The Cloning and Sequencing of the GapC Glyceraldehyde-3-Phosphate Dehydrogenase
from Gaillardia and Monarda and Determination of its Potential Protein Sequence
Samantha Ricketts, Jeremy Sabo and Diana Spencer
Tulsa Community College Department of Biotechnology
ABSTRACT
CONCLUSIONS AND FUTURE DIRECTIONS
The aim of the study was to clone a portion of the glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) gene from common Oklahoma plants, insert the gene fragment into a plasmid vector, and
analyze the sequences of the clones using bioinformatics. The GAPDH family of housekeeping
genes catalyzes an important step of glycolysis, which is a stage of respiration that occurs in all
living cells. GAPDH is a crucial enzyme for all animals, protists, bacteria, plants, and fungi. Also,
GAPDH is a protein used in DNA replication, cytoskeletal organization, programmed cell death, and
in neuronal diseases. GAPDH may play a role in cancer therapies. Genomic DNA (gDNA) was
extracted and amplified through a nested polymerase chain reaction (PCR). The fragment of DNA
was inserted into a cloning vector and E. coli cells were transformed with the constructed
recombinant DNA. Cells containing the DNA were screened and multiplied so that large quantities of
the DNA could be isolated and sequenced. Sequences were edited and assembled. The nucleotide
sequence was studied for six possible reading frames. The longest reading frame of amino acids
was analyzed for protein structure.
 It is possible to retrieve a plant out of a front yard, genetically recombine a gene from
that plant, and sequence its DNA using the protocol provided. The purpose of utilizing
GAPDH is its essential importance to the broad function of plants and overall
consistency within all plant life. We successfully extracted DNA, amplified a particular
gene, ligated into a vector, and verified the transformation into E. coli. It is possible to
then take the sequenced data, assemble the sequences, and research within a variety of
databases to seek botanical relationships. Possibly all genes and all botanic specimen
are areas of study with this protocol.
 One future project proposal is to repeat the protocol with the original plant specimen
choices in the DNA extraction, and optimize the process to find success with all of the
botanic organisms.
 Plant barcoding can be used to quickly identify and quantify a plant species in the field.
Taking all successful plant DNA extraction products and performing barcoding using
the reference genes rbcLa and matK to develop a phylogenetic relationship would add
to the body of basic plant identification.
 A goal of strengthening the plant evolutionary pathways relating to the progression of
GAPDH within the Bryophyta, Tracheophyta and Angiosperm Phyla would increase the
body of knowledge about the genes of respiration. This would include repeating the
protocol with several plants from each category and comparing results with
bioinformatics.
 A study of the comparison of the GAPDH gene structure in plants that perform similar
functions for man would be interesting. Recommended areas of study would include
plants that filter the air, medicinal plants, essential oil containing and antioxidant
containing plants.
 The ultimate goal for this continued research is to publish all results in GenBank.
INTRODUCTION The GAPDH family of enzymes is found in all cells and is seemingly acquired from
eubacteria through time. GAPDH is an ancient and ubiquitous enzyme that is most often found in the
6th step of glycolysis and also found in the Calvin cycle making it vital for energy production.
Respiration is the universal process by which cells convert carbohydrate energy into adenosine
triphosphate (ATP). The specimens studied in this research are both native to Oklahoma. Gaillardia,
also known as Indian Blanket, is Oklahoma’s state wildflower and Monarda is a common wildflower
often called Bee Balm. The vector chosen for the ligation was pJet 1.2 because it is a blunt ended
vector and contains the eco471R gene which allows a positive selection for transformants. The
eco471R gene is a fatal gene to E. coli when it is expressed. When the eco471R gene is disrupted by
the insertion of the DNA into the cloning site, the gene will no longer be expressed and the
transformed cells will grow and divide on selective media.
RESULTS
Amplified nested PCR GAPDH gene using 1% agarose gel and TAE buffer at 100V for 30 minutes.
Lane 1: Echinacea, Lane 2: Gaillardia, Lane 3: Lambs ear, Lane 4: Fern I, Lane 5: Snap Dragon, Lane 6:
Horsetail, Lane 7: Monarda, Lane 8: Fern II, Lane 9: gDNA, Lane 10: pDNA, Lane 11: water, Lane 12: +control
MATERIALS & METHODS
DNA EXTRACTION
DNA extraction was performed using a Bio-Rad Nucleic Acid Extraction Module (#1665000EDU). Plant DNA samples were extracted using a micropestle. The supernatant
was loaded into a column and filtered DNA was eluted from the extraction column.
PCR
A nested PCR reaction was performed using 40µl total for each sample.
Thermocycling protocol for initial run using a Bio-Rad T100 thermal cycler was 95°C
for 1 minute, 52°C for 1 minute, and 72°C for 2 minutes at 40 rounds. A degenerate
primer sequence for the initial amplification was: 5’ GABTATGTTGTTGA 3’
Thermocycling protocol for nested PCR using a Bio-Rad T100 thermal cycler was 95°C
for 1 minute, 46°C for 1 minute, and 72°C for 2 minutes at 40 rounds. The nested
reaction was run with proprietary primers.
GEL ELECTROPHORESIS
All samples were run in a 1% agarose gel in 1x TAE buffer at 100V for 30 minutes with
a 500bp molecular weight ruler. The gel was stained with ethidium bromide for 15
minutes and viewed through a Bio-Doc IT™ Imagining system UV transilluminator.
PCR PURIFICATION
The samples chosen from the gel to be purified included: Echinacea, Gaillardia, Fern I,
and Monarda. PCR samples from the gel were purified by size exclusion
chromatography using the BIO-RAD Kleen spin columns. (Cat 732-6300)
LIGATION
First a blunting reaction was set up with the following reagents: 2x ligation reaction
buffer, purified PCR product, sterile water, and proofreading polymerase. It was then
incubated at 70°C for 5 minutes. The tube was then cooled on ice for 2 minutes.
Next, the ligation reaction was set up with the following reagents: blunting reaction,
T4 DNA ligase, and the pJet1.2 blunted vector. It was then left at room temperature for
5-10 minutes.
TRANSFORMATION
Using competent cells through a heat shock process, ligation products were
transformed. Living clones were grown up in broth and minipreps were performed to
purify the plasmids. Products were verified via restriction digest.
SEQUENCING
Positive products were quantified and sequenced by Oklahoma State University
Recombinant DNA/Protein Resource Facility. Primers used were:
pJet SEQ Forward: 5’ CGACTCACTATAGGGAGAGCGGC
pJet SEQ Reverse: 5’ AAGAACATCGATTTTCCATGGCAG
GAP SEQ Forward: 5’ GGHATTGTTGAGGGTCTNATGAC
GAP SEQ Reverse: 5’ CCAGTGGTGCTRGGAATGATGTT
Sequenced products were then analyzed using bioinformatics.
BIOINFORMATICS and ANALYSIS
REFERENCES
Bio-Rad Laboratories (2008). Biotechnology Explorer™. Cloning and Sequencing Explorer Series. Bio-Rad.
http://www.fermentas.com/en/support/technical-reference/phage-plasmid-dna/pjet12
CBOL Plant Working Group. (2009, August 4). A DNA Barcode for Land Plants. (National Academy of Science) Retrieved 7-17, 2012,
from www.pnas.org: http://www.pnas.org/content/106/31/12794.full
Costion, C. A. (2011). Plant DNA Barcodes Can Accurately Estimate Species Richness in Poorly Known Floras. PLoS ONE, 6(11),
E26841.
Figge, R. M., Schubert, M., Brinkmann, H., & Cerff, R. (1999). Glyceraldehyde-3-Phosphate Dehydrogenase Gene Diversity in
Eubacteria and Eukaryotes: Evidence for Intra- and Inter-Kingdom Gene Transfer. Molecular Biology and Evolution, 16(4), 429-440.
Graciet, E., Lebreton, S., & Gontero, B. (2004). Emergence of new regulatory mechanisms in the Benson-Calvin pathway via
protein-protein interactions: a glyceraldehyde-3-phosphate
dehydrogenase /CP12/phosphoribulokinase complex. Journal of Experimental Botany, 1245-1254.
• PCR Reaction
• Transilluminator View
of Gel Products
• PJET1.2 Vector
• Positive Selection of
Transformants
• Restriction Digest of
Minipreps
• Quantification of
Products
• Electropherogram
• BLASTn Results of
Longest Reading
Frame
• BLASTp Results
• PDB Model of GAPDH
Hajirezaei, M. R. (2006). The influence of cytosolic phosphorylating glyceraldehyde 3-phosphate dehydrogenase (GAPC) on potato
tuber metabolism. Journal of Experimental Botany, 57(10), 2363-2377.
Harikrishnan KN, Bassal, S., Tikellis, C., & El-Osta, A. (2004). Expression Analysis of the Epigenetic Methyltransferases and MethylCpG Binding Protein Families in the Normal B-Cell and B-Cell Chronic Lymphocytic Leukemia (CLL). Cancer Biology & Therapy,
989-994.
Kress, W., & Erickson, D. (2007). A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the NonCoding trnH-psbA Spacer Region. PLoS ONE, 2(6), e508.
Long, M., De Souza, S. J., Rosenberg, C., & Gilbert, W. (1996, July 23). Exon shuffling and the origin of the mitochondrial targeting
function in plant cytochrome c1 precursor. Proceedings of the National Academy of Sciences, 93(15), 7727-7731.
Munoz-Beromeu, J., Cascales-minana, B., Alaiz, M., Segura, J., & Ros, R. (2010). A critical role of plastidial glycolytic
glyceraldehyde-3-phosphate dehydrogenase in the control of plant metabolism and development. Plant Signaling & Behavior, 6769.
Seki, T., Yoshino, K.-i., Tanaka, S., Dohi, E., Onji, T., Yamamoto, K., et al. (2012). Establishment of a Novel Fluorescence-Based
Method to Evaluate Chaperone-Mediated Autophagy in a Single Neuron. PLoS one.
ACKNOWLEDGEMENTS
DNA sequencing was performed by the DNA/Protein Resource Facility at Oklahoma
State University. The project described was supported by from the National Science
Foundation Community College Undergraduate Research Initiative housed at
Fingerlakes Community College. The funding assisted Tulsa Community College
Biotechnology to offer the Lab Sprints and the Lab Sprints Plus summer research
courses. The contents are solely the responsibility of the authors and do not
necessarily represent the official views of NSF.