Am J Physiol Gastrointest Liver Physiol 294: G1421–G1430, 2008.
First published April 10, 2008; doi:10.1152/ajpgi.00060.2008.
Specific overexpression of IL-7 in the intestinal mucosa: the role in intestinal
intraepithelial lymphocyte development
Hua Yang,1,2 Blair Madison,3 Deborah L. Gumucio,3 and Daniel H. Teitelbaum2
1
Department of General Surgery, Xinqiao Hospital, Chongqing, China; and Departments of 2Surgery
and 3Cell and Developmental Biology, the University of Michigan Medical School, Ann Arbor, Michigan
Submitted 4 February 2008; accepted in final form 10 April 2008
transgenic; interleukin-7; mouse; epithelial cells
IL-7 IS A MEMBER OF THE gamma chain-dependent (␥c) family of
cytokines, which share a common receptor ␥c component and
include IL-2, IL-7, IL-9, and IL-15. These cytokines strongly
influence T cell development and function (12, 38) and signal
T cell activation (35). In vivo only IL-7, and not other ␥c
family members (e.g., IL-4 or IL-15), has been found to be
essential for homeostatic proliferation of naive peripheral T
cells (34). IL-7 is produced by thymic and intestinal epithelial
cells (EC) (9, 37, 39), and in turn IL-7 receptors (IL-7R) have
been detected on the surface of thymocytes and intestinal
intraepithelial lymphocytes (IEL) (37, 50). Administration of
IL-7 has been demonstrated to enhance both peripheral T cells
and IEL numbers and function (9, 49). Kenai et al. (15) found
that anti-IL-7 antibody treatment disturbed the induction of
Addresses for reprint requests and other correspondence: D. H. Teitelbaum,
Section of Pediatric Surgery, Univ. of Michigan Hospitals, Mott F3970, Box
0245, Ann Arbor, MI 48109 (e-mail: dttlbm@umich.edu) or H. Yang, Dept. of
General Surgery, Xinqiao Hospital, Third Military Medical Univ., Chongqing
400037, China (e-mail: hwbyang@hotmail.com).
http://www.ajpgi.org
␣␤-T cell receptor (TCR)⫹ T cells after athymic nude mice
were implanted with fetal thymocytes. In the absence of IL-7,
homeostatic proliferation of naive T cells is almost completely
abolished, and the lifespan of naive T cells is greatly reduced
(34). In vitro, in the absence of any other stimulus, IL-7 has
been shown to induce proliferation of freshly isolated T cells in
a dose-dependent fashion (1, 41). It has been shown that
systemic overexpression of IL-7R in a transgenic mouse model
increased survival of AKR/J early thymocytes and can contribute to thymocyte proliferation (19). Recently, our laboratory
has shown that exogenous IL-7 administration significantly
affected IEL phenotype and led to an increase in IEL number,
as well as changes in IEL function. Cytokine expression
changed significantly in both ␣␤-TCR⫹ IEL and ␥␦-TCR⫹
IEL subtypes. Exogenous IL-7 administration resulted in a
significant expansion in the ␣␤-TCR⫹ IEL subpopulation
(49). These studies suggest that IL-7 plays a critical role in
regulating T cell homeostasis in peripheral lymphoid tissues.
IL-7 is produced by EC in the thymus and intestinal mucosa
(8, 9, 37, 39). Recent studies have demonstrated that close
interaction between mucosal lymphocytes and intestinal EC are
crucial in regulating immune response and EC growth in the
intestinal mucosa (37, 45, 49). Several studies have indicated
that EC may play an important role in mucosal immune
responses by helping to regulate IEL (11, 50). We have also
demonstrated that there is a close physical proximity of ECderived IL-7 and the IEL (49). IEL are a distinct population of
T lymphocytes that are located at the basolateral side of EC in
the epithelial layer of the intestine. It has been shown that
IL-7R are expressed on the surface of CD4⫺,CD8⫺,
CD4⫹,8⫺, and CD4⫺,8⫹ T cells, but not in CD4⫹,8⫹
double-positive T cells (32). More recently, a study from our
group has found that IL-7R were identified on both ␣␤-TCR⫹
IEL and ␥␦-TCR⫹ IEL subpopulations (50). IL-7 knockout
and IL-7 receptor knockout mice show distinct declines in
absolute numbers of thymocytes and IEL (24). In an IEL
culture model, IL-7 added to media significantly prevented the
spontaneous apoptosis of IEL by decreasing caspase activity
and preventing the decline in Bcl-2 expression (43).
Previous studies have examined IL-7 given either by systemic administration or systemic overexpression of IL-7 or
IL-7R (38, 49) (19). Such studies, however, may not permit
one to gain a complete understanding of the role that intestinal
EC-derived IL-7 has on the local IEL populations and how the
IEL might be modulated by local IL-7 production. To better
understand the role intestinal EC-derived IL-7 has in directing
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
0193-1857/08 $8.00 Copyright © 2008 the American Physiological Society
G1421
Downloaded from ajpgi.physiology.org on June 10, 2008
Yang H, Madison B, Gumucio DL, Teitelbaum DH. Specific
overexpression of IL-7 in the intestinal mucosa: the role in intestinal
intraepithelial lymphocyte development. Am J Physiol Gastrointest
Liver Physiol 294: G1421–G1430, 2008. First published April 10,
2008; doi:10.1152/ajpgi.00060.2008.—IL-7 plays a crucial role in
controlling T cell development and homeostasis. Since IL-7 may be
derived from extraintestinal sources, and exogenous IL-7 broadly
affects lymphoid populations, the actions of epithelial cell (EC)derived IL-7 are not fully understood. The effect of intestinal specific
expression of IL-7 on intestinal mucosal lymphocytes was investigated by using an IL-7 transgenic mouse model. We generated an
intestinal EC-specific overexpressing IL-7 transgenic mouse model
(IL-7vill) and compared their phenotype and function to wild-type
C57BL/6J mice. EC-derived IL-7 overexpression was found to be
exclusively in the small and large intestine. Numbers and subtypes of
mucosal lymphocytes, including intraepithelial lymphocytes (IEL)
and lamina propria lymphocytes (LPL), significantly changed in
IL-7vill mice. From a functional standpoint, IEL proliferation also
significantly increased in IL-7vill mice. IEL cytokine expression significantly changed in both T cell receptor (TCR)-␣␤⫹ and TCR-␥␦⫹
IEL subpopulations, including a significant increase in IFN-␥ and
TNF-␣ as well as an increase in keratinocyte growth factor expression. EC expression of CD103 (integrin ␣E␤7), the ligand of Ecadherin, markedly upregulated and may account for a mechanism of
the massive expansion of IEL in transgenic mice. Systemic lymphoid
populations did not change in transgenic mice. IL-7 overexpression by
intestinal EC significantly affected IEL phenotype and function. These
results offer insight into the role of IL-7 in IEL development and
suggest a critical role of EC-derived expression of IL-7 in the
phenotype and function of IEL.
G1422
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
IEL lineage and function, we established an intestinal ECspecific overexpressing IL-7 transgenic mouse model by using
a 12.4-kb region from the mouse villin gene to direct intestinal
overexpression of IL-7. We hypothesized that intestinal EC
specific IL-7 overexpression would significantly affect the
neighboring IEL phenotype and function.
METHODS
Creation of IL-7 Transgenic Mice
Sample Harvesting
All mice were euthanized at 8 wk of age, and serum and intestine,
spleen, kidney, and liver tissues were harvested.
IEL and LPL isolation from small intestine. Cells were isolated as
previously described (17). Briefly, the small bowel was placed in
tissue culture medium (RPMI 1640 with 10% FCS; Life Technologies, Gaithersburg, MD). Mesenteric fat and Peyer’s patches were
removed. The intestine was cut into 5-mm pieces, washed three times
in an IEL extraction buffer (l mM EDTA, l mM DTT in PBS), and
incubated in the same buffer with continuous brisk stirring at 37°C for
20 min. The supernatants containing released sloughed EC and IEL
were stored on ice. The remaining tissue pieces were incubated three
times for 45 min each with RPMI 1640 containing collagenase (40
U/ml), 5% FBS, glutamine, and an antibiotic mixture at 37°C (20).
Fig. 1. P12.4KVill vector was modified by ligation the IL-7 gene in a site
beyond the villi promoter region. The 2 sites (Kpn and XhoI) where the IL-7
sequence will be inserted are labeled into P12.4KVill vector. The two sites to
be cut by PmeI for release of the entire construct are also labeled. After
selection of an appropriately stable clone as determined by size and sequence,
the P12.4KVill ⫹ IL-7 construct will be released and injected into pronuclei of
fertilized ova to create this IL-7vill transgenic mouse.
Reverse Transcriptase-Polymerase Chain Reaction
Isolation of total RNA. A guanidinium isothiocyanate-chloroform
extraction method was used. Total RNA from isolated EC or IEL, or
subtype IEL, LPL, thymocytes, splenocytes, and a piece of liver or
kidney tissues were extracted by using Trizol reagent (Life Technologies) according to the manufacturer’s directions.
RT-PCR. Poly-A tailed mRNA was reversed transcribed into complementary DNA by adding total cellular RNA to the following
reaction mixture: PCR Nucleotide Mix (Invitrogen, Carlsbad, CA),
M-MLV Reverse Transcriptase (Invitrogen), oligo(dT)12–18 Primer
(Invitrogen), and RNAse Inhibitor (40 U/␮l, Roche Diagnostics,
Mannheim, Germany). DEPC-treated H2O was added to yield the
appropriate final concentration. For quantification of the IL-7 mRNA
(including transgenic IL-7 mRNA) expression study, IL-7 primers
were designed by using sequence from the encodable sequence of
mouse IL-7 cDNA: forward primer. TGCCCGAATAATGAACCAA,
reverse primer CAACCTCTCCAAGTTATGAACCA
GTAG. For transgenic IL-7 gene detection, the forward primer was
designed from exon-1, CAACTTCCTAAGATCTCCCAGGTG, and
the reverse primer was designed from IL-7 cDNA, GTTCCTGTCATTTTGTCCAATTC. Primers for other cytokines, keratinocyte
growth factor (KGF), and ligands were designed by use of proprietary
software (Lasergene 6; DNA Star, Madison, WI). Samples were
incubated at 40°C for 70 min, and the reaction was then stopped by
incubating at 95°C for 3 min. PCR reaction was run. Thermal cycler
settings were optimized to insure products were in the logarithmic
phase of production. The PCR products were run out on a 2% agarose
gel. Quantification of cDNA product was completed using a Kodak
1D image quantification software (Kodak, Rochester, NY), and target
PCR products were compared by normalizing each sample to the
production of ␤-actin.
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
Development of a p12.4KVill-IL-7 transgene. We utilized a previously characterized 12.4-kb murine villin promoter/enhancer fragment
to drive the expression of an IL-7 cDNA exclusively in the epithelium
of the large and small intestine (23). Since the 12.4-kb region contains
at least a portion of a locus control region, 70 – 80% of founder mice
were expected to express the transgene in the small and large intestine.
The full-length sequence of mouse IL-7 cDNA (generously donated
by Dr. Jay Bream, National Institute of Arthritis and Musculoskeletal
and Skin Diseases) was cloned behind the 12.4-kb villin promoter/
enhancer. The final clone used for transgenesis (P12.4KVILL-IL-7)
was confirmed by restriction digestion and sequence analysis (across
the complete IL-7 and into the villin sequences).
Generation of IL-7vill transgenic mice. The transgene, containing
villin regulatory sequences linked to IL-7, was prepared by digestion
of P12.4KVILL-IL-7 with PmeI (Fig. 1). After purification, transgene
DNA was injected into the pronuclei of fertilized ova (C57BL/6J ⫻
SJL/J) by the University of Michigan Transgenic Animal Core.
Founders were identified by PCR amplification of tail DNA with
primers specific for the transgene (forward primer ACAGGCACTAAGGGAGCCAATG; reverse primer TCCTGTCAT TTTGTC CAATTCA). Founders were then mated to C57BL/6J mice for the creation
of F1 hybrids. All mice were bred and housed under clean specific
pathogen-free conditions. Transgenic lines were maintained by crossing transgenic mice with C57BL/6J mice; transgenic animals were
identified by PCR analysis of their tail DNA.
Supernatants containing lamina propria lymphocytes (LPL) from each
incubation were pooled on ice.
Supernatants containing IEL and EC were then filtered through a
glass wool column, and IEL and EC were separated by using magnetic
beads conjugated with antibody to CD3 (BioMag SelectaPure antimouse CD3 antibody particles, Polyscience, Warrington, PA). Cells
bound to beads were considered purified IEL; the EC remained in the
supernatant. Flow cytometry confirmed purity of sorted cells, which
was greater than 99%.
Supernatant containing LPL (after collagenase incubation) were
filtered through a glass wool column. Suspensions were centrifuged,
the pellets were resuspended in 40% Percoll (Pharmacia, Piscataway,
NJ), and the cell suspensions were overlaid on 75% Percoll. After
centrifugation for 20 min at 600 g at 25°C, viable lymphocytes were
recovered from the 40%/75% interface and washed in RPMI 1640
with 5% FBS, glutamine, and the antibiotic mixture (20).
Purification of IEL subpopulations. Some IEL specimens were
further separated between ␣␤-TCR⫹ and ␥␦-TCR⫹ subpopulations
by using biomagnetic beads conjugated to monoclonal antibody as
previously described (48). The purity of samples was confirmed by
flow cytometry and compared with nonseparated IEL samples. Briefly, IEL
were stained either with anti-␣␤-TCR⫹ antibody conjugated with
fluorescein isothiocyanate (FITC) (PharMingen, San Diego, CA) or
with anti-␥␦-TCR⫹ antibody conjugated with FITC (PharMingen),
followed by incubation with magnetic beads conjugated with antibody
to FITC (Polyscience, Warrington, PA). Cells bound to beads were
considered purified ␣␤-TCR⫹IEL or ␥␦-TCR⫹ IEL and were processed for RNA isolation.
Isolation of lymphocytes from spleen and thymus. Thymocytes and
splenocytes were individually isolated by passage through a stainless
steel mesh grid in sterilized RPMI 1640. Red blood cells were lysed
with red blood cell lysis buffer for splenocytes, washed twice in 10%
FCS/RPMI 1640, and counted.
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
Immunoblot Analysis for EC-Derived IL-7 Expression
Briefly, isolated EC were homogenized on ice in lysis buffer (42).
Protein determination was performed by using a Micro BCA Protein
Assay Kit (Pierce, Rockford, IL). Approximately 40 ␮g of total
protein in loading buffer was loaded per lane in a SDS-polyacrylamide gel (13%) and separated by electrophoresis. Proteins were then
transferred to a polyvinylidene difluoride membrane (Bio-Rad Laboratories, Hercules, CA). The membrane was blocked with blocking
solution (Zymed Laboratories, South San Francisco, CA) and probed
with goat anti-mouse biotinylated-IL-7 antibody (R&D Systems,
Minneapolis, MN) (0.15 ␮g/ml in blocking solution) for 1 h. Bound
antibodies were exposed to a strepavidin-horseradish peroxidase conjugate (1:10,000, Zymed Laboratories), detected on X-ray film. Blots
were then stripped and reprobed with monoclonal mouse anti-␤-actin
antibody (1:8,000 in blocking solution; Sigma, St. Louis, MO) to
confirm equal loading of protein. The peroxidase-conjugated second
antibody was goat anti-mouse IgG (1.8,000 in blocking solution;
Invitrogen). Quantification of results was performed using Kodak 1D
image quantification software (Kodak). Thus results of immunoblots
are expressed as the relative expression of IL-7 to ␤-actin expression.
Recombinant mouse IL-7, anti-mouse IL-7 antibody, and biotinylated anti-IL-7 antibody were purchased from R&D Systems. Methods
utilized are similar to those previously described (7, 48). Briefly,
anti-IL-7 antibody was coated to the ELISA plate, and IL-7 levels
were measured by ELISA by use of matched-pair antibodies. Serum
IL-7 levels were determined graphically by using standard curves
generated with recombinant mouse IL-7.
Flow Cytometric Analysis
Lymphoid phenotype was studied by fluorescent-labeled antibody
staining detected with three-color flow cytometry. Monoclonal antibodies (BD PharMingen, San Diego, CA), consisting of anti-CD4,
CD8␣, CD8␤, ␣␤-TCR and ␥␦-TCR, CD44, as well as CD69 antibodies, were used to examine the IEL subsets. Acquisition and
analysis were performed on a FACSCalibur (Becton-Dickinson, San
Jose, CA) using CellQuest software (Becton-Dickinson). The IEL
population was gated on the basis of forward- and side-scatter characteristics. Quantification of each subpopulation was based on its
percentage of the gated IEL population.
In Vivo IEL Proliferation Study
BrdU administration. Mice were provided with water ad libitum
with 0.6 mg/ml 5-bromo-2-deoxyuridine (BrdU; Sigma) for 7 days as
described by Tough and Sprent (36). After this 7-day period of BrdU
labeling, mice were given unsupplemented water for an additional 14
days and then analyzed.
Intracellular BrdU staining analysis. Cell staining for BrdU utilized a BrdU Flow Kit (BD Pharmingen, CA), as directed by the
manufacturer. Briefly, isolated cells were suspended in FACS buffer
and cell surface was stained with appropriate phycoerytherin (PE)conjugated antibody at 4°C for 30 min. Cells were then washed twice
and resuspended, and Cytofix/Cytoperm (BrdU flow staining kit, BD
Pharmingen) was added for 20 min at 4°C. The cells were washed,
resuspended with Cytoperm plus buffer, and incubated for 10 min,
washed with Perm/Wash buffer, resuspended with Cytofix/Cytoperm,
incubated for 5 min, resuspended with diluted DNase buffer (provided
with kit), and incubated for 1 h. Cells were washed with Perm/Wash
buffer, and PE-conjugated antibody to BrdU was added at 4°C for 30
min. Cells were washed twice and resuspended in staining buffer prior
to flow cytometry. Acquisition and analysis were performed on a FACSCalibur (Becton-Dickinson) using CellQuest software (Becton-Dickinson). The IEL population (gated on the basis of forward- and
side-scatter characteristics) was quantified for each subpopulation on
the basis of its percentage of the gated IEL population.
Histological Analysis
Segments 0.5 cm long of jejunum and ileum were fixed in 10%
formaldehyde for histological sectioning. Tissues were then dehydrated with ethanol and embedded in paraffin. Sections were cut and
stained with hematoxylin-eosin. The villus height and width and crypt
depth were measured by use of a calibrated micrometer. Each measurement of the crypt and villus dimensions consists of the mean of
seven different fields.
Data Analysis
Data are expressed as means ⫾ SD. Cytokine expression and flow
cytometric results were analyzed by paired t-tests, with significance
being defined as P ⬍ 0.05.
RESULTS
Intestinal EC-Derived IL-7 Expression in Transgenic Mice
Villin is expressed in all EC of the small and large bowel and
along the entire crypt-villus axis, with an increasing gradient
from crypt to tip (25). It has been shown that the 12.4-kb
fragment of the mouse villin promoter is reliable and reproducible to drive reporter gene expression in the intestine in a
pattern that closely resembles that of the endogenous mouse
gene (23). This 12.4-kb regulatory promoter is largely specific
for the intestinal epithelium (23). RT-PCR showed EC-derived
IL-7 expression to be expanded exclusively in the intestine.
IL-7 mRNA expression was significantly higher in transgenic
mice than wild-type mice (Fig. 2, A and B), and no transgenic
expression of IL-7 mRNA was seen in thymus, kidney, spleen,
or liver tissues in transgenic IL-7vill mice (data not shown).
To clarify whether IL-7 overexpression in the intestinal EC
of transgenic mice led to local overproduction of IL-7 protein,
Western blot was used to detect EC-derived IL-7 expression in
the jejunum and ileum of IL-7vill transgenic mice. IL-7 expression was significantly higher in both jejunum and ileum compared with that of wild-type mice (Fig. 2, C and D). IL-7
expression increased nearly 3-fold in jejunum and 3.3-fold in
ileum compared with wild-type mice. Furthermore, this overexpression did not extend beyond the gastrointestinal tract;
serum IL-7 levels were undetectable in both IL-7vill mice and
wild-type mice by ELISA detection.
Effect of EC Specific Overexpression of IL-7 on the IEL
Numbers of IEL are increased in transgenic mice. Numbers
of IEL in IL-7vill mice were significantly (P ⬍ 0.05) expanded
compared with wild-type mice. The number of IEL in transgenic mice increased threefold compared with wild-type mice
(Fig. 3A).
IEL phenotype significantly changed in IL-7vill mice. To
better understand the changes occurring in the IEL in transgenic mice, phenotype analysis was performed with flow
cytometry. Several changes were identified in the surface
phenotype of IL-7vill mice compared with wild-type mice (Fig. 4).
Both CD4⫹,CD8⫺ and CD4⫹,CD8⫹ IEL subpopulations
were significantly higher in transgenic mice (Fig. 3B) (P ⬍
0.05). The CD4⫹,CD8⫺ IEL numbers increased 16.8-fold and
CD4⫹,CD8⫹ IEL numbers increased 8.1-fold in IL-7vill mice
compared with wild-type mice (Fig. 3B). The number of
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
IL-7 ELISA Detection
G1423
G1424
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
Fig. 2. Changes in epithelial cell (EC)-derived IL-7 expression in intestinal mucosal EC. A: RT-PCR detection of IL-7 mRNA expression. B: results of RT-PCR
are expressed as a ratio of IL-7 to ␤-actin mRNA expression. Expression of IL-7 mRNA was significantly increased in IL-7 transgenic mice (n ⫽ 6) compared
with wild-type mice (n ⫽ 6). *P ⬍ 0.05. C: composite Western blot of EC-derived IL-7 expression in an IL-7vill mouse and a wild-type mouse. J, jejunum; I,
ileum. D: EC-derived IL-7 expression was significantly higher in transgenic mice (n ⫽ 6) than wild-type mice (n ⫽ 6), P ⬍ 0.05. Results are the relative
expression of IL-7 protein normalized to the expression of ␤-actin multiplied by 100; n ⫽6 per group, *P ⬍ 0.05 total parenteral nutrition (TPN) group compared
with control group.
Fig. 3. Changes in the number of intraepithelial lymphocyte (IEL) in IL-7vill
mice. A: the number of IEL significantly increased in IL-7vill mice (n ⫽ 6)
compared with wild-type mice (n ⫽ 6) *P ⬍ 0.05. B: changes in the number
of IEL phenotype compared with wild-type mice (n ⫽ 6), *P ⬍ 0.05.
␣␤-TCR⫹ IEL compared with wild-type mice (2.7 ⫾ 0.6 ⫻
106). The percentage of the ␣␤-TCR⫹ IEL increased twofold
compared with wild-type mice, whereas it was interesting to
note that the percentage of ␥␦-TCR⫹ IEL population was
significantly lower in IL-7vill mice compared with wild-type
Fig. 4. Representative flow cytometry results of gated IEL populations. Cell
populations are expressed as the percentage of gated cells with different cell
phenotype markers. A: CD4 and CD8 markers. Increased the percentage of
CD4⫹CD8⫺ CD4⫹CD8⫹ IEL subpopulations were found in IL-7vill mice
compared with wild-type mice. B: CD8␣ and CD8␤ markers. IL-7vill mice
increased the percentage of CD8␣␤⫹ IEL population IEL. C: ␣␤-T cell
receptor (TCR) and ␥␦-TCR⫹ IEL markers, the percentage of ␣␤-TCR⫹ IEL
subpopulation significantly increase, and percentage of ␥␦-TCR⫹ IEL decreased in IL-7vill mice (n ⫽ 6) compared with wild-type mice (n ⫽ 6). P ⬍ 0.05.
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
CD8␣␤⫹ IEL (i.e., CD8␣␤ heterozygote portion of CD8⫹
cells) was also significantly increased in the IL-7vill mice
compared with wild-type mice (P ⬍ 0.05; Fig. 3B).
TCR subpopulations were also studied. The relative percentage of the ␣␤-TCR⫹ IEL population significantly increased in
IL-7vill mice compared with wild-type mice (Fig. 4C), as well
as the absolute number (17.1 ⫾ 2.1 ⫻ 106) of harvested
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
mice (Fig. 4C); however, this decline was relative in respect to
all IEL, and there was no significant difference of the absolute
number of isolated ␥␦-TCR⫹ IEL between IL-7vill mice and
wild-type mice (4.2 ⫾ 1.1⫻106 vs. 5.4 ⫾ 1.2⫻106 , P ⬎ 0.05).
IEL maturation and activation changes in IL-7vill mice.
CD44 was used as a marker of IEL maturation (26).
CD4⫹,CD44⫹ IEL were significantly increased in IL-7vill
mice compared with wild-type mice (38.4 ⫾ 5.9 vs. 6.5 ⫾
1.7%, respectively) (Fig. 5A); representing a 15.2-fold increase
in IL-7vill mice compared with wild-type mice (Fig. 3B).
CD8⫹,CD44⫹ IEL also significantly increased (P ⬍ 0.05) in
transgenic mice, representing a 1.9-fold increase compared
with wild-type mice (Fig. 3B). Surface expression of CD69
was used as a marker of T cell activation (31) and was noted
to be significantly altered in IL-7vill compared with wild-type
mice (Fig. 5B). The CD4⫹,CD69⫹ IEL number increased nearly
G1425
Fig. 6. Changes in IEL IL-7R mRNA expression from IL-7vill mice and a
wild-type mice. Results of RT-PCR are expressed as a ratio of IL-7 mRNA to
␤-actin mRNA expression. Expression of IL-7R mRNA was markedly increased in both ␣␤-TCR⫹IEL and ␥␦-TCR⫹ IEL in IL-7vill mice (n ⫽ 6)
compared with control mice (N ⫽ 6), *P ⬍ 0.05.
Functional Changes in the IEL
Fig. 5. IEL populations are expressed as the percentage of gated cells.
A: EC-derived IL-7 overexpression significantly increased the percentage of
mature CD4⫹ IEL, as measured by the percent of CD44-positive cells.
B: representative flow cytometry dot plots showing that IL-7vill mice have a
much higher level of IEL activation, as measured by CD69-positive cells,
compared with wild-type mouse.
Increased IEL proliferation in transgenic mice. Because of
the profound increase in IEL number and phenotypic changes
in IL-7vill mice, we next investigated alterations in proliferation
in various IEL subtypes. The results in Fig. 7 demonstrate that
the IEL from IL-7vill mice have a dramatic increase in the
proportion of cells entering the cell cycle compared with IEL
from wild-type mice. More specifically, IEL proliferation in
the CD4⫹ IEL was 18.5 ⫾ 1.2% in IL-7vill mice compared
with 2.1 ⫾ 0.4% in wild-type mice (n ⫽ 6 each group, P ⬍
0.05) (Fig. 7A). CD8⫹ IEL proliferation was 27.9 ⫾ 6.9% in
IL-7vill mice compared with 8.5 ⫾ 0.2% in wild-type mice
(P ⬍ 0.05; Fig. 7B). Similarly, the percentage of proliferating
␣␤-TCR⫹ IEL was significantly higher in transgenic mice
(Fig. 7C). Concomitant with the observed decline in the relative number of ␥␦-TCR⫹ IEL; however, no significant difference in ␥␦-TCR⫹ IEL proliferation was noted between transgenic and wild-type mice (Fig. 7D).
Changes in cytokine expressions in ␣␤-TCR⫹ and ␥␦-TCR⫹IEL.
A panel of cytokines was selected that could contribute to both
T cell activation as well as a downregulation of T cell activity
(28, 40). TNF-␣ expression significantly increased in both
␣␤-TCR⫹ and ␥␦-TCR⫹ IEL populations in IL-7vill mice
compared with wild-type mice (P ⬍ 0.05; Fig. 8). Because the
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
19.7-fold in IL-7vill mice (Fig. 3B) whereas CD8⫹,CD69⫹ IEL
number actually only increased twofold compared with wildtype mice (Fig. 3B).
IEL IL-7 receptor expression. IL-7R expression has been
detected on IEL and LPL (37, 50). It has been shown that the
IL-7/IL-7R-dependent signaling pathway plays a crucial role in
regulating the immune response in the intestinal mucosa (44,
50). To determine whether local overproduction of IL-7 affects
the neighboring IEL through the IL-7/IL-7R dependent signaling pathway, IEL IL-7R mRNA expression was studied. IL-7R
mRNA expression in both ␣␤-TCR⫹ IEL and ␥␦-TCR⫹IEL
subtypes were significantly increased compared with wild-type
mice (Fig. 6). The ␣␤-TCR⫹ IEL subtype IL-7R mRNA
expression increased 92.2%, and the ␥␦-TCR⫹ IEL IL-7R
mRNA expression increased 53.4% compared with wild-type
mice (Fig. 6).
G1426
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
pared with wild-type mice. Interestingly, despite a lack of
expansion in the ␥␦-TCR⫹ IEL population, IL-7 overexpression led to a 37.3% increase in ␥␦-TCR⫹ IEL-derived KGF
mRNA expression compared with wild-type mice (Fig. 9).
Histological Morphology in IL-7 Transgenic Mice
Fig. 7. Using 5-bromo-2-deoxyuridine (BrdU) incorporation, we measured
IEL proliferation via flow cytometry. Cell populations are expressed as the
percentage of gated cells. A: the percentage of proliferating CD4⫹ IEL in
IL-7vill mice was significantly increased compared with wild-type mice. B: the
percentage of proliferating CD8⫹ IEL in IL-7vill mice was significantly
increased compared with wild-type mice. C: the percentage of proliferating
␣␤-TCR⫹ IEL in IL-7vill mice was significantly increased compared with
wild-type mice. D: there was no significant difference in the proliferation rates
of ␥␦-TCR⫹ IEL between IL-7vill and wild-type mice. PE, phycoerytherin.
IEL is a major source of IFN-␥ (16, 46), IEL-derived IFN-␥
mRNA expression was also studied and was noted to be
significantly increased in both ␣␤-TCR⫹ IEL and ␥␦-TCR⫹
IEL populations of IL-7vill mice (Fig. 8). Other cytokines
studied, including IL-2 and IL-4, showed little to no change
compared with wild-type mice (Fig. 8).
Changes in ␥␦-TCR⫹IEL-derived KGF expression. KGF is
a known mitogenic growth factor and has been shown to
stimulate proliferation in a variety of EC lines (30). KGF has
a critical role in intestinal epithelial growth and maintenance
(45), and ␥␦-TCR⫹ IEL express KGF within the intestinal
mucosa (5, 45). Thus we investigated whether EC overexpression of IL-7 would influence the neighboring ␥␦ TCR⫹ IELderived KGF expression. ␥␦-TCR⫹ IEL-derived KGF was
noted to be significantly higher in IL-7 transgenic mice com-
IL-7vill mice were noted to have profoundly altered crypt and
villus structures (Fig. 10A). Villus height in IL-7vill mice was
significantly higher than in wild-type mice. Crypt depth in
IL-7vill mice was significantly deeper than in wild-type mice
(Fig. 10B). One of the most dramatic changes in our transgenic
mice was a significant increase in the width of the villi (Fig.
10B). It appeared that this marked increase in villus width was
due to a marked expansion of lymphocytes in the underlying
LPL population. We therefore investigated the associated alterations in the LPL of transgenic mice.
Fig. 9. Changes in keratinocyte growth factor (KGF) mRNA expression
in ␥␦-TCR⫹ IEL. Results of RT-PCR are expressed as a ratio of KGF to
␤-actin mRNA expression. Expression of KGF mRNA was markedly increased
in IL-7vill mice (n ⫽ 6) compared with control mice (n ⫽ 6), *P ⬍ 0.05.
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
Fig. 8. ␣␤-TCR⫹ and ␥␦-TCR⫹ IEL cytokine mRNA expressions. Both
␣␤-TCR⫹ and ␥␦-TCR⫹ IEL-derived TNF-␣ and IFN-␥ mRNA expression
in IL-7vill mice significantly increased compared with wild-type mice, but
either ␣␤-TCR⫹ or ␥␦-TCR⫹ IEL-derived IL-2 and IL-4 mRNA expression
did not significantly change in IL-7vill mice (n ⫽ 6) compared with control
mice (n ⫽ 6). Values (means ⫾ SD) are expressed as the ratio of target
cytokine vs. expression of ␤-actin; *P ⬍ 0.05.
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
G1427
Lamina Propria Changes in IL-7vill Mice
EC-specific overexpression of IL-7 also induced a significant expansion of LPL numbers and suggested that EC-derived
IL-7 may influence lymphoid development within the entire
crypt-villus structure, and not just the epithelial mucosal lining.
The number of LPL increased significantly in IL-7vill mice
compared with wild-type mice (P ⬍ 0.05; Fig. 11A). Numbers
of LPL increased threefold in IL-7 transgenic mice compared
with wild-type mice. B cells (as detected with CD19) were not
significantly different between IL-7 transgenic mice and wildtype mice (data not shown). Significant changes were also seen
in the LPL phenotype. The percentages of CD3⫹CD4⫹CD8⫹;
CD3⫹CD4⫹CD44⫹ and CD3⫹CD4⫹CD69⫹ subtypes significantly increased in transgenic mice compared with wild-type mice
(P ⬍ 0.05) (Fig. 11B).
Systemic Lymphoid Populations
To assess whether local overexpression of IL-7 affected
other lymphoid populations, thymocytes and splenocytes were
studied. Overexpression of IL-7 did not result in any significant
changes in thymocyte or splenocyte phenotype. There was also
no significant difference in the number of thymocytes or
splenocytes between transgenic and wild-type mice (data not
shown). These results indicate that IL-7 overexpression by EC
had no effect on systemic lymphoid populations. Thus the
changes induced by EC-derived IL-7 were due to the direct
effect on the mucosal level and not due to secondary changes
in other lymphoid populations that might be a source of some
portion of the IEL (i.e., thymic-derived IEL).
Mechanisms for IEL Recruitment to the Mucosal Epithelium
Although we demonstrated that the IEL are rapidly proliferating in our IL-7vill mice, we also noted a marked increase in
TCR-␣␤⫹ IEL; this cell population could come from extraintestinal sources, such as the thymus (13, 21, 29). Therefore, we
wanted to examine whether the expansion of the IEL in these
mice might be influenced by changes in the expression of the
IEL integrin ␣E␤7, which is a critical population for homing of
lymphocytes to the mucosa. Interestingly, both ␣␤-TCR⫹ and
␥␦-TCR-⫹ IEL integrin ␣E␤7 expression increased significantly compared with controls (Table 1). TCR-␣␤⫹ IEL integrin ␣E␤7 expression was also noted to be much higher than in
the ␥␦⫹ IEL in IL-7vill mice, as well as has previously been
observed in wild-type mice. The ligand of CD103 (␣E␤7) is
E-cadherin; therefore, we next investigated whether the
marked overexpression of the integrin ␣E␤7 resulted in any
changes to E-cadherin expression. In fact, we noted a 50%
increase in E-cadherin expression in our transgenic mice,
suggesting that local IL-7 overexpression contributes to IEL
expansion not just by increased proliferation, but by the recruitment of lymphocytes to the epithelium.
DISCUSSION
In this study, we found that EC-specific IL-7 overexpression
in our IL-7 transgenic mice significantly affected IEL phenotype and function and resulted in a significant expansion of the
IEL population. IEL functional changes included a significant
increase in IEL proliferation and alterations in cytokine expression for both ␣␤-TCR⫹ and ␥␦-TCR⫹ subtypes. In addition to the IEL, the intestinal LPL population was also seen to
be significantly expanded, and a significant change in the
proportion of LPL subtypes was observed. Finally, systemic
lymphoid populations did not change in the IL-7vill transgenic
mice, which supported the concept that local overexpression of
IL-7 resulted in a restricted area of action to the intestinal
mucosa and submucosa.
Villin is a cytoskeletal protein that is produced by EC and is
expressed along the brush border. Because villin is also expressed in the proliferative stem cells of the intestinal crypts
cells, it is believed to be an early marker of EC from the
remainder of the digestive tract (27). In the adult, the concentration of villin increases as cells move from the crypt to the tip
of the villi (25). The 12.4-kb regulatory fragment of villin we
used has been shown to be largely specific for the intestinal
epithelium (22, 23). This villin promoter/enhancer has been
shown to allow for the creation of a number of transgenic
mouse models with robust overexpression of several genes
(␤-galactosidase, Cre recombinase, green fluorescent protein,
and Hedgehog interacting protein) (23). In our IL-7vill mice
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
Fig. 10. A: histology of jejunum and ileum from wild-type and IL-7vill mice using hematoxylin and eosin staining. B: histological analysis of sections of small
intestine from wild-type mice and IL-7vill mice. *P ⬍ 0.05 compared with IL-7vill mice. Data are expressed as means ⫾ SD.
G1428
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
this 12.4-kb villin/IL-7 transgene was only detected from small
and large intestinal epithelial tissue and was not detected in
thymocytes, splenocytes, and kidney and hepatic tissues. Immune blot results showed that IL-7 protein expression in both
jejunum and ileum in IL-7vill mice was significantly higher
than in wild-type mice. Furthermore, the expression was confined to the local EC expression as, similar to wild-type mice;
serum IL-7 from transgenic IL-7 mice was undetectable.
The predominant IEL subpopulation is CD8⫹,CD4⫺ (70 –
85% of the total in mice) (10). IEL in mice also comprise a
large number of ␥␦-TCR⫹ cells, and ⬃50% of IEL are
Table 1. Alteration of CD103 (␣E␤7mRNA) and E-cadherin in IL-7vill mice
Mouse
Number ⫻106 (IEL)
␣E␤7 mRNA (TCR-␣␤⫹ IEL)
␣E␤7 mRNA (TCR-␥␦⫹IEL)
E-Cadherin mRNA
Wild-type
IL-7vill
4.8⫾1.2
14.6⫾4.5*
261⫾76
2263⫾446*
61.8⫾15
1134⫾257*
92.9⫾30.5
140.6⫾39.8*
Results are means⫾SD. IEL, intraepithelial lymphcytes. *P ⬍ 0.05, using ANOVA compared to wild-type group.
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
Fig. 11. A: changes in the number of lamina propria lymphocytes (LPL) in
IL-7vill mice. The number of LPL significantly increased in IL-7vill mice (n ⫽
6) compared with wild-type mice (n ⫽ 6) *P ⬍ 0.05, B: graphic distribution
of the LPL phenotypes. CD3 was used as T cell marker, and CD44 was used
as a marker of T maturation. CD69 was used as a T activation marker.
CD3⫹CD4⫹CD8⫺ subtype was significantly expended in transgenic mice
compared with wild-type mice, P ⬍ 0.05. There is a much higher
CD3⫹CD44⫹CD4⫹ LPL population in transgenic mice than wild-type mice.
The CD3⫹CD44⫹CD8⫹ LPL subtype decrease in transgenic mice than
wild-type mice, P ⬍ 0.05. There is a much higher CD3⫹CD69⫹CD4⫹ LPL
subtype in transgenic mice than wild-type mice, *P ⬍ 0.05.
␥␦-TCR⫹, compared with less than 2% of peripheral blood
lymphocytes (16). The function of the IEL appears to very
important in maintaining the intestinal barrier and gut immunity, as well as regulating intestinal growth (regulating EC
proliferation and apoptosis) (45, 46, 48, 51). Alterations in the
luminal environment may produce significant changes in the
IEL. A previous study from our group has shown that administration of total parenteral nutrition (TPN) in mice (the complete absence of luminal nutrients) led to a significant decline
in the CD4⫹,CD8⫺, CD4⫹,CD8⫹, and CD8⫹,CD44⫹ IEL
subpopulations, as well as a nearly complete loss of the
CD8␣␤⫹ IEL population. TPN also led to a significant change
in the expression of a variety of cytokines (16, 45). This change
in IEL function resulted in a loss of epithelial barrier function
and intestinal mucosal atrophy (47, 48, 52). The mechanism
that caused these IEL changes is unknown.
Recent studies have demonstrated that interactions between
mucosal lymphocytes and intestinal EC are crucial in regulating the immune response in the intestinal mucosa (33, 37, 45,
46). Several studies have indicated that EC may play an
important role in mucosal immune responses by helping to
regulate IEL phenotype and function (11, 37). Watanabe et al.
(37) demonstrate that intestinal EC express IL-7. IL-7 has been
shown to play a crucial role in controlling T cell development
and homeostasis (4), and this is supported by the wide range of
IEL subpopulations that express IL-7R (18, 37, 44). IL-7
knockout and IL-7R knockout mice show distinct declines in
absolute numbers of thymocytes and IEL (including an absence
of ␥␦-TCR⫹ IEL) (24). Using the intestinal fatty acid binding
protein promoter, Laky et al. (18) were able to reinstate IL-7
expression in IL-7 knockout mice, and this low level of
expression was sufficient for the development of the extrathymic IEL. This demonstrates the essential role that the local
expression of IL-7 has on the development of the mucosal
immune system. Exogenous administration of IL-7 resulted in
a significant increase in CD8␣␤⫹ IEL. Exogenous IL-7 also
resulted in a similar stimulation of LPL growth (24, 49). In a
more elegant fashion, Watanabe et al. (38) showed that the
systemic overexpression of IL-7 with an SR␣ promoter demonstrated an expansion of lymphoid populations and the development of chronic colitis. One particular distinguishing
feature of our particular model is that the overexpression of
IL-7 is predominantly in the small bowel and progressively
decreases in the colon, so that we may not observe the degree
of colitic changes that was identified by Watanabe et al.
The functional relevance of altered IL-7 expression in the
mucosal epithelium is illustrated in a recent study by our
laboratory that showed that TPN administration resulted in a
significant decrease in EC-derived IL-7 expression (53). Additionally, exogenous IL-7 administration to TPN mice significantly attenuated TPN-associated IEL changes (50). The precise etiology of these TPN-associated changes in IL-7 is
uncertain. It is difficult to determine whether the action of the
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
interesting, in that although IL-7 is critical for the formation of
␥␦-TCR⫹ IEL, IL-7 overexpression had little action on expanding the ␥␦-TCR⫹ IEL population but was able to influence its functional expression of both cytokines and growth
factors. We did not find any significant change in IL-2 or IL-4
expression between IL-7vill and wild-type mice. It is possible
that exogenous administration of IL-7 may stimulate extramucosal lymphoid populations that may account for the observed
increase in IEL-derived IL-2, a finding that did not occur in our
IL-7vill transgenic mouse model. A previous study of our
laboratory has shown that there is a close physical crosscommunication between EC-derived IL-7 and the neighboring
IEL via the IL-7R (49). Taken together, our data suggest that
cell-to-cell interactions between EC and IEL, via IL-7/IL-7R,
are an important mode of communication for the maintenance
and activation of the IEL.
In conclusion, this study demonstrated that intestinal specific
IL-7 overexpression significantly affected IEL and LPL populations and significantly changed IEL function, resulting in
overexpansion of the CD4⫹, CD8␣␤⫹ IEL, and ␣␤-TCR⫹
IEL subtypes, as well as an increase CD4⫹ IEL maturation and
activation. The results of this study confirm a close physical
and functional cross-communication between EC-derived IL-7
and the mucosal lymphoid population.
ACKNOWLEDGMENTS
This study was presented in part at the Annual Congress of the American
Gastroenterology Association, May 14 –19, 2005, Chicago, IL.
GRANTS
This research was supported by National Institute of Allergy and Infectious
Diseases Grant 2R01-AI044076-08 (to D. H. Teitelbaum), National Institute of
Diabetes and Digestive and Kidney Diseases Grant 5R01DK065850-02 (to
D. L. Gumucio), the ASPEN Rhoads Research Foundation Maurice Shils
Grant (to H. Yang), and the University of Michigan DNA Core, University of
Michigan Transgenic Core.
REFERENCES
AJP-Gastrointest Liver Physiol • VOL
1. Armitage RJ, Namen AE, Sassenfeld HM, Grabstein KH. Regulation
of human T cell proliferation by IL-7. J Immunol 144: 938 –941, 1990.
2. Barnard JA, Beauchamp RD, Coffey RJ, Moses HL. Regulation of
intestinal epithelial cell growth by transforming growth factor type beta.
Proc Natl Acad Sci USA 86: 1578 –1582, 1989.
3. Beagley KW, Husband AJ. Intraepithelial lymphocytes: origins, distribution, function. Crit Rev Immunol 18: 237–254, 1998.
4. Bhatia SK, Tygrett LT, Grabstein KH, Waldschmidt TJ. The effect of
in vivo IL-7 deprivation on T cell maturation. J Exp Med 181: 1399 –1409,
1995.
5. Boismenu R, Havran WL. Modulation of epithelial cell growth by
intraepithelial gamma delta T cells. Science 266: 1253–1255, 1994.
6. Borger P, Kauffman HF, Postma DS, Vellenga E. IL-7 differentially
modulates the expression of IFN-gamma and IL-4 in activated human T
lymphocytes by transcriptional and post-transcriptional mechanisms. J Immunol 156: 1333–1338, 1996.
7. Eisenbraun MD, Mosley RL, Teitelbaum DH, Miller RA. Altered
development of intestinal intraepithelial lymphocytes in P-glycoproteindeficient mice. Dev Comp Immunol 24: 783–795, 2000.
8. Fujihashi K, Kawabata S, Hiroi T, Yamamoto M, McGhee JR,
Nishikawa S, Kiyono H. Interleukin 2 (IL-2) and interleukin 7 (IL-7)
reciprocally induce IL-7 and IL-2 receptors on gamma delta T cell
receptor-positive intraepithelial lymphocytes. Proc Natl Acad Sci USA 93:
3613–3618, 1996.
9. Geiselhart LA, Humphries CA, Gregorio TA, Mou S, Subleski J,
Komschlies KL. IL-7 administration alters the CD4:CD8 ratio, increases
T cell numbers, and increases T cell function in the absence of activation.
J Immunol 166: 3019 –3027, 2001.
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
exogenous IL-7 was due to an effect on the thymus or directly
on the intestinal mucosa. Using intestinal specific overexpressing IL-7 transgenic mice has greatly facilitated our understanding of the role of EC-derived IL-7 on the neighboring IEL. This
allows one to detect the action of IL-7 in a more local or
paracrine fashion, as opposed to systemic (or endocrine) action
of this cytokine. In our present study, the IEL population was
significantly expanded, consisting of an increase in the CD4⫹
and CD8␣␤⫹, as well as ␣␤-TCR⫹ IEL subtypes. The increase in IEL subtypes is disproportionately biased to an
expansion of the CD4⫹ IEL population, which increased
ninefold, compared with CD8⫹ IEL, which increased fourfold
compared with wild-type mice. A bias toward the expansion of
the ␣␤-TCR⫹ IEL over the ␥␦-TCR⫹ IEL subpopulation was
also noted. This appears consistent with a greater colocalization of IL-7 expression the ␣␤-TCR⫹ group of IEL (49). Our
observation of an increase in IEL proliferation, as well as a
marked increase in CD103 (integrin ␣E␤7), suggests that the
expansion of the IEL population was due to both a local
increase in IEL growth as well as a recruitment of extraintestinal lymphocytes to the epithelium.
Interestingly, the LPL population was also expanded in our
transgenic mice. The fact that we did not find any significant
changes in the systemic lymphoid population in our IL-7vill
transgenic mice shows that the critical action of this local
(paracrine) expression of IL-7 was confined to the formation of
the IEL and LPL populations and suggests a potential functional role of EC-derived IL-7 to act on the underlying LPL
population. Studies suggest that IEL do not spend their entire
cycle in the epithelium but recirculate into the lamina propria
after activation, although this movement occurs at a much
slower rate than for most T cells (3, 11). Those studies may
explain the fact that LPL population was also found to be
significantly expanded in our transgenic mice. It is also possible that this expansion of the LPL might be due to a direct
effect of the IL-7 acting below the basement membrane of the
epithelium on the T cell population of the LPL. Although many
of these changes may potentially have been due to increased
nutritional intake in the transgenic group, this appears unlikely.
In fact, the measured amount of chow consumed was not
different between transgenic and wild-type mice. Furthermore,
body weights were actually about lower for the IL-7vill transgenic mice, compared with wild-types (20.49 ⫾ 0.81 vs.
22.91 ⫾ 0.87 g, at 8 wk of life for transgenic vs. wild-type,
respectively), suggesting that the increase in lymphoid populations was not due to increased food intake.
IL-7 has been shown to enhance peripheral T cell expression
of IL-4 (2, 6). Jiang and McGee (14) found that EC-derived
IL-7 could enhance human peripheral T cell IL-4 secretion but
not IFN-␥ in a cell culture model. A recent study from our
group showed that exogenous IL-7 administration to wild-type
healthy mice can upregulate both ␣␤-TCR⫹ and ␥␦-TCR⫹
IEL-derived IL-2 and IL-10 expression. As well, IL-7 was also
able to increase the expression of ␥␦-TCR⫹ IEL-derived KGF
expression. IL-7 had no effect on the expression of IL-4 or IL-6
(49). In this present study, both ␣␤-TCR⫹ and ␥␦-TCR⫹
IEL-derived cytokine expressions were studied. Both IFN-␥
and TNF-␣ expression were noted to be significantly increased
in IL-7vill transgenic mice compared with wild-type mice.
Interestingly, ␥␦-TCR⫹ IEL-derived KGF expression was also
noted to increase in our transgenic mice. This latter finding is
G1429
G1430
INTESTINAL MUCOSA SPECIFIC OVEREXPRESSION OF IL-7
33. Suzuki K, Oida T, Hamada H, Hitotsumatsu O, Watanabe M, Hibi T,
Yamamoto H, Kubota E, Kaminogawa S, Ishikawa H. Gut cryptopatches: direct evidence of extrathymic anatomical sites for intestinal T
lymphopoiesis. Immunity 13: 691–702, 2000.
34. Tan JT, Dudl E, LeRoy E, Murray R, Sprent J, Weinberg KI, Surh
CD. IL-7 is critical for homeostatic proliferation and survival of naive T
cells. Proc Natl Acad Sci USA 98: 8732– 8737, 2001.
35. Thomis DC, Gurniak CB, Tivol E, Sharpe AH, Berg LJ. Defects in B
lymphocyte maturation and T lymphocyte activation in mice lacking Jak3.
Science 270: 794 –797, 1995.
36. Tough DF, Sprent J. Turnover of naive- and memory-phenotype T cells.
J Exp Med 179: 1127–1135, 1994.
37. Watanabe M, Ueno Y, Yajima T, Iwao Y, Tsuchiya M, Ishikawa H,
Aiso S, Hibi T, Ishii H. Interleukin 7 is produced by human intestinal
epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes. J Clin Invest 95: 2945–2953, 1995.
38. Watanabe M, Ueno Y, Yajima T, Okamoto S, Hayashi T, Yamazaki
M, Iwao Y, Ishii H, Habu S, Uehira M, Nishimoto H, Ishikawa H,
Hata J, Hibi T. Interleukin 7 transgenic mice develop chronic colitis with
decreased interleukin 7 protein accumulation in the colonic mucosa. J Exp
Med 187: 389 – 402, 1998.
39. Watanabe M, Yamazaki M, Okamoto R, Ohoka S, Araki A, Nakamura T, Kanai T. Therapeutic approaches to chronic intestinal inflammation by specific targeting of mucosal IL-7/IL-7R signal pathway. Curr
Drug Targets Inflamm Allergy 2: 119 –123, 2003.
40. Weissenbach M, Clahsen T, Weber C, Spitzer D, Wirth D, Vestweber
D, Heinrich PC, Schaper F. Interleukin-6 is a direct mediator of T cell
migration. Eur J Immunol 34: 2895–2906, 2004.
41. Welch PA, Namen AE, Goodwin RG, Armitage R, Cooper MD. Human
IL-7: a novel T cell growth factor. J Immunol 143: 3562–3567, 1989.
42. Witkowski J, Miller R. Increased function of P-glycoprotein in T lymphocyte subsets of aging mice. J Immunol 150: 1296 –1306, 1993.
43. Yada S, Nukina H, Kishihara K, Takamura N, Yoshida H, InagakiOhara K, Nomoto K, Lin T. IL-7 prevents both caspase-dependent and
-independent pathways that lead to the spontaneous apoptosis of i-EIL.
Cell Immunol 208: 88 –95, 2001.
44. Yamazaki M, Yajima T, Tanabe M, Fukui K, Okada E, Okamoto R,
Oshima S, Nakamura T, Kanai T, Uehira M, Takeuchi T, Ishikawa H,
Hibi T, Watanabe M. Mucosal T cells expressing high levels of IL-7
receptor are potential targets for treatment of chronic colitis. J Immunol
171: 1556 –1563, 2003.
45. Yang H, Antony PA, Wildhaber BE, Teitelbaum DH. Intestinal intraepithelial lymphocyte gammadelta-T cell-derived keratinocyte growth factor
modulates epithelial growth in the mouse. J Immunol 172: 4151– 4158, 2004.
46. Yang H, Fan Y, Teitelbaum DH. Intraepithelial lymphocyte-derived interferon-gamma evokes enterocyte apoptosis with parenteral nutrition in mice.
Am J Physiol Gastrointest Liver Physiol 284: G629 –G637, 2003.
47. Yang H, Finaly R, Teitelbaum DH. Alteration in epithelial permeability
and ion transport in a mouse model of total parenteral nutrition. Crit Care
Med 31: 1118 –1125, 2003.
48. Yang H, Kiristioglu I, Fan Y, Forbush B, Bishop DK, Antony PA,
Zhou H, Teitelbaum DH. Interferon-gamma expression by intraepithelial
lymphocytes results in a loss of epithelial barrier function in a mouse
model of total parenteral nutrition. Ann Surg 236: 226 –234, 2002.
49. Yang H, Spencer AU, Teitelbaum DH. Interleukin-7 administration
alters intestinal intraepithelial lymphocyte phenotype and function in vivo.
Cytokine 31: 419 – 428, 2005.
50. Yang H, Sun X, Haxhija EQ, Teitelbaum DH. Intestinal epithelial
cell-derived interleukin-7: a mechanism for the alteration of intraepithelial
lymphocytes in a mouse model of total parenteral nutrition. Am J Physiol
Gastrointest Liver Physiol 292: G84 –G91, 2007.
51. Yang H, Teitelbaum DH. Novel agents in the treatment of intestinal
failure: humoral factors. Gastroenterology 130: S117–S121, 2006.
52. Yang H, Wildhaber B, Tazuke Y, Teitelbaum DH. 2002 Harry M. Vars
Research Award. Keratinocyte growth factor stimulates the recovery of
epithelial structure and function in a mouse model of total parenteral nutrition.
JPEN J Parenter Enteral Nutr 26: 333–340; discussion 340 –341, 2002.
53. Yang H, Wildhaber BE, Teitelbaum DH. Decline in intestinal epithelial
cell-derived IL-7: a mechanism for the alteration of intraepithelial lymphocytes in a mouse model of total parenteral nutrition (Abstract). Gastroenterology 126: A-126, 2004.
AJP-Gastrointest Liver Physiol • VOL
294 • JUNE 2008 •
www.ajpgi.org
Downloaded from ajpgi.physiology.org on June 10, 2008
10. Guy-Grand D, Vassalli P. Gut intraepithelial T lymphocytes. Curr Opin
Immunol 5: 247–252, 1993.
11. Hayday A, Theodoridis E, Ramsburg E, Shires J. Intraepithelial lymphocytes: exploring the Third Way in immunology. Nat Immunol 2:
997–1003, 2001.
12. He YW, Malek TR. The structure and function of gamma c-dependent
cytokines and receptors: regulation of T lymphocyte development and
homeostasis. Crit Rev Immunol 18: 503–524, 1998.
13. Howie D, Spencer J, Delord D, Pitzalis C, Wathen NC, Dogan A,
Akbar A, Macdonald TT. Extrathymic T cell differentiation in the
human intestine early in life. J Immunol 161: 5862–5872, 1998.
14. Jiang Y, McGee DW. Regulation of human lymphocyte IL-4 secretion by
intestinal epithelial cell-derived interleukin-7 and transforming growth
factor-beta. Clin Immunol Immunopathol 88: 287–296, 1998.
15. Kenai H, Matsuzaki G, Nakamura T, Yoshikai Y, Nomoto K. Thymusderived cytokine(s) including interleukin-7 induce increase of T cell
receptor ␣␤⫹ CD4-CD8- T cells which are extrathymically differentiated
in athymic nude mice. Eur J Immunol 23: 1818 –1825, 1993.
16. Kiristioglu I, Antony P, Fan Y, Forbush B, Mosley RL, Yang H, Teitelbaum DH. Total parenteral nutrition-associated changes in mouse intestinal
intraepithelial lymphocytes. Dig Dis Sci 47: 1147–1157, 2002.
17. Kiristioglu I, Teitelbaum DH. Alteration of the intestinal intraepithelial
lymphocytes during total parenteral nutrition. J Surg Res 79: 91–96, 1998.
18. Laky K, Lefrancois L, Lingenheld EG, Puddington L. Enterocyte
expression of interleukin 7 induces development of gamma delta T cells
and Peyer’s patches. J Exp Med 191: 1569 –1580, 2000.
19. Laouar Y, Crispe IN, Flavell RA. Overexpression of IL-7R alpha
provides a competitive advantage during early T-cell development. Blood
103: 1985–1994, 2004.
20. Li J, Kudsk KA, Gocinski B, Dent D, Glezer J, Langkamp-Henken B.
Effects of parenteral and enteral nutrition on gut-associated lymphoid
tissue. J Trauma 39: 44 –52, 1995.
21. Lin T, Matsuzaki G, Yoshida H, Kenai H, Omoto K, Umesue M, Singaram
C, Nomoto K. Thymus ontogeny and the development of TCR alpha beta
intestinal intraepithelial lymphocytes. Cell Immunol 171: 132–139, 1996.
22. Madison BB, Braunstein K, Kuizon E, Portman K, Qiao XT, Gumucio
DL. Epithelial hedgehog signals pattern the intestinal crypt-villus axis.
Development 132: 279 –289, 2005.
23. Madison BB, Dunbar L, Qiao XT, Braunstein K, Braunstein E,
Gumucio DL. Cis elements of the villin gene control expression in
restricted domains of the vertical (crypt) and horizontal (duodenum,
cecum) axes of the intestine. J Biol Chem 277: 33275–33283, 2002.
24. Maki K, Sunaga S, Komagata Y, Kodaira Y, Mabuchi A, Karasuyama
H, Yokomuro K, Miyazaki JI, Ikuta K. Interleukin 7 receptor-deficient
mice lack gammadelta T cells. Proc Natl Acad Sci USA 93: 7172–7177, 1996.
25. Maunoury R, Robine S, Pringault E, Leonard N, Gaillard JA,
Louvard D. Developmental regulation of villin gene expression in the
epithelial cell lineages of mouse digestive and urogenital tracts. Development 115: 717–728, 1992.
26. Miller RA. Age-related changes in T cell surface markers: a longitudinal
analysis in genetically heterogeneous mice. Mech Ageing Dev 96: 181–
196, 1997.
27. Pinto D, Robine S, Jaisser F, El Marjou FE, Louvard D. Regulatory
sequences of the mouse villin gene that efficiently drive transgenic
expression in immature and differentiated epithelial cells of small and
large intestines. J Biol Chem 274: 6476 – 6482, 1999.
28. Porter BO, Malek TR. Thymic and intestinal intraepithelial T lymphocyte development are each regulated by the gammac-dependent cytokines
IL-2, IL-7, and IL-15. Semin Immunol 12: 465– 474, 2000.
29. Rocha B, Vassalli P, Guy-Grand D. Thymic and extrathymic origins of
gut intraepithelial lymphocyte populations in mice. J Exp Med 180:
681– 686, 1994.
30. Rubin J, Osada H, Finch P. Purification and characterization of a newly
identified growth factor specific for epithelial cells. Proc Natl Acad Sci
USA 806: 802–906, 1989.
31. Sillett HK, Southgate J, Howdle PD, Trejdosiewicz LK. Expression of
activation and costimulatory elements by human intestinal intraepithelial
lymphocytes. Scand J Immunol 50: 52– 60, 1999.
32. Sudo T, Nishikawa S, Ohno N, Akiyama N, Tamakoshi M, Yoshida H.
Expression and function of the interleukin 7 receptor in murine lymphocytes. Proc Natl Acad Sci USA 90: 9125–9129, 1993.