star-like morphologies similarly to what is
observed in vivo and in vitro on PDL/Laminin-coated dishes (Fig. 4.4B). When we
measured how many of the cells were capable of extending at least one neurite
over 200 μm, we found that the scaffolds that supported the survival of both
RGCs and ACs were readily capable of supporting lengthy neurite outgrowth.
Using confocal Z-stack projections, we observed that most of the neurites of both
123
Figure 4.6 RGC neurites grow in random directions on hydrogel scaffolds. (A)
RGC neurites were imaged and assigned net orientations (ellipses; see Section 2). (B)
The frequency of neurites extending in each direction, partitioned into three bins of 30.
There was no significant difference between bins, indicating a lack of directionality to
RGC neurite growth. (C) The Shannon entropy of the h distribution from the histograms
(see Section 2) was high, indicating random orientation, but did not differ between
hydrogel scaffolds. (Scale bars = 200 µm.)
124
RGCs (Fig. 4.5C) and ACs were found on the surface of the scaffolds (Fig. 4.5C
top image), but some projections were found to penetrate deeper into the
scaffold structure (Fig. 4.5C bottom image). Thus, purified primary RGCs and
ACs extend lengthy neurites on hydrogel scaffolds.
We next asked if any of the hydrogel scaffolds affect the direction and
orientation of the neurite outgrowth of RGCs. The orientation of neurite outgrowth
of RGCs cultured on hydrogel scaffolds (Fig. 4.6A) were measured using the
ImageJ plugin OrientationJ. The frequency of neurites extending toward an
arbitrary direction was measured by the distribution function of the OrientationJ
plugin. When we partitioned the data into three bins of 30°, we found that for all
scaffolds, the percentage of neurites going in a specific direction (0-30°) was not
significantly different (p<0.01) than those away from it (60-90°) or in neutral
directions (30-60) (Fig. 4.6B). Randomness was measured in terms of entropy
(Fig. 4.6C). All the scaffolds that supported neurite had a similar level of
randomness
associated
with
the
direction
of
neurite
outgrowth.
This
demonstrates that although the hydrogel scaffolds support the elaborate growth
of neurites, the direction of the neurites is random. This suggests that none of the
scaffolds tested provide direction or orientation cues to direct neurite outgrowth
towards a particular direction.
Discussion
The extracellular matrix (ECM) is comprised of a complex organization of
glycoproteins, collagens, and hyaluronic acid (HA), among other components.
The architectural scaffolding provided by the ECM, in addition to the proteins
125
sequestered in the matrix, influence a cell’s ability to differentiate, proliferate,
migrate, and perform other specific functions(Friedl, 2004; Lin and Bissell, 1993;
Nelson and Bissell, 2006). In contrast to the ECM of other tissues, the central
nervous system (CNS) ECM is composed of an HA scaffold with associated
glycoproteins and proteoglycans(Viapiano and Matthews, 2006). This specialized
ECM in the CNS regulates neuronal survival, migration, axon growth, and
synapse formation(Venstrom and Reichardt, 1993; Viapiano and Matthews,
2006). Neurons normally interact with this HA-based matrix through HA-binding
proteins located on the cell surface and in the pericellular ECM, such as the
proteoglycan members of the lectican family (Yamaguchi, 2000). In order to
understand cell behavior within complex tissues like the CNS, cells must be
systematically studied in the context of a model microenvironment.
The paradigm for studying biological questions about complex tissues,
such as the retina, has focused on a limited group of experimental approaches in
culture, including explanting the whole retina, or studying retinal slices; or
studying the cell types involved, either individually or sometimes in pair-wise
combination. The latter option however, provides the researcher with a minimum
of opportunity to learn about cellular development or integration in the 3D
environment these cells normally experience. Studying the retina in vivo
preserves the 3D environment, but this generally restricts the research to
studying a single gene or pharmacologic agent at a time, using large groups of
animals. The system presented here provides a new, customizable research tool
to study cells in a 3D environment.
126
The most readily available option for 3D hydrogel scaffolds is Matrigel, a
solubilized basement membrane preparation extracted from the EngelbrethHolm-Swarm mouse sarcoma primarily composed of laminin, collagen type IV,
heparin sulfate proteoglycans, entactin, and various growth factors(Kleinman et
al., 1986; Kleinman et al., 1982). While many investigators use Matrigel to
study various cell types, the cocktail of ECM proteins and growth factors may not
always be appropriate for the intended research. Furthermore, since Matrigel is
derived from non-human sources, its utility in evaluation of human cell behavior
in a 3D environment is questionable. For example, Eiraku et al used a Matrigelbased 3D culture system to demonstrate that embryonic-stem-cell-derived retinal
epithelium aggregates spontaneously formed hemisphere epithelial vesicles with
proximal-distal axis patterning. The proximal layers differentiated into retinal
pigment epithelium and the distal region folded inward, exhibited interkinetic
nuclear migration, and generated stratified neural retinal tissue similar to the
retina in vivo. These data suggest that optic-cup morphogenesis is strongly
regulated by stepwise cell autonomous programs and domain-specific signals of
local epithelial properties, but requires the presence of ECM proteins found in
Matrigel. Synthetic polymer hydrogels are excellent alternatives to Matrigel.
Use of a synthetic polymer eliminates the issues that arise when using a nonhuman scaffold to study human cell behavior, such as comparability of
experimental results to the human analog. Furthermore, use of a synthetic
polymer as the base for the 3D matrix provides an opportunity to tailor the
127
mechanical and chemical properties of the scaffold to suit the intended research
purposes.
We previously reported reproducible synthesis of a series of PEG/PLL
hydrogels with a range of chemical and mechanical properties. PEG is a highly
biocompatible polymer that adds mechanical integrity to the hydrogel system.
However, cells do not adhere to PEG, therefore incorporation of ECM-binding
proteins into the network is required. To simplify our system we synthesized the
PEG hydrogels with PLL, which non-specifically promotes cell adhesion(Rainaldi
et al., 1998). In addition, since PLL contains free amines, the hydrogel can be
further modified for specific research purposes.
While the RGCs and ACs responded favorably to half of the hydrogels we
tested, survival on these hydrogels varied between the cell types. Hydrogels with
a 3:1 or 4:1 ratio of amines to hydroxyls and high molecular weight PEG,
regardless of PLL molecular weight, provided the best substrate for the RGCs to
attach to. None of the hydrogels that had higher ratios of amines to hydroxyls
demonstrated good survival for either cell type. This is consistent with
observations that polycationic polymers with high free amine concentrations can
be cytotoxic(Wang et al., 2004). Furthermore, hydrogels with low free amine
concentrations displayed decreased survival as well.
The mechanical properties, especially the stiffness, of the scaffold can
play a large role in influencing the behavior of the cells. In the case of the
hydrogels in our library, the RGCs survived best on hydrogels with elastic moduli
ranging from 3800-5700 Pa. However, there were some hydrogels within this
128
range of moduli where RGCs demonstrated poor survival. This demonstrates the
importance of not only the stiffness of the hydrogels in influencing cell RGC and
AC behavior, but the importance of the chemical composition as well.
Interestingly, in our previous work with NSCs, hydrogels which were not
favorable for NSC attachment and survival could be made favorable by coating
the hydrogels with laminin(Hynes et al., 2008), but this was not true for
experiments with RGCs and ACs here.
RGCs and ACs are born during embryonic development from a common
retinal progenitor. These two cell types synaptically integrate with one another in
the same retinal plexiform layer. As previously reported by our lab, most genes
(>74%) are expressed at similar levels in RGCs and ACs at embryonic and
postnatal ages suggesting that they may share some overlapping signals
regulating survival, neurite outgrowth, migration and other properties required for
integrating into an environment (Kunzevitzky et al., 2010). Here we add to this
characterization, finding that similar types of scaffolds supported survival and
neurite outgrowth for both RGCs and ACs.
In the normal eye, RGCs exhibit highly polarized morphology with intraretinal axons directed down well-aligned tracts towards the optic nerve head
(Sernagor et al., 2001). Therefore there is great interest in recapitulating these
precise levels of organization on neural-scaffolds engineered for retinal repair
(Mahairaki et al.; Wang et al.). Our data suggest that the hydrogel scaffolds
tested in these experiments would require further alterations in order to introduce
direction selective cues. Although the direction of neurite outgrowth was entirely
129
random, both cell types survived and extended neurites on the same type of
scaffolds, each cell type still retained their stereotyped morphology, suggesting
that the scaffold environment was not sufficient to alter key morphological
properties intrinsic to each cell type (Kunzevitzky et al., 2010).
Conclusions
Using this model system, we have begun to address a number of
important biological questions about neuronal integration and can begin to ask
which signals participate or influence these processes, as well as to take more
dramatic steps towards an organ-replacement strategy for neural tissue. The
impact of creating 3D neural tissue model systems will enhance studies not only
of all aspects of retinal function, but also of the development and function of the
brain. Future studies may incorporate neurons derived from patients with specific
diseases, using retinal stem cells for example, to enhance our ability to study
how 3D tissue architecture responds differently to insults or therapies.
Furthermore, we propose that a well-characterized 3D tissue-engineered retina
will provide many advantages in cost, animal usage, and assay specificity for
programs interested in gene or drug screening. Finally, it will be a major step
forward in cell replacement therapies currently being studied, to develop a 3D
neural tissue platform as a starting point to study tissue/organ replacement
therapy for the eye or brain, enhancing our understanding of the basic
mechanisms of neuronal integration in these approaches, rebuilding neural
circuitry in vitro, and replacing whole circuits in vivo (Kador and Goldberg, 2012).
Chapter 5
Human ciliary margin stem cell proliferation and differentiation
Chapter summary
Glaucoma and other optic neuropathies result in the loss of retinal
ganglion cells (RGCs) and visual dysfunction. Cell-based therapies may protect
the degenerating retina and potentially restore vision. Here, we show that small
biopsy-sized samples human ciliary margin demonstrate stem cell properties of
proliferation, self-renewal and multipotent potential. In culture, human ciliary
margin cells generated neurospheres, an effect potentiated by growth factor
stimulation. Furthermore, when plated on retinal ganglion cell (RGC) growthpromoting substrates in media that strongly supports RGC survival, a subset of
differentiated progeny acquired neural morphology and stained positive for retinal
markers. These data demonstrate the stem cell-like properties of cells procured
from adult eye biopsies.
Motivation
Most of the adult mammalian central nervous system (CNS) is incapable
of cellular regeneration in the face of degenerative disease or injury. For
example, retinal ganglion cells (RGCs) are not replaced in the retina when their
axons are damaged or degenerate in the optic nerve in diseases like glaucoma
or other optic neuropathies (Al-Shamekh and Goldberg, 2013). Stimulating
cellular regeneration may prove more attainable with the discovery of neural
stem cell-like populations in different regions of the adult CNS (Alvarez-Buylla
and Lois, 1995; Perron and Harris, 2000; Weiss et al., 1996). However, before
cell-based therapies reach patients, many questions remain, including which
130
131
stem cells are safe, readily available/accessible, and capable of differentiation
into RGCs or other retinal cell types.
In the adult eye, several studies have identified a number of different
cellular sources of neural stem cells (Das et al., 2005; Perron and Harris, 2000;
Tropepe et al., 2000). Stem cells, which can self-renew and generate multiple
cell types, are a promising donor source for retinal repair and regeneration
(Johnson and Martin, 2013). Transplantation of stem cells or their progeny into
the retina could provide neuroprotection to the remaining neurons or supplant
lost neurons to repair visual function. Moreover, significant progress has been
made in differentiating stem cells into specific cell types of the CNS including
retinal neurons (Lamba et al., 2010; Osakada et al., 2009; Wang and Harris,
2005; Yan et al., 2005).
In lower vertebrates, Müller glial cells and ciliary margin stem cells
generate new RGCs that then grow their axons down the optic nerve (Fischer et
al., 2002; Fischer and Reh, 2003). However in mammals, both ciliary margin cells
and Müller glial cells do not proliferate in response to retinal injury. Recently,
subpopulations of cells in both the ciliary body and Müller glial cells in the human
retina have been demonstrated to exhibit stem cell properties of self-renewal and
multipotent potential in culture (Coles et al., 2004; Tropepe et al., 2000) (Bhatia
et al.). However, others have debated whether these ciliary margin cells
accurately exhibit retinal stem cell properties such as their multipotent potential
for specific retinal cell types (Cicero et al., 2009).
132
Until now, samples from patients undergoing ocular procedures have not
been investigated for their stem cell potential. Here we investigate the feasibility
of recovering proliferative populations of stem cell-like cultures from biopsy-sized
samples of ciliary margin tissue (pars plana and pars plicata) from human eyes.
We demonstrate that a subpopulation of cells from these samples exhibit stem
cell properties including self-renewal, proliferation and multipotent potential to
differentiate into specific retinal cell types including RGCs.
Materials and methods
Animals
All use of animals conformed to the Association for Research in Vision
and Ophthalmology (ARVO) Statement for the Use of Animals in Research, and
was approved by the Institutional Animal Care and Use Committee (IACUC) and
the Institutional Biosafety Committee of the University of Miami. Mice were bred
from the following strain: C57BL/6-Tg (CAG-EGFP) 10sb/J (Stock # 003291,
Jackson Laboratory).
Human subjects and ciliary margin dissection
All tissues derived from human subjects were stripped of protected health
information to maintain compliance with HIPAA. Biopsy sized samples of ciliary
margin attached to scleral tissue were obtained from ocular melanoma patients in
phosphate buffered saline (PBS) from an ophthalmic surgical team directly
following enucleation, and as such were IRB-exempt. Ciliary margin tissue was
gently peeled away from sclera and either left whole or carefully cut to segregate
the pars plicata from the pars plana.
133
Mouse ciliary margin dissection
C56Bl/6 mice (Jackson Laboratories) were euthanized and eyes were
immediately enucleated, and rinsed in PBS. Carefully eyes were cut in half with
forceps and 11# surgical blade and the cornea and lens are gently peeled away.
Ciliary margin tissue was gently flayed away from sclera and with an 11# surgical
blade either left whole or carefully cut to segregate the pars plicata from the pars
plana.
Ciliary margin cell culture
Human (each biopsy sample) and mouse ciliary margin tissue (10 adult
mice) are dissociated into single cells using the same protocol. For both human
and mouse cell cultures, the tissue was gently dissociated in 165 units of papain
(Worthington Bioscience), 2 mg L-cysteine (Sigma), and 0.004% DNase (Sigma)
in 10 mL of DPBS (Invitrogen) in a 37°C water bath for 30 minutes. Cells were
then gently triturated for 5 minutes with a P1000 pipette in the presence of
ovumucoid containing trypsin inhibitor (Roche) to stop enzymatic activity. Cells
were then spun down at 700rpm for 5 minutes and resuspended in 10 mL of
DPBS with .02% BSA. Cell suspension was subsequently rinsed through a 100
micron and then a 40 micron filter (Invitrogen) and spun down again at 700 rpm
for 5 mins. Cells were then resuspended in a defined, serum-free DMEM/F12based (Invitrogen) media (Coles et al., 2004) containing for 20 mL of media:
400µL B27 (Chen et al., 2008), 200µL 100X SATO stock, 200µL L-glutamine (1
mM Gibco, final concentration), and 200µL Penicillin/Streptomycin (100X stock,
Gibco) with or without the presence of epidermal growth factor (EGF, 50 ng/mL;
134
Peprotech) and basic fibroblast growth factor (bFGF, 50 ng/mL; Peptrotech).
Cells were then plated at clonal density (100 cells/µL) on 6-well non-adherent
plates. Cells were cultured in these conditions for 7 days with a media change on
day 4. For Shh signaling experiments; recombinant Sonic hedgehog (Shh, see
graph for concentration, Peprotech) protein or cyclopamine (see graph for
concentration, Peprotech) were added during the first 7 days of culture to
measure their effects on neurosphere formation. After 7 days, cells were either
dissociated and passaged for the formation of new neurospheres or assessed for
differentiation. To measure differentiation, after 7 days of culture, neurospheres
were collected and plated as undissociated spheres on dishes coated with polyd-lysine (PDL, 70 kDa, µg/mL; Sigma) and laminin (2 µg/mL; Telios/Invitrogen) in
a serum free medium Neurobasal-based (Invitrogen), as described (Hertz et al.,
2013). For 20 mL of media the following were added: 400µL B27 (Chen et al.,
2008), 200µL L-glutamine (Invitrogen), 200µL 100X SATO stock,, 200µL TriiodoL-Thyronine (T3, Sigma), 20µL N-Acetyl-L-cysteine (1000X, NAC, Sigma), 200
µL Insulin (50 ng/mL final concentration, Invitrogen), 200µL 100mM sodium
pyruvate, 20 µL brain-derived neurotrophic factor (BDNF, 50 ng/mL final
concentration; Peprotech), ciliary neurotrophic factor (CNTF, 10 ng/mL final
concentration; Peprotech), and forskolin (5 mM; Sigma). Cells were cultured for 7
days with a media change at day 3 before fixing and immunostaining for retinal
markers. Detailed protocols available upon request.
135
Immunostaining
Ciliary margin cell cultures were briefly fixed for 15 min in 4%
paraformaldehyde (PFA) in PBS and then rinsed with PBS. Cells were blocked
and permeabilized with 10% donkey serum and 0.2% Triton X-100, respectively,
for 30 min. Cells were then incubated with primary antibodies, including antinestin (1:100, DSHB), anti-microtubule associated protein-2 (1:1000, MAP2,
Sigma) anti-recoverin (1:100, Santa Cruz), anti-glial fibrillary activated protein
(1:500, GFAP, Sigma), anti-Pax6
(1:10, DSHB) or anti-Chx10 (1:100, Santa
Cruz) overnight at 4° C. Cells were rinsed three times with PBS and incubated
with
the
matching
fluorophore-conjugated
secondary
antibodies
(1:500;
Invitrogen) overnight at 4° C. Cells were then rinsed in PBS containing DAPI
(1:10,000) to label cell nuclei, rinsed with PBS, and imaged using fluorescence
microscopy (Zeiss).
Statistical Analysis
Student t tests and analysis of variance (ANOVA) statistical tests were
conducted to identify significant differences among groups in all experiments
(Graphpad and Excel).
136
Results
Human biopsy-derived ciliary margin tissue from either pars plicata or pars
plana form neurospheres in culture
Biopsy sized portions of human ciliary margin were dissected from the
sclera (Fig. 5.1A). Carefully, the pars plicata was separated from the pars plana
(Fig. 5.1B), gently dissociated and plated at clonal density (Fig. 5.1C) in a
defined serum-free stem cell media with or without the mitogenic growth factors
epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF). Cells
derived from human pars plana and pars plicata tissue contained cells that
proliferated for 7 days to form spheres of pigmented and non-pigmented cells
ranging in size from 100-400 μm in diameter (Fig. 5.1D). We observed the
formation of pigmented neurospheres with or without the presence of growth
factors, however, cells cultured with mitogenic factors developed significantly
more neurospheres (Fig. 5.1E) (*p < 0.05). Furthermore, the pars plicata region
of the ciliary margin had significantly more retinal neurospheres compared with
the pars plana (p* < 0.05) with or without growth factors present the media (Fig.
5.1E). We next asked if ciliary margin-derived neurospheres express neural
progenitor proteins. The neurospheres formed in cultures with or without
mitogenic factors stained strongly for the neural stem cell marker nestin (Fig.
5.1F).
We next asked if the age of the eye donor has an effect on the number of
neurospheres generated in culture. We assessed the proliferative potential for
neurosphere formation from biopsy samples from donors ranging in age from
137
Figure 5.1 Human biopsy-derived ciliary margin tissue from either pars plicata or
pars plana form Nestin+ neurospheres in culture. (A) Biopsy sized samples of
human ciliary margin were dissected from the sclera and (B) the pars plicata (arrow
head) was separated from the pars plana (arrow). Cells were plated at clonal density (C)
in a defined serum-free stem cell media (see Methods) with or without the mitogenic
growth factors epidermal growth factor (20 ng/mL EGF) and basic fibroblast growth
factor (20 ng/mL bFGF). (D) After 7 days in culture, cells derived from human ciliary
margin tissue contained cells proliferated to form spheres of pigmented and nonpigmented cells ranging in size from 100-400 μm in diameter. (E) Ciliary margin cells
formed neurospheres with or without the presence of growth factors, however, cells
cultured with mitogenic factors developed significantly more neurospheres (*p< 0.05).
The pars plicata tissue had significantly more retinal neurospheres compared with the
pars plana tissue with or without growth factors present the media (*p < 0.05). (F) Ciliary
margin-derived neurospheres stained positive for the neural stem cell marker nestin.
(Scale bar, 400 µm for C, 400 µm for D, 100 µm for D; N = 3, *P < 0.05, ANOVA with
post hoc Dunnett’s test; mean ± SEM).
138
30-75. When we cultured these cells in mitogenic conditions, we found the
number of neurospheres derived from the ciliary margin were similar among the
different donor ages (Fig. 5.2). Thus, our data suggests stem cell properties such
as proliferation and self-renewal persist in these cells derived from older adults
and maintain similar proliferation rates to those derived from younger adults.
To further characterize the proliferation of human biopsy derived stem
cells, we next looked at how proliferation of neurospheres derived from human
ciliary margin tissue compares with mouse ciliary margin tissue. Ciliary margin
stem cells derived from mice have been expanded in culture and differentiated
into retinal neurons and glia (Tropepe et al., 2000). When cultured under the
same conditions, we found that ciliary margin derived from human biopsy
samples generated the same number of neurospheres (Fig. 5.3A, *p < 0.05) and
proliferate to form these neurospheres at similar rates (Fig. 5.3B, *p < 0.05)
compared with mouse tissue. Thus, these findings suggest that neurospheres
derived from mouse ciliary margin can be a suitable model and can provide
relevant insight into signals that regulate human stem cell properties. These
findings further corroborate the significance of findings generated from mouse
knockout models (Fang et al., 2013; Moshiri and Reh, 2004).
Mice with a mutation in Sonic hedgehog signaling demonstrate persistent
proliferation of ciliary margin stem cells in vivo (Moshiri and Reh, 2004). Thus, we
asked if human ciliary margin stem cells respond directly to Sonic hedgehog
(Shh) signals. To address this question we proliferated human ciliary margin cells
139
Figure 5.2 Donor age has no effect on neurosphere formation. (A) Ciliary margin
samples were collected from donors ranging in age from around 30-75 and
neurospheres were generated in a proliferation media in the presence of growth factor
(see methods for media, N=3, slope = -0.37, R2= 0.1132).
140
Figure 5.3 Ciliary margin derived from human biopsy samples generate similar
number of neurospheres compared with mouse tissue. Human and mouse ciliary
margin tissue were dissociated and cultured in proliferation media (see methods). Ciliary
margin derived from human biopsy samples generated similar (A) number of
neurospheres (*p < 0.05) and proliferate to form these neurospheres at (B) similar rates
(*p < 0.05) compared with mouse tissue (N = 3, *P < 0.05, ANOVA with post hoc
Dunnett’s test; mean ± SEM).
141
in the presence of growth factors with either recombinant Shh (20, 50, 100 or 200
ng/mL) or the Sonic hedgehog pathway inhibitor cyclopamine (20, 50,100 200
ng/mL). Cells exposed to recombinant Shh generated significantly more
neurospheres (Fig. 5.4A) with significantly larger diameters (Fig. 5.4B, *p < 0.05)
compared with cells cultured with cyclopamine or without either factor (Fig.
5.4A,B). Taken together, this demonstrates that ciliary margin-derived stem cell
proliferation is regulated by Shh signaling both positively and negatively, and
supports the hypothesis that within the neurospheres there is a basal level of Shh
signaling pathway activation.
We next asked how ciliary margin-derived cells respond to RGC growthpromoting signals and substrates. When plated on adherent plates with
PDL/laminin in a serum-free defined media that strongly promotes differentiated
RGC survival (Meyer-Franke et al., 1995), cells from the pigmented
neurospheres began to migrate away from the neurospheres to form a
monolayer (Fig. 5.4A). As the cells migrated, many of the cells lost a majority of
their pigmentation. A small proportion of these cells begin to display
morphological properties of neurons including a soma and thin, neurite-like
processes (Fig. 5.4B). Cells with this morphology did not express the neural
progenitor marker nestin (Fig. 5.4C) and expressed the neuronal marker MAP2
(Fig. 5.4D). To identify the neural and glial differentiation of these progeny, we
immunostained for photoreceptors with recoverin (Fig. 5.5A), glia with GFAP
(Fig. 5.5B), amacrine cells with Pax6 (and Nestin-negative), and RGC-like cells
142
Figure 5.4 Ciliary margin stem cell proliferation into neurospheres is responsive to
Sonic hedgehog signaling. Human ciliary margin cells were proliferated in the
presence of growth factors with either recombinant Shh (20, 50, 100 or 200 ng/mL) or
the Sonic hedgehog pathway inhibitor cyclopamine (20, 50,100 200 ng/mL) or control.
Cells subjected to recombinant Shh generated (A) significantly more neurospheres (*p <
0.05) with (B) significantly larger diameters (*p < 0.05) compared with cells cultured with
cyclopamine or without either factor (N = 3, *P < 0.05, ANOVA with post hoc Dunnett’s
test; mean ± SEM).
143
Figure 5.5 In differentiation conditions, ciliary margin-derived neurospheres lose
pigmentation and a subset of cells differentiate into cells with morphological
features of neurons. Neurospheres were plated on adherent plates with PDL/laminin in
a serum-free defined media that promotes differentiated RGC survival (see methods).
(A) After 7 days, cells from the pigmented neurospheres have migrated away from the
neurospheres, loss pigmentation, and form a monolayer. (B) A small proportion of these
cells display morphological properties of neurons including a soma and thin, neurite-like
processes (Scale bar, 400 µm for A, 100 for B).
144
Figure 5.6 Ciliary margin-derived neurospheres differentiate into a variety of progeny
with expression characteristics of retinal cells. Cells with neuronal morphology (see Fig.
5.4) did not express the neural progenitor marker (A) nestin and expressed the (B)
neuronal marker MAP2. To identify the more specific neural and glial cell types we
immunostained for photoreceptors with (C) recoverin, (D) glia with GFAP , (E) amacrine
cells with Pax6 (and Nestin-negative), and (F) bipolar or progenitors with Chx10 (see
Table 5.1, scale bar, 100 µm).
145
with MAP2 (Fig. 5.5C). When we quantified the progeny expressing each of
these markers, we found similar proportions to that seen from embryonic retinal
progenitor cultures (Table 5.1). Thus ciliary margin-derived neurospheres can
differentiate into a spectrum of progeny with morphological and expression
characteristics of retinal cells.
Discussion
Taken together, these data demonstrate that ciliary margin cells derived
from biopsy-sized samples can proliferate and differentiate into retinal cell types
in vitro in serum-free conditions. Other stem cell sources have also been
explored for retinal and RGC differentiation potential. Embryonic stem cells
(ESCs) have been the most widely researched pluripotent cell that have been
differentiated into most retinal cell types including RGCs in culture (Aoki et al.,
2009; Osakada et al., 2009). Uncovering signals regulating stem cell pluripotency
have led to the discovery that somatic cells can be reprogrammed to revert back
to an embryonic stem cell-like competence state. These cells, first described in
Japan in 2006 (Takahashi et al., 2007; Takahashi and Yamanaka, 2006), have
advantages over ESCs as a potential donor cell source including the potential for
autologous and patient specific generation of cells. However, mounting evidence
supports that reprogrammed cells are still influenced by and display particular
properties depending on the type of cells they were derived from (Al-Shamekh and
Goldberg, 2013). Therefore, because the safety and efficacy of retinal cells derived
from IPSCs for clinical treatments remains unclear, other adult stem cells that do
not require genetic reprogramming should be thoroughly explored for new potential
146
Table 5.1 The progeny of differentiated human ciliary margin neurospheres
express markers in similar proportions to that observed from embryonic
retinal progenitor cultures
147
donor stem cell sources for cell-based therapies. Ciliary margin-derived
progenitor cells may offer advantages such as accessibility, reproducibility,
patient-specificity, and safety compared with ESCs and IPSCs, although most of
these considerations have yet to be formally tested.
Are ciliary margin-derived cells actually stem cells? Non-mammalian
vertebrates, such as birds or fish continue to grow in size after development.
Thus, their eyes along with their retinas must also grow proportionately. To
accomplish this, new neurons are generated from ciliary margin stem cells and
integrate into the periphery of the retina (Das et al., 2005; Karl and Reh, 2010).
The equivalent mechanisms are not found in mammals in vivo, however our and
others’ work show that these cells may exist, albeit in a quiescent state. Recent
results further suggest that signals found in the regenerative program in nonmammalian vertebrates remain in the mammalian retina (Karl and Reh, 2010). In
knockout experiments in vivo, Ephrin-A3 has been shown to regulate this
quiescent state by suppressing Wnt signaling (Fang et al., 2013).
On the other hand, it has recently been proposed that the population of
cells that form neurospheres in culture do not represent a true stem cell
population (Cicero et al., 2009). The authors of that study hypothesized that the
multipotency observed in culture is due to a transdifferentiation phenomenon of
differentiated pigmented ciliary epithelial cells potentiated in response to growth
factors in media (Cicero et al., 2009). Their evidence for this claim is based on
observing traces of pigment in cells that also stain positive for retinal markers.
Furthermore they also observed poor retinal differentiation, in particular to
148
photoreceptor cell fate. However, we and other provide strong evidence against
these propositions to suggest that the ciliary margin population represents, in
fact, true stem cells that can give rise to multiple retinal lineages.
Transdifferentiation connotes differentiation of a single cell without proliferative or
self-renewal, which is not the case with stem cells derived from ciliary epithelium
observed in our experiments as cells in culture are readily passaged from clonal
density. Additionally, the multipotency of the ciliary margin stem cell and its ability
to differentiate into various retinal cell types, including photoreceptors, have now
been substantiated by numerous labs (Das et al., 2005; Del Debbio et al., 2013;
Inoue et al., 2006; Tropepe et al., 2000).
The similar frequency of neurosphere generation from younger adult
tissue to older adult tissue suggests that the quiescent stem cell population is
maintained throughout life in vivo which is particularly important when
considering that a majority of eye diseases affect older adults. Furthermore, we
demonstrate a higher proliferation of cells isolated from the pars plicata
compared with the pars plana which suggests that the pars plicata may be a
more efficient sub region of the ciliary margin to biopsy for future stem cell
sourcing.
We also show that the proliferation of human ciliary margin cells into
neurospheres is similar to mouse ciliary margin cells when cultured under similar
conditions, and in particular that proliferative response is regulated by Shh
signaling. In transgenic mice up to three months of age heterozygous for the Shh
receptor Patched, the presence of persistent progenitors suggests that Shh
149
signaling regulates stem cell proliferation in vivo (Moshiri and Reh, 2004). In our
experiments, we found that proliferation of adult ciliary margin derived stem cells
in culture increases or decreases with Shh pathway stimulation or inhibition,
respectively. Further investigation is required to elucidate the differences
observed in vivo and in vitro but these data might suggest difference in the
expression of Patched.
Together these data suggest that at least certain
properties of retinal progenitors are preserved in adult stem cells from mouse to
human.
Conclusion
Thus we have isolated retinal stem cells in the adult mammalian retina
from biopsy-sized samples of patients undergoing ocular procedures. These data
point to the possibilities for treatments for glaucoma and other optic neuropathies
(Johnson and Martin, 2013). Experimental studies using rodents confirm the
potential for retinal stem cells for RGC transplantation (Hertz et al., 2013) but
also emphasize the importance of supportive combinatorial signals for the proper
differentiation and integration of donor cells into the host retina (Johnson and
Martin, 2013; Lamba et al., 2009; MacLaren et al., 2006). Finally, although we
have identified a new way to acquire ciliary margin stem cells, much work
remains before these cells are effectively and safely used for clinical treatments.
It will be interesting to pursue the biology of these cells further, whether the
neurogenic potential of ciliary margin cells can be realized for cell replacement
therapy, or whether these cells or their progeny can provide trophic support to
promote host cell survival and regeneration in degenerative diseases such as
150
glaucoma, or whether these cells could be stimulated in vivo through drug or
gene therapy to activate endogenous regeneration and cell replacement.
Chapter 6
Discussion and conclusion
Retinal ganglion cell differentiation and transplantation
People diagnosed with glaucoma and other optic neuropathies exhibit a
prognosis of progressive and irreversible loss of vision caused by the death of
RGCs (Quigley, 2005). Cell-based therapies provide new promise for recovering
vision loss by replenishing lost neurons with stem cell-derived ‘replacement
neurons’. The scope of my work presented in this thesis focuses on two critical
questions required for RGC replacement therapies to advance towards the clinic.
(1) What signals are required and sufficient for the specification of RGCs, in vivo
during development, and in vitro from various stem cell populations? (2) Can in
vitro-derived RGCs integrate into their local environment following transplantation
into an injured adult eye or a synthetic hydrogel scaffold, towards cell or tissue
therapy?
In the retina, neurogenesis begins in a central-to-peripheral direction
(Brand and Livesey, 2011; Cayouette et al., 2003; Sernagor and Mehta, 2001).
Whether or not an RPC continues to divide and self-renew or exit the cell cycle
and differentiate is dependent on a delicate balance of opposing signals
(Cayouette and Raff, 2003; Mu et al., 2005; Qiu et al., 2008). These signals also
regulate the competence of subpopulations of progenitors to commit to specific
cell types. RPCs undergo differentiation into one of seven cell types in an
evolutionarily preserved sequence while forming discretely laminated patterning
(Agathocleous and Harris, 2009; Livesey and Cepko, 2001). RGCs are the first
151
152
cell type to differentiate along with amacrine cells, horizontal cells and cone
photoreceptor cells. Next, bipolar cells, rod photoreceptor cells, and Müller glial
cells are born as ‘late’ progeny. However, until recently the signals that regulate
RPC-to-RGC specification were unknown.
The proneural bHLH transcription factor Math5 is critical in determining
RPC competency for RGC specification (reviewed in Chapter 1). Subpopulations
of proliferating RPCs become less responsive to Notch signaling, which
subsequently promotes Math5 expression which in turn results in cell cycle exit
(Hufnagel et al., 2007; Le et al., 2006). Math5 begins to be expressed at
approximately the same time and in the same cells where Notch pathway
signaling proteins Delta, Hes1 and Hes5 are expressed (Brown et al., 2001;
Wang et al., 2001). However, Math5 is not sufficient to specify the RGC cell fate
as RPCs as Math5-expressing RPCs give rise to multiple retinal cell types (Yang
et al., 2003). Commitment to the RGC lineage is marked by the reduction
of Math5 expression and presence of newly expressed RGC specific proteins
such as the POU domain transcription factor Brn3b and the LIM-homeodomain
transcription factor Isl1 (Gan et al., 1999; Mu et al., 2008; Pan et al., 2005).
Taken together, as Math5 is insufficient as an instructive signal for RGC
specification, it was unclear what other signaling pathways work in concert with
Math5 to specify RGC fate.
SoxC Transcription Factors Regulate RGC Fate Determination
When thinking about cell differentiation and transplantation, a critical gap
in our grasp of the mechanisms regulating cell differentiation are the signals that
153
regulate cell fate to specific cell types lost in disease such as glaucoma and other
CNS neuropathies. In this thesis, we provide new insight into this issue by
identifying Sox4 and Sox11 as key regulators of RPC-to-RGC fate commitment.
The SRY (sex determining region Y)-box (Sox) family of transcription factors
have been characterized into groups A-E. In vertebrates, including human, the
Sox genes in group C consist of Sox4, Sox11, and Sox12 (Penzo-Mendez,
2010). Invertebrates, such as drosophila, have a highly conserved single SoxC
gene. (Bowles et al., 2000). SoxC proteins regulate transcription through a
conserved SRY-related HMG box (Sox) DNA-binding domain found in the Nterminus of the protein and a transactivation domain (TAD) found at the Cterminus (Penzo-Mendez, 2010). What are the known functions of SoxC during
development? The roles and functions of SoxC proteins remain incompletely
understood, however, strong evidence from mouse models demonstrate their
crucial role in cell fate and differentiation in numerous important developmental
processes. For example, Sox4-null embryos and Sox11-null newborns die from
heart malformations while Sox12-null mice are viable and show no noticeable
malformations (Dy et al., 2008). Studies derived from these mutant mice revealed
that Sox4 regulates the differentiation of lymphocytes, pancreatic beta cells, and
osteoblasts (Penzo-Mendez, 2010). SoxC genes are also expressed in neuronal
progenitors and in mesenchymal cells of many developing organs (Bhattaram et
al., 2010; Thein et al., 2010). Furthermore, Sox4 and Sox11 expression is greatly
increased in tumor cells of multiple forms of cancer but their function and direct
link to cancer pathology remain unclear (Castillo et al., 2012; Wasik et al., 2013).
154
Recent data suggest that SoxC misexpression and incorrect subcellular
localization may be important factors in the progression of multiple forms of
cancer (Vervoort et al., 2013b). Taken together, SoxC transcription factors
control cell differentiation, proliferation, survival and other essential functions
during development, but little was known about their function in the retina. And, a
deeper understanding of the mechanisms governing these pathways may help
answer important questions across multiple disciplines including development
and cancer biology.
Are SoxC proteins expressed by RGCs and sufficient to stimulate RGC
fate specification? From microarrays generated in our lab of embryonic and
postnatal acutely purified RGCs, we identified Sox4 and Sox11 among other
candidate genes with expression patterns that exhibit high expression
embryonically
which
go
down
during
postnatal
development.
The
developmentally regulated expression pattern expressed by RGCs coupled with
strong supporting evidence of SoxC function in cell differentiation in other areas
of the CNS helped build my hypothesis that these proteins may also regulate
RGC development (Bergsland et al., 2006; Potzner et al., 2010). Thus, SoxC
genes became among the candidate genes tested in my RGC fate specification
overexpression screen (See Chapter 2). Are SoxC proteins sufficient for RGC
fate specification? To address this important question, we conducted
overexpression experiments with RPCs and found that both Sox4 and Sox11
overexpression significantly increased the differentiation of RGCs from RPCs.
Currently it remains unknown what are the downstream targets of SoxC
155
transcription factors during RGC fate specification. Future experiments using
chromatin
immunoprecipitation
(ChIP)
combined
with
Next-Gen.
RNA
sequencing will help uncover the targets of these transcription factors to further
fill in more nodes of this complex gene regulatory network. Although our
immunostaining revealed SoxC proteins was mainly present in RGCs and a
subset of amacrine cells, determining how other retinal cell types are affected by
Sox4 and Sox11 overexpression remains for future exploration with a particular
interest in the effects on subtypes of amacrine cells and Müller glial differentiation
(Hoser et al., 2007). Furthermore, it will be of great interest for future experiments
to co-express both Sox4 and Sox11 together (perhaps along with Math5) to ask if
the pro-RGC differentiation effects of each SoxC protein synergize to increase
the efficiency in which RGCs are generated from stem cells. Thus, the RPC-toRGC overexpression screen uncovered a novel family of RGC differentiation
transcription factors that, to date, are among only a few proteins sufficient to
induce RGCs from their progenitors.
Are SoxC proteins required for RGC differentiation? The complete
knockout of Sox4 and Sox11 in mice results in developmental lethality. Thus, to
study RGC development in vivo, we used multiple cre-lines specific to retinal
development (Furuta et al., 2000) to knockout floxed alleles of Sox4 and Sox11
(Penzo-Mendez et al., 2007). We observed a significant (~25%) but not a
complete loss of RGCs in both Sox4 and Sox11 knockout mice. This differs from
SoxC knockout studies of other areas of the CNS in which knockout of either
Sox4 or Sox11 alone did not exhibit any apparent deficiencies compared with
156
control (Potzner et al., 2010). Perhaps this suggests that previously
characterized SoxC regulated regions of the CNS could be more discretely
characterized for losses of more specific types of neuron. This is particularly
important if neuron subtypes critical for normal functions are only a small
proportion of the total number of cells in the CNS area investigated. For example,
RGCs account for only around 0.5% of the total cells in the adult retina and yet
these cells make up the optic nerve required for vision. Although our
immunostaining data shows widespread and overlapping expression of both
Sox4 and Sox11 in RGCs, it remains unclear whether Sox4 and Sox11 are
required for the same subpopulation of RGCs. The loss of RGCs observed in the
KO of each gene alone (25%) may either reflect a subpopulation of RGCs
sensitive to the loss of either SoxC protein or that Sox4 and Sox11 each regulate
their own subpopulation of RGCs. Lineage tracing experiments using Sox4-cre
and Sox11-cre mice bred with floxed reporter mice will help elucidate these
questions, but remain for future investigation. Next, we asked if the combined
loss of Sox4 and Sox11 further potentiates the loss of RGCs observed in the
single knockouts. Remarkably, we observed a complete loss of optic nerve and a
near complete absence of RGC somas in Chx10-cre Sox4/11 double knockout
mice substantiating their critical role in RGC differentiation. These mice exhibited
no forms of microphthalmia or other observable malformations. Moreover, we
found that aside from Müller glial cell increase, no other retinal cell type was
affected by the loss of Sox4/11 which strongly suggests that the SoxC network is
specific to RGC differentiation. Patterned electroretinograms (ERG) experiments
157
will help elucidate how function is affected by the severe loss of RGCs observed
in the different SoxC KO permutations. Furthermore, as this is quite a unique
phenotype, mice completely missing their optic nerves may be helpful for future
patterned ERG studies to better understanding the contribution of RGCs to these
complex physiological wave functions. Additionally, our data demonstrates that
Sox4 and Sox11 remain expressed in adult RGCs. Therefore, it is unknown if
their continual expression is required to sustain RGC survival. Future
experiments using temporally controlled transgenes may help answer these
questions. Taken together through gain and loss of experiments we have
demonstrated that Sox4 and Sox11 as RGC regulate whose expression is
sufficiency and required for RGC development but many important questions
remain unanswered.
How do SoxC proteins interact with other proteins to bind to their targets?
Similarly to SoxB1 and SoxE proteins, SoxC cooperate with POU domain
transcription factors Brn1 and Brn2 to activate multiple signaling pathways
including FGF enhancers (Dy et al., 2008; Kuhlbrodt et al., 1998). A recent report
demonstrated that SoxC proteins may also regulate non-transcriptional targets.
For example, Sox4 can bind to and subsequently stop the degradation of p53 in
lung non-small cell carcinoma cells (Pan et al., 2009). Apoptosis signaling in
RGCs have been shown to be regulated by p53 signaling but whether or not
these same mechanisms recapitulate in RGCs remains for future investigation (Li
et al., 2002).
What are some known functional binding sites of SoxC
transcription factors? Functional SoxC binding sites were detected in the
158
regulatory element of the pan-neuronal gene βIII-tubulin which may be a direct
target of these proteins (Bergsland et al., 2006; Hoser et al., 2008).
Overexpression expression of Sox4 demonstrated a reduction in oligodendrocyte
differentiation in mice (Hoser et al., 2008) suggesting that the SoxC genes may
both promote differentiation of progenitor cells into neurons and inhibit
differentiation into glia. In our SoxC conditional KO mice, we found an increase in
Müller glial cells with figures statistically similar to the corresponding loss of
RGCs. Since our immunostaining evidence suggests that Mueller glial cell do not
express either Sox4 or Sox11, I hypothesize this as an indirect effect from the
loss of RGCs. Cepko and others have proposed a model in which Mueller glial
cells are the default cell type generated last during retinal histogenesis (Jadhav
et al., 2006). Perhaps in our KO models, the RPCs fail to differentiate into RGCs
and differentiate into Mueller glial fate by default towards the end of retinal
histogenesis. More discrete analysis of the timing during which this inappropriate
increase of Mueller glial cells occurs may help address these questions. Taken
together, these data provide support that SoxC genes regulate RGC
differentiation specifically and that the loss of RGCs in KO animals results in
indirect effects on other cell types.
REST Repression of RGC Fate Determination Is Sox4-Dependent
What signals control SoxC gene expression? For example, as neuronal
progenitors differentiate into neurons, they acquire unique sets of proneural
transcription factors. The transcriptional repressor REST prevents progenitors
from precocious differentiation to regulate generation of the proper number of
159
neurons. REST was first characterized as a repressor of neuronal differentiation
in non-neuronal cell types (Bruce et al., 2004; Chong et al., 1995). Since then, a
wealth of information exists in the literature on the molecular mechanisms by
which REST functions as a transcriptional repressor in the retina (Lunyak and
Rosenfeld, 2005). For example, REST behaves as a repressor by binding to a
conserved 21-bp motif known as repressor element 1 (RE-1) found in the
transcriptional
regulatory
domains
of
many
well
characterized
neural
differentiation genes (Mortazavi et al., 2006; Otto et al., 2007). Furthermore,
REST activates repression of gene expression by histone deacetylase
recruitment and through the corepressors mSin3 and CoREST (Lunyak and
Rosenfeld, 2005). Notably, REST binding sites were located on many RGCspecific genes (Mao et al.) and was shown to suppress RGC-specific gene
expression in RPCs in multiple experiments (Mao et al.). Interestingly,
inactivating REST in Math5-null retinas restores the expression of RGC-specific
transcription factor expression and partially activates downstream RGC genes
which establishes the presence of Math5-independent RGC differentiation
transcription factor pathways (Mao et al.). In addition to its ability to directly
repress neuronal gene enhancers (Lunyak 2002), REST/NRSF also appears to
inhibit precocious expression of neuronal proteins in RPCs through its capacity to
suppress the expression of Sox4/11 in chick spinal cord precursors (Bergsland et
al., 2006). Therefore, we hypothesized that REST may also repress the proneural effects of SoxC proteins on RGC fate specification. To address this
hypothesis, we conducted gain of function experiments and found that
160
overexpression of REST in wild type RPCs decreased RGC differentiation while
overexpression in RPCs derived from retinal-specific Sox4 cKO mice
demonstrated no difference in RGC fate specification. Thus we demonstrated
that REST repression of RGC differentiation depends on its ability to repress a
Sox4-dependent pathway. Future experiments are required to uncover the
specific mechanism by which REST suppresses Sox4 function. For example,
does REST repress SoxC protein through canonical RE-1 site binding or by other
less described pathways? Perhaps, in vitro RPCs derived from stem cell cultures
have high REST expression inhibiting in vitro neural differentiation. A clearer
understanding of how REST controls neural suppression and how to, perhaps,
release this inhibition may help with generating in vitro derived neurons with
greater efficiency from stem cell cultures.
TGFβ Superfamily Members Regulate Sox Genes and RGC Fate
Accumulating evidence has demonstrated that extrinsic signals, such as
TGFβ ligands, play important roles in regulating neural progenitor proliferation
and subsequent differentiation to specific neural cell fates in concert with
transcriptionally regulated cell-autonomous mechanisms (Rodriguez-Martinez et
al., 2012). However, the role and function of many of these exogenous signals to
regulate RGC differentiation are not well understood. In the mouse retina,
inactivation of the gene GDF-11, which encodes a member of the TGFβ protein
family, results in increased RGC production whereas inactivating the follistatin
gene, its antagonist, reduces RGCs (Kim et al., 2005). Conversely, treating
retinal explants with GDF-11 in culture results in decreased RGC genesis (Kim et
161
al., 2005). Therefore, follistatin appears to increase the number of RPCs
competent for RGC generation whereas GDF-11 suppresses this activity to
regulate the production of the appropriate number of total RGCs. GDF-11 and
follistatin control retinal progenitor competence by shortening and elongating the
duration of Math5 expression, respectively (Kim et al., 2005). Therefore, we
asked if other TGFβ family members play a role in RGC differentiation. As Sox4
is positively regulated by multiple TGFβ ligands in cancer cell lines (Vervoort et
al., 2013a), we screened TGFβ superfamily members for effects on Sox4
expression and RGC fate specification. Differentiating RPCs in culture in the
presence of GDF-11 decreased the expression of Math5 and Sox4 and
decreased the number of differentiated RGCs, suggesting that the effect of GDF11 in vivo is attributable to direct effects on RPCs. Interestingly, we found that
RPCs exposed to the related protein GDF-15 had a near 10-fold increase in
Sox4 and increased the number of differentiated RGCs compared with control.
GDF-11 still suppressed RGC differentiation in Sox4 cKO RPCs, but GDF-15
was no longer able to increase RGC differentiation in the absence of Sox4.
Taken together, these data demonstrate that, while GDF-11 signaling may work
through a Sox4-independent pathway to suppress RGC differentiation, this novel
role for GDF-15 in increasing RGC differentiation works through Sox4-dependent
signaling. GDF-15 is expressed in the developing retina) but it is not yet known
whether it is required for RGC fate specification in vivo. Furthermore, the effects
of GDF-15 on Sox11 expression remains for future study. Gene knockdown and
knockout studies in mice will elucidate these and other important questions such
162
as how RPCs discriminate between the pro-RGC GDF-15 and anti-RGC GDF-11
signals will also be an important direction for future study. I hypothesize that
there are discrete receptors for each of the two GDF molecules and that each of
these receptors have their own discrete signaling pathways whereby GDF-11
couples with Math5 and GDF-15 with Sox4. Taken together, my findings have a
number of important implications as they define a dependence on Sox4 for the
novel GDF-15 activation for RGC fate specification and utilizing these soluble
signals to generate RGCs may be a simpler, safer and cost effective method
compared with gene overexpression.
The Role of Cell Fate and Differentiation in Regulating Cell Transplantation
and Integration
Stem cell-based therapies provide new hope for treating glaucoma and
other optic neuropathies. Transplanting stem cells or stem cell-derived neurons
into the retina could provide neuro-protective support to surviving neurons or
potentially replace neurons that have previously been lost to restore visual
function. However, a number of key challenges must be solved before these
treatments reach patients. First, we must identify the appropriate donor cell
source, as well as how best to differentiate and deliver these cells to maximize
integration, neuroprotection, and functional recovery in the injured retina. To
tackle these important pre-clinical questions, I uncovered new signals in
pathways sufficient and required for RGC differentiation in mouse. My work also
focused on RGC differentiation derived from two different adult human stem cells
163
to elucidate whether these cells are a valuable renewable source for generating
‘replacement’ RGCs.
Human Ciliary Margin Stem Cells
While
uncovering
signals
sufficient
to
induce
or
potentiate
the
differentiation of RGCs in mouse RPCs, I became interested in identifying human
donor cell type suitable to translate these RPC-RGC findings to human RGCs.
Thus, we began to investigate tissue derived from biopsies of the human eye
may be a valuable source for adult stem cells to generate donor cells for
autologous cell-based therapies. Pigmented cells from the ciliary margin zone of
the adult human retina proliferate in culture to form spheres and display
fundamental neural stem cell properties including self-renewal and the ability to
give rise to neurons and glia. However, little is known about what initiates and
regulates these adult stem cell properties in vitro; properties which are either
non-existent following development or actively suppressed. Because these cells
have been shown to be a rare subpopulation of cells found in the ciliary margin, it
is important to elucidate if biopsy-sized samples of ciliary margin from human eye
samples can provide a useful source for cell-based therapies. In my thesis and
discussed in detail in chapter 5, I found that stem cell cultures derived from small
biopsies of CM from the enucleated eyes of human survive and proliferate into
pigmented spheres and could self-renew for multiple passages. Under specific
conditions, these cells can differentiate and express markers specific for multiple
retinal cell types including RGCs and photoreceptors. Future experiment may
include the overexpression SoxC genes along with Math5 to measure the
164
competence of ciliary margin stem cells for RGC differentiation. Another
interesting question is whether REST repression plays a role in the limited
intrinsic neural differentiation competence of ciliary margin stem cells? Future
experiments with REST suppression may help direct these stem cells towards
the RGC more efficiently that previously explored. Furthermore, it will be critical
to address whether the neurons derived in culture can carry out normal
electrophysiological function and/or reintegrate following transplantation. All of
these important questions remain for future investigation.
Induced Pluripotent Stem Cells
I also began exploring other adult stem cells sources for their RGCpotency following SoxC overexpression. For example, patient-specific induced
pluripotent stem cells (iPSCs) through reprogramming adult somatic cells back to
an embryonic stem cell-like state, is another stem cell source currently being
heavily explored for their therapeutic potential (Borooah et al., 2013; Comyn et
al., 2010; Meyer et al., 2011; Meyer et al., 2009). Mouse iPSCs were first
generated and described in 2006 (Takahashi and Yamanaka, 2006) by
expressing specific ‘stem cell’ factors in fibroblast cells. In differentiation
paradigms similar to ESCs, iPSCs demonstrated the capacity to differentiation into
RPCs and all seven retinal cell types including RGCs, albeit with low efficiency
(Comyn et al., 2010). However, before these cells or their in vitro derived progeny
are used for therapeutics, important safety concerns associated with these highly
proliferative cells must be addressed. For example, if oncogenic viruses are used
to reprogram cells towards iPSCs, then proper techniques must ensure that
165
these oncogenes are silenced following induction.
Recently, iPS cells were
successfully generated without genes overexpression but rather with repeated
treatments of specific proteins (Kim et al., 2009). Generating RGCs from patients
with inherited forms of glaucoma may help build a model for the genetic basis of
glaucoma and other optic neuropathies. However currently, a critical limitation
for RGC cell therapies and research are the low overall proportion of cell that turn
into RGCs or even ‘RGC-like’ cells (Jagatha et al., 2009; Parameswaran et al.,
2010). As discussed in detail in Chapter 2 of my thesis, manipulation of the SoxC
transcriptional network by overexpression greatly increased the efficiency of
human iPSC-derived RGC generation compared with other published model
system. Further manipulations combining other newly identified signaling
partners also uncovered in my thesis such as REST and GDF-15 may be
exploited to generate RGC donor cells with even more efficiency. Future
investigations will uncover whether human iPSC-derived RGCs can be purified
with high specificity using immunopanning techniques used for rodent RGCs
(Barres et al., 1988). Increased RGC differentiation efficiency with simpler and
less expensive techniques will usher in a paradigm shift in the proportion of
human cell culture-based research in turn obviating many mouse models further
demonstrating its ethical advantage.
Retinal Ganglion Cell Transplantation
Upon searching for methods to increase the efficiency of the generation of
in vitro-derived RGCs, I began to ask questions about the potential for RGCs to
integrate into a host retina following transplantation. This work was greatly
166
motivated
by
experiments
demonstrating
successful
photoreceptor
transplantation, which propelled my mission to uncover the equivalent
therapeutic potential for RGCs. However, compared to photoreceptors, fewer
advances have been made in integrating donor cells for RGC replacement
(Johnson and Martin, 2013; MacLaren et al., 2006). Transplantation of retinal
progenitors from various donor ages does not appear to produce newly born and
integrated RGCs in vivo. Unlike photoreceptors, RGCs extend axons a great
distance away from their soma to multiple specific targets in the brain and create
complex
dendritic
connections
with
their
synaptic
partners
in
the
retina. Additionally, in order to be clinically applicable, enhancing graft integration
by altering the host retina must be accomplished without disturbing regular retinal
function. To add to the complexity, there are many different types of RGCs, each
with highly specialized properties which coordinate complex visual functions and
likely require synaptic plasticity for wiring during a developmental time window.
Therefore, in the short term, protection of endogenous tissue from continued
degeneration, as has been achieved with stem cell transplantation in
experimental glaucoma (Johnson and Martin, 2013), might be a more realistic
potential therapeutic currently. As discussed in detail in Chapter 3 of my thesis, I
have made advances in enhancing RGC delivery into the retina following
intravitreal cell transplantation. These enhancements led to RGCs that can
survive, migrate into the ganglion cell layer, send dendrites deeper into the inner
plexiform layer (IPL), and extend axons in both normal and injured retina (Hertz
et al., 2013). Can integration efficiency be increased with the overexpression of
167
SoxC genes? I hypothesize that SoxC overexpressed RGCs may have increased
integration due to the up-regulation of SoxC-dependent developmental genes
which may provide neuroprotective signals to support the survival of donor cells
as they integrate into their local environment. SoxC overexpressed cells may
even provide great trophic support for neighboring spared endogenous RGCs
with greater effectiveness than RGCs alone. The RGC transplantation paradigms
developed in chapter 3 will also be useful for addressing questions about the
neural and therapeutic properties of human stem cell-derived neurons.
Connecting other findings from chapter 2 to increase the efficiency of RGC
generation such as GDF-15 and REST repression with my methodologies
developed for RGC integration in chapter 3 will be of great interest for future
studies to come. Finally, I hope that by incorporating these transplantation
techniques in combination with known effective axon regeneration signals (Moore
et al., 2011) we can synergize the two to enhance cell-based therapies to
regenerate long distances in the optic nerve and to the brain.
Tunable Hydrogel Scaffolds for Studying Neural Integration and Retinal
Repair
Although we observed that in vitro-derived RGCs can remain viable and
integrate into the retina following transplantation, I also became interested in
looking at new ways to deliver these cell into the eye. Our advances in our ability
to engineer specific cell-types have opened the possibility to generate artificial
tissues and organs that can be used in transplantation to restore the functions of
tissues or organs lost as a consequence of damage, aging or disease. One of
168
the most critical tissues for the development of bioengineered transplantable
replacement is the retina where loss of function contributes to irreversible
disabling blindness, such as in glaucoma and other optic neuropathies. While,
two-dimensional (2-D) culture systems (i.e. petri dish) have been sufficient to
elucidate many signals regulating survival and neurite outgrowth of neurons,
three-dimensional (3-D) culture systems allow for the creation of cellular
environments more physiologically relevant to a cell normal environment (Kador
and Goldberg, 2012; Lutolf and Hubbell, 2005). As, the retina consists of
complex groups of individual cells organized into discrete lamina that receive
electrical, chemical and physical signals from their local environment, standard in
vitro cell culture methods on 2-D substrates poorly represent in vivo neural
structure. Retinal cells alone are not capable of recreating complex tissues on
their own although stem and progenitor cells may form 3D tissues only under
very controlled and specific conditions (Eiraku et al., 2011). However, on a 3-D
scaffold, cells may mimic features of complex tissues not otherwise observed in
2-D cultures. Hydrogels are excellent candidates for 3-D scaffolds for ex vivo
culture of mammalian cells because they demonstrate mechanical properties that
parallel the properties of soft tissues (Tibbitt and Anseth, 2009). By uncovering
the unique properties of specific hydrogels that supported RGC and amacrine
cell survival, we have made progress in our ability to construct 3-D layered
synthetic neural tissue for either studying the interactions of neurons in 3-D
neural or for ‘pre-wiring’ retinal tissue for retinal repair.
169
With advances in neural and stem cell culture techniques, there is
increased feasibility to grow retinal cells in 3-D culture systems to study more
accurate representations of the in vivo environment than 2-D cultures.
Furthermore, each specific type of neuron depends on discrete compositions and
physical properties of their discrete environment, such as sublamina. Tunable
scaffolds solves address these solutions by allowing myriads of configurations.
The physical properties that collaborated with a lab that developed a library of
hydrogels composed of poly (ethylene glycol) and poly (L-lysine) which display a
wide range of mechanical properties. As part of my thesis and discussed in detail
in chapter 4 of my thesis, I identified specific hydrogel scaffolds from this library
that readily support the survival, migration and neurite outgrowth of purified
RGCs and amacrine cells. These experiments made progress in beginning to
look at the interactions of neurons in discrete layers as found in the retina.
Furthermore, the survival and neurite outgrowth data demonstrating a preference
for specific types of scaffolds provides insight to some of the physical and
chemical properties effects of local environment.
We also gained insight for
further tuning our engineered retinal tissue for cell replacement therapies in
disease such as glaucoma (Kador et al., 2013). Combining the single layers of
cells/scaffolds into stacked multilayers remains a challenge for future study,
however once achieved, will enable us new ways to how two different layers of
specific cells types integer with one another to pattern and generate synaptic
networks. Finally, these finding can be further optimized for in vivo study and
170
combined with methods developed from my transplantation research to enhance
RGC therapeutic transplantation.
Conclusion
Taken together the combined areas of my thesis highlights the complexity
associated with neural development as well as the requirements for bringing cellbased therapy to the clinic. By uncovering a novel SoxC-dependent gene
regulatory network operating in the developing retina, we have opened new
directions to achieve greater understanding and control of RGC differentiation.
Furthermore, controlling SoxC proteins or their upstream regulators may be an
important approach for generating RGCs from human stem cell populations for
future cell-based therapeutics. Combining these novel SoxC findings with these
advances in adult stem cell derived-RGCs will remain important questions for
future study. Furthermore, improved delivery methods of cells or ‘pre-wired’
synthetically-derived neural tissue from hydrogel scaffolds may improve the
effectiveness of neural transplantation for retinal repair. By mimicking the
properties found in specific lamina of the retina to generate 3-D neural tissue
platforms, we will better understand how neuronal networks integrate and
improve the effectiveness of neural transplantation for future therapies to come
(Kador et al., 2013). Since glaucoma is a complex set of diseases with multiple
pathways and mechanisms contributing to optic nerve injury, effective therapies
may need to target multiple pathways simultaneously. Therefore, cell
transplantation either to replace or to spare degenerating neurons offers a
171
feasible and effective strategy around these complications by either replacing the
lost neurons or the deficient signal.
Thus stem cell biology has unleashed a series of new therapeutic avenues
to combat the irreversible loss of RGCs associated with glaucoma and other
optic neuropathies. Furthermore, these finding in the retina will help address
significant questions about how cell-based therapies could be used to combat
neurodegeneration in other regions of the CNS. For treatments to reach patients
many obstacles must be overcome, including controlled differentiation,
successful integration, efficacy, as well as addressing safety, but with continued
dedication from scientists and clinicians this can be achieved.
WORKS CITED
Agathocleous, M., and Harris, W.A. (2009). From progenitors to differentiated
cells in the vertebrate retina. Annual review of cell and developmental biology 25,
45-69.
Ahmad, I., Del Debbio, C.B., Das, A.V., and Parameswaran, S. Muller glia: a
promising target for therapeutic regeneration. Invest Ophthalmol Vis Sci 52,
5758-5764.
Akerud, P., Canals, J.M., Snyder, E.Y., and Arenas, E. (2001). Neuroprotection
through delivery of glial cell line-derived neurotrophic factor by neural stem cells
in a mouse model of Parkinson's disease. J Neurosci 21, 8108-8118.
Al-Shamekh, S., and Goldberg, J. (2013). Retinal repair with induced pluripotent
stem cells. Transl Res.
Alexiades, M.R., and Cepko, C. (1996). Quantitative analysis of proliferation and
cell cycle length during development of the rat retina. Dev Dyn 205, 293-307.
Alexiades, M.R., and Cepko, C.L. (1997). Subsets of retinal progenitors display
temporally regulated and distinct biases in the fates of their progeny.
Development 124, 1119-1131.
Alvarez-Buylla, A., and Lois, C. (1995). Neuronal stem cells in the brain of adult
vertebrates. Stem cells 13, 263-272.
Ankeny, D.P., McTigue, D.M., and Jakeman, L.B. (2004). Bone marrow
transplants provide tissue protection and directional guidance for axons after
contusive spinal cord injury in rats. Exp Neurol 190, 17-31.
Antin, J.H., Bierer, B.E., Smith, B.R., Ferrara, J., Guinan, E.C., Sieff, C., Golan,
D.E., Macklis, R.M., Tarbell, N.J., Lynch, E., et al. (1991). Selective depletion of
bone marrow T lymphocytes with anti-CD5 monoclonal antibodies: effective
prophylaxis for graft-versus-host disease in patients with hematologic
malignancies. Blood 78, 2139-2149.
Aoki, H., Hara, A., Niwa, M., Yamada, Y., and Kunisada, T. (2009). In vitro and in
vivo differentiation of human embryonic stem cells into retina-like organs and
comparison with that from mouse pluripotent epiblast stem cells. Dev Dyn 238,
2266-2279.
Austin, C.P., Feldman, D.E., Ida, J.A., Jr., and Cepko, C.L. (1995). Vertebrate
retinal ganglion cells are selected from competent progenitors by the action of
Notch. Development 121, 3637-3650.
172
173
Badea, T.C., Cahill, H., Ecker, J., Hattar, S., and Nathans, J. (2009). Distinct
roles of transcription factors brn3a and brn3b in controlling the development,
morphology, and function of retinal ganglion cells. Neuron 61, 852-864.
Badea, T.C., and Nathans, J. Morphologies of mouse retinal ganglion cells
expressing transcription factors Brn3a, Brn3b, and Brn3c: analysis of wild type
and mutant cells using genetically-directed sparse labeling. Vision Res 51, 269279.
Ballios, B.G., and van der Kooy, D. (2010). Biology and therapeutic potential of
adult retinal stem cells. Can J Ophthalmol 45, 342-351.
Bankfalvi, A., Giuffre, G., Ofner, D., Diallo, R., Poremba, C., Buchwalow, I.B.,
Barresi, V., Bocker, W., and Tuccari, G. (2003). Relationship between HER2
status and proliferation rate in breast cancer assessed by immunohistochemistry,
fluorescence in situ hybridisation and standardised AgNOR analysis. Int J Oncol
23, 1285-1292.
Barker, A.J., Koch, S.M., Reed, J., Barres, B.A., and Ullian, E.M. (2008).
Developmental control of synaptic receptivity. J Neurosci 28, 8150-8160.
Baron, M. (2003). An overview of the Notch signalling pathway. Semin Cell Dev
Biol 14, 113-119.
Barres, B.A., Silverstein, B.E., Corey, D.P., and Chun, L.L. (1988).
Immunological, morphological, and electrophysiological variation among retinal
ganglion cells purified by panning. Neuron 1, 791-803.
Bergsland, M., Werme, M., Malewicz, M., Perlmann, T., and Muhr, J. (2006). The
establishment of neuronal properties is controlled by Sox4 and Sox11. Genes
Dev 20, 3475-3486.
Berkelaar, M., Clarke, D.B., Wang, Y.C., Bray, G.M., and Aguayo, A.J. (1994).
Axotomy results in delayed death and apoptosis of retinal ganglion cells in adult
rats. J Neurosci 14, 4368-4374.
Berson, D.M., Dunn, F.A., and Takao, M. (2002). Phototransduction by retinal
ganglion cells that set the circadian clock. Science 295, 1070-1073.
Bhatia, B., Jayaram, H., Singhal, S., Jones, M.F., and Limb, G.A. Differences
between the neurogenic and proliferative abilities of Muller glia with stem cell
characteristics and the ciliary epithelium from the adult human eye. Exp Eye Res
93, 852-861.
Bhattaram, P., Penzo-Mendez, A., Sock, E., Colmenares, C., Kaneko, K.J.,
Vassilev, A., Depamphilis, M.L., Wegner, M., and Lefebvre, V. (2010).
174
Organogenesis relies on SoxC transcription factors for the survival of neural and
mesenchymal progenitors. Nat Commun 1, 9.
Borooah, S., Phillips, M.J., Bilican, B., Wright, A.F., Wilmut, I., Chandran, S.,
Gamm, D., and Dhillon, B. (2013). Using human induced pluripotent stem cells to
treat retinal disease. Progress in retinal and eye research 37, 163-181.
Bowles, J., Schepers, G., and Koopman, P. (2000). Phylogeny of the SOX family
of developmental transcription factors based on sequence and structural
indicators. Dev Biol 227, 239-255.
Brand, A.H., and Livesey, F.J. Neural stem cell biology in vertebrates and
invertebrates: more alike than different? Neuron 70, 719-729.
Brand, A.H., and Livesey, F.J. (2011). Neural stem cell biology in vertebrates and
invertebrates: more alike than different? Neuron 70, 719-729.
Bringmann, A., Pannicke, T., Grosche, J., Francke, M., Wiedemann, P.,
Skatchkov, S.N., Osborne, N.N., and Reichenbach, A. (2006). Muller cells in the
healthy and diseased retina. Prog Retin Eye Res 25, 397-424.
Brown, N.L., Kanekar, S., Vetter, M.L., Tucker, P.K., Gemza, D.L., and Glaser, T.
(1998). Math5 encodes a murine basic helix-loop-helix transcription factor
expressed during early stages of retinal neurogenesis. Development 125, 48214833.
Brown, N.L., Patel, S., Brzezinski, J., and Glaser, T. (2001). Math5 is required for
retinal ganglion cell and optic nerve formation. Development 128, 2497-2508.
Bruce, A.W., Donaldson, I.J., Wood, I.C., Yerbury, S.A., Sadowski, M.I.,
Chapman, M., Gottgens, B., and Buckley, N.J. (2004). Genome-wide analysis of
repressor element 1 silencing transcription factor/neuron-restrictive silencing
factor (REST/NRSF) target genes. Proc Natl Acad Sci U S A 101, 10458-10463.
Brzezinski, J.A.t., Prasov, L., and Glaser, T. (2012). Math5 defines the ganglion
cell competence state in a subpopulation of retinal progenitor cells exiting the cell
cycle. Dev Biol 365, 395-413.
Calford, M.B., Chino, Y.M., Das, A., Eysel, U.T., Gilbert, C.D., Heinen, S.J.,
Kaas, J.H., and Ullman, S. (2005). Neuroscience: rewiring the adult brain. Nature
438, E3; discussion E3-4.
Castillo, S.D., Matheu, A., Mariani, N., Carretero, J., Lopez-Rios, F., LovellBadge, R., and Sanchez-Cespedes, M. (2012). Novel transcriptional targets of
the SRY-HMG box transcription factor SOX4 link its expression to the
development of small cell lung cancer. Cancer research 72, 176-186.
175
Cayouette, M., Barres, B.A., and Raff, M. (2003). Importance of intrinsic
mechanisms in cell fate decisions in the developing rat retina. Neuron 40, 897904.
Cayouette, M., and Raff, M. (2003). The orientation of cell division influences
cell-fate choice in the developing mammalian retina. Development 130, 23292339.
Chacko, D.M., Rogers, J.A., Turner, J.E., and Ahmad, I. (2000). Survival and
differentiation of cultured retinal progenitors transplanted in the subretinal space
of the rat. Biochemical and biophysical research communications 268, 842-846.
Chen, M., Chen, Q., Sun, X., Shen, W., Liu, B., Zhong, X., Leng, Y., Li, C.,
Zhang, W., Chai, F., et al. (2010). Generation of retinal ganglion-like cells from
reprogrammed mouse fibroblasts. Invest Ophthalmol Vis Sci 51, 5970-5978.
Chen, Y., Stevens, B., Chang, J., Milbrandt, J., Barres, B.A., and Hell, J.W.
(2008). NS21: re-defined and modified supplement B27 for neuronal cultures. J
Neurosci Methods 171, 239-247.
Chong, J.A., Tapia-Ramirez, J., Kim, S., Toledo-Aral, J.J., Zheng, Y., Boutros,
M.C., Altshuller, Y.M., Frohman, M.A., Kraner, S.D., and Mandel, G. (1995).
REST: a mammalian silencer protein that restricts sodium channel gene
expression to neurons. Cell 80, 949-957.
Chow, R.L., Altmann, C.R., Lang, R.A., and Hemmati-Brivanlou, A. (1999). Pax6
induces ectopic eyes in a vertebrate. Development 126, 4213-4222.
Christopherson, K.S., Ullian, E.M., Stokes, C.C., Mullowney, C.E., Hell, J.W.,
Agah, A., Lawler, J., Mosher, D.F., Bornstein, P., and Barres, B.A. (2005).
Thrombospondins are astrocyte-secreted proteins that promote CNS
synaptogenesis. Cell 120, 421-433.
Cicero, S.A., Johnson, D., Reyntjens, S., Frase, S., Connell, S., Chow, L.M.,
Baker, S.J., Sorrentino, B.P., and Dyer, M.A. (2009). Cells previously identified
as retinal stem cells are pigmented ciliary epithelial cells. Proc Natl Acad Sci U S
A 106, 6685-6690.
Coles, B.L., Angenieux, B., Inoue, T., Del Rio-Tsonis, K., Spence, J.R., McInnes,
R.R., Arsenijevic, Y., and van der Kooy, D. (2004). Facile isolation and the
characterization of human retinal stem cells. Proc Natl Acad Sci U S A 101,
15772-15777.
Comyn, O., Lee, E., and MacLaren, R.E. (2010). Induced pluripotent stem cell
therapies for retinal disease. Current opinion in neurology 23, 4-9.
176
Dahmane, N., and Ruiz i Altaba, A. (1999). Sonic hedgehog regulates the growth
and patterning of the cerebellum. Development 126, 3089-3100.
Das, A.V., James, J., Rahnenfuhrer, J., Thoreson, W.B., Bhattacharya, S., Zhao,
X., and Ahmad, I. (2005). Retinal properties and potential of the adult mammalian
ciliary epithelium stem cells. Vision Res 45, 1653-1666.
de Lima, S., Koriyama, Y., Kurimoto, T., Oliveira, J.T., Yin, Y., Li, Y., Gilbert,
H.Y., Fagiolini, M., Martinez, A.M., and Benowitz, L. (2012). Full-length axon
regeneration in the adult mouse optic nerve and partial recovery of simple visual
behaviors. Proceedings of the National Academy of Sciences of the United
States of America 109, 9149-9154.
Del Debbio, C.B., Peng, X., Xiong, H., and Ahmad, I. (2013). Adult ciliary
epithelial stem cells generate functional neurons and differentiate into both early
and late born retinal neurons under non-cell autonomous influences. BMC
Neurosci 14, 130.
Doherty, P., Cohen, J., and Walsh, F.S. (1990). Neurite outgrowth in response to
transfected N-CAM changes during development and is modulated by polysialic
acid. Neuron 5, 209-219.
Dorsky, R.I., Rapaport, D.H., and Harris, W.A. (1995). Xotch inhibits cell
differentiation in the Xenopus retina. Neuron 14, 487-496.
Dy, P., Penzo-Mendez, A., Wang, H., Pedraza, C.E., Macklin, W.B., and
Lefebvre, V. (2008). The three SoxC proteins--Sox4, Sox11 and Sox12--exhibit
overlapping expression patterns and molecular properties. Nucleic acids
research 36, 3101-3117.
Easter, S.S., Jr., and Malicki, J.J. (2002). The zebrafish eye: developmental and
genetic analysis. Results Probl Cell Differ 40, 346-370.
Edlund, T., and Jessell, T.M. (1999). Progression from extrinsic to intrinsic
signaling in cell fate specification: a view from the nervous system. Cell 96, 211224.
Eiraku, M., Takata, N., Ishibashi, H., Kawada, M., Sakakura, E., Okuda, S.,
Sekiguchi, K., Adachi, T., and Sasai, Y. (2011). Self-organizing optic-cup
morphogenesis in three-dimensional culture. Nature 472, 51-56.
Ek, S., Dictor, M., Jerkeman, M., Jirstrom, K., and Borrebaeck, C.A. (2008).
Nuclear expression of the non B-cell lineage Sox11 transcription factor identifies
mantle cell lymphoma. Blood 111, 800-805.
177
Ellezam, B., Selles-Navarro, I., Manitt, C., Kennedy, T.E., and McKerracher, L.
(2001). Expression of netrin-1 and its receptors DCC and UNC-5H2 after
axotomy and during regeneration of adult rat retinal ganglion cells. Exp Neurol
168, 105-115.
Emsley, J.G., Mitchell, B.D., Magavi, S.S., Arlotta, P., and Macklis, J.D. (2004).
The repair of complex neuronal circuitry by transplanted and endogenous
precursors. NeuroRx 1, 452-471.
Fang, Y., Cho, K.S., Tchedre, K., Lee, S.W., Guo, C., Kinouchi, H., Fried, S.,
Sun, X., and Chen, D.F. (2013). Ephrin-A3 suppresses Wnt signaling to control
retinal stem cell potency. Stem cells 31, 349-359.
Felling, R.J., and Levison, S.W. (2003). Enhanced neurogenesis following stroke.
J Neurosci Res 73, 277-283.
Fischer, A.J., Dierks, B.D., and Reh, T.A. (2002a). Exogenous growth factors
induce the production of ganglion cells at the retinal margin. Development 129,
2283-2291.
Fischer, A.J., Dierks, B.D., and Reh, T.A. (2002b). Exogenous growth factors
induce the production of ganglion cells at the retinal margin. Development 129,
2283-2291.
Fischer, A.J., and Reh, T.A. (2002). Exogenous growth factors stimulate the
regeneration of ganglion cells in the chicken retina. Dev Biol 251, 367-379.
Fischer, A.J., and Reh, T.A. (2003a). Potential of Muller glia to become
neurogenic retinal progenitor cells. Glia 43, 70-76.
Fischer, A.J., and Reh, T.A. (2003b). Potential of Muller glia to become
neurogenic retinal progenitor cells. Glia 43, 70-76.
Ford, M., Bertram, J., Hynes, S., Michaud, M., Li, Q., Young, M., Segal, S.,
Madri, J., and Lavik, E. (2006). A macroporous hydrogel for the coculture of
neural progenitor and endothelial cells to form functional vascular networks in
vivo. Proc Natl Acad Sci USA 103, 2512-2517.
Fricker-Gates, R.A., Shin, J.J., Tai, C.C., Catapano, L.A., and Macklis, J.D.
(2002). Late-stage immature neocortical neurons reconstruct interhemispheric
connections and form synaptic contacts with increased efficiency in adult mouse
cortex undergoing targeted neurodegeneration. J Neurosci 22, 4045-4056.
Friedl, P. (2004). Prespecification and plasticity: shifting mechanisms of cell
migration. Curr Opin Cell Biol 16, 14-23.
178
Furuta, Y., Lagutin, O., Hogan, B.L., and Oliver, G.C. (2000). Retina- and ventral
forebrain-specific Cre recombinase activity in transgenic mice. Genesis 26, 130132.
Gamm, D.M., Wang, S., Lu, B., Girman, S., Holmes, T., Bischoff, N., Shearer,
R.L., Sauve, Y., Capowski, E., Svendsen, C.N., et al. (2007). Protection of visual
functions by human neural progenitors in a rat model of retinal disease. PLoS
One 2, e338.
Gan, L., Wang, S.W., Huang, Z., and Klein, W.H. (1999a). POU domain factor
Brn-3b is essential for retinal ganglion cell differentiation and survival but not for
initial cell fate specification. Dev Biol 210, 469-480.
Gan, L., Wang, S.W., Huang, Z., and Klein, W.H. (1999b). POU domain factor
Brn-3b is essential for retinal ganglion cell differentiation and survival but not for
initial cell fate specification. Dev Biol 210, 469-480.
Gan, L., Xiang, M., Zhou, L., Wagner, D.S., Klein, W.H., and Nathans, J. (1996).
POU domain factor Brn-3b is required for the development of a large set of
retinal ganglion cells. Proc Natl Acad Sci U S A 93, 3920-3925.
Gill, G. (2005). SUMO changes Sox for developmental diversity. Mol Cell 20,
495-496.
Goldberg, J.L., Espinosa, J.S., Xu, Y., Davidson, N., Kovacs, G.T., and Barres,
B.A. (2002a). Retinal ganglion cells do not extend axons by default: promotion by
neurotrophic signaling and electrical activity. Neuron 33, 689-702.
Goldberg, J.L., Klassen, M.P., Hua, Y., and Barres, B.A. (2002b). Amacrinesignaled loss of intrinsic axon growth ability by retinal ganglion cells. Science
296, 1860-1864.
Gomes, F.L., Zhang, G., Carbonell, F., Correa, J.A., Harris, W.A., Simons, B.D.,
and Cayouette, M. Reconstruction of rat retinal progenitor cell lineages in vitro
reveals a surprising degree of stochasticity in cell fate decisions. Development
138, 227-235.
Griffith, L.G., and Swartz, M.A. (2006). Capturing complex 3D tissue physiology
in vitro. Nat Rev Mol Cell Biol 7, 211-224.
Guillemot, F., and Cepko, C.L. (1992). Retinal fate and ganglion cell
differentiation are potentiated by acidic FGF in an in vitro assay of early retinal
development. Development 114, 743-754.
179
Hasan, S.M., Vugler, A.A., Miljan, E.A., Sinden, J.D., Moss, S.E., and
Greenwood, J. (2010). Immortalized human fetal retinal cells retain progenitor
characteristics and represent a potential source for the treatment of retinal
degenerative disease. Cell transplantation 19, 1291-1306.
Hatakeyama, J., and Kageyama, R. (2004). Retinal cell fate determination and
bHLH factors. Semin Cell Dev Biol 15, 83-89.
Hattar, S., Liao, H.W., Takao, M., Berson, D.M., and Yau, K.W. (2002).
Melanopsin-containing retinal ganglion cells: architecture, projections, and
intrinsic photosensitivity. Science 295, 1065-1070.
Hendrickson, A.E. (1996). Synaptic development in macaque monkey retina and
its implications for other developmental sequences. Perspect Dev Neurobiol 3,
195-201.
Hernit-Grant, C.S., and Macklis, J.D. (1996). Embryonic neurons transplanted to
regions of targeted photolytic cell death in adult mouse somatosensory cortex reform specific callosal projections. Exp Neurol 139, 131-142.
Hertz, J., and Goldberg, J.L. (2012). Stem Cells In Glaucoma. In Stem Cell
Biology and Regenerative Medicine, S. Tsang, ed. (New York: Humana Press).
Hertz, J., Qu, B., Hu, Y., Patel, R.D., Valenzuela, D.A., and Goldberg, J.L.
(2013). Survival and Integration of Developing and Progenitor-Derived Retinal
Ganglion Cells Following Transplantation. Cell transplantation.
Hong, C.S., and Saint-Jeannet, J.P. (2005). Sox proteins and neural crest
development. Semin Cell Dev Biol 16, 694-703.
Hoser, M., Baader, S.L., Bosl, M.R., Ihmer, A., Wegner, M., and Sock, E. (2007).
Prolonged glial expression of Sox4 in the CNS leads to architectural cerebellar
defects and ataxia. J Neurosci 27, 5495-5505.
Hoser, M., Potzner, M.R., Koch, J.M., Bosl, M.R., Wegner, M., and Sock, E.
(2008). Sox12 deletion in the mouse reveals nonreciprocal redundancy with the
related Sox4 and Sox11 transcription factors. Molecular and cellular biology 28,
4675-4687.
Hu, Y., Cho, S., and Goldberg, J.L. (2010). Neurotrophic effect of a novel TrkB
agonist on retinal ganglion cells. Invest Ophthalmol Vis Sci 51, 1747-1754.
Hu, Y., Leaver, S.G., Plant, G.W., Hendriks, W.T., Niclou, S.P., Verhaagen, J.,
Harvey, A.R., and Cui, Q. (2005). Lentiviral-mediated transfer of CNTF to
schwann cells within reconstructed peripheral nerve grafts enhances adult retinal
ganglion cell survival and axonal regeneration. Mol Ther 11, 906-915.
180
Hufnagel, R.B., Riesenberg, A.N., Saul, S.M., and Brown, N.L. (2007).
Conserved regulation of Math5 and Math1 revealed by Math5-GFP transgenes.
Mol Cell Neurosci 36, 435-448.
Hynes, S.R., Rauch, M.F., Bertram, J.P., and Lavik, E.B. (2008). A library of
tunable poly(ethylene glycol)/poly(L-lysine) hydrogels to investigate the material
cues that influence neural stem cell differentiation. J Biomed Mater Res A.
Inoue, T., Hojo, M., Bessho, Y., Tano, Y., Lee, J.E., and Kageyama, R. (2002).
Math3 and NeuroD regulate amacrine cell fate specification in the retina.
Development 129, 831-842.
Inoue, T., Kagawa, T., Fukushima, M., Shimizu, T., Yoshinaga, Y., Takada, S.,
Tanihara, H., and Taga, T. (2006). Activation of canonical Wnt pathway promotes
proliferation of retinal stem cells derived from adult mouse ciliary margin. Stem
cells 24, 95-104.
Jadhav, A.P., Cho, S.H., and Cepko, C.L. (2006). Notch activity permits retinal
cells to progress through multiple progenitor states and acquire a stem cell
property. Proc Natl Acad Sci U S A 103, 18998-19003.
Jadhav, A.P., Roesch, K., and Cepko, C.L. (2009). Development and neurogenic
potential of Muller glial cells in the vertebrate retina. Prog Retin Eye Res 28, 249262.
Jagatha, B., Divya, M.S., Sanalkumar, R., Indulekha, C.L., Vidyanand, S., Divya,
T.S., Das, A.V., and James, J. (2009). In vitro differentiation of retinal ganglionlike cells from embryonic stem cell derived neural progenitors. Biochem Biophys
Res Commun 380, 230-235.
James, J., Das, A.V., Bhattacharya, S., Chacko, D.M., Zhao, X., and Ahmad, I.
(2003). In vitro generation of early-born neurons from late retinal progenitors. J
Neurosci 23, 8193-8203.
Jiang, Y., Ding, Q., Xie, X., Libby, R., Lefebvre, V., and Gan, L. (2013).
Transcription factors SOX4 and SOX11 function redundantly to regulate the
development of mouse retinal ganglion cells. J Biol Chem.
Johnson, T.V., Bull, N.D., and Martin, K.R. Identification of barriers to retinal
engraftment of transplanted stem cells. Invest Ophthalmol Vis Sci 51, 960-970.
Johnson, T.V., and Martin, K.R. (2008). Development and characterization of an
adult retinal explant organotypic tissue culture system as an in vitro intraocular
stem cell transplantation model. Invest Ophthalmol Vis Sci 49, 3503-3512.
181
Johnson, T.V., and Martin, K.R. (2013). Cell transplantation approaches to retinal
ganglion cell neuroprotection in glaucoma. Current opinion in pharmacology 13,
78-82.
Jones, J.M., and Thomson, J.A. (2000). Human embryonic stem cell technology.
Semin Reprod Med 18, 219-223.
Kador, K., and Goldberg, J. (2012a). Scaffolds and Stem Cells: Delivery of Cell
Transplants for Retinal Degenerations. Expert Reviews of Ophthalmology
Kador, K.E., and Goldberg, J.L. (2012b). Scaffolds and stem cells: delivery of cell
transplants for retinal degenerations. Expert review of ophthalmology 7, 459-470.
Kador, K.E., Montero, R.B., Venugopalan, P., Hertz, J., Zindell, A.N., Valenzuela,
D.A., Uddin, M.S., Lavik, E.B., Muller, K.J., Andreopoulos, F.M., et al. (2013).
Tissue engineering the retinal ganglion cell nerve fiber layer. Biomaterials 34,
4242-4250.
Kamada, T., Koda, M., Dezawa, M., Yoshinaga, K., Hashimoto, M., Koshizuka,
S., Nishio, Y., Moriya, H., and Yamazaki, M. (2005). Transplantation of bone
marrow stromal cell-derived Schwann cells promotes axonal regeneration and
functional recovery after complete transection of adult rat spinal cord. J
Neuropathol Exp Neurol 64, 37-45.
Kanekar, S., Perron, M., Dorsky, R., Harris, W.A., Jan, L.Y., Jan, Y.N., and
Vetter, M.L. (1997). Xath5 participates in a network of bHLH genes in the
developing Xenopus retina. Neuron 19, 981-994.
Karl, M.O., and Reh, T.A. Regenerative medicine for retinal diseases: activating
endogenous repair mechanisms. Trends Mol Med 16, 193-202.
Karl, M.O., and Reh, T.A. (2010). Regenerative medicine for retinal diseases:
activating endogenous repair mechanisms. Trends Mol Med 16, 193-202.
Kay, J.N., Finger-Baier, K.C., Roeser, T., Staub, W., and Baier, H. (2001).
Retinal ganglion cell genesis requires lakritz, a Zebrafish atonal Homolog.
Neuron 30, 725-736.
Kessler, J.D., Kahle, K.T., Sun, T., Meerbrey, K.L., Schlabach, M.R., Schmitt,
E.M., Skinner, S.O., Xu, Q., Li, M.Z., Hartman, Z.C., et al. (2012). A
SUMOylation-dependent transcriptional subprogram is required for Myc-driven
tumorigenesis. Science 335, 348-353.
182
Kim, D., Kim, C.H., Moon, J.I., Chung, Y.G., Chang, M.Y., Han, B.S., Ko, S.,
Yang, E., Cha, K.Y., Lanza, R., et al. (2009). Generation of human induced
pluripotent stem cells by direct delivery of reprogramming proteins. Cell stem cell
4, 472-476.
Kim, J., Wu, H.H., Lander, A.D., Lyons, K.M., Matzuk, M.M., and Calof, A.L.
(2005). GDF11 controls the timing of progenitor cell competence in developing
retina. Science 308, 1927-1930.
Kirby, M.A., and Steineke, T.C. (1996). Morphogenesis of retinal ganglion cells: a
model of dendritic, mosaic, and foveal development. Perspect Dev Neurobiol 3,
177-194.
Kleinman, H.K., McGarvey, M.L., Hassell, J.R., Star, V.L., Cannon, F.B., Laurie,
G.W., and Martin, G.R. (1986). Basement membrane complexes with biological
activity. Biochemistry 25, 312-318.
Kleinman, H.K., McGarvey, M.L., Liotta, L.A., Robey, P.G., Tryggvason, K., and
Martin, G.R. (1982). Isolation and characterization of type IV procollagen,
laminin, and heparan sulfate proteoglycan from the EHS sarcoma. Biochemistry
21, 6188-6193.
Kolpak, A., Zhang, J., and Bao, Z.Z. (2005). Sonic hedgehog has a dual effect on
the growth of retinal ganglion axons depending on its concentration. J Neurosci
25, 3432-3441.
Kovalev, I.F., Muchnik, S.R., Chikalo, II, Linnik, L.A., and Plevinskis, V.P. (1970).
[Changes in sorption properties and catalase activity of eye tissues under the
effect of irradiation from an optic quantum generator]. Oftalmol Zh 25, 212-216.
Kuhlbrodt, K., Herbarth, B., Sock, E., Enderich, J., Hermans-Borgmeyer, I., and
Wegner, M. (1998). Cooperative function of POU proteins and SOX proteins in
glial cells. The Journal of biological chemistry 273, 16050-16057.
Kunzevitzky, N.J., Almeida, M.V., and Goldberg, J.L. (2010). Amacrine cell gene
expression and survival signaling: differences from neighboring retinal ganglion
cells. Invest Ophthalmol Vis Sci 51, 3800-3812.
Kuwahara, M., Yamashita, M., Shinoda, K., Tofukuji, S., Onodera, A.,
Shinnakasu, R., Motohashi, S., Hosokawa, H., Tumes, D., Iwamura, C., et al.
(2012). The transcription factor Sox4 is a downstream target of signaling by the
cytokine TGF-beta and suppresses T(H)2 differentiation. Nat Immunol 13, 778786.
183
Lai, K., Kaspar, B.K., Gage, F.H., and Schaffer, D.V. (2003). Sonic hedgehog
regulates adult neural progenitor proliferation in vitro and in vivo. Nat Neurosci 6,
21-27.
Lamba, D.A., Gust, J., and Reh, T.A. (2009). Transplantation of human
embryonic stem cell-derived photoreceptors restores some visual function in Crxdeficient mice. Cell stem cell 4, 73-79.
Lamba, D.A., McUsic, A., Hirata, R.K., Wang, P.R., Russell, D., and Reh, T.A.
(2010). Generation, purification and transplantation of photoreceptors derived
from human induced pluripotent stem cells. PloS one 5, e8763.
Le, T.T., Wroblewski, E., Patel, S., Riesenberg, A.N., and Brown, N.L. (2006).
Math5 is required for both early retinal neuron differentiation and cell cycle
progression. Dev Biol 295, 764-778.
Lee, H.J., Kim, K.S., Park, I.H., and Kim, S.U. (2007). Human neural stem cells
over-expressing VEGF provide neuroprotection, angiogenesis and functional
recovery in mouse stroke model. PLoS One 2, e156.
Li, N., Li, X.R., and Yuan, J.Q. (2009). Effects of bone-marrow mesenchymal
stem cells transplanted into vitreous cavity of rat injured by ischemia/reperfusion.
Graefes Arch Clin Exp Ophthalmol 247, 503-514.
Li, Y., Schlamp, C.L., Poulsen, G.L., Jackson, M.W., Griep, A.E., and Nickells,
R.W. (2002). p53 regulates apoptotic retinal ganglion cell death induced by Nmethyl-D-aspartate. Mol Vis 8, 341-350.
Lin, C.Q., and Bissell, M.J. (1993). Multi-faceted regulation of cell differentiation
by extracellular matrix. FASEB J 7, 737-743.
Liu, W., Mo, Z., and Xiang, M. (2001). The Ath5 proneural genes function
upstream of Brn3 POU domain transcription factor genes to promote retinal
ganglion cell development. Proc Natl Acad Sci U S A 98, 1649-1654.
Livesey, F.J., and Cepko, C.L. (2001). Vertebrate neural cell-fate determination:
lessons from the retina. Nat Rev Neurosci 2, 109-118.
Lu, B., Wang, S., Girman, S., McGill, T., Ragaglia, V., and Lund, R. Human adult
bone marrow-derived somatic cells rescue vision in a rodent model of retinal
degeneration. Exp Eye Res 91, 449-455.
Lund, R.D., Wang, S., Lu, B., Girman, S., Holmes, T., Sauve, Y., Messina, D.J.,
Harris, I.R., Kihm, A.J., Harmon, A.M., et al. (2007). Cells isolated from umbilical
cord tissue rescue photoreceptors and visual functions in a rodent model of
retinal disease. Stem Cells 25, 602-611.
184
Lunyak, V.V., and Rosenfeld, M.G. (2005). No rest for REST: REST/NRSF
regulation of neurogenesis. Cell 121, 499-501.
Lutolf, M., and Hubbell, J. (2005). Synthetic biomaterials as instructive
extracellular microenvironments for morphogenesis in tissue engineering. Nat
Biotechnol 23, 47-55.
Macklis, J.D. (1993). Transplanted neocortical neurons migrate selectively into
regions of neuronal degeneration produced by chromophore-targeted laser
photolysis. J Neurosci 13, 3848-3863.
MacLaren, R.E., Pearson, R.A., MacNeil, A., Douglas, R.H., Salt, T.E., Akimoto,
M., Swaroop, A., Sowden, J.C., and Ali, R.R. (2006). Retinal repair by
transplantation of photoreceptor precursors. Nature 444, 203-207.
Madhavan, L., Ourednik, V., and Ourednik, J. (2008). Neural stem/progenitor
cells initiate the formation of cellular networks that provide neuroprotection by
growth factor-modulated antioxidant expression. Stem Cells 26, 254-265.
Madison, R.D., and Macklis, J.D. (1993). Noninvasively induced degeneration of
neocortical pyramidal neurons in vivo: selective targeting by laser activation of
retrogradely transported photolytic chromophore. Exp Neurol 121, 153-159.
Mahairaki, V., Lim, S.H., Christopherson, G.T., Xu, L., Nasonkin, I., Yu, C., Mao,
H.Q., and Koliatsos, V.E. Nanofiber matrices promote the neuronal differentiation
of human embryonic stem cell-derived neural precursors in vitro. Tissue Eng Part
A 17, 855-863.
Mao, C.A., Tsai, W.W., Cho, J.H., Pan, P., Barton, M.C., and Klein, W.H.
Neuronal transcriptional repressor REST suppresses an Atoh7-independent
program for initiating retinal ganglion cell development. Dev Biol 349, 90-99.
Mao, C.A., Tsai, W.W., Cho, J.H., Pan, P., Barton, M.C., and Klein, W.H. (2011).
Neuronal transcriptional repressor REST suppresses an Atoh7-independent
program for initiating retinal ganglion cell development. Dev Biol 349, 90-99.
Maragakis, N.J., Rao, M.S., Llado, J., Wong, V., Xue, H., Pardo, A., Herring, J.,
Kerr, D., Coccia, C., and Rothstein, J.D. (2005). Glial restricted precursors
protect against chronic glutamate neurotoxicity of motor neurons in vitro. Glia 50,
145-159.
Marquardt, T., Ashery-Padan, R., Andrejewski, N., Scardigli, R., Guillemot, F.,
and Gruss, P. (2001). Pax6 is required for the multipotent state of retinal
progenitor cells. Cell 105, 43-55.
185
Marshall, V.S., Waknitz, M.A., and Thomson, J.A. (2001). Isolation and
maintenance of primate embryonic stem cells. Methods Mol Biol 158, 11-18.
Masai, I. (2000). [Mechanisms underlying induction and progression of a
neurogenic wave in the zebrafish developing retina]. Tanpakushitsu Kakusan
Koso 45, 2782-2790.
McCabe, K.L., Gunther, E.C., and Reh, T.A. (1999). The development of the
pattern of retinal ganglion cells in the chick retina: mechanisms that control
differentiation. Development 126, 5713-5724.
McFarlane, S., Zuber, M.E., and Holt, C.E. (1998). A role for the fibroblast growth
factor receptor in cell fate decisions in the developing vertebrate retina.
Development 125, 3967-3975.
Meyer-Franke, A., Kaplan, M.R., Pfrieger, F.W., and Barres, B.A. (1995).
Characterization of the signaling interactions that promote the survival and
growth of developing retinal ganglion cells in culture. Neuron 15, 805-819.
Meyer, J.S., Howden, S.E., Wallace, K.A., Verhoeven, A.D., Wright, L.S.,
Capowski, E.E., Pinilla, I., Martin, J.M., Tian, S., Stewart, R., et al. (2011). Optic
vesicle-like structures derived from human pluripotent stem cells facilitate a
customized approach to retinal disease treatment. Stem cells 29, 1206-1218.
Meyer, J.S., Shearer, R.L., Capowski, E.E., Wright, L.S., Wallace, K.A.,
McMillan, E.L., Zhang, S.C., and Gamm, D.M. (2009). Modeling early retinal
development with human embryonic and induced pluripotent stem cells. Proc
Natl Acad Sci U S A 106, 16698-16703.
Monnier, P.P., Sierra, A., Schwab, J.M., Henke-Fahle, S., and Mueller, B.K.
(2003). The Rho/ROCK pathway mediates neurite growth-inhibitory activity
associated with the chondroitin sulfate proteoglycans of the CNS glial scar. Mol
Cell Neurosci 22, 319-330.
Moore, D.L., Apara, A., and Goldberg, J.L. (2009). Kruppel-like transcription
factors in the nervous system: novel players in neurite outgrowth and axon
regeneration. Mol Cell Neurosci 47, 233-243.
Moore, D.L., Apara, A., and Goldberg, J.L. (2011). Kruppel-like transcription
factors in the nervous system: novel players in neurite outgrowth and axon
regeneration. Mol Cell Neurosci 47, 233-243.
Morin, X., Jaouen, F., and Durbec, P. (2007). Control of planar divisions by the
G-protein regulator LGN maintains progenitors in the chick neuroepithelium. Nat
Neurosci 10, 1440-1448.
186
Mortazavi, A., Leeper Thompson, E.C., Garcia, S.T., Myers, R.M., and Wold, B.
(2006). Comparative genomics modeling of the NRSF/REST repressor network:
from single conserved sites to genome-wide repertoire. Genome research 16,
1208-1221.
Moshiri, A., and Reh, T.A. (2004). Persistent progenitors at the retinal margin of
ptc+/- mice. J Neurosci 24, 229-237.
Mu, L., Berti, L., Masserdotti, G., Covic, M., Michaelidis, T.M., Doberauer, K.,
Merz, K., Rehfeld, F., Haslinger, A., Wegner, M., et al. (2012). SoxC transcription
factors are required for neuronal differentiation in adult hippocampal
neurogenesis. J Neurosci 32, 3067-3080.
Mu, X., Fu, X., Beremand, P.D., Thomas, T.L., and Klein, W.H. (2008). Gene
regulation logic in retinal ganglion cell development: Isl1 defines a critical branch
distinct from but overlapping with Pou4f2. Proc Natl Acad Sci U S A 105, 69426947.
Mu, X., Fu, X., Sun, H., Beremand, P.D., Thomas, T.L., and Klein, W.H. (2005).
A gene network downstream of transcription factor Math5 regulates retinal
progenitor cell competence and ganglion cell fate. Dev Biol 280, 467-481.
Much, J.W., Liu, C., and Piltz-Seymour, J.R. (2008). Long-term survival of central
visual field in end-stage glaucoma. Ophthalmology 115, 1162-1166.
Mudhar, H.S., Pollock, R.A., Wang, C., Stiles, C.D., and Richardson, W.D.
(1993). PDGF and its receptors in the developing rodent retina and optic nerve.
Development 118, 539-552.
Nakamae, T., Tanaka, N., Nakanishi, K., Kamei, N., Sasaki, H., Hamasaki, T.,
Yamada, K., Yamamoto, R., Mochizuki, Y., and Ochi, M. (2009). Chondroitinase
ABC promotes corticospinal axon growth in organotypic cocultures. Spinal Cord
47, 161-165.
Nelson, C., and Bissell, M. (2006). Of extracellular matrix, scaffolds, and
signaling: tissue architecture regulates development, homeostasis, and cancer.
Annu Rev Cell Dev Biol 22, 287-309.
Neuhuber, B., Timothy Himes, B., Shumsky, J.S., Gallo, G., and Fischer, I.
(2005). Axon growth and recovery of function supported by human bone marrow
stromal cells in the injured spinal cord exhibit donor variations. Brain Res 1035,
73-85.
Neumann, C.J., and Nuesslein-Volhard, C. (2000). Patterning of the zebrafish
retina by a wave of sonic hedgehog activity. Science 289, 2137-2139.
187
Nomura, T., Honmou, O., Harada, K., Houkin, K., Hamada, H., and Kocsis, J.D.
(2005). I.V. infusion of brain-derived neurotrophic factor gene-modified human
mesenchymal stem cells protects against injury in a cerebral ischemia model in
adult rat. Neuroscience 136, 161-169.
Okano, H., and Temple, S. (2009). Cell types to order: temporal specification of
CNS stem cells. Curr Opin Neurobiol 19, 112-119.
Osakada, F., Hirami, Y., and Takahashi, M. Stem cell biology and cell
transplantation therapy in the retina. Biotechnol Genet Eng Rev 26, 297-334.
Osakada, F., Ikeda, H., Sasai, Y., and Takahashi, M. (2009). Stepwise
differentiation of pluripotent stem cells into retinal cells. Nat Protoc 4, 811-824.
Otto, S.J., McCorkle, S.R., Hover, J., Conaco, C., Han, J.J., Impey, S., Yochum,
G.S., Dunn, J.J., Goodman, R.H., and Mandel, G. (2007). A new binding motif for
the transcriptional repressor REST uncovers large gene networks devoted to
neuronal functions. J Neurosci 27, 6729-6739.
Pan, L., Yang, Z., Feng, L., and Gan, L. (2005). Functional equivalence of Brn3
POU-domain transcription factors in mouse retinal neurogenesis. Development
132, 703-712.
Pan, X., Zhao, J., Zhang, W.N., Li, H.Y., Mu, R., Zhou, T., Zhang, H.Y., Gong,
W.L., Yu, M., Man, J.H., et al. (2009). Induction of SOX4 by DNA damage is
critical for p53 stabilization and function. Proc Natl Acad Sci U S A 106, 37883793.
Parameswaran, S., Balasubramanian, S., Babai, N., Qiu, F., Eudy, J.D.,
Thoreson, W.B., and Ahmad, I. (2010). Induced pluripotent stem cells generate
both retinal ganglion cells and photoreceptors: therapeutic implications in
degenerative changes in glaucoma and age-related macular degeneration. Stem
Cells 28, 695-703.
Penzo-Mendez, A., Dy, P., Pallavi, B., and Lefebvre, V. (2007). Generation of
mice harboring a Sox4 conditional null allele. Genesis 45, 776-780.
Penzo-Mendez, A.I. (2010). Critical roles for SoxC transcription factors in
development and cancer. The international journal of biochemistry & cell biology
42, 425-428.
Perron, M., and Harris, W.A. (2000). Retinal stem cells in vertebrates. Bioessays
22, 685-688.
Pfrieger, F.W., and Barres, B.A. (1997). Synaptic efficacy enhanced by glial cells
in vitro. Science 277, 1684-1687.
188
Pluchino, S., Zanotti, L., Rossi, B., Brambilla, E., Ottoboni, L., Salani, G.,
Martinello, M., Cattalini, A., Bergami, A., Furlan, R., et al. (2005). Neurospherederived multipotent precursors promote neuroprotection by an
immunomodulatory mechanism. Nature 436, 266-271.
Potzner, M.R., Tsarovina, K., Binder, E., Penzo-Mendez, A., Lefebvre, V.,
Rohrer, H., Wegner, M., and Sock, E. (2010). Sequential requirement of Sox4
and Sox11 during development of the sympathetic nervous system. Development
137, 775-784.
Prasov, L., and Glaser, T. (2012). Pushing the envelope of retinal ganglion cell
genesis: context dependent function of Math5 (Atoh7). Dev Biol 368, 214-230.
Prasov, L., Nagy, M., Rudolph, D.D., and Glaser, T. (2012). Math5 (Atoh7) gene
dosage limits retinal ganglion cell genesis. Neuroreport 23, 631-634.
Price, J., Turner, D., and Cepko, C. (1987). Lineage analysis in the vertebrate
nervous system by retrovirus-mediated gene transfer. Proc Natl Acad Sci U S A
84, 156-160.
Provencio, I., Rodriguez, I.R., Jiang, G., Hayes, W.P., Moreira, E.F., and Rollag,
M.D. (2000). A novel human opsin in the inner retina. J Neurosci 20, 600-605.
Provencio, I., Rollag, M.D., and Castrucci, A.M. (2002). Photoreceptive net in the
mammalian retina. This mesh of cells may explain how some blind mice can still
tell day from night. Nature 415, 493.
Qiu, F., Jiang, H., and Xiang, M. (2008). A comprehensive negative regulatory
program controlled by Brn3b to ensure ganglion cell specification from
multipotential retinal precursors. J Neurosci 28, 3392-3403.
Quigley, H.A. (2005). Glaucoma: macrocosm to microcosm the Friedenwald
lecture. Invest Ophthalmol Vis Sci 46, 2662-2670.
Quigley, H.A., and Broman, A.T. (2006). The number of people with glaucoma
worldwide in 2010 and 2020. Br J Ophthalmol 90, 262-267.
Quina, L.A., Pak, W., Lanier, J., Banwait, P., Gratwick, K., Liu, Y., Velasquez, T.,
O'Leary, D.D., Goulding, M., and Turner, E.E. (2005). Brn3a-expressing retinal
ganglion cells project specifically to thalamocortical and collicular visual
pathways. J Neurosci 25, 11595-11604.
Rainaldi, G., Calcabrini, A., and Santini, M.T. (1998). Positively charged polymer
polylysine-induced cell adhesion molecule redistribution in K562 cells. Journal of
materials science Materials in medicine 9, 755-760.
189
Rapaport, D.H., Wong, L.L., Wood, E.D., Yasumura, D., and LaVail, M.M. (2004).
Timing and topography of cell genesis in the rat retina. J Comp Neurol 474, 304324.
Reese, B.E., and Colello, R.J. (1992). Neurogenesis in the retinal ganglion cell
layer of the rat. Neuroscience 46, 419-429.
Reh, T.A., and Fischer, A.J. (2001). Stem cells in the vertebrate retina. Brain
Behav Evol 58, 296-305.
Reh, T.A., and Levine, E.M. (1998). Multipotential stem cells and progenitors in
the vertebrate retina. J Neurobiol 36, 206-220.
Reynolds, B.A., and Weiss, S. (1992). Generation of neurons and astrocytes
from isolated cells of the adult mammalian central nervous system. Science 255,
1707-1710.
Riesenberg, A.N., Le, T.T., Willardsen, M.I., Blackburn, D.C., Vetter, M.L., and
Brown, N.L. (2009). Pax6 regulation of Math5 during mouse retinal neurogenesis.
Genesis 47, 175-187.
Rodriguez-Martinez, G., Molina-Hernandez, A., and Velasco, I. (2012). Activin A
promotes neuronal differentiation of cerebrocortical neural progenitor cells. PloS
one 7, e43797.
Roger, J.E., Nellissery, J., Kim, D.S., and Swaroop, A. (2010). Sumoylation of
bZIP transcription factor NRL modulates target gene expression during
photoreceptor differentiation. J Biol Chem 285, 25637-25644.
Sam, T.N., Xiao, J., Roehrich, H., Low, W.C., and Gregerson, D.S. (2006).
Engrafted neural progenitor cells express a tissue-restricted reporter gene
associated with differentiated retinal photoreceptor cells. Cell transplantation 15,
147-160.
Sanchez-Camacho, C., and Bovolenta, P. (2008). Autonomous and nonautonomous Shh signalling mediate the in vivo growth and guidance of mouse
retinal ganglion cell axons. Development 135, 3531-3541.
Savare, J., and Girard, F. (2005). [SUMO modification represses transcriptional
activity of Sox proteins]. Med Sci (Paris) 21, 917-919.
Schoenherr, C.J., and Anderson, D.J. (1995). The neuron-restrictive silencer
factor (NRSF): a coordinate repressor of multiple neuron-specific genes. Science
267, 1360-1363.
190
Schwartz, S.D., Hubschman, J.P., Heilwell, G., Franco-Cardenas, V., Pan, C.K.,
Ostrick, R.M., Mickunas, E., Gay, R., Klimanskaya, I., and Lanza, R. (2012).
Embryonic stem cell trials for macular degeneration: a preliminary report. Lancet
379, 713-720.
Selkoe, D., and Kopan, R. (2003). Notch and Presenilin: regulated
intramembrane proteolysis links development and degeneration. Annu Rev
Neurosci 26, 565-597.
Sernagor, E., Eglen, S.J., and Wong, R.O. (2001). Development of retinal
ganglion cell structure and function. Prog Retin Eye Res 20, 139-174.
Sernagor, E., and Mehta, V. (2001). The role of early neural activity in the
maturation of turtle retinal function. J Anat 199, 375-383.
Sheen, V.L., Dreyer, E.B., and Macklis, J.D. (1992). Calcium-mediated neuronal
degeneration following singlet oxygen production. Neuroreport 3, 705-708.
Sheen, V.L., and Macklis, J.D. (1994). Apoptotic mechanisms in targeted
neuronal cell death by chromophore-activated photolysis. Exp Neurol 130, 67-81.
Sheen, V.L., and Macklis, J.D. (1995). Targeted neocortical cell death in adult
mice guides migration and differentiation of transplanted embryonic neurons. J
Neurosci 15, 8378-8392.
Shen, S., Wiemelt, A.P., McMorris, F.A., and Barres, B.A. (1999). Retinal
ganglion cells lose trophic responsiveness after axotomy. Neuron 23, 285-295.
Shields, M.B. (2008). Normal-tension glaucoma: is it different from primary openangle glaucoma? Curr Opin Ophthalmol 19, 85-88.
Shin, J.J., Fricker-Gates, R.A., Perez, F.A., Leavitt, B.R., Zurakowski, D., and
Macklis, J.D. (2000). Transplanted neuroblasts differentiate appropriately into
projection neurons with correct neurotransmitter and receptor phenotype in
neocortex undergoing targeted projection neuron degeneration. J Neurosci 20,
7404-7416.
Shinzato, C., Iguchi, A., Hayward, D.C., Technau, U., Ball, E.E., and Miller, D.J.
(2008). Sox genes in the coral Acropora millepora: divergent expression patterns
reflect differences in developmental mechanisms within the Anthozoa. BMC Evol
Biol 8, 311.
Shkumatava, A., Fischer, S., Muller, F., Strahle, U., and Neumann, C.J. (2004).
Sonic hedgehog, secreted by amacrine cells, acts as a short-range signal to
direct differentiation and lamination in the zebrafish retina. Development 131,
3849-3858.
191
Shukla, D., Kolluru, C.M., Singh, J., John, R.K., Soman, M., Gandhi, B., Kim, R.,
and Perumalsamy, N. (2004). Macular ischaemia as a marker for nephropathy in
diabetic retinopathy. Indian J Ophthalmol 52, 205-210.
Snyder, E.Y., Yoon, C., Flax, J.D., and Macklis, J.D. (1997). Multipotent neural
precursors can differentiate toward replacement of neurons undergoing targeted
apoptotic degeneration in adult mouse neocortex. Proc Natl Acad Sci U S A 94,
11663-11668.
Sohur, U.S., Emsley, J.G., Mitchell, B.D., and Macklis, J.D. (2006). Adult
neurogenesis and cellular brain repair with neural progenitors, precursors and
stem cells. Philos Trans R Soc Lond B Biol Sci 361, 1477-1497.
Spence, J.R., Madhavan, M., Ewing, J.D., Jones, D.K., Lehman, B.M., and Del
Rio-Tsonis, K. (2004). The hedgehog pathway is a modulator of retina
regeneration. Development 131, 4607-4621.
Stenkamp, D.L., and Frey, R.A. (2003). Extraretinal and retinal hedgehog
signaling sequentially regulate retinal differentiation in zebrafish. Dev Biol 258,
349-363.
Sun, X., Chen, M., Li, J., Zhuang, J., Gao, Q., Zhong, X., Huang, B., Zhang, W.,
Huang, L., and Ge, J. E13.5 retinal progenitors induce mouse bone marrow
mesenchymal stromal cells to differentiate into retinal progenitor-like cells.
Cytotherapy 13, 294-303.
Suzuki, T., Akimoto, M., Imai, H., Ueda, Y., Mandai, M., Yoshimura, N., Swaroop,
A., and Takahashi, M. (2007). Chondroitinase ABC treatment enhances
synaptogenesis between transplant and host neurons in model of retinal
degeneration. Cell transplantation 16, 493-503.
Tai, Y.T., and Svendsen, C.N. (2004). Stem cells as a potential treatment of
neurological disorders. Curr Opin Pharmacol 4, 98-104.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and
Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human
fibroblasts by defined factors. Cell 131, 861-872.
Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from
mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663676.
Takahashi, M., Palmer, T.D., Takahashi, J., and Gage, F.H. (1998). Widespread
integration and survival of adult-derived neural progenitor cells in the developing
optic retina. Mol Cell Neurosci 12, 340-348.
192
Thein, D.C., Thalhammer, J.M., Hartwig, A.C., Crenshaw, E.B., 3rd, Lefebvre, V.,
Wegner, M., and Sock, E. (2010). The closely related transcription factors Sox4
and Sox11 function as survival factors during spinal cord development. J
Neurochem 115, 131-141.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J.,
Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from
human blastocysts. Science 282, 1145-1147.
Thomson, J.A., Kalishman, J., Golos, T.G., Durning, M., Harris, C.P., Becker,
R.A., and Hearn, J.P. (1995). Isolation of a primate embryonic stem cell line.
Proc Natl Acad Sci U S A 92, 7844-7848.
Tibbitt, M.W., and Anseth, K.S. (2009). Hydrogels as extracellular matrix mimics
for 3D cell culture. Biotechnol Bioeng 103, 655-663.
To, K., Ducharme, J., Figueroa, F.X., Mudgil, A., Thomas, D., and Tsiaras, W.G.
(1995). Ophthalmic complications of systemic disease. R I Med 78, 346-351.
Tomita, K., Nakanishi, S., Guillemot, F., and Kageyama, R. (1996). Mash1
promotes neuronal differentiation in the retina. Genes Cells 1, 765-774.
Tropepe, V., Coles, B.L., Chiasson, B.J., Horsford, D.J., Elia, A.J., McInnes,
R.R., and van der Kooy, D. (2000). Retinal stem cells in the adult mammalian
eye. Science 287, 2032-2036.
Turner, D.L., and Cepko, C.L. (1987). A common progenitor for neurons and glia
persists in rat retina late in development. Nature 328, 131-136.
Turner, D.L., Snyder, E.Y., and Cepko, C.L. (1990). Lineage-independent
determination of cell type in the embryonic mouse retina. Neuron 4, 833-845.
Usui, A., Iwagawa, T., Mochizuki, Y., Iida, A., Wegner, M., Murakami, A., and
Watanabe, S. (2013a). Expression of Sox4 and Sox11 is regulated by multiple
mechanisms during retinal development. FEBS Lett 587, 358-363.
Usui, A., Mochizuki, Y., Iida, A., Miyauchi, E., Satoh, S., Sock, E., Nakauchi, H.,
Aburatani, H., Murakami, A., Wegner, M., et al. (2013b). The early retinal
progenitor-expressed gene Sox11 regulates the timing of the differentiation of
retinal cells. Development 140, 740-750.
Valamanesh, F., Torriglia, A., Savoldelli, M., Gandolphe, C., Jeanny, J.C.,
BenEzra, D., and Behar-Cohen, F. (2007). Glucocorticoids induce retinal toxicity
through mechanisms mainly associated with paraptosis. Mol Vis 13, 1746-1757.
193
Van Hoffelen, S.J., Young, M.J., Shatos, M.A., and Sakaguchi, D.S. (2003).
Incorporation of murine brain progenitor cells into the developing mammalian
retina. Invest Ophthalmol Vis Sci 44, 426-434.
Venstrom, K.A., and Reichardt, L.F. (1993). Extracellular matrix. 2: Role of
extracellular matrix molecules and their receptors in the nervous system. FASEB
J 7, 996-1003.
Vervoort, S.J., Lourenco, A.R., van Boxtel, R., and Coffer, P.J. (2013a). SOX4
mediates TGF-beta-induced expression of mesenchymal markers during
mammary cell epithelial to mesenchymal transition. PloS one 8, e53238.
Vervoort, S.J., van Boxtel, R., and Coffer, P.J. (2013b). The role of SRY-related
HMG box transcription factor 4 (SOX4) in tumorigenesis and metastasis: friend or
foe? Oncogene 32, 3397-3409.
Viapiano, M.S., and Matthews, R.T. (2006). From barriers to bridges: chondroitin
sulfate proteoglycans in neuropathology. Trends Mol Med 12, 488-496.
Wagner, N., Wagner, K.D., Schley, G., Coupland, S.E., Heimann, H., Grantyn,
R., and Scholz, H. (2002). The Wilms' tumor suppressor Wt1 is associated with
the differentiation of retinoblastoma cells. Cell Growth Differ 13, 297-305.
Wallace, V.A., and Raff, M.C. (1999). A role for Sonic hedgehog in axon-toastrocyte signalling in the rodent optic nerve. Development 126, 2901-2909.
Wang, J., Ye, R., Wei, Y., Wang, H., Xu, X., Zhang, F., Qu, J., Zuo, B., and
Zhang, H. The effects of electrospun TSF nanofiber diameter and alignment on
neuronal differentiation of human embryonic stem cells. J Biomed Mater Res A
100, 632-645.
Wang, J.C., and Harris, W.A. (2005). The role of combinational coding by
homeodomain and bHLH transcription factors in retinal cell fate specification.
Dev Biol 285, 101-115.
Wang, J.T., Kunzevitzky, N.J., Dugas, J.C., Cameron, M., Barres, B.A., and
Goldberg, J.L. (2007). Disease gene candidates revealed by expression profiling
of retinal ganglion cell development. J Neurosci 27, 8593-8603.
Wang, S., Girman, S., Lu, B., Bischoff, N., Holmes, T., Shearer, R., Wright, L.S.,
Svendsen, C.N., Gamm, D.M., and Lund, R.D. (2008). Long-term vision rescue
by human neural progenitors in a rat model of photoreceptor degeneration. Invest
Ophthalmol Vis Sci 49, 3201-3206.
194
Wang, S.W., Kim, B.S., Ding, K., Wang, H., Sun, D., Johnson, R.L., Klein, W.H.,
and Gan, L. (2001). Requirement for math5 in the development of retinal
ganglion cells. Genes Dev 15, 24-29.
Wang, Y.-X., Robertson, J.L., Spillman, W.B., and Claus, R.O. (2004). Effects of
the chemical structure and the surface properties of polymeric biomaterials on
their biocompatibility. Pharm Res 21, 1362-1373.
Wang, Y.P., Dakubo, G., Howley, P., Campsall, K.D., Mazarolle, C.J., Shiga,
S.A., Lewis, P.M., McMahon, A.P., and Wallace, V.A. (2002). Development of
normal retinal organization depends on Sonic hedgehog signaling from ganglion
cells. Nat Neurosci 5, 831-832.
Warfvinge, K., Kiilgaard, J.F., Klassen, H., Zamiri, P., Scherfig, E., Streilein, W.,
Prause, J.U., and Young, M.J. (2006). Retinal progenitor cell xenografts to the
pig retina: immunological reactions. Cell Transplant 15, 603-612.
Wasik, A.M., Lord, M., Wang, X., Zong, F., Andersson, P., Kimby, E.,
Christensson, B., Karimi, M., and Sander, B. (2013). SOXC transcription factors
in mantle cell lymphoma: the role of promoter methylation in SOX11 expression.
Scientific reports 3, 1400.
Wechsler-Reya, R.J., and Scott, M.P. (1999). Control of neuronal precursor
proliferation in the cerebellum by Sonic Hedgehog. Neuron 22, 103-114.
Weiss, S., Dunne, C., Hewson, J., Wohl, C., Wheatley, M., Peterson, A.C., and
Reynolds, B.A. (1996). Multipotent CNS stem cells are present in the adult
mammalian spinal cord and ventricular neuroaxis. J Neurosci 16, 7599-7609.
West, E.L., Pearson, R.A., MacLaren, R.E., Sowden, J.C., and Ali, R.R. (2009).
Cell transplantation strategies for retinal repair. Prog Brain Res 175, 3-21.
Wianny, F., Bourillot, P.Y., and Dehay, C. (2011). Embryonic stem cells in nonhuman primates: An overview of neural differentiation potential. Differentiation
81, 142-152.
Wolburg, H., Willbold, E., and Layer, P.G. (1991). Muller glia endfeet, a basal
lamina and the polarity of retinal layers form properly in vitro only in the presence
of marginal pigmented epithelium. Cell Tissue Res 264, 437-451.
Wu, M.M., Fan, D.G., Tadmori, I., Yang, H., Furman, M., Jiao, X.Y., Young, W.,
Sun, D., and You, S.W. (2010). Death of axotomized retinal ganglion cells
delayed after intraoptic nerve transplantation of olfactory ensheathing cells in
adult rats. Cell Transplant 19, 159-166.
195
Wurm, A., Sock, E., Fuchshofer, R., Wegner, M., and Tamm, E.R. (2008).
Anterior segment dysgenesis in the eyes of mice deficient for the high-mobilitygroup transcription factor Sox11. Exp Eye Res 86, 895-907.
Xiang, M. (1998). Requirement for Brn-3b in early differentiation of postmitotic
retinal ganglion cell precursors. Dev Biol 197, 155-169.
Xiang, M., Zhou, L., Macke, J.P., Yoshioka, T., Hendry, S.H., Eddy, R.L., Shows,
T.B., and Nathans, J. (1995). The Brn-3 family of POU-domain factors: primary
structure, binding specificity, and expression in subsets of retinal ganglion cells
and somatosensory neurons. J Neurosci 15, 4762-4785.
Yamaguchi, Y. (2000). Lecticans: organizers of the brain extracellular matrix. Cell
Mol Life Sci 57, 276-289.
Yan, R.T., Ma, W., Liang, L., and Wang, S.Z. (2005). bHLH genes and retinal cell
fate specification. Mol Neurobiol 32, 157-171.
Yan, R.T., and Wang, S.Z. (2004). Requirement of neuroD for photoreceptor
formation in the chick retina. Invest Ophthalmol Vis Sci 45, 48-58.
Yang, X.J. (2004). Roles of cell-extrinsic growth factors in vertebrate eye pattern
formation and retinogenesis. Semin Cell Dev Biol 15, 91-103.
Yang, Z., Ding, K., Pan, L., Deng, M., and Gan, L. (2003). Math5 determines the
competence state of retinal ganglion cell progenitors. Dev Biol 264, 240-254.
Young, M.J., Ray, J., Whiteley, S.J., Klassen, H., and Gage, F.H. (2000).
Neuronal differentiation and morphological integration of hippocampal progenitor
cells transplanted to the retina of immature and mature dystrophic rats. Mol Cell
Neurosci 16, 197-205.
Yu, S., Tanabe, T., Dezawa, M., Ishikawa, H., and Yoshimura, N. (2006). Effects
of bone marrow stromal cell injection in an experimental glaucoma model.
Biochem Biophys Res Commun 344, 1071-1079.
Zaverucha-do-Valle, C., Gubert, F., Bargas-Rega, M., Coronel, J.L., MesentierLouro, L.A., Mencalha, A., Abdelhay, E., Santiago, M.F., and Mendez-Otero, R.
(2011). Bone marrow mononuclear cells increase retinal ganglion cell survival
and axon regeneration in the adult rat. Cell transplantation 20, 391-406.
Zhang, J.C., Liang, Q., Lei, Y., Yao, M., Li, L.L., Gao, X.G., Feng, J.X., Zhang,
Y., Gao, H.W., Liu, D.X., et al. (2012). SOX4 Induces Epithelial-Mesenchymal
Transition and Contributes to Breast Cancer Progression. Cancer Res 72, 45974608.
196
Zhang, X.M., and Yang, X.J. (2001). Temporal and spatial effects of Sonic
hedgehog signaling in chick eye morphogenesis. Dev Biol 233, 271-290.
Zhang, Y., and Wang, W. Effects of bone marrow mesenchymal stem cell
transplantation on light-damaged retina. Invest Ophthalmol Vis Sci 51, 37423748.
Zhu, W., Mao, Y., and Zhou, L.F. (2005). Reduction of neural and vascular
damage by transplantation of VEGF-secreting neural stem cells after cerebral
ischemia. Acta Neurochir Suppl 95, 393-397.