Molecular Microbiology (2000) 37(6), 1379±1388
New insights into the role of CcmC, CcmD and CcmE in
the haem delivery pathway during cytochrome c
maturation by a complete mutational analysis of the
conserved tryptophan-rich motif of CcmC
Henk. Schulz, Erica C. Pellicioli and
Linda ThoÈny-Meyer*
Institut fuÈr Mikrobiologie, EidgenoÈssische Technische
Hochschule, Schmelzbergstrasse 7, CH 8092 ZuÈrich,
Switzerland.
Summary
Maturation of c-type cytochromes in Escherichia coli
is a complex process requiring eight membrane
proteins encoded by the ccmABCDEFGH operon.
CcmE is a mediator of haem delivery. It binds haem
transiently at a conserved histidine residue and
releases it for directed transfer to apocytochrome c.
CcmC, an integral membrane protein with six transmembrane helices, is necessary and sufficient to
incorporate haem covalently into CcmE. CcmC contains a highly conserved tryptophan-rich motif,
WGXXWXWD, in its second periplasmic loop. Here,
we present the results of a systematic mutational
analysis of this motif. Changes of the non-conserved
T121 and W122 to A resulted in wild-type CcmC
activity. Changes of the single amino acids W119A,
G120A, W123A, W125I and D126A or of the spacing
within the motif by deleting V124 (DV124) inhibited the
covalent haem incorporation into CcmE. Enhanced
expression of ccmD suppressed this mutant phenotype by increasing the amounts of CcmC and CcmE
polypeptides in the membrane. The DV124 mutant
showed the strongest defect of all single mutants.
Mutants in which six residues of the tryptophan-rich
motif were changed showed no residual CcmC
activity. This phenotype was independent of the
level of ccmD expression. Our results demonstrate
the functional importance of the tryptophan-rich
motif for haem transfer to CcmE. We propose that
the three membrane proteins CcmC, CcmD and CcmE
interact directly with each other, establishing a
cytoplasm to periplasm haem delivery pathway for
cytochrome c maturation.
Accepted 28 June, 2000. *For correspondence. E-mail lthoeny@micro.
biol.ethz.ch; Tel. (141) 1 632 3326; Fax (141) 1 632 1148.
Q 2000 Blackwell Science Ltd
Introduction
Haem is a cofactor associated with proteins involved in
various biological activities. In c-type cytochromes, haem
is attached covalently to a conserved CXXCH sequence
motif. Although the synthesis of haem and apocytochrome c takes place in the cytoplasm, the covalent
attachment of haem to apocytochrome c is a periplasmic
process.
Numerous pathogenic bacteria are able to take up
haem via TonB-mediated import systems to use it as a
source of iron (reviewed by Moeck and Coulton, 1998;
Wandersman and Stojiljkovic, 2000). However, it is
unknown how the amphipathic haem molecule is exported
through the membrane during biogenesis of periplasmic
cytochromes. Cook and Poole (2000) recently showed
that haem is translocated into everted membrane vesicles
of Escherichia coli by an energy-independent mechanism,
but no evidence for a specific haem export system was
obtained.
E. coli synthesizes up to five different c-type cytochromes under anaerobic growth conditions (Iobbi-Nivol
et al., 1994). They are involved in the electron transfer to
terminal reductases of the anaerobic respiratory chain
with nitrate, nitrite or TMAO (trimethylamine-N-oxide) as
electron acceptors. These c-type cytochromes are either
localized in the periplasm as soluble proteins or found
attached to the membrane, with their functional domains
facing the periplasm.
In E. coli, eight genes, named ccmA±H, have been
found to be essential for cytochrome c maturation (ThoÈnyMeyer et al., 1995; Grove et al., 1996a). CcmE binds
haem covalently at a single histidine residue and then
transfers it to apocytochrome c, thereby acting as a
periplasmic haem chaperone (Schulz et al., 1998).
Recently, we showed that the activity of CcmC is
necessary and sufficient to incorporate haem covalently
into CcmE (Schulz et al., 1999). The small, integral
membrane protein CcmD was found to be involved in
stabilising CcmE (Schulz et al., 1999).
The membrane topology of the Rhodobacter capsulatus
CcmC homologue HelC and the Pseudomonas fluorescens ATCC 17400 CcmC was analysed by Goldman et al.
(1998) and Gaballa et al. (1998). CcmC contains six
1380 H. Schulz, E. C. Pellicioli and L. ThoÈny-Meyer
transmembrane helices, separated by two cytoplasmic
and three periplasmic loops. Two strictly conserved
histidines in the first and third periplasmic loop are
essential for the function of CcmC in E. coli (Schulz
et al., 1999). The most conserved domain in CcmC
homologues is the tryptophan-rich motif PXWGS/
TfWXWDA/PRLT present in the second periplasmic
loop, where f represents an aromatic amino acid residue
Fig. 1) (ThoÈny-Meyer et al., 1994; ThoÈny-Meyer, 1997;
Kranz et al., 1998; Xie and Merchant, 1998). These
conserved residues, together with the two histidines, have
been postulated to be involved in an interaction with
haem. It was reported that CcmC in P. fluorescens and
Paracoccus denitrificans had an additional function in the
biogenesis and/or secretion of pyoverdine, a siderophore
which ± like haem ± is an amphiphilic organic iron
complex (Gaballa et al., 1996; Page and Ferguson, 1999).
A similar, conserved tryptophan-rich motif WGGfWXWD
and flanking histidine residues in periplasmic loops are
present in CcmF and its orthologue NrfE of E. coli, which
are thought to interact with haem (Fig. 1). CcmF and NrfE
have been suggested to function as bacterial cytochrome
c haem lyases, catalysing the formation of the thioether
bonds between apocytochrome c and haem (Grove et al.,
1996b; Eaves et al., 1998). Another conserved tryptophan-rich motif is present in CcsA homologues from
Gram-positive bacteria, 1-subclass of proteobacteria and
plant chloroplasts (Kranz et al., 1998; Xie and Merchant,
1998). In Chlamydomonas reinhardtii, ccsA is required for
the maturation of c-type cytochromes (Xie and Merchant,
1996). This further substantiates the model that
the tryptophan-rich motif forms a hydrophobic surface,
facilitating the binding of haem. A minimal consensus
sequence of the tryptophan-rich motifs WGXfWXWD of
CcmC, CcmF and CcsA is shown in Fig. 1. By performing
a systematic mutational analysis of the minimal consensus motif of E. coli CcmC, we tested the involvement of
each individual amino acid in haem transfer to CcmE and
on cytochrome c biogenesis.
Results
The tryptophan-rich motif is involved in haem transfer to
CcmE
Most residues of the tryptophan-rich motif in CcmC
(Fig. 1) were changed to the small uncharged amino
acid alanine. The residue V124 was deleted in order to
change the spacing within the motif rather than the sidechain of this non-conserved amino acid. The residue W125
was changed to isoleucine for reasons of practicality during
mutant construction.
As we have shown previously, CcmC is sufficient to
trigger haem binding to CcmE. We now analysed the
ability of the mutants to attach haem covalently to CcmE
in a minimal system, i.e. in the absence of other ccm
genes. The Dccm mutant EC06, in which the ccmA±H
genes are deleted (ThoÈny-Meyer et al., 1995), was cotransformed with plasmid pEC458 (pccmE) and with
plasmids expressing different ccmC mutant alleles.
Figure 2A (top) shows that in the presence of wild-type
CcmC (lane 2) haem was incorporated into CcmE,
whereas in most of the ccmC mutants and in the negative
control (vector only) no haem attachment to CcmE
occurred (lanes 1, 3, 4, 7±10). Only the non-conserved
residues T121 and W122 (lanes 5 and 6) could be
replaced by alanines without loss of activity. These results
demonstrate that the conserved residues W119, G120,
W123, V124, W125 and D126 of the tryptophan-rich motif
of CcmC are involved in holo-CcmE formation.
A different picture emerged when the Dccm mutant was
transformed with plasmid pEC459, (pccmDE) from which
the small membrane protein CcmD is produced concomitantly with CcmE, and with a plasmid expressing
individual ccmC mutant alleles (Fig. 2A, bottom). Upon
enhanced expression of ccmD, all single CcmC point
mutants were active in haem attachment to CcmE
(Fig. 2A, top, lanes 3±10), albeit to various extents. The
mutant DV124 showed a significantly reduced activity
compared with the other point mutants (Fig. 2A, bottom,
lane 8). The finding that expression of ccmD from a
constitutive promoter of a low copy number plasmid was
able to suppress the mutant phenotype prompted us to
test whether more dramatic changes in the tryptophanrich motif lead to an entire loss of CcmC function. For this
purpose, one mutant was constructed in which six
residues (W119, W122±D126) were changed to alanine
(abbreviated by A6) and another mutant was constructed
in which W119 was changed to alanine and W122±D126
were deleted (abbreviated by D5). Both the A6 and the D5
mutants were no longer able to attach haem to CcmE,
even if ccmD was co-expressed (Fig. 2A, bottom, lanes
11 and 12). They showed the same phenotype as the
previously described mutant H184A (Schulz et al., 1999)
(Fig. 2A, bottom, lane 13), demonstrating the importance
of the tryptophan-rich motif for CcmC activity.
CcmD influences the amount of both CcmC and CcmE in
the membrane
To analyse the amount of CcmE polypeptide present in
the mutants, an immunoblot with the same membrane
fractions as in Fig. 2A was probed with anti-CcmE serum
(Fig. 2B). The individual point mutations in CcmC did not
seem to influence the abundance of CcmE polypeptide in
the membrane (Fig. 2B). Thus, the different abilities of the
ccmC mutants to form holo-CcmE, as observed in
Fig. 2A, were not due to different levels of CcmE but
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
Haem delivery during cytochrome c maturation 1381
Fig. 1. Amino acid sequence alignment of the tryptophan-rich motif of CcmC homologues from representative organisms. Strictly conserved
residues are shaded in black, aromatic amino acids in grey and the flanking putative transmembrane helices are indicated. For comparison,
the tryptophan-rich motifs of E. coli CcmF/NrfE and C. reinhardtii CcsA are shown, where the black-shaded residues are also conserved in
homologues from other organisms. The minimal consensus sequence of the motif is shown below. X, any amino acid, f, aromatic amino acid.
Ec, E. coli; Bj, Bradyrhizobium japonicum (Ramseier et al., 1991); Hi, Haemophilus influenzae (Fleischmann et al., 1995); Pc, Pantoea citrea
(Pujol and Kado, 2000); Pd, P. denitrificans (Page et al., 1997); Pf, P. fluorescens (Gaballa et al., 1996); Pp, Pseudomonas putida
(AJ131925); Ra, Reclinomonas americana (Lang et al., 1997); Rc, R. capsulatus (Beckman et al., 1992); Rp, Rickettsia prowazekii (Andersson
et al., 1998); Rs, Rhodobacter sphaeroides (U83136); Sp, Shewanella putrefaciens (AF044582); At, Arabidopsis thaliana (Marienfeld et al.,
1996); Cr, C. reinhardtii (Chen and Moroney, 1995).
rather to different activities of CcmC. However, there was
a significant difference in the amount of CcmE detectable
in membranes depending on the presence of CcmD
(compare Fig. 2B top and bottom); when CcmD was
present, more CcmE polypeptide accumulated in the
membrane. Note that the cultivation of cells, the preparation of membranes, the determination of protein concentrations, the haem stain analysis and the Western blot
transfer and immunodetection of all samples analysed in
Fig. 2 were carried out at the same time.
To investigate the possibility that the observed phenotypes were due to a reduced level of CcmC mutant
polypeptides, an immunoblot analysis with the same
membrane fractions as in Fig. 2A and B was performed
using polyclonal anti-CcmC serum (Fig. 2C). Although
various strong cross-reacting bands were detected, the
CcmC polypeptide could be identified unambiguously as a
23 kDa protein because of the absence of a band in
membranes lacking CcmC (Fig. 2C, lane 1). Note, that
non-specific cross-reacting bands can be used as internal
controls for the amount of protein loaded. In the absence
of CcmD (Fig. 2C, top), CcmC polypeptide was detected
in membranes from the wild type (lane 2), from mutants
W119A, G120A, T121A, W122A, W123A, DV124, H184A
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
and ± although at lower levels ± from mutants W125I and
D126A. By contrast, CcmC polypeptide was not detected
in the mutants A6 and D5. However, in the presence of
CcmD (Fig. 2C, bottom) the CcmC polypeptide was found
in membrane fractions of all ccmC mutants. CcmC mutant
polypeptides with multiple changes showed a slightly
different mobility in the gel (Fig. 2C, bottom, lanes 11 and
12), which may be due to small changes in protein folding.
Our results indicate that mutations A6 and D5 lead to
reduced accumulation of CcmC polypeptide, probably
because the mutant form is destabilized. We suggest that
the presence of CcmD stabilises mutant forms of CcmC
(see next section). However, partial or complete loss of
haem attachment to CcmE in the presence of ccmD
(Fig. 2A, bottom, lanes 8, 11±13) was not due to
instability of these CcmC mutant polypeptides. Rather,
the mutations DV124, A6, D5 and H184A strongly affected
the enzymatic activity of CcmC.
The CcmC A6 mutant is functionally inactive but forms a
stable polypeptide in the membrane
Our polyclonal antibodies against synthetic peptides of
CcmC are not very sensitive (Fig. 2C). Therefore, it was
1382 H. Schulz, E. C. Pellicioli and L. ThoÈny-Meyer
Fig. 2. Functional analysis of point mutants in the tryptophan-rich motif of CcmC and dissection of the role of CcmD in the cytochrome c
biogenesis pathway. The Dccm mutant EC06 was co-transformed with plasmids expressing genes encoding different CcmC point mutants plus
either pEC458 expressing ccmE (top) or with pEC459 expressing ccmDE (bottom) respectively.
A. Activity stain for covalently bound haem of 100 mg membrane proteins after 15% SDS±PAGE. CcmC point mutants were analysed for their
ability to accumulate holo-CcmE either in the absence (top) or presence (bottom) of CcmD.
B. Immunoblot of the same membrane fractions (20 mg protein) as in A probed with anti-CcmE serum. All preparation steps for SDS±PAGE,
Western blot transfer and detection were performed at the same time. Thus, for all samples, the intensity of the bands is proportional to the
amount of CcmE present in the sample.
C. Immunoblot of the same membrane fractions (50 mg protein) as in A probed with anti-CcmC serum. As for B, visualization of all samples
was performed at the same time. Lanes: 1, vector pACYC184; 2, wt, pEC439 pccmC (wild-type); 3, W, pEC450 pccmC (W119A); 4, G,
pEC454 pccmC (G120A); 5, T, pEC455 pccmC (T121A); 6, W, pEC456 pccmC (W122A); 7, W, pEC471 pccmC (W123A); 8, V, pEC457
pccmC (DV124); 9, W, pEC451 pccmC (W125I); 10, D, pEC452 pccmC (D126A), 11, A6, pEC477 pccmC (W119A/[W122±D126]A); 12, D5,
pEC478 pccmC (W119A/D[W122±D126]); 13, H, pEC470 pccmC (H184A).
not possible to determine whether low levels of the CcmC
A6 polypeptide were present even in the absence of
overproduced CcmD. A hexa-histidine tag was fused to
the C-terminus of wild-type and the A6 mutant CcmC to
enhance detection of these proteins by using a monoclonal anti-penta-histidine antibody. The hexa-histidinetagged mutant CcmC was present in the membranes in
the absence of CcmD, although it accumulated at slightly
lower levels than the corresponding wild-type protein
(Fig. 3A). Hence, the lack of a CcmC-specific band in
Fig. 2C (top, lane 11) was due to the low sensitivity of the
polyclonal anti-CcmC antibody and was not due to an
instability of the mutant protein. This implies that the
tryptophan-rich motif per se is critical for the activity
of CcmC. The histidine tag did not interfere with the
activity of the protein because the histidine-tagged wildtype CcmC protein was capable of attaching haem to
CcmE (Fig. 3B) and supported cytochrome c maturation
(Fig. 3C, see below).
Effect of point mutations in the tryptophan-rich motif of
CcmC on the biogenesis of c-type cytochromes
The ability of the point mutants of CcmC to form
holocytochrome c was tested. The periplasmic B. japonicum cytochrome c550 (Cyt c550) encoded by cycA can be
expressed in E. coli from plasmid pRJ3291 upon addition
of arabinose (Schulz et al., 1999). E. coli strain EC28,
containing an in frame deletion mutation in ccmC (DccmC),
was transformed with pRJ3291 and with plasmids expressing different ccmC alleles. The cells were grown anaerobically in the presence of nitrite as electron acceptor to
ensure expression of the ccm operon and the structural
genes napBC, which encode the c-type cytochromes of the
periplasmic nitrate reductase (Potter and Cole, 1999). After
induction of cycA expression, holocytochrome c formation
was analysed by haem staining of periplasmic proteins.
Wild-type ccmC and the ccmC mutant alleles W119A,
G120A, T121A, W122A, W123A, W125I and D126A (Fig. 4,
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
Haem delivery during cytochrome c maturation 1383
Fig. 3. Analysis of the activity and the presence of His-tagged wildtype CcmC and His-tagged CcmCA6 in membrane protein fractions.
A. The Dccm mutant EC06 was co-transformed with plasmids
expressing His-tagged wild-type CcmC or His-tagged CcmCA6 and
with a plasmid expressing ccmE. Immunoblot of membrane protein
fractions (50 mg) probed with anti-penta-His monoclonal antibodies.
B. Haem stain of the same membrane proteins (100 mg) as in A.
C. The DccmC mutant EC28 was transformed with plasmids
expressing genes which encode either His-tagged wild-type CcmC
or His-tagged CcmCA6. In addition, the strains contained the
plasmid pRJ3291 expressing the B. japonicum cycA gene, which
encodes cytochrome c550 (Cyt c550). Cells were grown anaerobically in
the presence of nitrite, and TCA-precipitated periplasmic proteins
(50 mg) were stained for covalently bound haem. ccmC wt, His-tagged
wild-type CcmC; ccmCA6, His-tagged W119A/[W122-D126]A) CcmC.
lanes 2±7, 9±10) were able to complement the DccmC
mutant phenotype. Both the endogenous E. coli c-type
cytochrome NapB and the heterologously expressed
cytochrome c550 from B. japonicum were formed. Although
the mutants G120A, T121A, W122A and W123A (Fig. 4,
lanes 4±7) produced similar amounts of holocytochrome c
to the wild type (Fig. 4, lane 2), the mutants W119A, W125I
and D126A (lanes 3, 9±10) showed a slight reduction in
cytochrome c formation. In contrast, cells expressing no
ccmC (Fig. 4, lane 1) or the ccmC mutant alleles DV124,
A6, D5 and H184A (Fig. 4, lanes 8, 11±13) were not able to
synthesize holo-cytochrome c. These results further confirm
that the tryptophan-rich motif is important for CcmCmediated haem transfer during cytochrome c maturation.
CcmC D V124 requires overexpression of ccmD to
complement a DccmC mutant
The CcmC DV124 mutant was able to attach haem to
CcmE when ccmD was overexpressed from the constitutive
promoter of a plasmid (Fig. 2A, lane 8, bottom). However,
this activity was the lowest of all point mutants tested
(Fig. 2A). Nevertheless, the DV124 ccmC allele did not
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
allow cytochrome c maturation in the DccmC mutant
EC28 (Fig. 4, lane 8). In this genetic background, ccmD
was expressed only from its chromosomal copy. Thus, we
tested whether overexpression of ccmD from a plasmid
could support holocytochrome c formation in EC28 carrying
a plasmid-borne ccmC V124D allele. E. coli cells were
grown under anaerobic conditions with TMAO as terminal
electron acceptor to induce the expression of the c-type
cytochrome TorC, which is involved in the TMAO reductase
pathway. Membrane proteins were isolated and analysed for
covalently bound haem (Fig. 5A). The DccmC strain cotransformed with plasmids expressing ccmC DV124 and
ccmDE was capable of synthesizing both holo-CcmE and
the c-type cytochrome TorC (Fig. 5A, lane 6). This activity
was strictly dependent on expression of ccmD from a
plasmid (Fig. 5A, compare lanes 5 and 6).
For comparison, we also analysed the ccmC D126A
mutant in more detail as it displays an intermediate
phenotype. The CcmC D126A polypeptide was not
able to catalyse holo-CcmE formation in the absence of
overproduced CcmD (Fig. 2A, lane 10, top), but it could
complement the DccmC mutant to form holo-cytochrome
c (Fig. 4, lane 10). In the presence of a chromosomal copy
of ccmD, the D126 mutant was capable of synthesizing
holo-CcmE and TorC, whereas mutant DV124 required
overexpression of ccmD for activity.
An immunoblot with the same membrane proteins as in
Fig. 5A was probed with anti-CcmE serum (Fig. 5B). The
amount of CcmE polypeptide detected in the membrane
fractions increased when ccmD was overexpressed from
a plasmid (even number lanes in Fig. 5B). In contrast to
the experiments presented in Fig. 2B, in the experiment
shown in Fig. 5A chromosomal copy of ccmD was always
expressed. Thus, the level of CcmE polypeptide accumulating in the membrane fraction was not only dependent
on the presence but also on the amount of CcmD in the
membrane. However, further interpretations of the effects
of overexpression of CcmD will only be possible when
specific antibodies for CcmD are available.
The differing amounts of CcmE in the membrane
fraction were also reflected by the intensities of the
haem-staining bands of CcmE (Fig. 5A). When the
DccmC mutant was complemented either with wild-type
ccmC or with ccmC D126A, the amount of holo-CcmE
was dependent on the level of ccmD expression (Fig. 5,
compare lanes 3 and 4 and lanes 7 and 8). However, the
amount of the holo-TorC produced was not limited by the
level of ccmD expression and therefore by the amount of
holo-CcmE present in the membrane (Fig. 5A, compare
lanes 3 and 4 and lanes 7 and 8).
Discussion
One of the most striking common features of cytochrome
1384 H. Schulz, E. C. Pellicioli and L. ThoÈny-Meyer
Fig. 4. Ability of point mutants in the tryptophan-rich motif of CcmC to form holocytochrome c. The DccmC mutant EC28 was transformed with
plasmids expressing genes encoding different CcmC point mutants. In addition, the strains contained the plasmid pRJ3291 expressing the
B. japonicum cycA gene, which encodes cytochrome c550 (Cyt c550). E. coli cells were grown anaerobically in the presence of nitrite. A haem
stain of TCA-precipitated periplasmic proteins (25 mg) separated by 15% SDS±PAGE is shown. Lanes: 1, vector pACYC184; 2, wt, pEC439
pccmC (wild type); 3, W, pEC450 pccmC (W119A); 4, G, pEC454 pccmC (G120A); 5, T, pEC455 pccmC (T121A); 6, W, pEC456 pccmC
(W122A); 7, W, pEC471 pccmC (W123A); 8, V, pEC457 pccmC (DV124); 9, W, pEC451 pccmC (W125I); 10, D, pEC452 pccmC (D126A), 11,
A6, pEC477 pccmC (W119A/[W122-D126]A); 12, D5, pEC478 pccmC (W119A/D[W122-D126]); 13, H, pEC470 pccmC (H184A).
c maturation proteins of Gram-negative as well as of
Gram-positive bacteria, plant and protist mitochondria and
chloroplasts is the presence of at least one membrane
protein with several membrane-spanning segments that
contains a well-conserved, tryptophan-rich motif exposed
to the compartment where the mature c-type cytochromes
reside. In E. coli, the three CcmC, CcmF and NrfE
proteins of this type have been shown to be required
for attachment of haem to CcmE, to the CXXCH haembinding site of c-type cytochromes and to the unusual
CWSCK haem-binding site of NrfA respectively (ThoÈnyMeyer, 1997; Eaves et al., 1998; Schulz et al., 1999). It
has been proposed previously that the tryptophan-rich
motif forms a hydrophobic platform for haem binding and
that two conserved histidines in neighbouring periplasmic
loops are axial ligands of the haem iron (ThoÈny-Meyer
et al., 1994; Goldman et al., 1998; Xie and Merchant,
1998).
The role of CcmC in the cytochrome c biogenesis
pathway was dissected in this work by analysing the
ability of CcmC to attach haem covalently to CcmE. A
minimal system consisting of CcmC and CcmE was used
to study the effect of small changes within the tryptophanrich motif of CcmC. Point mutations in the non-conserved
residues T121 and W122 had no effect on the ability of
CcmC to attach haem to CcmE. In contrast, mutants in
the strictly conserved CcmC residues (W119A, G120A,
W123A, DV124, W125I and D126A) were no longer able
to attach haem to CcmE, demonstrating that these
residues were critical for the activity of CcmC. These
findings support the idea of a hydrophobic surface in
CcmC on the periplasmic side of the membrane that may
be used for binding of haem and presenting it to CcmE.
Earlier attempts to identify essential residues in the
CcmC homologues of R. capsulatus and P. fluorescens
have not led to a clear picture of how much the
tryptophan-rich motif is involved in haem trafficking during
cytochrome c maturation. For example, the R. capsulatus
HelC derivatives W117L, G118A and D124E (see Fig. 1)
were functional in anaerobic photosynthetic growth that
requires mature c-type cytochromes (Goldman et al.,
1998), whereas the P. fluorescens mutants W126I and
D127A were fully or partially defective in cytochrome c
maturation
Fig. 5. Influence of ccmD expression on the
activity of ccmC point mutants. The DccmC
mutant EC28 was co-transformed with
plasmids expressing genes encoding different
CcmC point mutants and with a plasmid
expressing either ccmE (±ccmD) or ccmDE
(1ccmD). E. coli cells were grown
anaerobically in the presence of TMAO.
A. Membrane proteins (100 mg) were
separated by 15% SDS±PAGE and stained
for covalently bound haem.
B. Immunoblot of identical membrane
fractions (20 mg) as in A probed with antiCcmE serum. vector, pACYC184; wt, ccmC
(wild type); DV124, ccmC (DV124); D126A,
ccmC (D126A).
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
Haem delivery during cytochrome c maturation 1385
(Gaballa et al., 1998). To compare our findings with those
mentioned above, we also tested our point mutants for
cytochrome c maturation. Interestingly, we found that in
the presence of other ccm genes, the ccmC mutants had
a less drastic phenotype, not only with respect to
cytochrome c maturation but also regarding haem attachment to CcmE. Unfortunately, the effect of mutated CcmC
polypeptide on cytochrome c formation cannot be tested in
the absence of other ccm genes because all ccm gene
products are essential for cytochrome c formation. However
both haem attachment and cytochrome c formation were
abolished when multiple changes or deletions of residues
within the tryptophan-rich motif were introduced.
We have observed previously that the small membrane
protein CcmD can affect the abundance of CcmE in
the membrane (Schulz et al., 1999). We suspected that
the presence or absence of CcmD may also influence the
effect of single base mutations in ccmC. In fact, the
defective phenotype of these mutants could be partially
complemented by expression of ccmD from a plasmid.
This finding strongly suggests that CcmC and CcmD
interact with each other in the membrane. Moreover, it
explains the wild-type phenotype of the R. capsulatus HelC
point mutants because in the R. capsulatus experiments
the CcmD homologue HelD was always present.
We have tried to fit our findings into a model that
predicts the interaction of the transmembrane segments
and periplasmic domains of CcmC, CcmD and CcmE.
CcmC is believed to assemble in the membrane such that
the tryptophan-rich motif between helices III and IV
resides on the surface of the periplasmic side of the
membrane and interacts with one of the hydrophobic
faces of haem. The two histidines of CcmC in the
periplasmic loops I and II and V and VI would help to
position haem correctly by liganding the central haem
iron. At least one of the vinyl groups is exposed to the
surface, where it might bind to H130 in the periplasmic
domain of CcmE. CcmD is embedded in the membrane
making contact with both CcmC and CcmE because its
presence reinforces the function of the tryptophan-rich
motif and enhances the levels of CcmE polypeptide in the
membrane. Our model, although still highly speculative, is
in agreement with the current knowledge on the haem
delivery pathway of cytochrome c biogenesis in Gramnegative bacteria and serves as a basis to understand
better the mechanisms of haem transfer between proteins.
Experimental procedures
Growth conditions
E. coli cells were grown at 308C in Luria±Bertani medium
(Sambrook et al., 1989) either aerobically or anaerobically
with 10 mM TMAO as electron acceptor. For analysis of
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
periplasmic c-type cytochromes, cells were grown anaerobically at 308C in minimal salts medium (Iobbi-Nivol et al.,
1994) supplemented with 0.4% glycerol, 40 mM fumarate
and 5 mM nitrite as electron acceptors. Antibiotics were
added at the following final concentrations: ampicillin,
100 mg ml21; chloramphenicol, 10 mg ml21; kanamycin,
50 mg ml21. For the expression of cycA, which encodes B.
japonicum cytochrome c550, cells were grown to midexponential phase and then induced with 0.1% arabinose.
Construction of plasmids and site-directed mutagenesis
E. coli strain DH5a was used as host for cloning (Hanahan,
1983). Plasmid pEC99 (Table 1) contains a 1190 bp ccmCD
AflII±SspI fragment cloned into the EcoRV site of the
tetracycline resistance gene of pACYC184 (Chang and
Cohen, 1978) in the same orientation as the resistance
gene. For the construction of pEC439, which only contains
ccmC, the 470 bp BglI±BamHI fragment of pEC422 was
ligated to the 2.9 kb BglI±BclI fragment of pEC99. In pEC86,
the whole ccmABCDEFGH gene cluster is expressed from
the tet promoter of pACYC184 (Arslan et al., 1998). To
construct plasmids expressing ccmE (pEC458) and ccmDE
(pEC459) from the tet promoter of pBR322, a 998 bp FspI±
BamHI fragment or a 1.65 kb MscI±BamHI fragment of
pEC86, respectively, were cloned into a 4.17 kb EcoRV±
BamHI fragment of pBR322.
Point mutations W119A, G120A, T121A, W122A, DV124,
W125I and D126A of CcmC were constructed following the
`Quick change' protocol (Stratagene Europe), leading to
plasmids pEC450, pEC454, pEC455, pEC456, pEC457,
pEC451 and pEC452 respectively. The high-performance
liquid chromatography (HPLC)-purified forward and reversed
primers (Microsynth) listed in Table 2 were used. Plasmid
pEC439 was used as the template.
The point mutation W123A was constructed using PCRmediated mutagenesis. Vent polymerase (New England
Biolabs) was used for all PCR reactions. A 400 bp fragment
was amplified using primers ccmCW123A and ccmCC, and
plasmid pEC86 served as template. The amplified fragment
was then used as a primer together with primer ccmCN for a
second PCR of ccmC, using plasmid pEC86 as the template.
This resulted in a 745 bp DNA fragment. The product was
cleaved with BamHI and EcoRI and ligated into a 2.7 kb
BamHI±EcoRI-digested pUCBM20 (Roche Diagnostics)
fragment, resulting in plasmid pEC449. For the construction
of pEC453, the 520 bp NsiI±EcoRI wild-type ccmC fragment
of pEC422 was replaced with the 520 bp NsiI±EcoRI W123A
mutant ccmC fragment of pEC449. To express the W123A
and the H184A mutations from the tet promoter of
pACYC184, plasmids pEC453 and pEC436 were digested
with NsiI and SspI. The 715 bp ccmC fragments were ligated
into a 3.55 kb NsiI±NruI-digested fragment of pEC99, resulting
in plasmids pEC466 and pEC465 respectively. After digestion
with BglI, the 850 bp fragments of pEC466 and pEC465 were
ligated into a 3.78 kb BglI fragment of pEC99, resulting in
plasmids pEC471 and pEC470 respectively.
The plasmids pEC477 expressing ccmC W119A/[W122±
D126]A and pEC478 expressing ccmC W119A/[DW122±
D126] were constructed by PCR mutagenesis. Primers
ccmCAla5 and ccmCWmotif were used together with primer
1386 H. Schulz, E. C. Pellicioli and L. ThoÈny-Meyer
Table1. Strains and plasmids used in this work
Strains
Relevant genotype/resistance
Reference
DH5a
MC1061
EC06
EC28
Plasmids
pEC86
pEC99
pEC422
pEC436
pEC439
pEC449
pEC450
pEC451
pEC452
pEC453
pEC454
pEC455
pEC456
pEC457
pEC458
pEC459
pEC465
pEC466
pEC470
pEC471
pEC477
pEC478
pEC483
pEC484
pEC486
pEC487
pRJ3291
supE44 DlacU169 (F80lacZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1
hsdR mcrB araD139 D(araABC-leu)7679DlacX74 galU galK rpsL thi
DccmA-H derivative of MC1061; KmR
DccmC derivative of MC1061
Hanahan (1983)
Meissner et al. (1987)
ThoÈny-Meyer et al. (1995)
Throne-Holst et al. (1997)
ccmABCDEFGH cloned into pACYC184; CmR
ccmCD cloned into pACYC184; CmR
H6-ccmC cloned into pISC-3, ApR
H6-ccmCH184A cloned into pISC-3, ApR
ccmC cloned into pACYC184; CmR
ccmCW123A cloned into pUCBM20, ApR
ccmCW119A cloned into pACYC184; CmR
ccmCW125I cloned into pACYC184; CmR
ccmCD126A cloned into pACYC184; CmR
H6-ccmCW123A cloned into pISC-3, ApR
ccmCG120A cloned into pACYC184; CmR
ccmCT121A cloned into pACYC184; CmR
ccmCW122A cloned into pACYC184; CmR
ccmCDV124 cloned into pACYC184; CmR
ccmE cloned into pBR322; ApR
ccmDE cloned into pBR322; ApR
ccmC 0 H184A cloned into pACYC184; CmR
ccmC 0 W123A cloned into pACYC184; CmR
ccmCH184A cloned into pACYC184; CmR
ccmCW123A cloned into pACYC184; CmR
ccmCW119A,W122±D126A cloned into pACYC184; CmR
ccmCW119A, DW122±D126 cloned into pACYC184; CmR
H6-ccmC 0 cloned into pACYC184; CmR
H6-ccmC 0 W119A,W122±D126A cloned into pACYC184; CmR
H6-ccm cloned into pACYC184; CmR
H6-ccmCW119A,W122±D126A cloned into pACYC184; CmR
B. japonicum cycA cloned into pISC-2; KmR
Arslan et al. (1998)
This work
Schulz et al. (1999)
Schulz et al. (1999)
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
Schulz et al. (1999)
Table 2. Nucleotide sequences of primers used
for the construction of point mutations in ccmC
and for DNA sequencing.
Primer
Nucleotide sequence (5 0 23 0 )
ccmCW119A/KpnIf
ccmCW119A/KpnIr
ccmCG120Af
ccmCG120Ar
ccmCT121A/EheIf
ccmCT121A/EheIr
ccmCW122A/KpnIf
ccmCW122A/KpnIr
ccmCV124D/KpnIf
ccmCV124D/KpnIr
ccmCW125I/ClaIf
ccmCW125I/ClaIr
ccmCD126A/KpnIf
ccmCD126A/KpnIr
ccmCW123A
ccmCAla5
ccmC-Wmotif
ccmC15854±872
ccmCN
ccmCC
ccmCH6BclI
pACYC3961±3941
GCATGGGGAAAACCGATGGCGGGTACCTGGTGGGTATGGG
CCCATACCCACCAGGTACCCGCCATCGGTTTTCCCCATGC
GGGAAAACCGATGTGGGCCACCTGGTGGGTATGGGATGC
GCATCCCATACCCACCAGGTGGCCCACATCGGTTTTCCC
GGGAAAACCGATGTGGGGCGCCTGGTGGGTATGGGATGC
GCATCCCATACCCACCAGGCGCCCCACATCGGTTTTCCC
GGGAAAACCGATGTGGGGTACCGCGTGGGTATGGGATGC
GCATCCCATACCCACGCGGTACCCCACATCGGTTTTCCC
GGAAAACCGATGTGGGGTACCTGGTGGTGGGATGCACGTCTG
CAGACGTGCATCCCACCACCAGGTACCCCACATCGGTTTTCC
GGCACCTGGTGGGTAATCGATGCACGTCTGACTTCTGAACTGG
CCAGTTCAGAAGTCAGACGTGCATCGATTACCCACCAGGTGCC
CCGATGTGGGGTACCTGGTGGGTATGGGCTGCACGTCTGACTTC
GAAGTCAGACGTGCAGCCCATACCCACCAGGTACCCCACATCGG
GCACCTGGGCGGTATGGGATGC
CTCGGTACCGCGGCGGCGGCGGCTGCACGTCTGACTTCTGAACTG
CTCGGTACCGCACGTCTGACTTCTGAACTGG
GGCTGGTTTATACCGTGGC
CGGGATCCATATGTGGAAAACACTGC
CGGAATTCTCATTTACGGCCTCTTTTCAG
CCTGATCAGTGGTGGTGGTGGTGGTGTTTACGGCCTCTTTTCAG
CCCCCGTTTTCACCATGGGC
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
Haem delivery during cytochrome c maturation 1387
pACYC3961±3941; pEC439 served as template. The amplified fragments were cleaved with NcoI and KpnI to give
780 bp DNA fragments, which were ligated into a 2.6 kb
NcoI±KpnI fragment of pEC450, resulting in plasmids
pEC477 and pEC478 respectively.
For the construction of a histidine tag at the C-terminus of
CcmC, primers ccmCH6BclI and ccmC15854±872 were
used. Plasmids pEC439 (ccmC wild type) and pEC477
(ccmC W119A/[W122±D126]A) were used as templates for
the PCR reaction. The amplified fragments were digested
with BclI and NsiI. The resulting 540 bp fragments were
ligated into the 2.84 kb BclI±NsiI fragment of pEC471 to give
plasmids pEC483 (ccmC 0 wild type) and pEC484 (ccmC 0
W119A/[W122±D126]A). The 870 bp BglI±NcoI fragments
of these plasmids were ligated into a 2.5 kb BglI±NcoI
fragment of pEC439. The final plasmids pEC486 and
pEC487 expressed C-terminally histidine-tagged versions of
wild-type CcmC and W119A/[W122±D126A] CcmC.
All mutations and PCR products were confirmed by DNA
sequencing using an ABI Prism 310 Genetic Analyzer (Perkin
Elmer).
Laboratories). The antiserum was preadsorbed with acetone
powder prepared from E. coli (EC28) DccmC. Antibodies
against CcmE have been described previously (Schulz et al.,
1998). Signals were detected using goat anti-rabbit IgG
alkaline phosphatase conjugate (Bio-Rad) as secondary
antibody and 3-{4-methoxyspiro[1,2-dioxetan-3,2 0 -(5 0 chloro)
tricyclo(3.3.1.13,7)decan]-4-yl} phenyl-phosphate (CSPD)
(Roche Diagnostics) as substrate. Immunoblot analysis
against the histidine-tagged versions of CcmC was performed using monoclonal penta-His antibodies (Qiagen).
Signals were detected using goat anti-mouse IgG alkaline
phosphatase conjugate (Bio-Rad) as secondary antibody and
CSPD as substrate.
Fractionation of E. coli cells
References
Periplasmic fractions of 500 ml anaerobically grown cultures
were isolated by treatment with polymyxin B sulphate (Fluka).
The cells were harvested by centrifugation at 4000 g, washed
in cold 50 mM tris-HCl, pH 8.0, and resuspended (2 ml g21
wet cells) in cold extraction buffer (1 mg ml21 polymyxin B
sulphate, 20 mM tris-HCl, 500 mM NaCl, 10 mM EDTA,
pH 8.0). The suspension was stirred for 60 min at 48C and
centrifuged at 40 000 g for 20 min at 48C. The supernatant
contained the periplasmic fraction.
Membrane fractions of 250 ml aerobically or 500 ml
anaerobically grown cultures were prepared as follows. The
cells were harvested by centrifugation at 4000 g, washed in
cold 50 mM tris-HCl, pH 8.0, resuspended in 3 ml cold
50 mM tris-HCl, pH 8.0 containing 10 mg ml21 desoxyribonuclease I and passed twice through a French pressure cell
at 110 MPa. Cell debris was separated by centrifugation at
40 000 g for 20 min at 48C. The supernatant was subjected
to ultracentrifugation at 140 000 g for 60 min at 48C. The
membrane fraction was washed once with 1 ml cold 50 mM
tris-HCl, pH 8.0, buffer and resuspended in 200 ml of the
same buffer.
Andersson, S.G., Zomorodipour, A., Andersson, J.O.,
Sicheritz-Ponten, T., Alsmark, U.C., Podowski, R.M., et al.
(1998) The genome sequence of Rickettsia prowazekii and
the origin of mitochondria. Nature 396: 133±140.
Arslan, E., Schulz, H., Zufferey, R., KuÈnzler, P., and ThoÈnyMeyer, L. (1998) Overproduction of the Bradyrhizobium
japonicum c-type cytochrome subunits of the cbb3-type
oxidase in Escherichia coli. Biochem Biophys Res Commun 251: 744±747.
Beckman, D.L., Trawick, D.R., and Kranz, R.G. (1992)
Bacterial cytochromes c biogenesis. Genes Dev 6: 268±
283.
Chang, A.C.Y., and Cohen, S.H. (1978) Construction and
characterization of amplifiable multicopy DNA cloning
vehicles derived from the P15A cryptic miniplasmid. J
Bacteriol 134: 1141±1156.
Chen, Z.Y., and Moroney, J.V. (1995) Identification of a
Chlamydomonas reinhardtii chloroplast gene with significant homology to bacterial genes involved in cytochrome c
biosynthesis. Plant Physiol 108: 843±844.
Cook, G.M., and Poole, R.K. (2000) Oxidase and periplasmic
cytochrome assembly in Escherichia coli K-12: CydDC and
CcmAB are not required for haem-membrane association.
Microbiology 146: 527±536.
Eaves, D.J., Grove, J., Staudenmann, W., James, P., Poole,
R.K., White, S.A., et al. (1998) Involvement of products of
the nrfEFG genes in the covalent attachment of haem c to
a novel cysteine±lysine motif in the cytochrome c552 nitrite
reductase from Escherichia coli. Mol Microbiol 28: 205±
216.
Fleischmann, R.D., Adams, M.D., White, O., Clayton, R.A.,
Kirkness, E.F., Kerlavage, A.R., et al. (1995) Wholegenome random sequencing and assembly of Haemophilus influenzae. Science 28: 496±512.
Gaballa, A., Koedam, N., and Cornelis, P. (1996) A
cytochrome c biogenesis gene involved in pyoverdine
Biochemical methods
Protein concentrations of periplasmic and membrane proteins were determined using the Bradford assay (Bio-Rad).
Haem staining of proteins separated by SDS±PAGE was
carried out using o-dianisidine (Sigma) as substrate. The gel
was incubated for 10 min in 10% TCA. After extensive
washing with water, the gel was stained using 20 mg of odianisidine dissolved in 20 ml of 50 mM trisodium citrate,
pH 4.4, 0.7% hydrogen peroxide.
Immunoblot analysis was performed using antiserum
directed against three synthetic peptides of CcmC (CcmC1,
KTLHQLAIPPRLYQIC; CcmC2, CNTLHQGSTRMQQSID;
CcmC3, CEKRRPWVSELILKRGRK) (purchased from Tana
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388
Acknowledgements
We thank E. Furter-Graves for critical comments on the
manuscript. This work was supported by grants from the
Swiss National Foundation for Scientific Research and from
the ETH.
1388 H. Schulz, E. C. Pellicioli and L. ThoÈny-Meyer
production in Pseudomonas fluorescens ATCC 17400. Mol
Microbiol 21: 777±785.
Gaballa, A., Baysse, C., Koedam, N., Muyldermans, S., and
Cornelis, P. (1998) Different residues in periplasmic
domains of the CcmC inner membrane protein of Pseudomonas fluorescens ATCC 17400 are critical for cytochrome
c biogenesis and pyoverdine-mediated iron uptake. Mol
Microbiol 30: 547±555.
Goldman, B., Beck, D.L., Monika, E.M., and Kranz, R.G.
(1998) Transmembrane heme delivery systems. Proc Natl
Acad Sci USA 95: 5003±5008.
Grove, J., Tanapongpipat, S., Thomas, G., Griffiths, L.,
Crooke, H., and Cole, J. (1996a) Escherichia coli K-12
genes essential for the synthesis of c-type cytochromes
and a third nitrate reductase located in the periplasm. Mol
Microbiol 19: 467±481.
Grove, J., Busby, S., and Cole, J. (1996b) The role of the
genes nrfEFG and ccmFH in cytochrome c biosynthesis in
Escherichia coli. Mol Gen Genet 252: 332±341.
Hanahan, D. (1983) Studies on transformation of Escherichia
coli with plasmids. J Mol Biol 166: 557±563.
Iobbi-Nivol, C., Crooke, H., Griffith, L., Grove, J., Hussain, H.,
Pommier, J., et al. (1994) A reassessment of the range of
c-type cytochromes synthesized by Escherichia coli K-12.
FEMS Microbiol Lett 119: 89±94.
Kranz, R., Lill, R., Goldman, B., Bonnard, G., and Merchant,
S. (1998) Molecular mechanisms of cytochrome c biogenesis: three distinct systems. Mol Microbiol 29: 383±
396.
Lang, B.F., Burger, G., O'Kelly, C.J., Cedergren, R., Golding,
G.B., Lemieux, C., et al. (1997) An ancestral mitochondrial
DNA resembling a eubacterial genome in miniature. Nature
387: 493±497.
Marienfeld, J., Unseld, M., Brandt, P., and Brennicke, A.
(1996) Genomic recombination of the mitochondrial atp6
gene in Arabidopsis thaliana at the protein processing site
creates two different presequences. DNA Res 3: 287±290.
Meissner, P.S., Sisk, W.P., and Bergman, M.L. (1987)
Bacteriophage lambda cloning system for the construction
of directional cDNA libraries. Proc Natl Acad Sci USA 84:
4171±4175.
Moeck, G.S., and Coulton, J.W. (1998) TonB-dependent iron
acquisition: mechanisms of siderophore-mediated active
transport. Mol Microbiol 28: 675±681.
Page, D.M., and Ferguson, S.J. (1999) Mutational analysis of
the Paracoccus denitrificans c-type cytochrome biosynthetic genes ccmABCDG: disruption of ccmC has distinct
effects suggesting a role for CcmC independent of CcmAB.
Microbiology 145: 3047±3057.
Page, D.M., Pearce, D.A., Norris, H.A., and Ferguson, S.J.
(1997) The Paracoccus denitrificans ccmA, B and C genes:
cloning and sequencing, and analysis of the potential of
their products to form a haem or apo-c-type cytochrome
transporter. Microbiology 143: 563±576.
Potter, L.C., and Cole, J.A. (1999) Essential roles for the
products of the napABCD genes, but not napFGH, in
periplasmic nitrate reduction by Escherichia coli K-12.
Biochem J 344: 69±76.
Pujol, C.J., and Kado, C.I. (2000) Genetic and biochemical
characterization of the pathway in Pantoea citrea leading to
pink disease of pineapple. J Bacteriol 182: 2230±2237.
Ramseier, T.M., Winteler, H.V., and Hennecke, H. (1991)
Discovery and sequence analysis of bacterial genes
involved in the biogenesis of c-type cytochromes. J Biol
Chem 266: 7793±7803.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989)
Molecular Cloning: a Laboratory Manual, 2nd edn. Cold
Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Schulz, H., Hennecke, H., and ThoÈny-Meyer, L. (1998)
Prototype of a heme chaperone essential for cytochrome
c maturation. Science 281: 1197±1200.
Schulz, H., Fabianek, R.A., Pellicioli, E.C., Hennecke, H., and
ThoÈny-Meyer, L. (1999) Heme transfer to the heme
chaperone CcmE during cytochrome c maturation requires
the CcmC protein, which may function independently of the
ABC-transporter CcmAB. Proc Natl Acad Sci USA 96:
6462±6467.
ThoÈny-Meyer, L. (1997) Biogenesis of respiratory cytochromes in bacteria. Microbiol Mol Biol Rev 61: 337±376.
ThoÈny-Meyer, L., Ritz, D., and Hennecke, H. (1994) Cytochrome c maturation in bacteria: a possible pathway begins
to emerge. Mol Microbiol 12: 1±9.
ThoÈny-Meyer, L., Fischer, F., KuÈnzler, P., Ritz, D., and
Hennecke, H. (1995) Escherichia coli genes required for
cytochrome c maturation. J Bacteriol 177: 4321±4326.
Throne-Holst, M., ThoÈny-Meyer, L., and Hederstedt, L.
(1997) Escherichia coli ccm in-frame deletion mutants
can produce cytochrome b, but not cytochrome c. FEBS
Lett 410: 351±355.
Wandersman, C., and Stojiljkovic, I. (2000) Bacterial heme
sources: the role of heme, hemoprotein receptors and
hemophores. Curr Opinion Microbiol 3: 215±220.
Xie, Z., and Merchant, S. (1996) The plastid-encoded ccsA
gene is required for heme attachment to chloroplast c-type
cytochromes. J Biol Chem 271: 4632±4639.
Xie, Z., and Merchant, S. (1998) A novel pathway for
cytochromes c biogenesis in chloroplasts. Biochim Biophys
Acta 10: 309±318.
Q 2000 Blackwell Science Ltd, Molecular Microbiology, 37, 1379±1388