Neurobiology of Disease 63 (2014) 48–61
Contents lists available at ScienceDirect
Neurobiology of Disease
journal homepage: www.elsevier.com/locate/ynbdi
Drosophila Myc, a novel modifier suppresses the poly(Q) toxicity by
modulating the level of CREB binding protein and histone acetylation
M. Dhruba Singh, Kritika Raj, Surajit Sarkar ⁎
Department of Genetics, University of Delhi, South Campus, Benito Juarez Road, New Delhi 110 021, India
a r t i c l e
i n f o
Article history:
Received 7 August 2013
Revised 6 November 2013
Accepted 19 November 2013
Available online 27 November 2013
Keywords:
Polyglutamine [poly(Q)] disorders
Neurodegeneration
Inclusion bodies
Drosophila
Myc
CBP
Histone acetylation
a b s t r a c t
Polyglutamine or poly(Q) disorders are dominantly inherited neurodegenerative diseases characterised by
progressive loss of neurons in cerebellum, basal ganglia and cortex in adult human brain. Overexpression of
human form of mutant SCA3 protein with 78 poly(Q) repeats leads to the formation of inclusion bodies and
increases the cellular toxicity in Drosophila eye. The present study was directed to identify a genetic modifier
of poly(Q) diseases that could be utilised as a potential drug target. The initial screening process was influenced
by the fact of lower prevalence of cancer among patients suffering with poly(Q) disorders which appears to be
related to the intrinsic biological factors. We investigated if Drosophila Myc (a homologue of human cMyc
proto-oncogene) harbours intrinsic property of suppressing cellular toxicity induced by an abnormally long
stretch of poly(Q). We show for the first time that targeted overexpression of Drosophila Myc (dMyc) mitigates
the poly(Q) toxicity in eye and nervous systems. Upregulation of dMyc results in a significant reduction in
accumulation of inclusion bodies with residual poly(Q) aggregates localising into cytoplasm. We demonstrate
that dMyc mediated suppression of poly(Q) toxicity is achieved by alleviating the cellular level of CBP and
improved histone acetylation, resulting restoration of transcriptional machinery which are otherwise abbreviated due to poly(Q) disease conditions. Moreover, our study also provides a rational justification of the enigma of
poly(Q) patients showing resistance to the predisposition of cancer.
© 2013 Elsevier Inc. All rights reserved.
Introduction
The poly(Q) repeat disorders are used to describe abnormal expansion of poly(CAG) tracts in a gene that leads to the expression of the
pathogenic protein with unusually long extended poly(Q) stretch,
which in turn could dramatically modify the functional characteristics
of the protein. This condition is associated with several human hereditary neurodegenerative disorders such as Huntington's disease (HD), 6
different forms of Spinocerebellar ataxias (1, 2, 3, 6, 7 and 17), Spinal
and bulbar muscular atrophy (Kennedy's disease) and Dentatorubralpallildoluysian atrophy (Everett and Wood, 2004). A remarkable and
intriguing feature of poly(Q) disorders include their selective pattern
of neuronal degeneration in different forms of the diseases (Landes
and Bates, 2004). For instance, in HD the cortical and basal ganglia are
highly affected whereas in Spinocerebellar ataxia type 3, Purkinje cells
in cerebellum are mostly affected (Landes and Bates, 2004; Paulson,
2012). Interestingly, most of these disorders are dominantly inherited
and exhibit a set of overlapping phenotypes: late adult onset, formation
of protein aggregates and progressive degeneration of vulnerable
subsets of neurons.
⁎ Corresponding author. Fax: +91 11 2411 2761.
E-mail address: sarkar@south.du.ac.in (S. Sarkar).
Available online on ScienceDirect (www.sciencedirect.com).
0969-9961/$ – see front matter © 2013 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.nbd.2013.11.015
Among different forms of poly(Q) diseases, Spinocerebellar ataxia
represents a subgroup and Spinocerebellar ataxia type 3 (SCA3) or
Machado Joseph disease (MJD) being the most common form. In
polyglutamine disorders the poly(Q) repeats within the coding region
of protein elicit accumulation of mutant polypeptides in the form of
insoluble aggregates (nuclear inclusions or inclusion bodies) in nuclei
of affected neurons causing toxic gain of function (DiFiglia et al., 1997;
Landes and Bates, 2004). Subsequently, the nuclear inclusion bodies sequester endogenous proteins involved in proteosomal system, protein
folding machinery and key transcription factors, which ultimately lead
to neuronal dysfunction and activation of initiator and effector caspases
causing apoptosis (Chen et al., 2000; Lin et al., 2000; Saudou et al., 1998;
Tsoi et al., 2012). One of the striking features of poly(Q) diseases includes impaired cellular transcription machinery as several key transcription factors such as TATA binding protein (TBP), CREB binding
protein (CBP), TBP-associated factor (TAFII130) and Specificity factor
(SP1) are sequestered by poly(Q) aggregates (Dunah et al., 2002;
McCampbell et al., 2000; Nucifora et al., 2001; Perez et al., 1998;
Shimohata et al., 2000; Taylor et al., 2003). Sequestration of histone acetyltransferases by inclusion bodies has been implicated as one of the
leading factors for neurodegeneration and cellular toxicity in poly(Q)
mediated diseases (McCampbell et al., 2000; Nucifora et al., 2001;
Taylor et al., 2003). Subsequently, cell–cell communications and stringency of signalling pathways are also severely impaired due to
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
increasing load of misfolded proteins in axonal compartments
(Gunawardena and Goldstein, 2001; Seidel et al., 2010).
In order to decipher the disease pathogenicity and to design remedial strategies, the cellular and molecular mechanism(s) operating the
neuronal degeneration have been extensively investigated. Although
the precise role of poly(Q) aggregates in disease pathogenesis is still
enigmatic, it is increasingly clear now that the pathogenic effect of
poly(Q) aggregates could be altered in vivo in model systems such as
C. elegans, Drosophila and mouse. Modelling of human neurodegenerative disorders in model organisms not only provided an opportunity
to study the mechanistic details of the disease progression but also
facilitated in identification of several genetic modifiers which could
dominantly mitigate the toxic effects of poly(Q) aggregates (Lu and
Vogel, 2009). Heat shock factor (Hsf), Myocyte enhancer factor 2
(Mef2), TBP-associated Factor 10 (Taf10), Debra (dbr), Drosophila myeloid leukaemia factor 1 (dmlf), CREB Binding Protein (CBP), Histone
deacetylase 6 (HDAC6), SUMO (smt3), Heat shock protein 70 (Hsp70),
DIAP1 (thread), and p53 are some of the examples of genetic modifiers
of poly(Q) toxicity (Reviewed by Mallik and Lakhotia, 2010a). Interestingly, majority of the genetic modifiers of poly(Q) disorders could be
classified in subgroups such as components of protein folding and degradation machinery, gene expression and programmed cell death etc.
(Bonini, 1999; Branco et al., 2008; Chan et al., 2002; Ghosh and Feany,
2004; Warrick et al., 1999). In this context, it is important to note that
mammalian model systems are relatively challenging to be utilised for
modifier screening due to their complex genetic background and
environment.
The present study was directed to identify novel genetic modifiers
that suppress the poly(Q) induced cellular toxicity and could provide
a potential target for designing and testing therapeutic strategies. The
preliminary screening was influenced by the fact of lower prevalence
of cancer among patients suffering with neurodegenerative disorders
which appears to be related to intrinsic biological factors (Ji et al.,
2012; Sorensen et al., 1999). We identified dMyc (a homologue of
human c-Myc, a proto-oncogene) as a novel genetic modifier of SCA3
induced toxicity in Drosophila. Our findings suggest for the first time
that targeted overexpression of dMyc can significantly ameliorate progression of poly(Q) induced neurodegeneration and reduces formation
of inclusion bodies. We further report that enhanced expression of
dMyc increases cellular abundance of CBP and acetylated form of histone which collectively may induce chromatin remodelling and modulate global gene expression. Our studies suggest that protooncogenic
property of dMyc may harbour inherent capability of suppressing
neuro-degeneration caused by poly(Q) repeat disorder.
Material and methods
Drosophila stocks
The Drosophila stocks used in the experiments were reared in
cornmeal/agar/yeast media at 24 ± 1 °C. The wild type used in the
experiment was Oregon R+. The transgenic lines UAS-SCA3trQ78(S)
(Bonini, 1999), UAS-SCA3trQ78(W) (Warrick et al., 1999), GMR-Gal4
(Hay et al., 1994), UAS-DIAP1 (Bloomington Stock Centre, Indiana,
USA), Elav-Gal4 (Lin and Goodman, 1994), 201YGal4 (Yang et al.,
1995), UAS-dMyc (two lines with independent insertion on second
and third chromosome) (Johnston et al., 1999), UAS-eGFP-HttQ138mRFP (Weiss et al., 2012), UAS-CBP RNAi (Ludlam et al., 2002), UAS-CBP
FLAD (Kumar et al., 2004), and UAS-dMyc RNAi (Bloomington stock no.
25784) were either procured from Bloomington Drosophila stock centre,
Indiana, USA, or obtained from various laboratories as referred above.
Examination of adult eye
The images of adult eyes were captured by Canon G10 digital camera
attached with Zeiss Stemi 200-C stereo zoom binocular microscope. For
49
the evaluation of fluorescence of eGFP in adult eyes, heads from desired
genotypes were decapitated and mounted on glass slide and observed
immediately under an Olympus BX51 florescence microscope at equal
exposures.
Phototaxis and survival assay
Groups of nearly 20 flies were put into Y-Maze design to study the
phototaxis activity (Quinn et al., 1974). One side of Y-Maze was darkened by covering with thick black paper, while the other arm was
uncovered. A beam of light was allowed to shine over the transparent
side. After 20 s the flies in each arm were counted and scored for visibility. Phototaxis indices are calculated on the basis that 100% wild type
flies choose transparent arm of the Y-maze whereas the disease fly
will choose between dark and transparent side depending upon its visibility. About 100–200 flies were observed for each genotype to score
visibility. For the survivability test, the progenies of desired genotypes
at third instar larval stage were collected in milk bottles and allowed
to pupate. Total number of flies eclosing from the pupal case were
recorded and statistical analysis was performed. More than 500 pupae
were examined for each genotype.
Scanning electron microscopy (SEM)
Adult heads of desired genotype were decapitated in 1XPBS. The
tissues were fixed in 2.5% glutaraldehyde and 2% paraformaldehyde
at 4 °C for overnight. The tissues were dehydrated in acetone and
critically-dried. The heads were mounted on studs under stereo zoom
binocular microscope and coated with gold. Images were captured
using a Zeiss EVO40 scanning electron microscope.
Pseudopupil analysis
Pseudopupil analysis allows observation of photoreceptors arrangement of Drosophila eye (Franceschini, 1972). Each ommatidia show 7
photoreceptors clustered towards the centre of each ommatidia.
The adult heads of desired genotype were decapitated and mounted
on glass slide and observed under bright field 60 × oil objective of an
Olympus BX51 microscope.
Histology and immunohistochemistry
For Drosophila adult eye sectioning, two days old heads were decapitated and fixed in 4% paraformaldehyde for 20 min. The tissues were
dehydrated in alcohol and then in xylene. Xylene was completely removed by frequently changing the solution by molten wax. The tissues
were poured into moulds and the orientation of eyes was manipulated
with the help of a dissecting needle. The sections were cut at 15 μm
thickness using semi-automatic microtome (Thermo Scientific, USA).
Tissues were stained in 0.01% Toluidine blue solution (in 1XPBS) for
5 min. and mounted in DPX and observed under bright field microscope
(Olympus BX51).
For immunochemistry, the eye disc of third instar larvae or 55 h old
pupal eye disc or two days old adult brain was dissected in 1XPBS. The
tissues were fixed in 4% paraformaldehyde (15812-7, Sigma, USA) for
20 min. The tissues were washed with 1XPBST and incubated in
blocking solution for 2 h at room temperature. Later tissues were incubated in desired primary antibody or TRITC-Phalloidin (dilution 1:200
in 1XPBS, Sigma Aldrich, USA) overnight at 4 °C. The primary antibodies
were anti-HA (1:1000; Y11, Santa Cruz Biotechnology, USA), anti-dMyc
(1:1000; P4C4 B10) (Prober and Edgar, 2000), anti-Fasciclin ΙΙ (1: 100;
ID4, DSHB, USA), anti-cleaved-caspase-3 (1:1000; D175, Cell Signalling
Technology, USA), anti-HSP70 (1:500; 7Fb) (Chai et al., 1999), and antidCBP (1:600) (Lilja et al., 2003), anti-ace-H3K9 (1:1000; AH3-H20,
Abcam, USA), anti-Elav (1:400; 9F8A9, DSHB, USA), anti-disc large
(1:500; 4 F3, DSHB, USA) and anti-armadillo (1:400; N27A1, DSHB,
50
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
USA). Following day, tissues were washed 3 times in 1XPBST for 20 min
each and incubated in appropriate secondary antibody (1:200 dilution;
Molecular Probes, USA). The secondary probes were; Cy3 Goat antimouse (A10521), Cy3 goat anti-Rabbit (A10520), Alexa 488 goat antimouse (A10001), Alexa-488 goat anti-rabbit (A11008) and Alexa-488
goat anti-guinea pig (A11073). In some cases tissues were counterstained with DAPI (5 μg/ml, Roche Diagnostics, GmbH, Germany) and
mounted in prolong gold antifade mounting reagent (P36934, Molecular probes, USA). The images were captured either by Olympus BX51 or
BX53 fluorescence microscope using appropriate filters or Leica TCS SP5
II confocal microscope. Equal numbers of confocal optical section images were taken while constructing comparative merge images with
Leica application suite advanced fluorescence software. The pictures
were assembled using Adobe Photoshop CS5 software.
for 30 s, annealing step at 60 °C for 30 s and extension step at 72 °C
for 45 s. Equal amount of PCR products were visualised on 1% agarose
gel and the picture was acquired using Alpha imager HP.
In case of quantitative real time-PCR, amplification was performed
on a cDNA amount equivalent to 25 ng of total RNA with 1 × SYBR
Green universal PCR master mix (Applied Biosystems, USA) containing
deoxyribonucleotide triphosphates, MgCl2, AmpliTaq Gold DNA polymerase, and forward and reverse CBP primers as described above.
Each reaction was performed in triplicate on Applied Biosystems
7900HT fast real time sequence detection system (Applied Biosystems,
USA), and experimental Ct values were normalised to RP49 forward
5′-ATGCTAAGCTGTCGCACAA-3′ and reverse 5′- TTGTGCACCAGGAACT
TCTT-3′ primers. The data was subjected to ΔΔCt statistical analysis
and presented as mean ± standard deviation.
Bromouridine staining
Results
Drosophila third instar eye discs were dissected in 1XPBS. The
eye discs were incubated in 10 μM BrdU (Sigma, USA) in Schneider's
medium (Sigma, USA) at room temperature for one hour. Subsequently,
tissues were fixed in 4% paraformaldehyde and treated with 2 N HCl at
room temperature to denature the DNA. Tissues were then neutralised
using 100 mM borax solution and incubated in anti-BrdU antibody
(1:600; G3G4, DSHB, USA) for overnight at 4 °C. Tissues were then
incubated for two hours in appropriate secondary antibody (1:200).
The images were captured by Olympus BX51 or BX53 fluorescence microscope using appropriate filters.
Enhanced expression of dMyc suppresses poly(Q) toxicity in eye
Western blot
30 heads of 1 day old flies of desired genotypes were decapitated
and homogenised in RIPA buffer (50 mM Tris-Cl, 1% TritonX-100, 0.1%
SDS, 0.5% sodium deoxycholate, 150 mM NaCl, 10% Glycerol) supplemented with protease inhibitor cocktail to the final concentration of
1% (Sigma, USA). Concentration of protein was estimated by Bradford
method and 30 μg of total protein from each genotype was
mixed with equal volume of 2 × Laemni buffer (120 mM Tris-Cl, 10%
β-Mercaptoethanol, 4% SDS, 20% Glycerol, 1 mM PMSF and 0.02%
bromophenol blue) and loaded into polyacrylamide gel (12% resolving
and 4% stacking gel). The protein samples were transferred to nitrocellulose membrane (Millipore, USA) by wet transfer apparatus at 40 V for
overnight at 4 °C. The membrane was blocked in blocking buffer (cat no.
37570; Thermo Pierce, USA) and incubated in desired primary antibody
for overnight at 4 °C. The membrane was washed three times in 1XPBST
and incubated in appropriate secondary antibody for 2 h. The primary
antibody used was anti-HA (1:1000, Y-11, Santa Cruz Biotechnology,
USA). For loading control anti-α tubulin was used (1:1000; Cell
Signalling, USA). The Secondary antibody was Horseradish peroxidase
conjugated secondary antibody (1:1000, Merck, India). The blot was
developed using ECL detection kit (cat no. 32209, Thermo Pierce,
USA). Images were acquired in a Fujifilm imaging system (FLS-4000).
To investigate the role of dMyc in poly(Q) disease, we utilised a
Drosophila model of human SCA3 in which a truncated form of ataxia3 protein containing 78 CAG repeats with HA tag [SCA3tr78Q(S)] cloned
after yeast upstream activator system (UAS), and tissue specific expression of the transgene could be achieved by regulating the availability of
the Gal4 transcription factor in selective tissues (Bonini, 1999; Brand
and Perrimon, 1993; Chan et al., 2002; Warrick et al., 1999). Targeted
expression of SCA3tr78Q(S) [referred as UAS-78Q(S) in figures] in
Drosophila eye using GMR-Gal4 (Hay et al., 1994) (hereinafter referred
as UAS-SCA3trQ78(S)/GMR-Gal4) resulted in severe degeneration
(Bonini, 1999; Chan et al., 2002; Warrick et al., 1999). Compared to
wild type (Fig. 1A) or GMR-Gal4/+ (not shown) which gives normal appearance of eye, the degeneration in UAS-SCA3trQ78(S)/GMR-Gal4 flies
Semi quantitative reverse transcription PCR and quantitative real time-PCR
Total RNA from desired genotypes were isolated from 50 heads of
one day old Drosophila by TRIZOL reagent using manufactures protocol
(cat no. T9424, Sigma Aldrich, USA). cDNA was prepared from 3 μg
of total RNA using Oligo d(T)18 (cat no. S1316S, New Englands Biolabs,
UK) and 200 units of M-MuLV reverse transcriptase (cat no. M0253S,
New England Biolab, UK). The gene specific primers used in the
experiments were: CBP forward 5′-GCTGCGGCAAATCTTTTCTC-3′; CBP
reverse 5′-CCTGGATGGGCGCTAAACTA-3′ and control primers were,
GAPDH2 forward 5′-CAAGTTCGATTCGACCCACG-3′ and GAPDH2
reverse 5′ CCTTCAAGTGAGTGGATGCC 5′. The thermal programme
used for amplification of transcript includes initial denaturation step
of 95 °C for 5 min followed by 30 cycles of denaturation step at 94 °C
Fig. 1. GMR-Gal4 driven coexpression of dMyc suppresses poly(Q) induced neurodegeneration in Drosophila eye. (A–D) Picture of external surface of adult eye. (A) Wild type.
(B) Degeneration of eye surface and black necrotic patches is evident in UASSCA3trQ78(S)/GMR-Gal4. (C) Coexpression of dMyc restores the cellular degeneration
and roughening of eye surface. (D) RNAi mediated reduced expression of dMyc further enhances the severity of poly(Q) phenotypes and large necrotic patches are evident.
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
was prominent even on the 1st day of adult life (Fig. 1B). The affected
eyes exhibited loss of pigmentation, disrupted ommatidial arrangement, collapsed cellular architecture and irregular bristles lattice
(Fig. 1B). In many of the adult eyes, severely degenerated tissues formed
black necrotic lesions over the surface of the eyes (Fig. 1B). In agreement
with earlier reports (Warrick et al., 1999), retinal expression of
SCAtrQ27 did not develop any of the above phenotypes (not shown),
demonstrating that poly(Q) induced degeneration is length-dependent.
To investigate if targeted expression of Drosophila Myc (dMyc,
also known as dimunitive) can mitigate the poly(Q) induced toxicity,
we crossed UAS-SCA3trQ78(S)/GMR-Gal4 with UAS-dMyc in which
wild type dMyc expresses under UAS control. Earlier reports suggest
that targeted overexpression of dMyc results in 33% enlargement in
size of adult eye ommatidium in Drosophila (Secombe et al., 2007),
however, when a single copy of UAS-dMyc transgene was coexpressed
in Drosophila eye along with UAS-SCA3trQ78(S) (hereinafter
referred as UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc), the external eye
architecture and bristle arrangements were significantly restored
(Fig. 1C). Intriguingly, relative measurement of adult ommatidium
in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc flies showed only 7%
(N = 236 ommatidium) enlargement in size, compared to 33% enlargement as discussed earlier (Secombe et al., 2007). The pigments were
spread uniformly throughout the ommatidia which indicate lesser
pathogenicity (Fig. 1C). In addition, the necrotic patches which
were otherwise common in UAS-SCA3trQ78(S)/GMR-Gal4 genotype,
were rarely formed in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc flies
(N ≥ 500). Coexpression of UAS-GFP transgene with UAS-SCA3trQ78(S)/
GMR-Gal4 did not result in any phenotypic change (Fig. S1A; N = 86)
which excludes any possibility of the effect of two UAS transgene on
disease phenotype.
We further wanted to study the effect of the reduced expression of
dMyc in SCA3 trQ78(S) background; and intriguingly, an aggravated
level of degeneration was evident when cellular abundance of dMyc
was depleted by expressing a copy of UAS-dMyc RNAi in UASSCA3trQ78(S)/GMR-Gal4 flies (Fig. 1D). Large necrotic patches were evident on the eye surface in all such eclosing flies (N = 246) with complete loss of inner cellular mass and ommatidial structure on
subsequent days. We validated the UAS-dMyc driven poly(Q) rescue
event with two independent lines of UAS-dMyc transgenic on chromosome 2 and 3 respectively (Johnston et al., 1999). Both of the lines exhibited similar rescue proficiency when coexpressed independently
with UAS-SCA3trQ78(S). Surprisingly, coexpression of two copies of
UAS-dMyc resulted in somewhat similar or slightly improved morphology than the single dose of UAS-dMyc (not shown). We also wanted to
investigate if the modifier potency of dMyc is comparable with any
established modifier of poly(Q) disorder such as Drosophila inhibitor
of apoptosis (DIAP1) (Branco et al., 2008; Ghosh and Feany, 2004).
The selection of DIAP1 was influenced by its well-established universal
role in inhibition of apoptotic events in Drosophila (Hay et al., 1995). We
found that DIAP1 mediated modulation (single copy) of UASSCA3trQ78(S)/GMR-Gal4 toxicity resulted in lesser extent of rescue
than that of dMyc (single copy), indicating possibility of dMyc as a stronger suppresser of poly(Q) than DIAP1 (Fig. S1B).
The scanning electron microscopy of external eye surface revealed
that compared to the wild type adult eye which shows regular arrangement of ommatidia (Fig. 2A), external eye structure of UAS-SCA3trQ78(S)/
GMR-Gal4 was severely deformed and ommatidia are collapsed into
the brain as underlying structures were absent (Fig. 2B). Subsequently,
upregulation of dMyc showed significant improvement in external
eye morphology with distinct ommatidia and bristle arrangement
(Fig. 2C). To investigate the internal morphology of adult eyes, 15 μm
thick horizontal sections were prepared and stained with 0.01% Toluidine
blue stain. In agreement with earlier reports, compared to the wild type
(Fig. 2D) expression of SCA3trQ78(S) showed degeneration of internal
structure and the retinal portion was devoid of any tissue mass
(Fig. 2E). In contrast, coexpression of dMyc was found to suppress retinal
51
degeneration and improved internal structure of eyes (Fig. 2F) in 83% of
the cases (N = 200). Notably, improvement in internal eye structure remains evident through the Drosophila life span.
As reported earlier, poly(Q) mediated defects do not manifest in
third instar larval eye disc although aggregation of IB could be detected
(Bonini, 1999). It has been demonstrated that threshold level of
poly(Q) aggregates is achieved by the time of pupation, and progressive
disruption of cellular processes and degeneration takes place during the
pupal development (Bonini, 1999). Therefore, to understand the role of
dMyc in the modulation of the poly(Q) toxicity, morphological studies
were performed on developing pupal eyes. Drosophila eye is composed
of intricate structures containing around 600 ommatidia. Each ommatidium comprises twenty cells; 1 corneal cell, 2 primary cells, 3 secondary cells, 3 tertiary cells, 3 bristles and 8 rhabdomeres each having
photoreceptors towards the centre of ommatidia. The 8th rhabdomere
lies just below the 7th so it is not visible at the same focal plane
with other photoreceptors. To demonstrate whether upregulation of
dMyc reverses poly(Q) toxicity, 55 h old Drosophila pupal eyes were
examined by staining with various cellular markers.
Phalloidin is a marker of F-actin which stains the cellular boundary
as well as photoreceptor pigments at the centre of the ommatidia. In
wild type, trapezoid arrangement of seven rhabdomeres was observed
and individual ommatidia showed hexagonal structure (Fig. 2G). Abnormal development of rhabdomeres was observed due to expression
of SCA3trQ78(S) and ommatidia were found to arrange irregularly
with spaces between them (Fig. 2H). Coexpression of dMyc significantly
improved the ommatidial architecture and trapezoid arrangement of
rhabdomere was also restored (Fig. 2I). Subsequently, staining with
Elav demonstrated restoration of neuronal differentiation in rescued
flies [Compare Fig. S2A (wild type) and S2C] which was otherwise
collapsed in UAS-SCA3trQ78(S)/GMR-Gal4 flies (Fig. S2B). To further
investigate if the phenotypic improvement has been extended to
other areas of developing pupal eyes, staining with Disc large (Dlg; a
septate junction marker) and Armadillo (an adheran junction marker)
was performed. Compare to wild type (Fig. S2D, G), staining with
these markers revealed cellular degeneration and gross morphological
defects in primary, secondary and tertiary cells, cone cells and abnormal
bristle lattice in UAS-SCA3trQ78(S)/GMR-Gal4 flies (Fig. S2E, H). These
defects were almost completely suppressed following coexpression of
dMyc (Fig. S2F, I).
To ascertain that the overexpression of dMyc was indeed achieved in
the target tissues, eye discs of third instar larvae were stained with antibody specific to Drosophila Myc (Prober and Edgar, 2000). Staining
with wild type (Fig. 2J) and UAS-SCA3trQ78(S)/GMR-Gal4 (Fig. 2K)
exhibited basal level of expression throughout the disc area. Comparatively, a robust expression of dMyc confined to the posterior region of
morphogenetic furrow was evident in UAS-SCA3trQ78(S)/GMR-Gal4/
UAS-dMyc larval eye disc (Fig. 2L). Above result clearly demonstrated
that a robust expression of dMyc was indeed achieved in eye field
which might be driving the rescue event.
Functional rescue of poly(Q)-mediated toxicity by dMyc
The overexpression of SCA3 protein with expanded poly(Q) repeats
destroys the ommatidial arrangement and impairs the visibility in
Drosophila (Bonini, 1999; Chan et al., 2002; Warrick et al., 1999). In
spite of severity of the disease, dMyc restores the cellular architecture
and external morphology of the eye. Although substantial level of rescue
in external and internal eye architecture has been achieved due to overexpression of dMyc; as revealed by pseudopupil analysis, restoration of
photoreceptors in adult eyes was partial and only three or four photoreceptors were observed (data not shown). So we used a less toxic and
weaker form of SCA3 transgene, UAS-SCA3trQ78(W) (Warrick et al.,
1999) to substantiate our findings. Although GMR-Gal4 driven expression of weak form of UAS-SCA3trQ78(W) transgene did not exhibit any
visible external morphological defects immediately after eclosion,
52
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
Fig. 2. GMR-Gal4 driven coexpression of dMyc improves the external and internal cellular architectures in poly(Q) induced neurodegeneration in Drosophila eye. (A–C) SEM images taken
at 2000X to observe the external eye surface. (A) Wild type. (B) Disorganised ommatidial structure in UAS-SCA3trQ78(S)/GMR-Gal4. (C) Coexpression of dMyc prevents deformity in
external ommatidial arrangement restores bristle lattice. (D–F) Toluidine blue stained horizontal section of eye retina. (D) Wild type. (E) Retinal tissues are completely degenerated in
UAS-SCA3trQ78(S)/GMR-Gal4. (F) Coexpression of dMyc suppresses the retinal degeneration and inner tissue masses are now visible. (G–I) Confocal images of 55 h old pupal eye disc
stained with TRITC-Phalloidin. (G) Wild type shows hexagonal arrangement of ommatidia. (H) Formation and arrangement of ommatidial rhabdomeres are abnormal in UASSCA3trQ78(S)/GMR-Gal4. (I) Coexpression of dMyc improves the morphology and arrangement of ommatidial subunits. (J–L) Confocal pictures of eye discs stained with anti-dMyc. (J,
K) Basal level of dMyc expression is observed in wild type and UAS-SCA3trQ78(S)/GMR-Gal4. (L) Robust upregulation of dMyc is evident in eye disc by coexpression of UAS-dMyc transgene
in UAS-SCA3trQ78(S)/GMR-Gal4 background.
however, compare to wild type (Fig. S3A) or GMR-Gal4/+ (not shown),
pseudopupil analysis during subsequent days revealed exponential loss
of pigment and roughening of eye surface (Fig. S3B). Subsequently, in
contrast to the wild type of similar age (Fig. S3D), intact ommatidia
with 7 photoreceptors were rarely visible in 5 days old UASSCA3trQ78(W)/GMR-Gal4 flies and degenerating cellular masses were
witnessed with some ommatidia showing one or two rhabdomeres
(Fig. S3E). Flies coexpressing UAS-SCA3trQ78(W) and UAS-dMyc showed
restoration of ommatidial architecture and increase in the number of
photoreceptors (Fig. S3C, F; N = 100). The rescue was evident throughout the life span.
To investigate whether improvement in the external morphology of
eye corresponds to the restoration of functional vision, phototaxis assay
was performed on 2 days old adult flies (Quinn et al., 1974). The rationale behind the Y-maze phototaxis assay is that the flies with normal
vision will choose the illuminated arm of Y-maze whereas flies with
abnormal vision will choose randomly either the illuminated or the
dark arm of the Y-maze. In wild type, 95% flies (Fig. 3A; N = 184)
move towards illuminated chamber and only 5% move to dark chamber.
Expression of SCA3trQ78(W) in eyes compromised the functional vision
and flies moved randomly in light and dark chambers almost equally
(Fig. 3A; N = 247). Increase in positive phototaxis behaviour was
observed by coexpression of dMyc as 86% (N = 219) of flies choose
the light chamber over the dark chamber (Fig. 3A). This study confirmed
that dMyc not only restored the internal and external morphology of
eyes but also improved the functional vision.
dMyc mediated reduction of poly(Q) toxicity in nervous system
Polyglutamine disorders primarily affect different parts of human
brain tissues depending upon the type of disease. Although Drosophila
eye has been widely used as a model organ to study the poly(Q) pathogenicity and modifier screening, however, it is equally important to establish the modifier capacity of selected candidates by expressing them
in selective parts of nervous system and brain. Therefore, we asked
whether dMyc mediated suppression of SCA3 toxicity also extends to
rest of the nervous system and brain. We utilised two Gal4 drivers;
Elav-Gal4 which expresses in central and peripheral nervous system
pan neuronally, and 201Y-Gal4 which exclusively expresses in kenyon
cells of the mushroom body of Drosophila brain (Lin and Goodman,
1994; Yang et al., 1995). In agreement with the earlier report
(Warrick et al., 1999), targeted expression of SCA3trQ78(S) using ElavGal4 caused 100% lethality as pupal pharates (Fig. 3B; N = 614).
Coexpression of dMyc with SCA3trQ78(S) pan neuronally resulted in
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
partial but significant suppression of lethality. Following coexpression
of dMyc, 24% of flies (N = 563) eclosed as fully differentiated adult
with life span ranging between 20 and 30 days (Fig. 3B) with almost
normal behaviour during first 15 days and subsequently developed
mild paralytic phenotype. Remaining 76% developed as fully differentiated pupae, but were unable to eclose or die during eclosion.
Drosophila mushroom body is an associative brain structure homologous to hippocampus of the higher mammals and is essential for olfactory memory, learning and courtship behavioural responses. It is a
paired organ composed of kenyon cells and its axonal extensions namely 2α, 2β and 2γ lobes. We found that targeted expression of
SCA3trQ78(S) in neuronal subpopulation (kenyon cells) of mushroom
body resulted in substantial lethality at pupal stage (Fig. 3B, C1). Only
3.19% (N = 565) viable adult escapers eclosed and survived with the
maximum life span of 7–8 days (Fig. 3B, C2). Intriguingly, coexpression
53
of dMyc with SCA3trQ78(S) and 201Y-GAL4 increased the survival ratio
to 97.5% (Fig. 3B; N = 483) with a life span of 30–35 days showing normal behaviour. To examine the protective role of dMyc on poly(Q) toxicity, the morphology of the mushroom body in adult brains was
observed by staining with Fas II antibody. Compared to the size of
wild type mushroom body (Fig. 3D, G; average size = 405.33 ±
0.75 μm; N = 12), expression of SCA3trQ78(S) resulted in a significant
reduction in the size of α and β neuropiles of mushroom body in surviving SCA3trQ78(S)/201Y-Gal4 adults (Fig. 3E, G; average size = 284.00 ±
2.74 μm; N = 12). Moreover, overall intensity of Fas II staining was also
low compared to the wild type (compare Fig. 3D and E). The neuropile
of γ-lobe was poorly stained perhaps due to selective loss of neuronal
counterpart in the kenyon cells. Our staining experiments clearly demonstrated that the overall size of the mushroom body along with α and
β lobes were substantially restored by coexpression of dMyc (Fig. 2F, G;
Fig. 3. Upregulation of dMyc improves vision and prevents poly(Q) mediated brain degeneration: (A) poly(Q) induced impaired vision is alleviated by coexpression of dMyc. Bars in
histograms represent mean value (±SD) of either positively or negatively phototaxis flies (B) Pupal lethality mediated by expression of SCA3trQ78(S) either in pan neuronal tissues or
in mushroom body is rescued by coexpression of dMyc. (C) Expression of SCA3trQ78(S) in mushroom body causes lethality at fully differentiated pupal stage (1) and a few escapers
(3.19%) eclose and survives for 7–8 days (2). (D–F) Mushroom body of 2 days old flies stained by anti-Fas ΙΙ. (D) Wild type showing α, β and γ lobes of mushroom body. (E) Overall
size is significantly reduced and γ lobe is degenerated in UAS-SCAtrQ78(S)/201Y-Gal4 flies. (F) Size of mushroom body is restored and γ lobe is rescued from degeneration and clearly
visible following coexpression of dMyc. (G) Graph represents comparative size of mushroom bodies dissected from adult brains of different genotypes.
54
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
average size = 392.67 ±1.73 μm; N = 13). Moreover, degeneration of
γ-lobe was also copiously prevented (Fig. 3F). The Fas II staining experiment was also performed with brain dissected out from 55 h old pupa
and similar results were obtained (not shown). This finding clearly
demonstrates that the potential of dMyc to modulate poly(Q) toxicity
is extensively prevalent in different organs and neuronal tissues.
Enhanced level of dMyc reduces poly(Q) mediated cell death and
cellular stress
Apoptosis or programmed cell death is a cell intrinsic mechanism of
removing or killing of cells which are injured or whose survival is compromised for maintenance of cellular homeostasis (Cashio et al., 2005).
In poly(Q) disease, formation of highly toxic inclusion bodies induces
apoptosis in selective regions of brain (Chen et al., 2000; Saudou et al.,
1998). Inclusion bodies accumulate dynamically in different regions of
brain and induce activation of highly specific caspase proteins, which
in normal cells are masked by binding with inhibitor of apoptosis such
as IAP1 (Chen et al., 2000; Chew et al., 2004; Fan and Bergmann,
2010; Meier et al., 2000; Saudou et al., 1998). To examine the poly(Q)
induced apoptotic activity, third instar larval eye discs were stained
with anti-cleaved caspase-3 antibody. The activation of caspase was
not evident in wild type eye disc cells (Fig. 4A). Following the expression of SCA3trQ78(S), a substantial amount of caspase-3 staining
indicate its highly activated state which would subsequently lead extensive cell death in targeted region (Fig. 4B). On the contrary, a low level of
caspase-3 staining confined to only fewer cells in posterior region of eye
disc in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc genotype (Fig. 4C). A
comparable pattern of caspase-3 staining was evident in developing
eyes dissected out from the pupal stage (not shown). Moreover, acridine orange staining of third instar larval imaginal discs (Fig. S4) and
pupal eyes (not shown) was also revealed substantially less prevalence
of cell death in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc genotype in
comparison to UAS-SCA3trQ78(S)/GMR-Gal4.
The expression of SCA3trQ78(S) causes formation of toxic nuclear
inclusions which induces expression of stress inducible form of HSP70
as cell intrinsic mechanism to refold the abnormally folded poly(Q)
disease proteins (Chai et al., 1999; Chan et al., 2002; Mallik and
Lakhotia, 2009; Warrick et al., 1999). In order to examine the protective
activity of dMyc on poly(Q) toxicity, the level of cellular stress was
checked by assessing the expression of stress inducible form of HSP70
(Velazquez et al., 1983) which was otherwise not expressed in wild
type flies raised in unstressed condition (Fig. 4D). However, GMR-Gal4
driven expression of SCA3trQ78(S) resulted in significant upregulation
in the expression of stress inducible HSP70 which was evident in the
form of small aggregates being restricted to the posterior of morphogenetic furrow in the eye disc (Fig. 4E). Coexpression of dMyc in the
poly(Q) background significantly repressed the stress induced expression of HSP70 and only a little amount of staining was visible at the posterior end of the disc (Fig. 4F). Above experiments clearly demonstrated
that enhanced level of dMyc in SCA3 background provides a protective
role and dominantly helps in reducing the cellular toxicity and cell
death.
Upregulation of dMyc inhibits poly(Q) protein aggregation
The formation of nuclear inclusions have been postulated as the
pathological feature in all the cases of poly(Q) diseases and the size
and number of inclusions could be directly correlated with disease
severity in model organisms (Bonini, 1999; Chan et al., 2002; Warrick
et al., 1999). Since cellular apoptosis and level of HSP70 were significantly altered due to coexpression of dMyc, we postulated that dMyc
may also modulate the subcellular level and distribution dynamics of inclusion bodies. To substantiate our hypothesis, GMR-Gal4 driven,
SCA3trQ78(S) expressing third instar larval eye discs were stained
with anti-HA antibody (Bonini, 1999; Chan et al., 2002; Warrick et al.,
1999). Robust accumulation of poly(Q) aggregates covering more than
half of the eye field was detected in such imaginal discs (Fig. 4G). Magnified images revealed subcellular abundance of inclusions bodies of
various sizes present in nuclear as well as cytoplasmic compartments
(Fig. 4I). Coexpression of Drosophila Myc with UAS-SCA3trQ78(S)/
GMR-Gal4 prevented the formation of nuclear inclusions and also altered the subcellular localisation dynamics of residual inclusion bodies
which mostly now appear in the cytoplasmic domain (Fig. 4H). Subsequent analysis revealed significantly reduced level of poly(Q) proteins
with occasional presence of small size inclusion bodies and their interaction with nucleus was hardly evident (Fig. 4J). Similar study with
the weak form of SCA3trQ78(W) also showed substantially reduced
level of poly(Q) proteins (Fig. S3 compare G and H). However, as revealed by confocal optical sectioning and co-localization studies, no
physical association could be established between dMyc and inclusion
bodies (not shown). To further understand the rescue potential of
dMyc, the level of inclusion bodies in adult flies were examined by
western blot using anti-HA antibody. In agreement with the earlier
reports (Chan et al., 2002), in UAS-SCA3trQ78(S)/GMR-Gal4 the inclusion bodies were found as highly insoluble protein complexes which
were difficult to resolve and mostly remain trapped in the stacking gel
(Fig. 4K, lane 1). Following coexpression of dMyc, the abundance of
SDS-insoluble protein aggregates was significantly reduced, however,
the monomeric form of poly(Q) protein was difficult to observe perhaps
due to their high mobility rate (Fig. 4K, lane 2). Above findings clearly
illustrate that dMyc potentially suppress the poly(Q) mediated toxicity
by altering the subcellular level and distribution pattern of the nuclear
inclusions.
Further investigation was performed to check whether dMyc can
also modulate the toxicity in other form of poly(Q) disease line and
we selected a Huntington line, UAS-eGFP-HttQ138-mRFP tagged with
both the eGFP and mRFP upstream and downstream of coding sequence
in first exon 1 (Weiss et al., 2012). The UAS-eGFP-HttQ138-mRFP transgenic line allows in vivo imaging of huntingtin expression and study
of aggregation dynamic in live animals (Weiss et al., 2012). GMR-Gal4
driven expression of UAS- eGFP-HttQ138-mRFP exhibited abundant
expression of huntingtin protein in the form of cytoplasmic aggregates
in third instar larval eye discs as detected by in vivo imaging and in
fixed tissues (Fig. 4L). Consequently, such adult flies exhibited roughening and degeneration of eyes which increased with aging (Fig. 4N) and
subsequent pseudopupil analysis showed drastic loss of photoreceptors
(see inset in Fig. 4N). Invariably, coexpression of dMyc showed constant
rescue efficacy as found earlier and normal looking eye was reestablished in UAS-eGFP-HttQ138-mRFP/GMR-Gal4/ UAS-dMyc flies
(Fig. 4O) with considerable improvement in the photoreceptors
(Fig. 4O inset). Moreover, coexpression of dMyc also resulted in significant reduction in the expression of huntingtin protein as recorded by invivo imaging (Fig. 4M). The difference in eGFP-HttQ138-mRFP aggregation level was further established in seven days old adult fly head by
directly observing the decapitated head under fluorescent microscope.
Expression of eGFP-HttQ138-mRFP in adult head produced large and
brightly fluorescing aggregates distributed widely around the eye region (Fig. 4P). Coexpression of dMyc resulted in substantial reduction
in accumulation of eGFP-HttQ138-mRFP aggregates in seven days old
adult eyes and only a few ommatidia showed fluorescence (Fig. 4Q).
Taken together, above studies clearly suggest that overexpression of
dMyc could potentially suppress the toxic effects of the multiple forms
of the poly(Q) aggregates by altering their expression and subcellular
distribution dynamics.
Mitigation of poly(Q) toxicity by dMyc is not a consequence of induced
cell proliferation
Human form of Myc has been reported to play an important role
in cellular proliferation by inducing cells to enter into S-phase
(Leone et al., 2001; Robinson et al., 2009). Moreover, aberrant
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
55
Fig. 4. Coexpression of dMyc reduces cellular apoptosis, toxicity and suppresses the formation of inclusion bodies. (A–C) Apoptotic signal is examined by staining with anti-cleaved
caspase-3. (A) No staining observed in wild type. (B) Robust caspase-3 activity is evident in UAS-SCA3trQ78(S)/GMR-Gal4. (C) Caspase-3 staining is reduced due to coexpression
of dMyc. (D–F) Cellular toxicity examined by staining with stress induced anti-HSP70. (D) Abundance of HSP70 is not detectable in wild type (E) GMR-Gal4 driven expression of
SCA3trQ78(S) resulted in significant expression of HSP70 in eye filed. (F) Expression of HSP70 is minimal and aggregate formation is also prevented by induced expression of dMyc in
SCA3trQ78(S) background. (G–H) Localisation of poly(Q) proteins examined by staining with anti-HA. (G) Expression SCA3trQ78(S) forms inclusion bodies covering more than half of
eye field. (H) Coexpression of dMyc prevents formation of inclusion bodies. (I–J) Staining with anti-HA (green) and DAPI (red) to study the relative localization of poly(Q) aggregates.
(I) Robust accumulation of poly(Q) aggregates (green) is evident in magnified image. A substantial amount of poly(Q) aggregates colocalize with nucleus (red) and large inclusion bodies
are frequently visible. (J) Coexpression of dMyc prevents the formation of protein aggregates and residual amount poly(Q) proteins are localised in cytoplasm. (K) Western blot of protein
homogenates from 1 day old fly showing increased SDS solubility of poly(Q) aggregates following coexpression of dMyc. Most of the SDS insoluble protein aggregates are trapped in stacking gel following expression of SCA3trQ78(S). A significant reduction in the amount of trapped protein in stacking gel could be seen following expression of dMyc. α-tubulin was used as
loading control. (L–M) GMR-Gal4 driven in-vivo expression dynamic of eGFP-HttQ138-mRFP aggregates. Expression of GFP has been shown in panels. (L) Expression of eGFP-HttQ138mRFP shows high level of entangled huntingtin protein in eye field. (M) Coexpression of dMyc reduces the level of huntingtin protein. (N–O) Bright field images of adult eye surface
(N) Expression of eGFP-HttQ138 causes roughening of eye surface and degeneration of photoreceptors (inset). (O) Coexpression of dMyc suppresses the roughening of eye surface and
reduces degeneration of photoreceptors (inset). (P–Q) In vivo imaging of 7 days old adult heads showing comparative level of poly(Q) aggregates. (P) Bright expression of eGFPHttQ138 is an indicative of robust accumulation of poly(Q) aggregate in adult eye. (Q) Coexpression of dMyc significantly reduces the accumulation of poly(Q) aggregates in adult eyes.
expression of Myc has been found to be associated with several forms of
cancer (Lutz et al., 2002). In Drosophila, overexpression of dMyc results
in increase in growth rates and cell size, however, its direct involvement
in cellular proliferation has not been reported yet (Johnston et al., 1999;
Secombe et al., 2007). Therefore, in view of the possibility we asked
whether dMyc mediated suppression of poly(Q) toxicity was indeed
achieved by re-entry in cell cycle and subsequent replacement of
degenerating neuronal cells. To address this question, the level of
56
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
BrdU incorporation efficiency in third instar larval eye discs was examined. In agreement with the earlier reports, wild type eye disc (N = 26)
exhibited maximum incorporation of BrdU in second mitotic wave region (SMW), a region posterior to morphogenetic furrow where cells
undergo S-phase followed by wave of mitotic division (Escudero and
Freeman, 2007; Yamaguchi et al., 1999) (Fig. 5A). Eye discs dissected
from UAS-SCA3trQ78(S)/GMR-Gal4 larvae (N = 28) showed inconsistency (74% discs exhibited reduced BrdU incorporation than wild
type) in the rate of BrdU incorporation (Fig. 5B) which could be due to
the toxic effect of poly(Q) aggregates and impaired transcriptional
efficiency (Cohen-Carmon and Meshorer, 2012). On the other hand,
although coexpression of dMyc in poly(Q) background resulted in
improved BrdU incorporation in SMW region (N = 34), however, the
level of incorporation was always found to be maintained as the wild
type or occasionally marginally less than that (compare Fig. 5A and C).
The BrdU incorporation efficiency was not affected in other parts of
eye field in above genotypes. This study clearly demonstrated that the
modulation in poly(Q) toxicity was not due to cell cycle re-entry and
subsequent replacement of degenerated neurons, rather some other
intrinsic properties of dMyc appeared to be responsible for improved
survivability of neuronal cells.
dMyc mediated suppression of poly(Q) toxicity is achieved by modulating
the cellular abundance of CBP and improved histone acetylation
Sequestration of c-AMP response element binding protein (CBP) has
been implicated as a major factor responsible for poly(Q) induced
repression of cellular transcriptional activity (McCampbell et al., 2000;
Nucifora et al., 2001; Taylor et al., 2003). Moreover, reports suggest
that poly(Q) induced neurodegeneration makes a negative impact on
transcriptional efficiency of CBP (Taylor et al., 2003). dMyc has been
reported as a global transcriptional regulator and an interacting partner
of CBP, and together they bind to the E-box containing promoter region
of the genes to modulate gene expression (Vervoorts et al., 2003;
Gallant, 2009). Therefore, we asked if expression of dMyc have
made any impact on the expression level and cellular distribution
pattern of CBP.
We checked the level of CBP transcripts by semi quantitative reverse
transcription-PCR (Fig. 5D1) and quantitative real time-PCR (Fig. 5D2),
using total RNA isolated from one day old adult Drosophila heads
(Taylor et al., 2003) using gene specific primers. In agreement with earlier reports, level of CBP transcripts in UAS-SCA3trQ78(S)/GMR-Gal4 was
found to be critically reduced (Taylor et al., 2003) as compared to wild
type (Fig. 5D1, compare lane i-ii; also see D2). Coexpression of dMyc
with UAS-SCA3trQ78(S)/GMRGal4 normalised the level of CBP
transcripts almost as the wild type (Fig. 5D1, lane iii; D2). Thereupon,
we also asked whether overexpression of dMyc has any effect on the
transcriptional efficiency of CBP during normal homeostasis. Remarkably, we observed an increase in the level of CBP transcripts following
overexpression of dMyc in normal condition (Fig. 5D1, lane iv; D2).
Subsequently, overexpression of SCA3trQ78(W) was also found to
deplete CBP transcripts level which was normalised by coexpression
of dMyc (data not shown). Based on these investigations we hypothesised
that the protective activity of dMyc on poly(Q) induced neurodegeneration could be the operating by normalising the cellular abundance of
CBP.
The hypothesis was further validated by genetic interaction studies
using UAS-CBP RNAi and UAS-CBP FLAD transgenic lines (Kumar et al.,
2004; Ludlam et al., 2002). CBP-FLAD harbours a dominant negative
mutation in acetyl transferase domain of CBP (Kumar et al., 2004).
Although as reported earlier, downregulation of CBP using UAS-CBP
RNAi or altering the CBP histone acetyltransferase activity using UASCBP FLAD under SCA3trQ78(S) background exacerbates the poly(Q)
toxicity (Mallik and Lakhotia, 2010b), but we did not observe any
gross phenotypic difference in such cases (not shown). We further
observed that downregulation or loss of CBP acetyltransferase activity
by UAS-CBP RNAi (N = 258) and/or UAS-CBP FLAD (N = 186) respectively, in UAS-SCA3trQ78(S)/GMR-GAL4/ UAS-dMyc background reduced the
inability of dMyc to suppress the poly(Q) toxicity (Fig. 5E1-2). The
inability of dMyc to suppress the poly(Q) induced neurodegeneration in
above cases arise due to the fact that additional increase in CBP level is
either destroyed by CBP RNAi or by rendered non-functional by CBP
FLAD. Therefore, the genetic interaction studies clearly indicated that
dMyc mediated rescue was indeed being channelized by increased
cellular level of CBP.
As overexpression of dMyc restores the level of CBP, the cellular
distribution and level of CBP protein were further examined by immunostaining to the eye disc with anti-CBP antibody (Lilja et al., 2003). In
wild type (N = 18), uniformly distributed basal level expression of
CBP was evident in the entire disc area (Fig. 5F). Consistent with our
RT-PCR data, GMR-Gal4 driven expression of SCA3trQ78(S) resulted in reduced level of CBP in the entire eye field (N = 23; compare Figs. 5F-G).
Subsequently, coexpression of dMyc increased the cellular abundance of
CBP to the near normal level (N = 25; compare Figs. 5F-H). The comparative distribution dynamics of CBP and poly(Q) were also performed by
co-staining the imaginal discs with anti- CBP and anti-HA antibodies.
Studies at higher magnification revealed bright and diffuse distribution
dynamics of CBP in wild type cells (N = 15; Fig. 5I) whereas accumulation of poly(Q) aggregates in UAS-SCA3trQ78(S)/GMR-Gal4 resulted in
relatively reduced and abnormal staining pattern (N = 23; Fig. 5J). Intriguingly, some of the poly(Q) bearing cells exhibited complete loss of
CBP expression (inset in Fig. 5J, arrowhead). It was also observed that
CBP depleted cells exhibit propensity of early nuclear fragmentation
and possibly degenerate early compare to the cells showing residual
abundance of CBP. In this context it is important to note that earlier
reports have also demonstrated similar kind of phenomenon in which
neuronal cells with poly(Q) aggregates were found to sequester endogenous CBP and several of such cells were marked by complete loss of
CBP expression (Jiang et al., 2003; McCampbell et al., 2000; Nucifora
et al., 2001). In agreement with our earlier results, coexpression of
dMyc in SCA3trQ78(S) background normalised the cellular abundance
of CBP and wild type distribution pattern was restored (N = 26,
compare Fig. 5I-K). Moreover, the interaction between CBP and
poly(Q) aggregates was also minimised in such cases as the level of
poly(Q) proteins was significantly reduced and confined to the cytoplasmic compartment.
Sequestration of CBP by poly(Q) aggregates makes a negative impact
on the process of histone acetylation and reduces global transcriptional
activities (McCampbell et al., 2000; Nucifora et al., 2001; Taylor et al.,
2003). Earlier reports have confirmed that dMyc recruits histone acetyltransferase to target chromatin and locally promotes hyper-activation
of multiple lysine residues of H3 and H4 (Knoepfler et al., 2006;
Martinato et al., 2008). Therefore, we checked the abundance of
acetylated histone in wild type, following accumulation of poly(Q)
aggregates and after overexpressing dMyc in disease background.
The level of acetylated histone H3 was analyzed in third instar larval
eye disc by staining with anti-acetylated histone H3 (ace-H3K9). The
wild type eye disc (N = 19) showed moderate level of staining
confined to the nuclear compartments (Fig. 5L). In contrast, GMR-Gal4
driven expression of SCA3trQ78(S) resulted in significant reduction in
the abundance of acetylated histone H3 (N = 23, Fig. 5M). Interestingly
coexpression of dMyc in SCA3 background restored the level of histone
acetylation (N = 25, Fig. 5N). Moreover, majority of the SCA3trQ78(S)/
GMR-Gal4/ UAS-dMyc discs even exhibited enhanced level of staining
compared to wild type (compare Fig. 5L and N). Therefore, in view of
several reports, the higher level of histone acetylation could be directly
attributed with enhanced transcriptional efficiency (Knoepfler et al.,
2006; Martinato et al., 2008; Taylor et al., 2003). Taken together,
the above studies confirmed that dMyc mediated suppression of
poly(Q) toxicity was actually accomplished by improving the cellular
transcriptional efficiency via restoring the level of CBP and histone
acetylation.
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
57
Fig. 5. dMyc does not modulate poly(Q) toxicity by increasing the cellular proliferation; rather increase in the expression of CBP drives the rescue mechanism. (A–C) Cell division assessed
by BrdU incorporation and subsequent staining with anti-BrdU. (A) Wild type shows incorporation of BrdU in second mitotic wave (SMW) region (B) Expression of SCA3trQ78(S) causes
inconsistent incorporation of BrdU in SMW region. (C) Coexpression of dMyc does not induce cellular proliferation but improves poly(Q) mediated defect of BrdU incorporation in SMW
region. (D) Relative level of CBP mRNA was examined by semi-quantitative reverse transcription-PCR (1) and quantitative real time-PCR (2). (D1) lanes: i. wild type ii. UAS-78Q(S)/GMRGal4 iii. UAS-78Q(S)/GMR-Gal4/UAS-dMyc iv. UAS-dMyc/GMR-Gal4. (D2) Compare to wild type (1.0 ± 0.047), expression of SCA3trQ78(S) results in reduction of CBP mRNA to
0.68 ± 0.036, which is almost normalized (0.98 ± 0.083) by coexpression of dMyc (bars in histograms represent mean value ± SD). Overexpression of dMyc in wild type background
results in (1.47 ± 0.11) fold increase in CBP expression. (E) dMyc mediated suppression of poly(Q) disorder is averted by downregulation of CBP using UAS-CBP-RNAi (1) or by suppressing CBP function by using dominant negative form of acetyl transferase domain of CBP using UAS-CBP-FLAD (2). (F–H) Anti-CBP staining in third instar larval imaginal discs (arrow in F–H
indicates eye field) (F) Wild type eyes show normal pattern of CBP expression. (G) Expression of SCA3trQ78(S) depletes the level of CBP in entire eye field. (H) Coexpression of dMyc restores the level of CBP throughout the eye field. (I–K) Co-staining with anti-CBP (green) and anti-HA (red) observed at higher magnification. (I) CBP is distributed diffusely in the wild type
cells. (J) Expression of SCA3trQ78(S) sequesters the CBP protein. Complete loss of CBP staining could be noted in selective rhabdomeres of a given ommatidia (arrowheads in inset). (K)
Coexpression of dMyc prevents sequestration of CBP and enhances its cellular abundance. (L–N) Staining with anti-acetylated form of histone H3 (ace-H3K9). (L) Wild type. (M) Expression of SCA3trQ78(S) reduces the level of ace-H3K9. (N) Coexpression of dMyc enhances the level of ace-H3K9.
Discussion
Present study was focused on to identification of a novel genetic
modifier of poly(Q) diseases which could be utilised as a potential
drug target. Our initial screening was largely influenced by some population studies in which significantly lower prevalence of cancer was
reported in patients with poly(Q) diseases than in the general population, and a common mechanism was suggested which may provide
such protection against the development of cancer (Ji et al., 2012;
Sorensen et al., 1999). However, the cellular and molecular factors
which cultivate this negative correlation between the poly(Q) diseases
and risk of developing cancer are largely enigmatic (Ji et al., 2012;
58
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
Sorensen et al., 1999). Based on above demographic findings, we
hypothesised if the intrinsic properties of some proto-oncogenes
could be exploited to dominantly suppress the progression of poly(Q)
induced neurodegeneration. Consistent with the hypothesis, for the
first time we report that targeted overexpression of dMyc (a homologue
of human c-Myc, a proto-oncogene) could potentially suppress the SCA3
induced neurodegeneration in Drosophila. It is also interesting in view of
the fact that accumulation of protein inclusion bodies and cellular degeneration was substantially reduced following overexpression of
dMyc in target tissues. In contrast, reduced expression of dMyc further
aggravates the poly(Q) induced cellular toxicity and degeneration.
Moreover, dMyc mediated mitigation of SCA3 phenotype was equally
effective in suppressing the toxicity in both, the Drosophila eye and
neurons of the central and peripheral nervous system(s).
The myc proto-oncogene family (c-myc, N-myc, and L-myc) is
amongst one of the most studied genes in biology (Bellosta and
Gallant, 2010; Gallant, 2009; Meyer and Penn, 2008). Functioning as a
proto-oncogene, Myc is often found to be overexpressed in various
forms of tumour (Lutz et al., 2002). It has been implicated in several
important biological functions such as transcriptional control, cell
cycle progression, apoptosis, cell migration, cell adhesion, mi-RNA biogenesis, stem cell behaviour etc. (Bellosta and Gallant, 2010; Lovén
et al., 2012; Meyer and Penn, 2008; Takashashi and Yamanaka, 2006).
The N-terminal transcription regulatory domain of Myc contains highly
conserved “Myc boxes” 1, 2 and 3 (MB, MB2 and MB3), and C-terminal
poses basic region-helix-loop-helix-leucine zipper (BHLHZ) domain,
which facilitates formation of heterodimer with another BHLHZdomain protein, Max (“Myc-associated protein X”). As transcriptional
regulator, Myc:Max heterodimers recognise relatively less conserved
sequence motif “E-boxes” (CACGTG) and activate the expression of
neighbouring genes (Amati et al., 1992; Gallant, 2009; Lovén et al.,
2012). CBP has also been implicated as one the positive co-factors of
Myc which facilitates binding of the heterodimer with target DNA
sequence (Vervoorts et al., 2003). Interestingly, Myc:Max dimers have
also been reported to repress a distinct set of target genes by interacting
with several transcription factors. Moreover, in a recent study Myc was
identified as one of the factors required to induce stem cell characteristics in the fibroblast cells (Takashashi and Yamanaka, 2006). Interestingly, in spite of availability of a large amount of data it is difficult to
propose a working model of c-Myc, since it modulates the expression
of a large number of assorted genes at a given developmental time
point.
Drosophila genome poses single homolog of human c-Myc, known as
dMyc or diminutive (dm), performing diverse biological functions as
noted earlier (Bellosta and Gallant, 2010; Gallant, 2009). Enhanced
level c-Myc in both mammalian and Drosophila cells stimulates rDNA
transcription as an integral feature of the augmented cell growth response to Myc (Grewal et al., 2005). Upregulation of dMyc in Drosophila
results in enlargement of cell size and increased cellular transcription
(Prober and Edgar, 2000; Secombe et al., 2007). Subsequently, targeted
overexpression of dMyc in Drosophila eye resulted in ommatidial
enlargement and roughening of the eye surface (Prober and Edgar,
2000). However, such eyes did not display any noticeable defect in
neuronal differentiations. It was postulated that enlarged cell size
which was primarily achieved due to enhanced growth resulted
in disorganised ommatidial arrangement that finally lead to the roughening of the eye surface (Prober and Edgar, 2000). Intriguingly, as
discussed earlier, targeted overexpression of dMyc in poly(Q) background not only resulted in reduction of cellular toxicity but the ommatidial sizes also appeared reasonably normal (7% enlarged size), which
was otherwise 33% larger (Secombe et al., 2007). It appears that due
to poly(Q) toxicity and subsequent reduction in transcriptional efficiency, dMyc mediated increase in cell size was compromised in SCA3 background and the rescue flies (UAS-SCA3trQ78(S)/GMR-Gal4; UAS-dMyc)
achieved rather normal cellular size. Perhaps the functional dynamics
of dMyc in the presence of poly(Q) aggregates is somewhat different
than that in wild type. In this context it is also important to note that
when two dosages of dMyc were co-expressed with SCA3trQ78(S), the
eyes were similarly preserved as with a single copy. Perhaps, expression
of Myc beyond a threshold level is not supported by the cells.
The cellular stress mediated by abnormal poly(Q) proteins induces
the expression of inducible form of HSP70 which associate themselves
with the inclusion bodies (Chan et al., 2002; Warrick et al., 1999) and
subsequently trigger the apoptotic activity due to activation of
cysteine caspases, and lead to loss of selective neurons (Chen et al.,
2000; Saudou et al., 1998). Overexpression of dMyc resulted in a significant reduction of cellular poly(Q) aggregates with residual inclusion
bodies mostly being restricted in the cytoplasmic compartments,
which are reported to be relatively less deleterious compared to their
nuclear accumulation (Warrick et al., 1999). Though, we did not find
any explicit in-situ colocalization or physical interaction between
dMyc and inclusion bodies. In Drosophila, role of dMyc in apoptosis is
somewhat vague as contrasting evidences have been proposed
(Montero et al., 2008; Secombe et al., 2007). In present case, dMyc
mediated reduction in cell death appeared to be a consequence of the
sequestration or degradation of cellular inclusion bodies, increased
solubility of poly(Q) aggregates and reduced toxicity burdens; which
might have been achieved by inducing the expression of various survival factors. Therefore, a substantial reduction in the abundance of nuclear
inclusions bodies and their altered distribution dynamic could be the
primary responsible factor driving the subsequent rescue events.
While working upon the mechanistic details we first postulated that
since induction of c-Myc is known to induce S-phase entry and cellular
proliferation in mammalian cells (Leone et al., 2001; Robinson et al.,
2009); the rescue phenotype in present case might have been achieved
by inducing cell cycle re-entry and subsequently by replacement of
degenerating cells with newly dividing cells. However, as revealed by
comparative BrdU incorporation efficiency, coexpression of dMyc with
SCA3trQ78(S) only stabilised the rate of cell division to the level of
wild type, and did not make any noticeable impact. Therefore, our
study clearly demonstrate that dMyc mediated mitigation of poly(Q)
toxicity is not accomplished by increasing the rate of cell division,
rather, some intrinsic properties of dMyc is commencing the rescue
phenomenon.
Sequestration of potent transcriptional regulators by poly(Q) proteins have been suggested to be a key factor causing cellular toxicity
and neuronal dysfunction (Dunah et al., 2002; McCampbell et al.,
2000; Nucifora et al., 2001; Perez et al., 1998; Taylor et al., 2003; Tsoi
et al., 2012). Many of the transcription factors comprise poly(Q)
or glutamine rich domains, and in such cases, the poly(Q) tract themselves serves as transcriptional activator (Gerber et al., 1994). Several
transcriptional regulators comprising poly(Q) tracts such as Myocyte
enhancer factor 2 (Mef2), C-terminal binding protein (dCtBP), Sin3A,
Debra (dbr), Heat etc. get sequestered in inclusion bodies resulting
in impairment of transcriptional machinery in disease condition (Bilen
and Bonini, 2007; Bolger et al., 2007; Fernendez-Funez et al., 2000;
Fujikake et al., 2008). In addition, sequestration of other essential
cellular proteins, e.g. chaperone proteins (Chan et al., 2002;
Cummings et al., 1998; Waelter et al., 2001) and proteasome subunits
(Cummings et al., 1998; DiFiglia et al., 1997; Waelter et al., 2001), etc.
further exacerbates the transcriptional impairment. Therefore, in view
of a well-established role of c-Myc as a global transcriptional regulator
(Eilers and Eisenman, 2008; Lovén et al., 2012), we hypothesised if
dMyc mediated poly(Q) suppression is being accomplished by modulating the cellular transcriptional efficiency. Moreover, in view of the fact
that CBP is a positive cofactor of c-Myc which binds to the carboxyterminal region of the protein for subsequent regulation of gene expression, we postulated that enhanced level of dMyc could positively
modulate the expression of CBP which could then mitigate the toxic
effects of poly(Q) aggregates.
CBP is a transcriptional coactivator which is also essential to coordinate cellular responses to intracellular signals (Chan and La Thangue,
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
2001). CBP has a repeat of 18 glutamines near its carboxy terminal
which was reported to interact with the expanded poly(Q) repeats of
the mutated proteins (McCampbell et al., 2000, 2001). This interaction
negatively affects the transcriptional activity of CBP, which has been
suggested as a major source of cellular toxicity (Jiang et al., 2006;
McCampbell et al., 2000; Nucifora et al., 2001; Taylor et al., 2003). In addition, CBP has also been attributed to be associated with modulation of
poly(Q) repeat instability in Drosophila disease model (Jung and Bonini,
2007). In agreement with the earlier findings (Jiang et al., 2003, 2006;
McCampbell et al., 2000; Nucifora et al., 2001), we also noted a significant reduction in the CBP expression following expression of SCA3 protein in Drosophila. Moreover, some cells in a given ommatidia showed
complete loss of CBP staining and propensity of early degeneration.
Regulated overexpression of CBP or enhancement of its activity has
been demonstrated to mitigate poly(Q) induced neurodegeneration
(Taylor et al., 2003). Moreover, microarray analysis have demonstrated
that overexpression of CBP enables the cells to recuperate the standard
level of gene expression which was otherwise compromised in poly(Q)
disease condition (Taylor et al., 2003). We found that enhanced level of
dMyc induces the expression of CBP in SCA3 as well as in wild type
background. Although upregulation in CBP expression was not robust
in poly(Q) disease condition and the resulting level was relatively comparable with that of wild type. On the other hand, dMyc mediated overexpression of CBP was somewhat greater in case of wild type. At this
point we do not know the exact underlying mechanism regulating the
transcriptional activation of CBP, however, dMyc mediated chromatin
remodelling (Eilers and Eisenman, 2008) could be one of the leading
factors which might be operating the above phenomenon. Subsequently, our studies further demonstrated that apart from the expression
level, in-situ distribution pattern of CBP was also normalized following
expression of dMyc. Therefore, it appeared that dMyc induced suppression of poly(Q) toxicity was indeed being accomplished by regulating
the cellular abundance of CBP. Genetic interaction studies further
demonstrated that downregulating the expression of CBP by UAS-CBP
RNAi or UAS-CBP FLAD in poly(Q) background restricts the dMyc's ability
to mitigate the toxicity, which is only possible in the event of a direct
functional association between the cellular level of dMyc and CBP. As
far as we are aware, this is the first report demonstrating a positive
correction between the expression level of dMyc and CBP.
Interestingly, dMyc mediated suppression of poly(Q) toxicity
showed a striking contrast with some of the earlier known modifiers
such as Tpr2 and Mlf (Kazemi-Esfarjani, and Benzer, 2000a,b), in
which overexpression of modifier gene did not make any significant
impact on the accumulation of inclusion bodies; whereas dMyc overexpression was found to be directly associated with the reduced level of
protein aggregates. In this context it is important to note that CBP
mediated suppression of poly(Q) toxicity was also demonstrated to be
associated with the reduced level of inclusion bodies (Taylor et al.,
2003). Above similarities further indicate that dMyc driven rescue of
poly(Q) suppression might be actually operating by modulating the
expression of CBP.
CBP has also been demonstrated to harbour intrinsic acetyltransferase activities which function in combination with various transcription
factors to finally regulate the expression of target genes by acetylating
the histone components of chromatin core particles (Ogrysko et al.,
1996). Process of histone acetylation alters the chromatin structure in
such a way that the DNA becomes more accessible to the transcription
factors. The ultimate status of nuclear histone acetylation is the outcome
of the relative activities of two opposing classes of proteins: the histone
acetyltransferase and the histone deacetylase, and a fine balance
between the levels of two above proteins are essential to attain the
desired level of gene expression.
CBP functions as a potent poly(Q) modifier by modulating the
status of histone acetylation and sequestration of CBP by poly(Q) proteins has been correlated with compromised acetyl transferase activity,
which subsequently results in global transcriptional dysregulation
59
(McCampbell et al., 2000; Nucifora et al., 2001; Taylor et al., 2003). In
agreement with the noted function of CBP, it has been found that reversal of histone acetylation either by overexpression of CBP or by treating
with histone deacetylase inhibitor drugs such as Suberoylanilide
hydroxamic acid (SAHA), Trichostatin A (TSA) and sodium butyrate
equally reduces the poly(Q) induced neurodegeneration (McCampbell
et al., 2001; Steffan et al., 2001). In this context it is also important to
note that dMyc itself has been implicated in maintaining the acetylated
state of histone proteins by functioning as a member of Myc/Max/Mad
basic helix-loop-helix-zipper transcription factor (Knoepfler et al.,
2006; Martinato et al., 2008). Therefore, dMyc's own intrinsic capability
of modifying chromatin structure along with its ability to restore CBP
level as found in present study prompted us to examine the level of
acetylated form of histone H3 (ace-H3K9).
In agreement with the earlier reports, accumulation of poly(Q)
protein aggregates resulted in a significant reduction in the level of
H3-histone acetylation (Cohen-Carmon and Meshorer, 2012; Pennuto
et al., 2009), which was restored following coexpression of dMyc. In
fact, the level of histone acetylation was relatively higher in rescue
flies than in wild type, which could be an additive effect of the increased
expression of dMyc and CBP. However, any isolated role of dMyc in
histone acetylation seems to be minimal in the present case since in absence of the desired level of CBP, dMyc mediated poly(Q) suppression
was predominantly compromised. Thus, we believe that dMyc mediated improved level of histone acetylation was essentially accomplished
by modulating the level of CBP.
In summary, we report dMyc as a novel modifier of poly(Q) diseases
in Drosophila. Although, earlier studies have identified oncogenic
proteins such as dMlf1 (Drosophila myeloid leukaemia factor 1) and
Src42A as poly(Q) modifiers in Drosophila, but mechanistic details
have not been worked out (Kaltenbach et al., 2007; Kazemi-Esfarjani,
and Benzer, 2000b). We propose that dMyc mitigates the poly(Q) toxicity by inducing the expression of CBP which in turn restores the status of
histone acetylation (ace-H3k9), thereby increasing the transcriptional
activities of the genes which either inhibit the formation of poly(Q) aggregate or accelerate the degradation pathway to remove the inclusion
bodies (Fig. 6). In addition, CBP itself, by functioning as a polyglutamine
peptide, may directly prevent the interaction of polyglutamine monomers to form larger inclusion bodies (Kazantsev et al., 2002).
At this point we do not know if the modifier capacity of dMyc is also
applicable with other forms of neurodegenerative disorders since we
Fig. 6. Accumulation of poly(Q) proteins is associated with neuronal toxicity, cellular
dysfunction and death. Our studies suggest that upregulation of dMyc modulates the
cellular abundance of CBP. Enhanced level of CBP could inhibit the accumulation of
poly(Q) aggregate by functioning directly as blocking peptide, and/or indirectly by
improving the status of histone acetylation which subsequently results in increased
transcriptional activity. As suggested earlier, increased transcriptional activity negatively
regulate the aggregate formation, accelerate the process of poly(Q) degradation and
provide pro-survival ability.
60
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
restricted our study to the Drosophila models of poly(Q) diseases. Our
study reveals a brighter side of Myc which is otherwise implicated in developing various kinds of cancers. Moreover, in view of the increasing
evidences that a single proto-oncogenic mutation may not be enough
to develop majority of cancer types; enriching the transcriptional activity by finding a mean (such as activating drugs) to alter the expression
of Myc in poly(Q) disease conditions could be a novel therapeutic
approach to suppress the toxic effects of inclusion bodies. Moreover,
our study also attempts to provide a possible explanation of the enigma
of poly(Q) patients showing resistance to the predisposition of cancer.
It appears that reduced cellular abundance of CBP and subsequent
compromised activity of Myc in patients with poly(Q) disorders
provides an inherent immunity against cancer.
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.nbd.2013.11.015.
Acknowledgment
We are thankful to Peter Gallant (University of Zurich, Switzerland),
Justin P. Kumar (Indiana University, Bloomington, USA), J. Troy Littleton
(Massachusetts Institute of Technology, USA) and the Bloomington
Stock Center for providing different fly stocks used in this study. We
gratefully thank Bob Eisenman (Fred Hutchinson Cancer Research
Center, USA) for anti-dMyc and T. Lilja (Stockholm University, USA)
for anti-CBP antibodies. This work was supported by research grant
(Ref. no. BT/PR4937/MED/30/727/2012) from the Department of
Biotechnology (DBT), Government of India, New Delhi, to S.S. MDS is
supported by the Senior Research Fellowship (SRF) from the Council
of Scientific and Industrial Research (CSIR), New Delhi. We also thank
Delhi University for financial support under R&D scheme and Central
Instrumentation Facility (CIF) at South Campus for confocal microscopy.
We are grateful to Nabanita Sarkar, Renu Yadav and Soram Idiyasan
Chanu for technical help.
References
Amati, B., Dalton, S., Brooks, M.W., Littlewood, T.D., Evan, G.I., Land, H., 1992. Transcriptional activation by the human c-Myc oncoprotein in yeast requires interaction
with Max. Nature 359, 423–426.
Bellosta, P., Gallant, P., 2010. Myc function in Drosophila. Genes Cancer 1, 542–546.
Bilen, J., Bonini, N.M., 2007. Genome-wide screen for modifiers of ataxin-3
neurodgeneration in Drosophila. PLoS Genet. 3, 1950–1964.
Bolger, T.A., Zhao, X., Cohen, T.J., Tsai, C.C., Yao, T.P., 2007. The neurodegenerative disease
protein ataxin-1 antagonizes the neuronal survival function of myocyte enhancer
factor-2. J. Biol. Chem. 282, 29186–29192.
Bonini, N.M., 1999. A genetic model for human polyglutamine-repeat disease in Drosophila melanogaster. Philos. Trans. R. Soc. Lond. B Biol. Sci. 354, 1057–1060.
Branco, J., Al-Rahmani, I., Ukani, L., Perez, A.M., Fernandez-Funez, P., Rincon-Limas, D.,
Botas, J., 2008. Comparative analysis of genetic modifiers in Drosophila points to common and distinct mechanisms of pathogenesis among polyglutamine diseases. Hum.
Mol. Genet. 17, 376–390.
Brand, A.H., Perrimon, N., 1993. Targeted gene expression as a means of altering cell fates
and generating dominant phenotypes. Development 118, 401–415.
Cashio, P., Lee, T.V., Bergmann, A., 2005. Genetic control of programmed cell death in Drosophila melanogaster. Semin. Cell Biol. 16, 225–235.
Chai, Y., Koppenhafer, S.L., Bonini, N.M., Paulson, H.L., 1999. Analysis of the role of heat
shock proteins (Hsp) molecular chaperones in polyglutamine disease. J. Neurosci.
19, 10338–10347.
Chan, H.M., La Thangue, N.B., 2001. p300/CBP proteins: HATs for transcriptional bridges
and scaffolds. J. Cell Sci. 114, 2363–2373.
Chan, H.Y., Warrick, J.M., Andriola, I., Merry, D., Bonini, N.M., 2002. Genetic modulation of
polyglutamine toxicity by protein conjugation pathways in Drosophila. Hum. Mol.
Genet. 11, 2895–2904.
Chen, M., Ona, V.O., Li, M., Ferrante, R.J., Fink, K.B., Zhu, S., Bian, J., Guo, L., Farrell, L.A.,
Hersch, S.M., et al., 2000. Minocycline inhibits caspase-1 and caspase-3 expression
and delays mortality in transgenic mouse model of Huntington's disease. Nat. Med.
6, 797–801.
Chew, S.K., Akdemir, F., Chen, P., Lu, W.J., Mills, K., Daish, T., Kumar, S., Rodriquez, A.,
Abrams, J.M., 2004. The apical caspase dronc governs programmed cell death in Drosophila. Dev. Cell 7, 897–907.
Cohen-Carmon, D., Meshorer, E., 2012. Polyglutamine (polyQ) disorders: the chromatin
connection. Nucleus 3, 433–441.
Cummings, C.J., Mancini, M.A., Antalffy, B., DeFranco, D.B., Orr, H.T., Zoghbi, H.Y., 1998.
Chaperone suppression of aggregation and altered subcellular proteasome localization imply protein misfolding in SCA1. Nat. Genet. 19, 148–154.
DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.P., Aronin, N., 1997.
Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic
neurites in brain. Science 277, 1990–1993.
Dunah, A.W., Jeong, H., Griffin, A., Kim, Y.M., Standaert, D.G., Hersch, S.M., Mouradian,
M.M., Young, A.B., Tanese, N., Krainc, D., 2002. Sp1 and TAFII130 transcriptional activity disrupted in early Huntington's disease. Science 296, 2238–2243.
Eilers, M., Eisenman, R.N., 2008. Myc's broad reach. Genes Dev. 22, 2755–2766.
Escudero, M., Freeman, M., 2007. Mechanism of GI arrest in the Drosophila eye imaginal
disc. BMC Dev. Biol. 7, 13.
Everett, C.M., Wood, N.W., 2004. Trinucleotide repeats and neurodegenerative disease.
Brain 127, 2385–2405.
Fan, Y., Bergmann, A., 2010. The cleaved-Caspase-3 antibody is a marker of Caspase-9-like
DRONC activity in Drosophila. Cell Death Differ. 17, 534–539.
Fernendez-Funez, P., Nino-Rosales, M.L., de Gouyon, B., She, W.C., Luchak, J.M., Martinez,
P., Turiegano, E., Benito, J., Capovilla, M., Skinner, P.J., et al., 2000. Identification of
genes that modify ataxin-1 induced neurodegeneration. Nature 408, 101–106.
Franceschini, N., 1972. Pupil and Pseudopupil in the Compound Eye of Drosophila. In:
Wehner, R. (Ed.), Information processing in the visual system of anthropods. Springer
Verlag, Berlin, pp. 75–82.
Fujikake, N., Nagai, Y., Popiel, H.A., Okamato, Y., Yamaguchi, M., Toda, T., 2008. Heat shock
transcription factor 1-activating compounds suppress polyglutamine-induced neurodegeneration through induction of multiple molecular chaperones. J. Biol. Chem. 283,
26188–26197.
Gallant, P., 2009. Drosophila Myc. Adv. Cancer Res. 103, 111–144.
Gerber, H.P., Seipel, K., Georgiev, O., Hofferer, M., Hug, M., Rusconi, S., Schaffner, W., 1994.
Transcription activation modulated by homopolymeric glutamine and proline
stretches. Science 263, 808–811.
Ghosh, S., Feany, M.B., 2004. Comparison of pathways controlling toxicity in the eye and
brain in Drosophila models of human neurodegenerative diseases. Hum. Mol. Genet.
13, 2011–2018.
Grewal, S.S., Li, L., Orian, A., Eisenman, R.N., Edgar, B.A., 2005. Myc-dependent regulation
of ribosomal RNA synthesis during Drosophila development. Nat. Cell Biol. 7,
295–302.
Gunawardena, S., Goldstein, L.S., 2001. Disruption of axonal transport and neuronal viability by amyloid precursor protein mutation in Drosophila. Neuron 32, 389–401.
Hay, B.A., Wolff, T., Rubin, G.M., 1994. Expression of baculovirus P35 prevents cell death in
Drosophila. Development 120, 2121–2129.
Hay, B.A., Wassarman, D.A., Rubin, G.M., 1995. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell 63, 1253–1262.
Ji, J., Sundquist, K., Sundquist, J., 2012. Cancer incidence in patients with polyglutamine
diseases: a population-based study in Sweden. Lancet Oncol. 6, 642–648.
Jiang, H., Nucifora Jr., F.C., Ross, C.A., DeFranco, D.B., 2003. Cell death triggered by
polyglutamine-expanded Huntingtin in a neuronal cell line is associated with degradation of CREB-binding protein. Hum. Mol. Genet. 12, 1–12.
Jiang, H., Poirier, M.A., Liang, Y., Pei, Z., Weiskittel, C.E., Smith, W.W., DeFranco, D.B., Ross,
C.A., 2006. Depletion of CBP is directly linked with cellular toxicity caused by mutant
huntingtin. Neurobiol. Dis. 23, 543–551.
Johnston, L.A., Prober, D.A., Edgar, B.A., Eisenman, R.N., Gallant, P., 1999. Drosophila Myc
regulates cellular growth during development. Cell 98, 779–790.
Jung, J., Bonini, N., 2007. CREB-binding protein modulates repeat instability in a Drosophila
model for the polyQ disease. Science 315, 1857–1859.
Kaltenbach, L.S., Romero, E., Becklin, R.R., Chettier, R., et al., 2007. Huntingtin interacting
proteins are genetic modifiers of neurodegeneration. PLoS Genet. 3, e82.
Kazantsev, A., Walker, H.A., Slepko, N., Bear, J.E., Preisinger, E., Steffan, J.S., Zhu, Y.Z.,
Gertler, F.B., Houseman, D.E., Marsh, J.L., et al., 2002. A bivalent Huntingtin binding
peptide suppresses polyglutamine aggregation and pathogenesis in Drosophila. Nat.
Genet. 30, 367–376.
Kazemi-Esfarjani, P., Benzer, S., 2000a. Genetic suppression of polyglutamine toxicity in
Drosophila. Science 287, 1837–1840.
Kazemi-Esfarjani, P., Benzer, S., 2000b. Suppression of polyglutamine toxicity by a Drosophila homolog of myeloid leukemia factor 1. Hum. Mol. Genet. 11, 2657–2672.
Knoepfler, P.S., Zhang, X.Y., Cheng, P.F., Gafken, P.R., McMahon, S.B., Eisenman, R.N., 2006.
Myc influences global chromatin structure. EMBO J. 25, 2723–2734.
Kumar, J.P., Jamal, T., Doetsch, A., Turner, F.R., Duffy, J.B., 2004. CREB binding protein functions during successive stages of eye development in Drosophila. Genetics 168,
877–893.
Landes, C., Bates, G.P., 2004. Huntingtin and the molecular pathogenesis of Huntington's
disease. Fourth in molecular medicine review series. EMBO Rep. 10, 958–963.
Leone, G., Sears, R., Huang, E., Rempel, E., Nuckolls, F., Park, C.H., Giangrande, P., Wu, L.,
Saavedra, H.I., Field, S.J., et al., 2001. Myc requires the distinct E2F activities to induce
S phase and apoptosis. Mol. Cell 8, 105–113.
Lilja, T., Qi, D., Stabell, M., Mannervik, M., 2003. The CBP coactivator functions both upstream and downstream of Dpp/Screw signaling in the early Drosophila embryo.
Dev. Biol. 262, 294–302.
Lin, D.M., Goodman, C.S., 1994. Ectopic and increased expression of Fasciclin ΙΙ alters motoneuron growth cone guidance. Neuron 13, 507–523.
Lin, X., Antalffy, B., Kang, D., Orr, H.T., Zoghbi, H.Y., 2000. Polyglutamine expansion downregulates specific neuronal genes before pathologic changes in SCA1 Nat. Neurosci. 3,
157–163.
Lovén, J., Orlando, D.A., Sigova, A.A., Lin, C.Y., Rahl, P.B., Burge, C.B., Levens, D.L., Lee, T.I.,
Young, R.A., 2012. Revisiting global gene expression analysis. Cell 151, 476–482.
Lu, B., Vogel, H., 2009. Drosophila models of neurodegenerative diseases. Annu. Rev.
Pathol. Mech. Dis. 4, 315–342.
Ludlam, W.H., Taylor, M.H., Tanner, K.G., Denu, J.M., Goodman, R.H., Smolik, S.M., 2002.
The acetyltransferase activity of CBP is required for the wingless activation and H4
acetylation in Drosophila melanogaster. Mol. Cell. Biol. 22, 3832–3841.
M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61
Lutz, W., Leon, J., Eilers, M., 2002. Contribution of Myc to tumorigenesis. Biochim. Biophys.
Acta 1602, 61–71.
Mallik, M., Lakhotia, S.C., 2009. RNAi of the large non-coding hsromega transcripts suppresses polyglutamine pathogenesis in Drosophila models. RNA Biol. 6, 464–478.
Mallik, M., Lakhotia, S.C., 2010a. Modifiers and mechanisms of multi-system polyglutamine
neurodegenerative disorders: lessons from fly models. J. Genet. 89, 497–526.
Mallik, M., Lakhotia, S.C., 2010b. Improved activities of CREB binding protein, heterogeneous nuclear ribonucleoproteins and proteasome following downregulation of noncoding hsromega transcripts help suppress poly(Q) pathogenesis in fly models.
Genetics 184, 927–945.
Martinato, F., Cesaroni, M., Amati, B., Guccione, E., 2008. Analysis of Myc-induced histone
modification on target chromatin. PLoS ONE 3, e3650.
McCampbell, A., Taylor, J.P., Taye, A.A., Robitschek, J., Li, M., Merry, D., Chai, Y., Paulson, H.,
Sobue, G., Fischbeck, K.H., 2000. CREB-Binding protein sequestration by expanded
polyglutamine. Hum. Mol. Genet. 9, 2197–2202.
McCampbell, A., Taye, A.A., Whitty, L., Penney, E., Steffen, J.S., Fischbeck, K.H., 2001. Histone deacetylase inhibitors reduce polyglutamine toxicity. Proc. Natl. Acad. Sci. U. S.
A. 98, 15179–15184.
Meier, P., Silke, J., Leevers, S.J., Evan, G.I., 2000. The Drosophila caspase DRONC is regulated
by DIAP1. EMBO J. 19, 598–611.
Meyer, N., Penn, L.Z., 2008. Reflecting on 25 years of Myc. Nat. Rev. Cancer 8, 976–990.
Montero, L., Muller, N., Gallant, P., 2008. Induction of apoptosis by Drosophila Myc. Genesis 46, 104–111.
Nucifora Jr., F.C., Sasaki, M., Peters, M.F., Huang, H., Copper, J.K., Yamada, M., Takashashi,
H., Tsuji, S., Troncosco, J., Dawson, V.L., et al., 2001. Interference by Huntington and
atrophin-1 with cbp-mediated transcription leading to cellular toxicity. Science
291, 2423–2428.
Ogrysko, W., Schiltz, R.L., Russanova, V., Howard, B.H., Nakatani, Y., 1996. The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87, 953–959.
Paulson, H., 2012. Machado-Joseph disease/spinocerebellar ataxia type 3. Handb. Clin.
Neurol. 103, 437–449.
Pennuto, M., Palazzolo, I., Poletti, A., 2009. Post-translational modifications of expanded
polyglutamine proteins: impact on neurotoxicity. Hum. Mol. Genet. 18, R40–R47.
Perez, M.K., Paulson, H.L., Pendse, S.J., Saionz, S.J., Bonini, N.M., Pitman, R.N., 1998. Recruitment and role of nuclear localization in polyglutamine-mediated aggregation. J. Cell
Biol. 143, 1457–1470.
Prober, D.A., Edgar, B.A., 2000. Ras1 promotes cellular growth in the Drosophila wing. Cell
100, 435–446.
Quinn, W.G., Harris, W.A., Benzer, S., 1974. Conditioned behaviour in Drosophila eyes.
Proc. Natl. Acad. Sci. U. S. A. 71, 708–712.
Robinson, K., Asawachaicharn, N., Galloway, D.A., Grandori, C., 2009. c-Myc accelerates Sphase and requires WRN to avoid replication stress. PLoS ONE 4, e5951.
Saudou, F., Finkbeiner, S., Devys, D., Greenberg, M.E., 1998. Huntingtin acts in the nucleus
to induce apoptosis but death does not correlate with the formation of intracellular
inclusions. Cell 95, 55–66.
61
Secombe, J., Li, L., Carlos, L., Eisenman, R.N., 2007. The Trithorax group protein Lid is a
trimethyl histone H3K4 demethylase required for dMyc-induced cell growth. Genes
Dev. 21, 537–551.
Seidel, K., den Dunnen, W.F., Schultz, C., Paulson, H., Frank, S., de Vos, R.A., Brunt, E.R.,
Deller, T., Kamipinga, H.H., Rub, U., 2010. Axonal inclusions in spinocerebellar ataxia
type 3. Acta Neuropathol. 120, 449–460.
Shimohata, T., Nakajima, T., Yamada, M., Uchida, C., Onodera, O., Naruse, S., Kimura,
T., Koide, R., Nozaki, K., Sano, Y., et al., 2000. Expanded polyglutamine stretches
interact with TAFΙΙ130, interfering with CREB-dependent transcription. Nat.
Genet. 26, 29–36.
Sorensen, S.A., Fenger, K., Olsen, J.H., 1999. Significantly lower incidence of cancer among
patients with Huntington disease: an apoptotic effect of an expanded polyglutamine
tract? Cancer 86, 1342–1346.
Steffan, J.S., Bodai, L., Pallos, J., Poelman, M., McCampbell, A., Apostol, B.L., Kazantsev, A.,
Schmidt, E., Zhu, Y.Z., Greenwald, M., et al., 2001. Histone deacetylase inhibitors arrest
polyglutamine-dependent neurodegeneration in Drosophila. Nature 413, 739–743.
Takashashi, K., Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse embryonic and stem fibroblast cultures by defined factors. Cell 126, 663–676.
Taylor, J.P., Taye, A.A., Campbell, C., Kazemi- Esfarjani, P., Fischbeck, K.H., Min, K.T., 2003.
Aberrant histone acetylation, altered transcription, and retinal degeneration in a Drosophila model of polyglutamine disease are rescued by CREB-binding protein. Genes
Dev. 17, 1463–1468.
Tsoi, H., Lau, T.C., Tsang, S.Y., Lau, K.F., Chan, H.Y., 2012. CAG expansion induces nucleolar
stress in polyglutamine disease. Proc. Natl. Acad. Sci. U. S. A. 109, 13428–13433.
Velazquez, J.M., Sonoda, S., Bugaisky, G., Lindquist, S., 1983. Is the major Drosophila heat
shock protein present in cells that have not been heat shocked? J. Cell Biol. 96,
286–290.
Vervoorts, J., Luscher-Firzlaff, J.M., Rottmann, S., Lilischkis, R., Walsemann, G., Dohmann,
K., Austen, M., Luscher, B., 2003. Stimulation of c-Myc transcription activity and acetylation by recruitment of the cofactor CBP. EMBO Rep. 4, 484–490.
Waelter, S., Boeddrich, A., Lurz, R., Scherzinger, E., Lueder, G., Lehrach, H., Wanker, E.E.,
2001. Accumulation of mutant huntingtin fragments in aggresome-like inclusion
bodies as a result of insufficient protein degradation. Mol. Biol. Cell 12, 1393–1407.
Warrick, J.M., Chan, H.Y., Gray-Board, G.L., Chai, Y., Paulson, H.L., Bonini, N.M., 1999. Suppression of polyglutamine-mediated neurodegeneration in Drosophila by molecular
chaperone HSP70. Nat. Genet. 23, 425–428.
Weiss, K.R., Kimura, Y., Lee, W.C., Littleton, J.T., 2012. Huntingtin aggregation kinetics and
their pathological role in Drosophila Huntington's disease model. Genetics 190,
581–600.
Yamaguchi, M., Hirose, F., Inoue, Y.H., Shiraki, M., Hayashi, Y., Nishi, Y., Matsukage, A.,
1999. Ectopic expression of human p53 inhibits entry into S phase and induces apoptosis in the Drosophila eye imaginal disc. Oncogene 18, 6767–6775.
Yang, M.Y., Armstrong, J.D., Vilinsky, I., Strausfeld, N.J., Kaiser, K., 1995. Subdivision of the
Drosophila mushroom bodies by enhancer-trap expression patterns. Neuron 15,
45–54.
Supplementary data Fig. S1. Fig. S1. (A) Coexpression of UAS-GFP with SCA3trQ78(S) does not make any phenotypic difference. (B) Coexpression of
DIAP1 improves the poly(Q) phenotype, though at lower magnitude compared to dMyc (compare with Fig. 1 C).
Fig. S2. Fig. S2. Coexpression of dMyc suppresses the poly(Q) induced defects in 55 h old pupal eye disc. (A–C) Immunoataining with
anti-Elav, (A) Wild type shows floral arrangement of photoreceptor cells. (B) Expression of SCA3trQ78(S) disturbs the normal
development of photoreceptor cells. (C) Coexpression of dMyc restores the normal pattern of photoreceptor cells. (D–F)
Immunostaining with anti-Dlg (D) Wild type eye showing normal arrangement of ommatidial cells and bristles. (E) Expression of
SCA3Q78(S) affects the development of various ommatidial cells including primary, secondary, tertiary and cone cells. The
ommatidial bristles also show abnormal arrangement. (F) Coexpression of dMyc suppresses overall defects in ommatidial
arrays. (G–I) Immunostaining with anti-armadillo (G) Wild type shows normal ommatidial lattice and photoreceptors. (H)
Expression of SCA3trQ78(S) adversely affects the ommatidial lattice, cellular architecture and development of photoreceptors.
(I) Coexpression of dMyc suppresses the defects in ommatidial lattice and prevents degeneration of photoreceptors. Fig. S3. Fig. S3. Coexpression of dMyc with SCA3trQ78(W) rescues degeneration of photoreceptors and reduces the expression of
poly(Q) protein. (A–C) External morphology of 15 days old adult Drospophila eye. (A) Wild type. (B) Expression of
SCA3trQ78(W) causes partial depigmentation of eye with slight roughening. (C) External eye surface is completely rescued by
coexpression of dMyc. (D–F) Pseudopupil image of 5 days old adult eye. (D) 7 photoreceptors are observed in wild type. (E)
Absence of photoreceptors due to expression of SCA3trQ78(W). (F) Coexpression of dMyc suppresses degeneration of
photoreceptors and 5–7 photoreceptors are found in each ommatidia. (G–H) Immunostaining with anti-HA. (G) poly(Q) protein
is distributed abundantly in cytoplasm due to expression of SCA3trQ78(W) and inclusion bodies are formed in few rows in the
posterior region of eye field. (H) Coexpression of dMyc reduces the total poly(Q) protein and abundance of inclusion bodies. Fig. S4. Fig. S4. dMyc suppresses the poly(Q) mediated cell death. (A–C) Acridine orange staining of larval eye discs. (A) No staining
could be observed in wild type. (B) Large number of cells shows positive acridine orange staining due to expression of
SCA3trQ78(S). (C) Coexpression of dMyc reduces abundance of acridine orange positive cells.