Journal of Neuroimmunology 103 Ž2000. 112–121
www.elsevier.comrlocaterjneuroim
Differential regulation of neurotrophin expression by mitogens and
neurotransmitters in mouse lymphocytes
Rina Barouch a , Elena Appel a , Gila Kazimirsky a , Armin Braun b, Harald Renz b,
Chaya Brodie a,)
a
b
Faculty of Life Sciences, Bar-Ilan UniÕersity, Ramat Gan 52900, Israel
Departments of Clinical Chemistry and Biochemistry, Charite-Virchow
Clinic of the Humboldt UniÕersity, Berlin, Germany
´
Received 5 February 1999; received in revised form 15 September 1999; accepted 12 October 1999
Abstract
In this study, we examined the expression of neurotrophins in mouse lymphocytes and the regulation of their expression by mitogens
and neurotransmitters. We found that mixed splenocytes as well as T and B lymphocytes expressed mRNA for all the neurotrophins
examined. Differential regulation of the neurotrophins was obtained upon stimulation of the cells. Thus, LPS increased the expression of
NGF, BDNF and NT-3 in splenocytes and B cells, whereas Con-A increased the mRNA of NT-3 and NT-4 in T cells and NGF
expression in splenocytes. The neurotransmitter substance P and the b-adrenergic agonist, isoproterenol induced an increase in the
expression of NGF. Our results suggest an important role for the different neurotrophins in the function of the immune system and point
to a bi-directional interaction between neurotrophins and neurotransmitters in this system. q 2000 Published by Elsevier Science B.V. All
rights reserved.
Keywords: Neurotrophins; Mitogens; Neurotransmitters; Lymphocytes; Immune system
1. Introduction
Nerve growth factor ŽNGF. brain-derived neurotrophic
factor ŽBDNF., neurotrophin-3 ŽNT-3. and neurotrophin4r5 ŽNT-4r5. are members of the neurotrophin family.
These factors share about 50–55% sequence identity, have
similarity in overall structure features and are highly conserved proteins across different species ŽHallbook et al.,
1991.. The neurotrophins are primarily known for their
influence on the survival and differentiation of neurons
ŽManess et al., 1994.. The biological activity of the neurotrophins is mediated via interactions with two classes of
cell-surface receptors. The low affinity NGF receptor, p75,
binds all the members of the neurotrophin family with
similar affinity, and the different members of the Trk
family of tyrosine protein kinase receptors that bind neurotrophins with high affinity. This family includes Trk A
which binds NGF ŽKaplan et al., 1991., Trk B which binds
BDNF and NT-4r5 but also binds NT-3 with lower affin-
)
Corresponding author: Tel.: q972-3-5318266; fax: q972-3-5351824;
e-mail: ehnya@mail.biu.ac.il
ity ŽKlein et al., 1991; Suppet et al., 1991. and Trk C
which binds NT-3 ŽLamballe et al., 1991..
NGF is essential for the development, differentiation
and survival of sympathetic and sensory neurons in the
peripheral nervous system ŽYankner and Shooter, 1982;
Levi-Montalcini, 1987. and for cholinergic neurons in the
central nervous system ŽBuck et al., 1987; Whittemore and
Seiger, 1987.. In addition to its neurotrophic effects, NGF
has numerous effects on immune system activity. For
example, NGF enhances proliferation of B and T cells
ŽThorpe and Perez-Polo, 1987; Otten et al., 1989; Brodie et
al., 1992. induces synthesis and secretion of antibodies
from B cells ŽOtten et al., 1989; Brodie and Gelfand, 1994;
Brodie et al., 1995., induces differentiation of monocytes
into macrophages ŽEhrhard et al., 1993b., increases mast
cell number, and leads to massive degranulation on these
cells ŽMarshall et al., 1992.. NGF is also produced by
immune cells such as splenocyte-activated CD4 positive T
cell clones ŽEhrhard et al., 1993a., mouse splenic lymphocytes ŽSantambrogio et al., 1994. and mast cells ŽLeon et
al., 1994., thus suggesting an autocrine effect of this factor
on the function of immunocompetent cells. The expression
of other neurotrophins by immunocompetent cells and the
0165-5728r00r$ - see front matter q 2000 Published by Elsevier Science B.V. All rights reserved.
PII: S 0 1 6 5 - 5 7 2 8 Ž 9 9 . 0 0 2 3 3 - 7
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
regulation of neurotrophin expression in these cells are
starting to be explored.
The spleen is a primary lymphoid organ that is extensively innervated by sympathetic noradrenergic nerve
fibers. These fibers form a synaptic contact with both
blood vessels and specific cellular components, including
parenchymal fields of lymphocytes and macrophages
ŽFelten et al., 1985.. Morphological studies also revealed
the presence of neuropeptidergic innervation in the spleen,
including fibers of substance P ŽSP., neuropeptide Y,
metenkephalin-like and cholecystokinin ŽFelten et al.,
1985.. In addition, various neurotransmitters including SP
and norepinephrine ŽNE. have been shown to modulate
immune activity via specific receptors ŽPayan, 1989; Payan
and Goetzl, 1985, 1987; Payan et al., 1983..
In this study, we examined the expression of the neurotrophins, NGF, BDNF, NT-3 and NT-4 in mouse lymphocytes and studied the regulation of these neurotrophin
expression by T and B cell mitogens and by the neurotransmitters, NE and SP.
2. Materials and methods
2.1. Cell cultures
Freshly isolated splenocytes were prepared from 8–10weeks-old Balb C male mice. T cells were purified using a
CD90 magnetic cell sorting column according to the manufacturer’s instructions ŽMilleny, Biotec.. B lymphocytes
were purified using a CD45 column ŽMilleny, Biotec.. The
purity Ž90–95%. of T and B cells was determined by flow
cytometry analysis. Splenocytes, B and T cells were grown
in RPMI-1640 ŽGibco., supplemented with 10% heat inactivated fetal-calf serum, penicillin Ž100 mgrml., streptomycin Ž100 mgrml., L-glutamine Ž2 mM.. The cells were
treated with Con-A, 5 mgrml ŽSigma., LPS 5 mgrml
ŽSigma Serotype 0127:B8., SP, 100 nM ŽSigma. and Žy.isoproterenol, 1 mM ŽSigma..
2.2. Neurotrophin secretion
For determination of neurotrophin secretion, 3 = 10 6
cellsrwell were incubated with the various treatments in
24-well tissue plates. The supernatants were collected after
48 h and stored at y708. The secretion of the neurotrophins NGF, BDNF and NT-3 by mouse splenocytes,
T and B cells was measured using commercial ELISA
Kits, according to the manufacturer’s instructions.
2.3. Preparation of mRNA and PCR analysis
Total RNA was extracted from primary cultures of
mouse splenocytes Ž5 = 10 7 cells per 10 cm plate. with
TRI Reagent ŽMRC. according to manufacturer’s instructions and dissolved in 20 ml of DEPC-treated H 2 O. To
digest the remaining DNA 2 ml of RQ1 DNAse Ž1 Urml.
113
ŽPromega. was added, incubated for 30 min at 378C, RNA
was extracted by phenolrchloroform, precipitated with
ethanol and redissolved in 20 ml DEPC-treated H 2 O.
Five micrograms of total RNA were transcribed into
cDNA with an ExpandTM Reverse Transcriptase ŽBoehringer Mannheim., using 50 pmol of the OligoŽdT.15 ,
according to the protocol provided by the manufacturer.
Relative levels of neurotrophin mRNA was estimated by a
semi-quantitative polymerase chain reaction ŽPCR. in comparison to the mRNA of the ribosomal protein S-12. The
cDNA product, 1 mg — for PCR with neurotrophin primers
and 0.25 mg — for PCR with S-12 primers, was resuspended in a total volume of 50 ml containing 1 unit of Taq
DNA Polymerase ŽAppligene., 200 mM each of dATP,
dCTP, dGTP, dTTP, 1 = reaction buffer provided by the
manufacturer and 50 pmol of primers. NGF cDNA fragment Ž658 bp. corresponding to nucleotides 284–942 of
mouse cDNA was amplified by semi-quantitative PCR,
using forward primer: 5X-CATAGCGTAATGTCCATGTTGTTCT; and reverse primer: 5X-CTTCTCATCTGTTGTCAACGC ŽScott et al., 1983..
BDNF cDNA fragment Ž295 bp. was obtained using the
following primers for human cDNA ŽMoretto et al., 1994.:
forward 5X-AGCCTCCTCTGCTCTTTCTGD; reverse: 5XTTGTCTATGCCCCTGCAGCC. NT-3 fragment Ž161 bp.
was amplified using as a forward primer 5X-TTTCTCGCTTATCTCCGTGGC and as a reverse 5X-AGGGTGCTCTGGTAATTTTCC ŽHohn et al., 1990..
NT-4 cDNA fragment Ž274 bp. corresponding to nucleotides 378–652 of rat cDNA was synthesized with
primers: 5X-GGTGCTGGGCGAGGTGCCTGC and 5XGGCACGGCCTGTTCGGCTGAG ŽIp et al., 1992..
S-12 cDNA fragment Ž368 bp. was obtained with human primers: forward: 5X-GGAAGGCATTGCTGCTGG;
reverse: 5X-CTTCAATGACATCCTTGG.
Primers for S-12 span exon–intron junctions in order to
avoid amplification of contaminating genomic DNA. PCR
fragments for the neurotrophins did not contain introns. As
a control, we used reaction mixture with 1 ml RNA instead
of cDNA in order to exclude any contamination as a
source of amplified fragments Ž0 control.. Amplification
step consisted of 958C for 3 min and 40 Žfor neurotrophins. or 30 Žfor S-12. cycles of 958C for 30 s, 558C
for 1 min and 708C for 1 min. In a preliminary study, each
cDNA was amplified in serial of 25, 30 and 40 cycles to
obtain data within the linear-range of the assay. PCR
products were size-fractionated by electrophoresis in 2%
agarose gels and ethidium bromide stained. For molecular
weight markers, we used 50 bp DNA ladder ŽMWXIII,
Boehringer Mannheim.. The specificity of the PCR product was examined by hybridization with internal antisense
primer: for NGF, 5X-CTT GAC GAA GGT GTG AGT C
Ž19 mer.; BDNF, 5X-GTC GCA CAC GCT CAG CTC Ž18
mer.; NT-3, 5X-GAT GAT GAG GGA ATT GAG Ž18
mer.; NT-4, 5X-GGT GTC GAT CCG AAT CCA G Ž19
mer..
114
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
Fig. 1. NGF mRNA expression in mouse lymphocytes. Mixed splenocytes ŽA., T cells ŽC. or B cells ŽD. were treated with Con-A, LPS, SP or IsoP for 6 h, or mixed splenocytes were treated with LPS for
different time periods ŽB.. RNA was extracted and the samples were processed for RT-PCR. As a control, we used reaction mixture with 1 ml RNA instead of cDNA in order to exclude any contamination as
a source of amplified fragments Ž0 control.. The RT-PCR products were visualized by ethidium bromide staining. Results of a representative experiment out of similar four are presented.
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
For the hybridization, size-fractionated PCR products
were downward transferred from agarose gel to GeneScreen PlusTM nylon membranes ŽDupont. using 0.4 N
NaOH, 0.6 N NaCl transfer solution according to the
method of Chomczynski Ž1992.. Hybridization was done at
428C in 5 = SSC, 50% formamide, 0.5% SDS, 10% dextran sulfate, 100 mgrml denatured Salmon Sperm DNA
overnight with w32 P x-end-labeled internal primer. For the
end labeling we used 50 pmol of each primer and the
reaction was performed with 4 ml of -ATP w32 P x Žf 3000
Cirmmol. ŽDupont. and polynucleotide kinase ŽNEB. in
total volume 20 ml 30 min at room temperature. After
hybridization the filters were washed in 2 = SSC, 0.1%
SDS for 30 min at room temperature and in 0.1 = SSC,
0.1% SDS 1 h at 608C and were exposed to Kodak XAR
films at y708C with an intensifying screen for 5–6 h. The
intensity of the bands was quantified with TINA program.
115
h which declined thereafter ŽFig. 1A, B.. We also examined the effects of the two neurotransmitters which have
been reported to be involved in spleen innervation, SP and
the b-adrenergic agonist, IsoP. Treatment of the cells with
IsoP Ž1 mM. or SP Ž100 nM. induced a large increase in
NGF expression which reached plateau levels after 6 h
ŽFig. 1A.. The increases in NGF mRNA induced by IsoP
and SP was much larger than that exerted by Con-A or
LPS.
T cells also expressed a basal level of NGF mRNA.
Treatment of the cells with Con-A, SP and NE induced an
increase in NGF expression ŽFig. 1C..
The basal level of mRNA in B cells did not change
significantly in response to the various treatments. Interest-
2.4. Statistical analysis
The results are presented as the mean values " SE. All
data were analyzed using pair Student’s t-test to determine
the level of difference between the treatments.
3. Results
The expression of the neurotrophins was examined
using semi-quantitative RT-PCR and ELISA. Isolated cells
were treated with the T cell mitogen, Con-A, the B cell
mitogen LPS, the neurotransmitter SP or the b-adrenergic
agonist, isoproterenol ŽIsoP.. Dose–response and kinetic
studies were first performed for each of the treatments and
the optimal conditions obtained were used in all subsequent studies. Thus, the effects of Con-A were examined
at concentrations of 0.1–5 mgrml and maximal effects
were obtained at a concentration of 5 mgrml. LPS effects
were examined at concentrations of 1–10 mgrml and
maximal effects were obtained at a concentration of 5
mgrml. SP exerted maximal effect at a concentration of
100 nM, whereas concentrations of 10 nM and 1 mM
resulted in lower responses. Treatment of the cells with
various concentrations of IsoP Ž10 nM–1 mM. resulted in
a dose–response curve with a maximal effect at a concentration of 1 mM. The expression of the neurotrophins was
examined in mixed lymphocytes and in isolated T and B
cells.
3.1. NGF expression
Lymphocytes expressed mRNA for NGF ŽFig. 1A..
Treatment of the cells with the T cell mitogen Con-A
induced an increase in NGF mRNA which reached plateau
levels following 3–6 h of treatment. In contrast, treatment
of the cells with the B cell mitogen LPS induced a
transient increase in the expression of NGF mRNA after 1
Fig. 2. Effects of Con-A, LPS, SP, and IsoP on NGF secretion. Splenocytes ŽA., T ŽB. and B cells ŽC. were incubated for 48 h with the
indicated treatments and NGF secretion was determined by ELISA.
Results represent the means"SE of four separate experiments. U p- 0.05.
116
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
Fig. 3. BDNF mRNA level in mouse lymphocytes. Mixed splenocytes ŽA and B., T cells ŽC. or B cells ŽD. were treated as described in Fig. 1. BDNF mRNA was detected using Southern blot followed by
hybridization with 32 P-labeled internal primer. Results of a representative experiment out of similar four are presented.
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
Fig. 4. NT-3 mRNA level in mouse. Mixed splenocytes ŽA., T cells ŽC. or B cells ŽD. were treated with Con-A, LPS, SP or IsoP for 6 h, or mixed splenocytes were treated with LPS for different time
periods ŽB.. RNA was extracted and the samples were processed for RT-PCR. The RT-PCR products were visualized by ethidium bromide staining. Results of a representative experiment out of similar four
are presented.
117
118
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
ingly, the upregulation of NGF levels following SP treatment in mixed lymphocytes was much higher than that
observed in T and B cells ŽFig. 1C. and can be attributed
to either the presence of contaminating macrophages or to
the effects of cytokines secreted as a result of T and B cell
interaction.
For measurements of NGF production, cells were treated
with Con-A, LPS, SP and IsoP for 48 h and their culture
supernatants were analyzed for NGF using an ELISA.
Similar to the results obtained for the mRNA levels,
stimulation with Con-A, LPS, SP and IsoP induced a
significant increase in NGF secretion from mixed lymphocytes ŽFig. 2A.. Con-A induced an increase of 15% in
NGF secretion at a concentration of 1 mgrml and a
maximal increase of 45% at a concentration of 5 mgrml.
LPS induced an increase of 24% at a concentration of 1
mgrml and a 52% increase at a concentration of 5 mgrml.
IsoP induced a very small effect Ž10%. at a concentration
of 100 nM and plateau levels of 32% were obtained at a
concentration of 1–5 mM. SP induced a maximal increase
Ž130%. in NGF secretion at a concentration of 100 nM,
whereas, 10 nM induced only a 30% increase and 1 mM
SP induced a 55% increase in NGF secretion. The effect of
SP was blocked significantly Žabout 90% inhibition. in the
presence of 10 mM SP antagonist. Similarly, the b-adrenergic antagonist, propranolol Ž50 mM., abolished the effect
of IsoP by 80% Ždata not shown..
In isolated T cells, only Con-A induced a significant
increase in NGF secretion from 40 pgr3 = 10 6 cells in
controls to 100 pgr3 = 10 6 in treated cells ŽFig. 2B.. In
isolated B cells, treatment with LPS and IsoP induced a
significant increase in NGF secretion, from 70 pg in
control cells to 400 pg in LPS-treated cells and 140 pg in
IsoP-treated cells ŽFig. 2C..
Control untreated T expressed basal levels of NT-3, and
treatment with Con-A, SP and IsoP induced an increase in
mRNA levels ŽFig. 4C.. Untreated B cells also expressed
basal amounts of NT-3, and treatments with the various
stimuli examined did not affect its expression ŽFig. 4D..
Low levels of NT-3 protein were detected in unstimulated lymphocytes. This level was increased in response to
LPS and Con-A ŽFig. 5A.. Isolated T cells produced low
levels of NT-3 Ž20 pgr3 = 10 6 ., while stimulation of the
cells with Con-A for 48 h induced a large increase in the
protein level Ž100 pgr3 = 10 6 cells. ŽFig. 5B.. Untreated
B cells also secreted low levels of NT-3, and LPS induced
a large increase in NT-3 production from 30 pgr3 = 10 6
in control cells to 200 pgr3 = 10 6 in LPS-treated cells
ŽFig. 5C..
3.2. BDNF expression
The mixed lymphocyte population, T and B cells, expressed a basal level of BDNF mRNA. Treatment of
lymphocytes with SP induced an increase in BDNF mRNA
expression ŽFig. 3A., whereas Con-A or IsoP did not
induce significant changes in either cell preparation ŽFig.
3A, C and D.. Treatment of mixed lymphocytes with LPS
exerted a similar effect to that observed in NGF-treated
lymphocytes. Thus, LPS induced a transient increase after
1 h followed by a decrease thereafter ŽFig. 3B..
The expression of BDNF protein was measured using
an ELISA. Under no condition, we were able to detect
significant BDNF protein in the cultures.
3.3. NT-3 expression
NT-3 mRNA was also expressed in mixed lymphocytes.
The expression of NT-3 was not significantly regulated by
Con-A, SP or IsoP ŽFig. 4A.. LPS induced a small increase
in NT-3 expression following 1–2 h of treatment and this
expression was decreased thereafter ŽFig. 4B..
Fig. 5. Effects of Con-A, LPS, SP, and IsoP on NT-3 secretion. Splenocytes ŽA., T ŽB. and B cells ŽC. were incubated for 48 h with the
indicated treatments and NT-3 secretion was determined by ELISA.
U
Results represent the means"SE of four separate experiments. p- 0.05,
UU
p- 0.005.
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
Fig. 6. NT-4 mRNA level in splenocytes. Mixed splenocytes ŽA., T cells
ŽB. or B cells ŽC. were treated as described in Fig. 1. NT-4 mRNA was
detected using Southern blot followed by hybridization with 32 P-labeled
internal primer. Results of a representative experiment out of similar four
are presented.
3.4. NT-4 mRNA expression
Splenocytes, T and B cells, expressed a basal level of
NT-4 mRNA. Treatment of the cells with the different
stimuli did not affect the expression of NT-4 in mixed
lymphocytes ŽFig. 6A. or in isolated B cells ŽFig. 6C.. In T
cells, we found a small increase in NT-4 expression in
Con-A-treated cells ŽFig. 6B..
4. Discussion
In this study, we demonstrated the expression and regulation of neurotrophins in mouse lymphocytes at both the
119
mRNA and protein levels. Our results at the mRNA level
show that mixed lymphocytes as well as B and T cells,
express mRNA for all the neurotrophins examined. These
results confirm and further extend evidence of previous
studies regarding the expression of neurotrophin mRNA
and their regulation in lymphoid organs and immunocompetent cells ŽZhou and Rush, 1993; Laurenzi et al., 1994;
Katoh-Semba et al., 1996; Yamamoto et al., 1996.. At the
protein level, we demonstrated for the first time secretion
of significant levels of NGF and NT-3 by B and T cells.
Our results clearly demonstrate the existence of a differential regulation of the various neurotrophins in immunocompetent cells. In addition to the differential regulation of
the neurotrophins by the mitogens and neurotransmitters
examined, we also observed differential expression of the
neurotrophins in different cell populations as a result of the
various treatments. This difference can be attributed to
either the presence of additional cell types such as
macrophages in the lymphocyte preparation or to the effects of cytokines secreted as a result of T and B cell
interaction.
The high level of NGF production by lymphocytes and
the effects of the neurotransmitters on its expression could
be explained by considering the possible roles, which NGF
plays in the spleen. NGF is a survival factor for both
sympathetic and sensory neurons during development.
Many sympathetic neurons continue to depend on NGF for
survival throughout adulthood, whereas sensory neurons
depend on this factor in the postnatal period ŽBarde, 1989;
Gorin and Johnson, 1990; Ruit et al., 1990.. Since the
spleen has a very dense sympathetic innervation, NGF may
act as a target-derived factor for these nerves ŽShelton and
Reichardt, 1984., and it is therefore produced in relatively
high levels by this organ. In addition to its effects on
sympathetic neurons, NGF may also play a role in the
function of some sensory neurons ŽLewin and Mendell,
1993.. For example, NGF leads to a rapid and large
increase in the production of SP in sensory neurons. Since
the spleen contains sensory fibers, which secrete SP, it is
possible that NGF affects the function of these fibers
through up-regulation of neuropeptide production. Thus,
the increase of NGF production by lymphocytes treated
with SP and NE may point to the existence of a positive
regulatory loop, in which SP and NE induce an increase in
NGF production which then acts back on the sympathetic
and peptidergic nerves.
Another importance of NGF production by lymphocytes
may be related to its role as a potent modulator of different
inflammatory and immune responses ŽOtten et al., 1994;
Braun et al., 1998.. For example, NGF enhances T and B
cell mediated immune response ŽOtten et al., 1989; Brodie
and Gelfand, 1992; Brodie et al., 1995., enhances survival
and cytotoxic activity of eosinophils ŽHamada et al., 1996.,
increases the number of mast cells and induces degranulation of these cells ŽAloe and Levi-Montalcini, 1977., promotes differentiation of granulocytes ŽKimata et al., 1991.
120
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
and monocyte activation ŽEhrhard et al., 1993b.. Since
lymphocytes, monocytes and mast cells have been all
shown to express functional NGF receptors ŽBrodie et al.,
1992; Ehrhard et al., 1993b; Melamed et al., 1996., our
results point to an important role for NGF as an autocrine
modulator in the immune system.
The expression of BDNF, NT-3 and NT-4 by splenocytes is less understood since there is no reported evidence
regarding the effects of these neurotrophins on the function
of sympathetic nerves. Specific effects of these neurotrophins have been, however, reported on other peripheral nerves ŽIbanez, 1995.. Receptors for BDNF, NT-3 and
NT-4 are expressed on various immunocompetent cells
ŽLaurenzi et al., 1994.. Thus, rather than acting as target
derived factors for nerves which innervate the spleen, these
neurotrophins may act as autocrine factors for immunocompetent cells.
The ability of the neurotransmitters SP and of the
b-adrenergic agonist, IsoP, to regulate the expression of
neurotrophins in splenic lymphocytes may be mediated
through two possible mechanisms. The first mechanism is
a direct effect of these neurotransmitters on T and B cells
through binding to specific receptors. Indeed, SP receptors
were found on murine splenic T as well as on B cells
ŽPayan et al., 1983; Stanisz et al., 1987.. Similarly, badrenergic receptors were detected on splenocytes. Alternatively, the effects of SP and IsoP may be mediated via
different cytokines, which are induced by these compounds. Indeed, SP induces the release of the inflammatory cytokines; IL-1, TNF-a and IL-6 from human monocytes ŽLotz et al., 1988. and macrophages ŽKimball et al.,
1988; Pascual and Bost, 1990..
In addition, we found a differential regulation of neurotrophin expression by T and B cell mitogens. Con-A is a
known T cell mitogen which leads to T cell proliferation
and to the production of cytokines such as IL-2 and IL-4
which then act in an autocrine manner to promote cell
proliferation ŽGajewski et al., 1989.. NGF has been shown
to act as a mitogen for lymphocytes and the production of
this factor by Con-A-treated cells may point to a similar
role of NGF as an autocrine factor in lymphocyte proliferation. Activation of B cells by LPS induced an increase in
the expression and production of NGF and NT-3 and in the
mRNA level of BDNF. NGF induction by LPS has been
reported in astrocytes and brain macrophages through activation of NF-kB ŽHeese et al., 1998.. Recently, we found
that LPS induced the expression of NGF, NT-3 and GDNF
but not of BDNF, supporting the existence of a differential
pattern of neurotrophin regulation ŽBrodie and Goldreich,
1996; Appel et al., 1997..
In summary, our results further support the existence of
a bi-directional cross talk between the nervous and immune systems via interaction between neurotrophins and
neurotransmitters. Thus, the release of the neurotransmitters NE and SP from sympathetic and sensory nerves
that innervate the spleen, regulate the expression of neu-
rotrophins, which are involved in the maintenance, and
survival of these nerves. In addition, the production of the
neurotrophins by immunocompetent cells and their regulation upon B and T cell activation by mitogens may implicate a role for these factors in the function of the immune
system.
Acknowledgements
This work was supported by the Volkswagen-Stiftung
Foundation.
References
Aloe, L., Levi-Montalcini, R., 1977. Mast cell increase in tissues of
neonatal rats injected with the nerve growth factor. Brain Res. 133,
358–366.
Appel, E., Kolman, O., Kazimirsky, G., Blumberg, P.M., Brodie, C.,
1997. Regulation of GDNF expression in cultured astrocytes by
inflammatory stimuli. NeuroReport 8, 3309–3312.
Barde, Y.A., 1989. Trophic factors and neuronal survival. Neuron 2,
1525–1534.
Braun, A., Appel, E., Baruch, R., Herz, U., Brodie, C., Botcharev, V.,
Renz, H., 1998. Role of nerve growth factor in a mouse model of
allergic airway inflammation and asthma. Eur. J. Immunol. 28, 3240–
3251.
Brodie, C., Gelfand, E.W., 1992. Functional NGF receptors on human B
lymphocytes: interaction with IL-2. J. Immunol. 148, 3492–3497.
Brodie, C., Gelfand, E.W., 1994. Regulation of Ig production by nerve
growth factor. Comparison with anti-CD40. J. Neuroimmunol. 52,
87–96.
Brodie, C., Goldreich, N., 1996. Th2 derived cytokines act as immunosuppressive factors and provide neurotrophic support in the CNS. Soc.
Neurosci. Abstr.
Brodie, C., Renz, H., Bradely, K., Gelfand, E.W., 1995. NGF and
anti-CD40 provide opposite signals to IgE production in IL-4 treated
lymphocytes. Eur. J. Immunol. 26, 171–178.
Buck, C.R., Martinez, H.J., Black, I.B., Chao, M., 1987. Developmentally regulated expression of the nerve growth gene in the periphery
and the brain. Proc. Natl. Acad. Sci. U. S. A. 84, 3060–3063.
Chomczynski, P., 1992. One-hour downward alkaline capillary transfer
for blotting of DNA and RNA. Anal. Biochem. 201, 134–139.
Ehrhard, P.B., Erb, P., Graumann, U., Otten, U., 1993a. Expression of
nerve growth factor and nerve growth factor receptor tyrosine kinase
TRK in activated CD-4 positive T-cell clones. Proc. Natl. Acad. Sci.
U. S. A. 90, 10984–10988.
Ehrhard, P.B., Ganter, U., Stalder, A., Bauer, J., Otten, U., 1993b.
Expression of functional trk protooncogene in human monocytes.
Proc. Natl. Acad. Sci. U. S. A. 90, 5423–5427.
Felten, O.L., Felten, S.Y., Carlson, S.L.O.J.A., Livnat, S., 1985. Noradrenergic and peptidergic innervation of lymphoid tissue. J. Immunol.
136, 152–156.
Gajewski, T.F., Schell, S.R., Nau, G., Fitch, F.W., 1989. Regulation of
T-cell activation: differences among T-cell subsets. Immunol. Rev.
111, 79–110.
Gorin, P.D., Johnson, E.M. Jr., 1990. Effects of long-term growth factor
deprivation on the nervous system of the adult rat: an experimental
autoimmune approach. Brain Res. 198, 27–42.
Hallbook, F., Ibanez, C.F., Persson, H., 1991. Evolutionary studies of the
nerve growth factor family reveal a novel member abundantly expressed in Xenopus ovary. Neuron 6, 845–858.
Hamada, A., Watanabe, N., Ohtomo, H., Matsuda, H., 1996. Nerve
R. Barouch et al.r Journal of Neuroimmunology 103 (2000) 112–121
growth factor enhances survival and cytotoxic activity of human
eosinophils. Br. J. Haematol. 93, 299–302.
Heese, K., Fiebich, B.L., Bauer, J., Otten, U., 1998. NF-kappa B modulates lipopolysaccharide-induced microglial nerve growth factor expression. Glia 22, 401–407.
Hohn, A., Leibrock, J., Bailey, K., Barde, Y.-A., 1990. Identification and
characterization of a novel member of the nerve growth factorrbrain
derived neurotrophic factor family. Nature 344, 339–341.
Ibanez, C.F., 1995. Neurotrophic factors: from structure-function studies
to designing effective therapeutics. Trends Biotechnol. 13, 217–227.
Ip, N.Y., Ibanez, C.F., Nye, S.H., McClain, J., Jones, P.F. et al., 1992.
Mammalian neurotrophin-4: structure, chromosomal localization, tissue distribution, and receptor specificity. PNAS 89, 3060–3064.
Kaplan, D., Hempstead, B.L., Martin-Seance, D., Chao, M.V., Parada,
L.F., 1991. The trk proto-oncogene product: a signal transducing
receptor for nerve growth factor. Science 252, 554–558.
Katoh-Semba, R.K., Kaisho, Y., Shintan, A., Nagahama, M., Karo, K.,
1996. Tissue distribution and immunocytochemical localization of
neurotrophin 3 in the brain and peripheral tissues of rats. J. Neurochem. 66, 330–337.
Kimata, H., Yoshida, A., Ishioka, C., Mikawa, H., 1991. Nerve growth
factor inhibits immunoglobulin production but not proliferation of
human plasma cell lines. Clin. Immunol. Immunopathol. 60, 145–151.
Kimball, E.S., Persico, F.J., Vaught, J.L., 1988. Substance P, neurokinin
A, and neurokinin B induce generation of IL-1 like activity in P388
D1 cells. J. Immunol. 41, 3564–3569.
Klein, R., Nanduri, V., Jing, S., Lamballe, F., Tapley, P., Bryant, S.,
Cordon-Cardo, C., Jones, K.R., Reichardt, L.F., Barbacid, M., 1991.
The TRK-B tyrosine protein kinase is a receptor for brain-derived
neurotrophic factor and neurotrophin-3. Cell 66, 395–403.
Lamballe, F., Klein, R., Barbacid, M., 1991. Trk C, a new member of the
trk family of tyrosine kinase, is a receptor for neurotrophin-3. Cell 66,
967–979.
Laurenzi, M.A., Barbany, G., Timmusk, T., Lindgren, J.A., Persson, H.,
1994. Expression of mRNA encoding neurotrophins and neurotrophin
receptors in rat thymus, spleen tissue and immunocompetent cells.
Regulation of neurotrophin-4 mRNA expression by mitogens and
leukotriene B 4 . Eur. J. Biochem. 223, 733–741.
Leon, A., Buriani, A., Dal Toso, R., Fabris, M., Romanello, S., Aloe, L.,
Levi-Montalcini, R., 1994. Mast cells synthesize, store and release
nerve growth factor. Proc. Natl. Acad. Sci. U. S. A. 91, 3739–3743.
Levi-Montalcini, R., 1987. The nerve growth factor: 35 years later.
Science 237, 1154–1162.
Lewin, G.R., Mendell, L.M., 1993. Nerve growth factor and nociception.
TINS 16, 353–359.
Lotz, M., Vaughan, J.H., Carson, D.A., 1988. Effects of neuropeptides on
production of inflammatory cytokines by human monocytes. Science
241, 1218–1221.
Maness, L.M., Kasitin, A.J., Weber, J.T., Banks, W.A., Beckman, B.S.,
Zadina, J.E., 1994. The neurotrophins and their receptors: structure,
function and neuropathology. Neurosci. Biobehav. Rev. 18, 143–159.
Marshall, J.S., Stead, R.H., McSharry, C., Nielsen, L., Bienenstock, J.,
1992. The role of mast cell degranulation products in mast cell
hyperplasia: I. Mechanism of content and transport of substance P and
calcitonin gene-related peptide in sensory nerves innervating inflamed
tissue: evidence for a regulatory function of nerve growth factor in
vivo. Neuroscience 49, 693–698.
121
Melamed, I., Kelleher, C.A., Franklin, R.A., Brodie, C., Hempstead, B.,
Kaplan, D., Gelfand, E.W., 1996. Nerve growth factor signal transduction in human B lymphocytes is mediated by gp140trk. Eur. J.
Immunol. 26, 1985–1992.
Otten, U., Ehrhard, P., Peck, R., 1989. Nerve growth factor induces
growth and differentiation of human B lymphocytes. Proc. Natl.
Acad. Sci. U. S. A. 86, 10059–10063.
Otten, U., Scully, J.L., Ehrhard, P.B., Gadient, R.A., 1994. Neurotrophins: signals between the nervous and immune system. Prog.
Brain Res. 103, 293–305.
Pascual, D.W., Bost, K.L., 1990. Substance P production by P388 D1
macrophages: a possible autocrine function for this neuropeptide.
Immunology 71, 52–56.
Payan, D.G., 1989. Neuropeptides and inflammation: the role of substance P. Annu. Rev. Med. 40, 341–352.
Payan, D.G., Goetzl, E.J., 1985. Modulation of lymphocyte function by
sensory neuropeptides. J. Immunol. 135, 7835–7865.
Payan, D.G., Goetzl, E.J., 1987. Substance P receptor-dependent responses of leukocytes in pulmonary inflammation. Am. Rev. Respir.
Dis. 136, S43–S48, Suppl.
Payan, D.G., Brewster, D.R., Goetzl, E.J., 1983. Specific stimulation of
human T lymphocytes by substance P. J. Immunol. 131, 1613–1615.
Ruit, K.G., Osborne, P.A., Schmidt, R.E., Johnson, E.M., William Jr.,
Snider, D., 1990. Nerve growth factor regulates sympathetic ganglion
cell morphology and survival in the adult mouse. J. Neurosci. 10,
2412–2419.
Santambrogio, L., Benedetti, M., Cho, M.V., Muzaffar, R., Kuling, K.,
Gabellini, N., Hochwald, G., 1994. Nerve growth factor production
by lymphocytes. J. Immunol. 153, 4488–4495.
Scott, J., Selby, M., Urdea, M., Quiroda, M., Bell, G.I., Rutter, W.J.,
1983. Isolation and nucleotide sequence of a cDNA encoding the
precursor of mouse nerve growth factor. Nature 302, 538–540.
Shelton, D.L., Reichardt, L.F., 1984. Expression of the B nerve growth
factor gene correlates with the density of sympathetic innervation in
effector organs. Proc. Natl. Acad. Sci. U. S. A. 81, 7951–7955.
Stanisz, A.M., Scicchitano, R., Dazin, P., Bienenstock, J., Payan, D.G.,
1987. Distribution of substance P receptors on murine spleen and
Peyer’s patch T and B cells. J. Immunol. 139, 749–754.
Suppet, D., Eschandon, E., Maragos, J., Middlemas, D.S., Reid, S.W.,
Blair, J., Burton, L.E., Stanton, B.R., Kaplan, D.R., Hunter, T.,
Nikolics, K., Parada, L.F., 1991. The neurotrophic factors brain-derived neurotrophic factor and neurotrophin-3 are ligands for the trk B
tyrosine kinase receptor. Cell 65, 895–903.
Thorpe, L.W., Perez-Polo, J.R., 1987. The influence of nerve growth
lymphocytes. J. Neurosci. Res. 18, 134–139.
Whittemore, S.R., Seiger, A., 1987. The expression, localization and
functional significance of B-nerve growth factor in the central nervous system. Brain Res. Rev. 12, 439–464.
Yamamoto, C., Sobue, K., Yamamoto, K., Terao, S., Mitsuma, T., 1996.
Expression of mRNAs for neurotrophic factors ŽNGF, BDNF, NT3
and GDNF. and their receptors ŽPt5, TrkA, TrkB and TrkC. in the
adult human peripheral nervous system and nonneuronal tissues.
Neurochem. Res. 21, 929–938.
Yankner, B.A., Shooter, E.M., 1982. The biology and mechanism of
action of nerve growth factor. Annu. Rev. Biochem. 51, 845–868.
Zhou, X., Rush, R., 1993. Localization of neurotrophin-3-like immunoreactivity in peripheral tissues of the rat. Brain Res. 621, 189–199.