Pluripotent Stem Cells
PLURIPOTENT STEM CELLS
Polarized Human Embryonic Stem Cell-Derived
Retinal Pigment Epithelial Cell Monolayers Have
Higher Resistance to Oxidative Stress-Induced Cell
Death Than Nonpolarized Cultures
JAMIE HSIUNG,a DANHONG ZHU,a DAVID R. HINTONa,b
Departments of aPathology
and bOphthalmology, Keck
School of Medicine of the
University of Southern
California, Los Angeles,
California, USA
Correspondence: David R.
Hinton, M.D., 2011 Zonal Avenue,
HMR209, Los Angeles, California
90089, USA. Telephone: 323-4426617; E-Mail: dhinton@usc.edu
Received September 16, 2014;
accepted for publication October
13, 2014; first published online in
SCTM EXPRESS November 19,
2014.
©AlphaMed Press
1066-5099/2014/$20.00/0
http://dx.doi.org/
10.5966/sctm.2014-0205
ABSTRACT
Oxidative stress-mediated injury to the retinal pigment epithelium (RPE) is a major factor involved in
the pathogenesis of age-related macular degeneration (AMD), the leading cause of blindness in the
elderly. Human embryonic stem cell (hESC)-derived RPE cells are currently being evaluated for their
potential for cell therapy in AMD patients through subretinal injection of cells in suspension and subretinal placement as a polarized monolayer. To gain an understanding of how transplanted RPE cells
will respond to the highly oxidatively stressed environment of an AMD patient eye, we compared the
survival of polarized and nonpolarized RPE cultures following oxidative stress treatment. Polarized,
nonpolarized/confluent, nonpolarized/subconfluent hESC-RPE cells were treated with H2O2. Terminal deoxynucleotidyl transferase dUTP nick end labeling stains revealed the highest amount of cell
death in subconfluent hESC-RPE cells and little cell death in polarized hESC-RPE cells with H2O2 treatment. There were higher levels of proapoptotic factors (phosphorylated p38, phosphorylated c-Jun
NH2-terminal kinase, Bax, and cleaved caspase 3 fragments) in treated nonpolarized RPE—particularly
subconfluent cells—relative to polarized cells. On the other hand, polarized RPE cells had constitutively higher levels of cell survival and antiapoptotic signaling factors such as p-Akt and Bcl-2, as well
as antioxidants superoxide dismutase 1 and catalase relative to nonpolarized cells, that possibly
contributed to polarized cells’ higher tolerance to oxidative stress compared with nonpolarized
RPE cells. Subconfluent cells were particularly sensitive to oxidative stress-induced apoptosis.
These results suggest that implantation of polarized hESC-RPE monolayers for treating AMD
patients with geographic atrophy should have better survival than injections of hESC-RPE cells in
suspension. STEM CELLS TRANSLATIONAL MEDICINE 2015;4:10–20
INTRODUCTION
Human embryonic stem cell (hESC)-derived retinal pigment epithelial (RPE) cells are currently being evaluated in clinical trials to replace damaged/
degenerated RPE in patients with age-related
macular degeneration (AMD) [1]. In AMD, the
leading cause of blindness among the elderly
worldwide [2], RPE cells are damaged or lost, leading to secondary photoreceptor impairment and
vision loss; thus, it is crucial to find ways to replace
lost RPE cells that may slow the disease progression [3]. hESCs are a good potential source for
generating RPE cells because they can be indefinitely self-renewed and expanded to generate
an almost unlimited source of young RPE cells [4].
There are currently two strategies for the delivery of hESC-derived RPE into the subretinal space:
injection of RPE cells in suspension and the placement of a monolayer of prepolarized RPE cells. Although suspension-injection is quicker and less
invasive, there is no way of controlling RPE attachment or of ensuring survival on the damaged
Bruch’s membrane; furthermore, cell aggregates
could form and damage the neural retina [5–8].
Suspension-injection of RPE cells into patients with
late dry AMD (geographic atrophy) and Stargardt’s
macular dystrophy (SMD) is currently in phase I/II
clinical trials (dry AMD, clinical trial NCT01344993;
SMD, clinical trial NCT01691261) in studies sponsored by Advanced Cell Technology [4]. Another
strategy consists of surgically inserting a patch
of polarized RPE cells grown on a membrane
designed to mimic the Bruch’s membrane into
the subretinal space. A phase I clinical trial is
planned to begin in 2015 to study hESC-RPE monolayer implantation grown on polyester for patients
with wet AMD (clinical trial NCT01691261). Our
California Institute for Regenerative Medicinefunded project (California Project to Cure Blindness) is completing preclinical work on a strategy
STEM CELLS TRANSLATIONAL MEDICINE 2015;4:10–20 www.StemCellsTM.com
©AlphaMed Press 2015
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Key Words. Age-related macular degeneration x Retinal pigment epithelial cell x
Embryonic stem cells x Polarized retinal pigment epithelial cell x Oxidative stress x
Apoptosis
Hsiung, Zhu, Hinton
MATERIALS AND METHODS
H9 ESC Stem Cell Culture and Differentiation
Use of the H9 ESC line was approved for use by the University of
Southern California Stem Cell Research Oversight Committee. Using the modified mTESR1 protocol from Stem Cell Technologies,
H9 ESCs (WiCell Research Institute, Madison, WI, http://www.
wicell.org) were cultured in mTesR 1 medium (StemCell Technologies, Vancouver, Canada, Canada, http://www.stemcell.com) on
6-well plates coated with hESC-qualified, lactate dehydrogenase
elevating virus (LDEV)-free Matrigel (BD Biosciences, San Jose, CA,
http://www.bdbiosciences.com). Stem cells were split every 5
days with the StemPro EZ Passage tool (Invitrogen, Carlsbad,
CA, http://www.invitrogen.com). Spontaneous differentiation
was initiated after 7 days of culturing, which consisted of changing
the mTesR 1 medium to Dulbecco’s modified Eagle’s medium:F12
(1:1), 200 mM L-glutamine, 15 mM HEPES (Corning Life Sciences,
Tewksbury, MA, http://www.corning.com/lifesciences) supplemented with 10% knockout serum replacement (Life Technologies, Carlsbad, CA, http://www.lifetech.com). Medium was
changed every 3–4 days during the 10-week differentiation
period.
www.StemCellsTM.com
RPE Cell Purification and Culture
After 10 weeks of differentiation, RPE cells were purified from
other differentiating cell types with a double-enzymatic method
based on the fact that RPE cells are more adherent to the plate.
RPE cells were washed with Dulbecco’s phosphate-buffered saline without Ca2+ or Mg2+ (Corning Life Sciences) and then incubated with 0.05% trypsin, 0.1% EDTA in Hanks’ balanced saline
solution (Corning Life Sciences) at 37°C for 5 minutes. The nonRPE cells were detached after the first trypsinization and pipetted
out. The remaining putative RPE cells were again incubated with
trypsin-EDTA for 5 minutes. The dissociated cells were counted
and plated at a density of 1 3 105 cells per cm2 onto plates coated
with phenol red-free, growth factor-reduced, LDEV-free Matrigel
(BD Biosciences). The cells continued to be cultured in the same
differentiation medium as described above with the medium
changed twice a week and were passaged every 4 weeks. Cells
were used for experiments through passage 4.
Plating Polarized and Nonpolarized/Confluent,
Nonpolarized/Subconfluent RPE Cells
RPE cells from passage 3 or 4 were grown on Matrigel-coated
Transwell plates with 0.4-mm pore size (Corning Life Sciences) until the transepithelial resistance (TER) reached at least 350 V×cm2
(approximately 4 weeks after seeding) [12]. TER of polarized RPE
was measured using an epithelial voltometer (World Precision
Instruments, Sarasota, FL, http://www.wpiinc.com). The reading
for the “blank” was obtained by measuring an empty well containing only medium and Matrigel. Nonpolarized/confluent RPE cells
were plated at a density of 1.3 3 105 cells per cm2 to reach confluence the following day, and nonpolarized/subconfluent RPE
cells were plated at 5.0 3 104 cells per cm2 to reach approximately
70% confluence the following day. Both confluent and subconfluent cells were also plated on Matrigel-coated plates and treated
with H2O2 the day after plating.
H2O2 Cell Treatment
Nonpolarized confluent and subconfluent cells were initially treated for 24 hours with a range of H2O2 concentrations from 0 to
1,000 mM, whereas polarized RPE were also initially treated with
a range of 0–1,400 mM H2O2 to determine which dosage was
associated with initiation of cell death. Nonpolarized RPE were
treated with 0 and 600 mM H2O2, whereas polarized RPE were
treated with 0, 600, and 1,000 mM H2O2 in serum-free medium
for most of the experiments. Depending on the experiment,
the length of treatment ranged from 15 minutes to 8 hours to
24 hours. After treatment, cells were harvested immediately
for RNA for quantitative reverse transcription-polymerase chain
reaction (Q-RT PCR) and protein for Western blot.
Q-RT PCR
Post-H2O2 treatment, polarized and nonpolarized RPE cells were
harvested with Buffer RLT containing b-mercaptoethanol (Sigma)
using the RNeasy kit (Qiagen, Valencia, CA, http://www.qiagen.
com) and homogenized with the Qiashredder (Qiagen). RNA
extraction was performed following the manufacturer’s instructions. RNA was then converted to cDNA following the instructions
of the ImPromII kit (Promega, Madison, WI, http://www.promega.
com). Q-RT PCR was performed in duplicate following the instructions of the Light Cycler 480 SYBR Green I Master (Roche,
©AlphaMed Press 2015
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
using hESC-RPE monolayer grown on parylene for AMD patients
with geographic atrophy [1]. Although the latter strategy is surgically more invasive, the cells are less likely to proliferate or migrate, with the main advantage being that the RPE cells are
prepolarized [9]. As a polarized monolayer of pigmented neuroepithelial cells, the RPE transports substances between the photoreceptors and the choroidal blood vessels [10], has well-defined
tight junctions [11], secretes growth factors, and phagocytoses
shed photoreceptor outer segments. Thus, prepolarized RPE
monolayers should function better than cell suspensions if the cell
suspension does not form polarized monolayers in vivo.
The RPE monolayer is naturally polarized in vivo, whereas RPE
cell cultures can also develop into a comparable polarized monolayer in vitro. When hESC-derived RPE cells are passaged, they initially lose their polarity and are in a similar state as hESC-RPE cell
suspensions. Although they are able to regain polarity in approximately 4 weeks in vitro [12], there is little evidence that cell suspensions will polarize over large areas in vivo [4, 9].
Oxidative stress is thought to contribute to the onset and progression of AMD [13–15]. Aging results in an increase of cellular
exposure to oxidative stress, in which there is a build-up of damaging reactive oxygen species and a decline in antioxidants
[16–19]. In a head-to-head comparison, we have shown that prepolarized cell sheets of hESC-derived RPE have better survival
than cell suspensions following transplantation in the nude rat
[9]. Similarly, in the ARPE-19 immortalized RPE cell line, further
differentiated 5-week-old cultured cells were more resistant to
H2O2 treatment compared with 1-week-old cultured cells [20].
Polarized RPE may have an advantage over nonpolarized RPE in
oxidative stress resistance because of their increased pigmentation, because melanosomes have been shown to protect against
oxidative stress [21], as well as the ability to secrete higher
amounts of neurotrophic factors like pigment epithelial-derived
factor relative to nonpolarized RPE [22]. Thus, in support of the
transplantation of prepolarized hESC-RPE, we hypothesize that
polarized confluent RPE are more resistant to oxidative stress relative to subconfluent or nonpolarized confluent cells.
11
Polarization of RPE Monolayer and Oxidative Stress
12
Indianapolis, IN, http://www.roche.com). The glyceraldehyde-3phosphate dehydrogenase (GAPDH) housekeeping gene was used
for the internal control. Fold changes were calculated based on
the average of three different biological samples. The primer
sequences are as follows: superoxide dismutase 1 (SOD1): forward,
TCCATGTTCATGAGTTTGGAGAT, and reverse, TCTGGATAGAGGATTAAAGTGAGGA; superoxide dismutase 2 (SOD2): forward, AATCAGGATCCACTGCAAGG, and reverse, TAAGCGTGCTCCCACACAT;
Bcl2: forward, AGTACCTGAACCGGCACCT, and reverse, GCCGTACAGTTCCACAAAGG; Bax: forward, AGCAAACTGGTGCTCAAGG, and
reverse, TCTTGGATCCAGCCCAAC; and p21: forward, CCGAGGCACTCAGAGGAG, and reverse, AGCTGCTCGCTGTCCACT.
Western Blot
Student’s t test was used to determine statistical significance. All
the tests were two-sided, and the accepted level of significance
was p , .05.
RESULTS
Polarized RPE Are More Resistant to
H2O2-Mediated Apoptosis
The polarized, nonpolarized/confluent, and nonpolarized/
subconfluent H9-RPE cells were treated in a dose ranging from
200 to 1,000 mM H2O2 for 24 hours to gauge the best concentration to analyze cell death. At 600 mM H2O2 (Fig. 1A), subconfluent
H9-RPE cells showed rounding up of cells and cell detachment,
whereas confluent cells showed focal cell detachment; however,
polarized H9-RPE appeared unaffected by the treatment. At 1,000
mM treatment, all nonpolarized RPE detached, whereas polarized
RPE began to show some detachment. Next, the treated cells
were analyzed for cell death using terminal deoxynucleotidyl
transferase dUTP nick end labeling (TUNEL) staining. At 600
mM H2O2, despite many cells detaching from the plate, nearly
100% of all remaining subconfluent cells stained positive for
TUNEL, compared with approximately 15% of TUNEL-positive
confluent cells; no TUNEL-positive cells were detected in treated
polarized cells. At 800 and 1,000 mM, nonpolarized RPE had completely detached, whereas polarized cultures began to die with
1,000 mM treatment (Fig. 1B, 1C). These results indicated 600
mM H2O2 demonstrated best differential amounts of cell death,
and 1,000 mM H2O2 showed substantial cell death in polarized
RPE; therefore, we continued to use these dosages in further
experiments.
Caspase 3 is a major regulator of cell death, which, upon activation, executes apoptosis by catalyzing the cleavage of certain
cellular proteins at specific amino acid sequences. Cleaved or
activated caspase 3 (CC3) has 19/17- and 12-kDa bands. Western
blot indicates that nonpolarized RPE had constitutively higher
CC3 relative to polarized RPE in untreated cells (Fig. 1D). Following treatment, the total level of CC3 increased considerably in
confluent RPE and subconfluent RPE; however, levels of CC3
remained very low in polarized RPE. These results indicate that
polarized RPE are more resistant to oxidative stress-induced apoptosis relative to nonpolarized cells, and the level of confluence
plays a significant role in the degree of cell death from oxidative
stress.
Terminal Deoxynucleotidyl Transferase dUTP Nick End
Labeling Assay
Polarized RPE TER Drop Corresponds to Sudden Increase
in H2O2 Cell Death
Post-H2O2 treatment, cells were fixed in 4% paraformaldehyde for
30 minutes. After permeabilization with Triton X-100, cells were
incubated with TdT enzyme (Promega, Madison, WI, http://www.
promega.com) for 1 hour at 37°C. Samples were mounted
using Vectashield mounting medium with 49,6-diamidino-2phenylindole (DAPI) (Vector Laboratories). Images were taken
at three random fields for each sample using the 103 objective.
The average number of positively stained green cells from three
fields was counted relative to the average number of DAPIstained nuclei to obtain the percentage of positively stained cells
in each sample.
Additionally, we evaluated the TER of the polarized cells after
treatment with increasing concentrations of H2O2. The TER was
relatively stable at approximately 350 V×cm2 when treated with
lower H2O2 doses and then dropped at 1,000 mM H2O2 (p , .05)
(Fig. 2A). When TER was plotted against percentage of cell death,
the TER was consistently at approximately 350 V×cm2 with no cell
death until approximately 150 V×cm2, which corresponded to
a sudden spike in cell death of 35% (Fig. 2B). This suggests that
the abrupt increase of cell death at 1,000 mM H2O2, which corresponded to the sudden drop in TER, was associated with the detachment of cells from the monolayer.
©AlphaMed Press 2015
S TEM C ELLS T RANSLATIONAL M EDICINE
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Post-H2O2 treatment, cells were harvested with 1:1 mammalian
protein extraction reagent (Thermo Scientific, Waltham, MA)
containing 1:100 addition of protease inhibitor cocktail (SigmaAldrich, St. Louis, MO, http://www.sigmaaldrich.com) and
Laemmli buffer (Bio-Rad, Hercules, CA, http://www.bio-rad.
com) and 1:20 addition of b-mercaptoethanol. Samples were
boiled for 5 minutes, and 10 mg of sample were loaded into
10% or 15% Tris-HCl gels (Bio-Rad), depending on the protein size.
The gel was transferred onto a polyvinylidene difluoride membrane (Millipore, Temecula, CA) and incubated with the following
primary antibodies at 4°C overnight at the specified dilution in 5%
nonfat milk with TBS and 0.1% Tween buffer (TBST): p38 (1/1,000)
(Cell Signaling Technology, Beverly, MA, http://www.cellsignal.
com), phosphorylated p38 (p-p38) (1/1,000) (Cell Signaling Technology), c-Jun NH2-terminal kinase (JNK) (1/1,000) (Cell Signaling
Technology), phosphorylated JNK (p-JNK) (1/1,000) (Cell Signaling
Technology), Bcl-2 (1/500) (Cell Signaling Technology), Bax (1/
1,000) (Cell Signaling Technology), Caspase 3 (1/100) (Cell Signaling Technology), SOD1 (1/1,000) (Abcam, Cambridge, MA, http://
www.abcam.com), SOD2 (1/1000) (Abcam), p53 (1/1,000) (Millipore, Temecula, CA, http://www.millipore.com), catalase (1/
1,000), Akt (1/1,000), p-Akt (1/1,000) (Cell Signaling Technology),
and phosphorylated phosphatase and tensin homolog (p-PTEN)
(1/1,000) (Cell Signaling Technology). The following day, the
membranes were incubated for 1 hour with corresponding secondary antibodies conjugated with peroxidase (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com) before being
subjected to ECL substrate (Thermo Fisher Scientific, Waltham,
MA, http://www.thermofisher.com) followed by exposure to
film. Densitometry analysis of Western Blots was performed using
Image J software with n = 3.
Statistics
Hsiung, Zhu, Hinton
13
Nonpolarized RPE Have Higher Levels of Proapoptotic
Signaling Pathways
We then evaluated apoptotic signaling pathways that were likely
to play a role in nonpolarized RPE’s sensitivity to oxidative stress.
The JNK and p38 mitogen-activated protein kinase (MAPK) signaling pathways have been found to mediate oxidative stressinduced apoptosis in RPE [23]. We found constitutively strong
levels of p-p38 and p-JNK in untreated nonpolarized RPE in
Figure 3A and 3B, and additionally, upon oxidative stress treatment, there were significant increases in both p-p38 and p-JNK
levels in nonpolarized RPE, with the highest levels found in subconfluent RPE. However, in polarized RPE, p-p38 and p-JNK levels
were barely detectable in the untreated control and treated samples. These results show that the p38 and JNK apoptotic signaling
pathways are more highly activated in nonpolarized RPE than in
polarized RPE when under oxidative stress.
JNK and p38 have previously been shown to phosphorylate and
activate the proapoptotic transcription factor p53, which in turn can
activate p21Waf1/Cip1 for cell cycle arrest. Before treatment, polarized
RPE had the lowest levels of p53 and p21, whereas subconfluent RPE
constitutively expressed the highest amount of p53 and p21. Following H2O2 treatment, subconfluent RPE experienced the largest increase in p53 and p21 (protein and mRNA). It was only with 1,000
mM treatment that polarized RPE experienced a small increase in
p53 and p21 (Fig. 3C, 3D). These results indicate that p53 is activated
by H2O2 stress in all RPE types, but the activation in nonpolarized RPE,
particularly subconfluent cells, is strongest. These data also show that
www.StemCellsTM.com
the stronger p38 and JNK activation signaling in nonpolarized RPE
resulting from H2O2 insult likely caused an increase in p53 expression.
The mitochondrial outer membrane permeability (MOMP),
significant for the onset of apoptosis via caspase activation, is
highly regulated by a group of proteins in the B-cell lymphoma
(Bcl-2) family. One of the members, Bcl-2 associated X protein
(Bax), when activated by intrinsic or extrinsic stimuli, can disrupt
the MOMP and initiate apoptosis. Antiapoptotic protein Bcl-2
prevents MOMP by binding to Bax. Other groups have found evidence of JNK and p38 kinase directly phosphorylating and activating Bax and consequently apoptosis [24]. Figure 4 compares Bax
levels in polarized and nonpolarized RPE. Q-RT PCR results indicate that after H2O2 treatment for 24 hours, Bax expression levels
nearly doubled relative to respective untreated cells in nonpolarized cultures (p , .05), whereas in polarized RPE, there was no
significant change at either treatment. However, protein expression levels of Bax were unchanged throughout the various samples with the exception of a significant drop in Bax levels in
subconfluent cells after 24-hour treatment (Fig. 4A). After
a shorter, 8-hour treatment, Bax in subconfluent cells significantly
increased (p , .05) while remaining unchanged in polarized or
confluent RPE (Fig. 4B). This could be attributed to the majority
of treated subconfluent cells having already passed the early
stages of apoptosis because many cells have detached. Q-RT
PCR, a more sensitive assay, was likely able to detect the few
remaining cells that still express Bax. Taken together, these
results suggest that nonpolarized RPE are more sensitive to
©AlphaMed Press 2015
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Figure 1. Polarized H9-retinal pigment epithelial (RPE) cells had highest resistance to H2O2-mediated cell apoptosis. (A): Nonpolarized H9-RPE
cells were seeded at various concentrations and reached desired confluence the following day; subconfluent: 1.0 3 104 cells per cm2; confluent
and polarized RPE: 1.3 3 105 cells per cm2. Polarized H9-RPE cells were cultured for approximately 1 month with transepithelial resistance of
least 350 V×cm2 before treatment. H9-RPE cells were treated with 600 mM H2O2 for 24 hours. Subconfluent cells appeared to have the highest
amount of cell death, and confluent cells also appeared to have some cell death. Polarized cells appeared unaffected by the treatment. (B):
Overlay of terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and 49,6-diamidino-2-phenylindole-stained cells treated with
600 mM H2O2 showed the most TUNEL-positive cells in subconfluent cells relative to confluent cultures. TUNEL staining did not detect any cell
death at 600 mM H2O2 treatment in polarized cells, but TUNEL-positive cells appeared in polarized cultures at 1,000 mM. (C): Average percentage
of positive TUNEL-stained cells counted in three random fields. (D): Western blot indicated that the total level of cleaved caspase 3 (19/17- and
12-kDa fragments) was higher in treated nonpolarized cells compared with polarized RPE in cells treated for 8 hours. n = 4; p, p , .05; pp, p , .01.
Abbreviations: Cl., cleaved; Con., confluent; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Pol., polarized; Sub., subconfluent.
14
Polarization of RPE Monolayer and Oxidative Stress
Polarized RPE Express Constitutively Higher Levels
of Antioxidants
Figure 2. Cell death in H2O2-treated polarized H9-RPE corresponded
to a drop in TER. (A): TER of polarized RPE cells did not drop significantly with increasing H2O2 dosage up to 1,000 mM. (B): Percentage
of TUNEL-positive cells in polarized cultures plotted against TER in polarized cultures treated with H2O2. n = 3; p, p , .05. Abbreviations:
RPE, retinal pigment epithelium; TER, transepithelial resistance.
oxidative stress-induced apoptosis resulting from higher activation levels of JNK and p-38 signaling pathways, which in turn could
initiate the MOMP through Bax or via p53 activation of Bax to activate caspase 3.
Polarized RPE Have Constitutively Higher Levels of Cell
Survival Signaling
Next, we looked at possible cell survival signaling mechanisms responsible for polarized RPE’s higher resistance to oxidative stress.
The phosphoinositide 3-kinase (PI3K)/Akt cell survival signaling
pathway has been shown to be activated in the RPE following exposure to H2O2 [25] to drive cell survival as well as increase antioxidant superoxide dismutase 1 expression [26]. Figure 5A shows
that although all cell groups experienced an increase in phosphorylated Akt (p-Akt) following oxidant treatment relative to corresponding untreated cultures in, polarized RPE had constitutively
higher levels of p-Akt relative to nonpolarized RPE (p , .05). We
©AlphaMed Press 2015
We were interested in investigating SOD levels, because the PI3K/
Akt pathway has been shown to regulate SOD1 expression. Polarized RPE expressed constitutively higher levels of SOD1 in
untreated cells compared with nonpolarized RPE, and the expression remained consistently strong following treatment, despite
the higher H2O2 dosage. However, in nonpolarized RPE, following
H2O2 treatment, SOD1 experienced a decrease in expression with
the largest drop in subconfluent cells, according to Q-RT PCR and
Western blot data (Fig. 7A). Q-RT PCR results show that SOD2 expression increased in nonpolarized cells relative to polarized cells
(p , .05) after H2O2. There were no changes in levels of SOD2
mRNA in polarized cells before and after treatment (Fig. 7B). However, SOD2 protein expression levels were unchanged in cells
post-treatment compared with corresponding control cells. Thus,
SOD1 most likely plays a greater role in preventing oxidative
stress-mediated apoptosis in RPE cells.
Another antioxidant factor, catalase, was found to be expressed
similarly to SOD1. Polarized RPE had the highest baseline level of catalase, and its level remained unchanged after oxidative stress treatment, whereas subconfluent RPE had the least baseline level of
catalase, and the expression further drops following treatment
(Fig. 7C). These results indicate that polarized RPE are protected
from oxidative stress, which may be a result of their constitutively
higher levels of SOD1 and catalase. Additionally, SOD1 and catalase
expression levels remained high, even after higher dosages of H2O2,
whereas they decreased in nonpolarized cells.
DISCUSSION
Oxidative stress is one of the major factors contributing to the
death of RPE in AMD. Transplantation of hESC-derived RPE
cells has the potential to replenish and replace damaged or lost
RPE cells. So far, two major forms of hESC-derived RPE cells,
S TEM C ELLS T RANSLATIONAL M EDICINE
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
also looked at PTEN, a negative regulator for the PI3K/Akt signaling
pathway. Although levels of PTEN inversely correlate with p-Akt,
phosphorylation of PTEN causes PTEN inactivation, which indirectly results in the activation of PI3K/Akt pathways. Figure 5B
indicates that oxidative stress treatment does not increase
p-PTEN expression in any of the RPE culture types; however, there
were higher baseline p-PTEN levels (p , .05) in polarized RPE relative to nonpolarized RPE in untreated cells. These results indicate that polarized RPE are more likely to survive oxidative
stress, because polarized RPE have a constitutively higher active
Akt survival pathway, which could be partly driven by higher
p-PTEN levels.
Activation of the PI3K/Akt pathway has been shown to transcriptionally upregulate Bcl-2 expression [27]. Both Western blot
and Q-RT PCR shows that baseline Bcl-2 is significantly higher in
polarized RPE relative to nonpolarized cells (p , .05). Following
treatment, whereas nonpolarized RPE experienced a drop in Bcl-2
expression, Bcl-2 levels in polarized RPE noticeably increased (Fig.
6A). Furthermore, in polarized RPE, there was a higher Bcl-2:Bax
ratio relative to nonpolarized cells (Fig. 6B). These results, which
correlate with our p-Akt findings, indicate that polarized RPE are
protected from induction of apoptosis compared with nonpolarized cells because of their higher antiapoptotic Bcl-2 levels, likely
resulting from higher Akt phosphorylation.
Hsiung, Zhu, Hinton
15
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Figure 3. Treated nonpolarized RPE had greatest levels of proapoptotic signaling relative to polarized RPE. (A): Following treatment with 600
mM H2O2, phosphorylated p38 (38 kDa) increased relative to untreated cells but was not detected in either treated or untreated polarized RPE.
b-Actin (47 kDa) was used as a loading control. (B): Treatment with 600 mM H2O2 resulted in highest phosphorylated JNK in subconfluent cultures (46,54 kDa). (C): Following treatment with 600 mM H2O2, polarized RPE had the lowest expression of proapoptotic p53 (53 kDa) relative to
nonpolarized cultures. (D): Western blot and Q-RT PCR quantification indicated highest expression of p21 (21 kDa) in treated subconfluent cells.
GAPDH (38 kDa) was used as a loading control. n = 3; p, p , .05; pp, p , .01. Abbreviations: Con., confluent; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; JNK, c-Jun NH2-terminal kinase; Pol, polarized; Q-RT PCR, quantitative reverse transcription-polymerase chain reaction; RPE,
retinal pigment epithelium; Sub., subconfluent.
prepolarized RPE sheets and dissociated RPE cell suspensions,
have been used to transplant or inject into the subretinal space
of the eye [28]. To elucidate the issue of how those implanted
RPE cells will react in the eye of an AMD patient, a highly oxidative
stressed in vivo environment [14], we compared the resistance to
oxidative stress of polarized relative to nonpolarized RPE cells.
www.StemCellsTM.com
Our results demonstrate that polarized RPE cells are more resistant to H2O2-mediated apoptosis than nonpolarized cultures.
RPE cell replacement has been widely used in studies rescuing
vision loss in animal models and therapies of AMD and other vision loss diseases. Many RPE cell types were applied in those studies and therapies, such as fetal RPE [29], ARPE-19, h1RPE7 cell
©AlphaMed Press 2015
16
Polarization of RPE Monolayer and Oxidative Stress
Figure 5. Less cell death in polarized H9-retinal pigment epithelium (RPE) could be attributed to higher activation of cell survival signaling, such
as p-Akt and p-PTEN. (A): Among untreated controls, the highest p-Akt (60 kDa) levels were in polarized RPE. (B): The highest levels of p-PTEN (54
kDa) were found in polarized RPE. n = 3; p, p , .05; pp, p , .01. Abbreviations: Con., confluent; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Pol, polarized; Sub., subconfluent.
lines [30], and, recently, stem cell-derived RPE. There are currently several ongoing and planned clinical trials using suspension
injection and monolayer implantation to treat AMD and other
blinding diseases. The key factor for successful transplantation
is survival of implanted cells in the host. Despite the widespread
©AlphaMed Press 2015
usage of injecting suspended cells for AMD therapy, there are
some obstacles associated with this method with respect to cell
survival. Our group previously showed that most hESC-RPE
suspension-injected cells died within 6 months of grafting into immunocompromised rats. However, placement of prepolarized
S TEM C ELLS T RANSLATIONAL M EDICINE
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Figure 4. Treated subconfluent retinal pigment epithelium (RPE) had the highest proapoptotic Bax expression levels. (A): Following 24 hours of
treatment with H2O2, Bax protein (20 kDa) levels noticeably decreased in subconfluent RPE. Q-RT PCR indicated elevated proapoptotic Bax
expression in treated nonpolarized RPE. (B): Western blot indicated the highest Bax expression in subconfluent RPE at 8 hours of treatment.
GAPDH (38 kDa) was used as a loading control. n = 3; p, p , .05; pp, p , .01. Abbreviations: Con., confluent; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; Pol, polarized; Q-RT PCR, quantitative reverse transcription-polymerase chain reaction; Sub., subconfluent.
Hsiung, Zhu, Hinton
17
RPE into the subretinal space of the same animal model resulted
in far more cells surviving, even after 12 months [9]. These results
indicated that suspension-injected cells appear more vulnerable
to cell death relative to the placement of prepolarized RPE. We
thought there are several reasons for the short life of implanted
nonpolarized cells in the host environment. First, dissociated cells
may have difficulty in attaching and surviving on the Bruch’s
membrane of AMD patients. Sugino et al. [7] seeded hESC-RPE
onto aging Bruch’s membrane explants and observed poor cell attachment and cells peeling off. On the other hand, RPE cells grown
on a biocompatible scaffold that mimics the Bruch’s membrane
could rectify this issue. Additionally, dissociated RPE cells have
more immunogenicity than polarized RPE sheet. There have been
reports that suspension-injected RPE are more sensitive to immune rejection compared with monolayer transplantation [31].
This is thought to be attributed to the disruption of the monolayer
[32, 33]. Third, dissociated RPE cells are more sensitive to oxidative stress-induced cell death. Based on our in vitro results shown
here, in an oxidant-rich in vivo environment like that found in
AMD patients, we would expect suspension-injected RPE to succumb more readily to cell death than polarized RPE.
We have designed three types of hES-RPE cells, polarized RPE
cell, nonpolarized confluent RPE cells, and nonpolarized, subconfluent RPE cells in this study to mimic the cell types of transplanted RPE cells that have been used for cell replacement
therapy to treat AMD. With suspension injection of RPE cells, despite the final goal being RPE cell integration within host cells on
Bruch’s membrane, the actual fate and integration of the injected
cells is difficult to control. Although some papers have shown
injected RPE cells integrated between the host cells, most
injected RPE cells aggregated into large cell clumps, attached to
the apical side of the host RPE forming multiple layers, or formed
www.StemCellsTM.com
dispersedly distributed small cell clumps [9, 34]. We designed the
two types of nonpolarized RPE cells, confluent and nonconfluent,
in our study to imitate the condition of most post-injected RPE
cells. Our subconfluent cell cultures are typically a mix of small
clusters of cells as well individual cells and serve as a model for
injected RPE cells that form small cell clumps in the subretinal
space. Conversely, our confluent culture model is indicative of situations where injected RPE cells form large cell clumps and/or
multiple layers on the apical side of the host RPE.
The effects of oxidative stress in RPE have also been studied
extensively in ARPE-19 cells. Although the TER in polarized ARPE19 is notably lower than in polarized hESC-RPE, studies have indicated that further differentiated, polarized ARPE-19 cells have
substantially fewer disruptions of tight junction proteins when
subjected to the same dosage of oxidative stress as less differentiated ARPE-19 cultures [20]. The authors had to significantly increase their H2O2 dosage in the differentiated ARPE-19 cells to
obtain levels of junction protein disruption similar to those of
the less differentiated ARPE-19 cells. This paralleled our finding
that the same H2O2 dosage that caused nonpolarized RPE cell
death had no effect on polarized hESC-RPE TER; instead, the concentration had to be doubled to induce a decline in TER. Another
group found that H2O2 in the presence of serum further disrupted
the polarized RPE monolayer by instigating complement activation, which has been associated with AMD pathogenesis [35].
H2O2, one of major reactive oxygen species and a precursor to
tissue-damaging free radicals, is naturally produced in vivo. The
eye is a highly oxidative stressed tissue. In normal human eyes,
H2O2 levels in the aqueous humor have been reported to be in
the range of 14–31 mM, whereas under pathological conditions
such as cataracts, H2O2 levels can range from 33 to 500 mM in
the aqueous humor [36–38]. Several groups have shown H2O2
©AlphaMed Press 2015
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Figure 6. Polarized retinal pigment epithelium (RPE) constitutively had higher levels of antiapoptotic Bcl-2. (A): Western blot and Q-RT PCR
showed a decrease in antiapoptotic Bcl-2 (26 kDa) expression in nonpolarized RPE following treatment relative to untreated cells, whereas levels
in polarized RPE remained high. (B): Direct comparison of Bcl-2 levels relative to Bax levels based on Western blot quantification. n = 3; p, p , .05;
pp, p , .01. Abbreviations: Con., confluent; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Pol, polarized; Q-RT PCR, quantitative reverse
transcription-polymerase chain reaction; Sub., subconfluent.
18
Polarization of RPE Monolayer and Oxidative Stress
at this pathological range stimulating apoptosis in RPE cells in
vitro and shown high numbers of apoptotic RPE cells in postmortem AMD eyes [23, 39, 40]. Because the implanted RPE will remain
in the highly oxidative stressed environment of an AMD patient’s
eye, we simulated those pathological conditions with high dosages of H2O2 to treat hESC-RPE cells in vitro and compared the resistance to the oxidative stress between the polarized and
nonpolarized RPE cells. From the results, we observed that the polarized RPE cells had far less cell death in these artificial pathological conditions than nonpolarized RPE cells.
In all cells, there is a complex balance between proapopototic
and antiapoptotic factors that determines whether a particular
cellular insult activates apoptosis or cell survival signaling. We
found here that polarized RPE had higher levels of cell survival factors (p-Akt, Bcl-2, SOD1, and catalase) that aided them in survival
in oxidative stress. These antiapoptotic factors likely initiated
a cell survival signaling cascade when polarized RPE were exposed
to oxidative stress. H2O2 has previously been shown to activate
Akt and protect ARPE-19 cells from oxidant-induced cell death
[25]. p-Akt is known to transcriptionally elevate Bcl-2 expression,
©AlphaMed Press 2015
which in turn has been shown to increase SOD1 levels as well as
catalase activity [26, 27, 41–43]. SOD1 is the copper/zinc form of
superoxide dismutase, which catalyzes the reaction of superoxide
anion to H2O2 and oxygen, whereas catalase further breaks down
H2O2 to water and oxygen. Bcl-2 is known to inhibit Bax from releasing cytochrome C, which prevents caspase activation [44, 45].
Consequently, the increased levels of cell survival signaling in
polarized RPE might prevent any proapoptotic signaling. Akt signaling has been shown to inactivate proapoptotic molecules including caspase 9 and BAD in rhabdomyosarcoma [46–48]. In
our results, levels of proapoptotic p-p38, p-JNK, p53, and p21
were barely detectable/very low in untreated polarized RPE,
and there were just modest increases of p-p38, p-JNK, p53, and
p21 in polarized RPE following oxidative stress treatment.
We found nonpolarized RPE, particularly subconfluent RPE, to
have the highest amount of proapoptotic factors and conversely
the lowest levels of cell survival signaling. p-p38, p-JNK, p53, and
p21 were found to be highest in subconfluent RPE [23, 49]. JNK
and p38 were shown to be activated as a result of H2O2 treatment
and to be responsible for Bax translocation into the mitochondria
S TEM C ELLS T RANSLATIONAL M EDICINE
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Figure 7. There were significantly higher levels of antioxidant proteins superoxide dismutase 1 (SOD1) and catalase expressed in polarized
retinal pigment epithelium (RPE) relative to nonpolarized RPE. (A–C): Western blot and Q-RT PCR results of SOD1 ([A], 17 kDa), SOD2 ([B],
25 kDa), and catalase ([C], 60 kDa) (protein levels only) in treated polarized and nonpolarized RPE. n = 3; p, p , .05. Abbreviations: Con., confluent; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Pol, polarized; Q-RT PCR, quantitative reverse transcription-polymerase chain reaction; Sub., subconfluent.
Hsiung, Zhu, Hinton
19
to induce apoptosis in RPE cells [23]. Phosphorylation of JNK and
p38 has also been shown to activate p53, which in turn transcriptionally activates Bax as well as p21, which is also responsible for
cell cycle arrest. One of the ways that p-JNK initiates apoptosis is
through inactivation of Bcl-2, and this was indicated in our results
with barely detectable Bcl-2 levels in treated subconfluent cells
[50]. Taken together, these results indicate that nonpolarized
RPE, and particularly subconfluent cells, experienced higher levels of p53-activated, Bax-mediated apoptosis associated with activation of the JNK and p38 MAPK pathway. Unlike polarized RPE,
nonpolarized RPE do not possess high levels of cell survival signaling, thus making them vulnerable to the elevated proapoptotic
signaling and more sensitive to oxidative stress.
Polarized RPE are most resistant to oxidative stress-mediated cell
death because they have constitutively higher levels of cell survival signaling, antiapoptotic protein, and antioxidants compared
with nonpolarized RPE. On the other hand, subconfluent RPE are
most susceptible to oxidative stress with the greatest levels of
proapoptotic factors and limited amounts of prosurvival signaling
factors and antioxidants. Based on these findings, we conclude
that grafted RPE cells would better survive in high oxidative
stressed environments if the RPE are polarized; hence use of polarized RPE is likely to be beneficial to patients with AMD undergoing hESC-RPE cell replacement therapy.
REFERENCES
1 Bharti K, Rao M, Hull SC et al. Developing
cellular therapies for retinal degenerative diseases. Invest Ophthalmol Vis Sci 2014;55:
1191–1202.
2 Gehrs KM, Anderson DH, Johnson LV et al.
Age-related macular degeneration: Emerging
pathogenetic and therapeutic concepts. Ann
Med 2006;38:450–471.
3 da Cruz L, Chen FK, Ahmado A et al. RPE
transplantation and its role in retinal disease.
Prog Retin Eye Res 2007;26:598–635.
4 Schwartz SD, Regillo CD, Lam BL et al. Human embryonic stem cell-derived retinal pigment epithelium in patients with age-related
macular degeneration and Stargardt’s macular
dystrophy: Follow-up of two open-label phase
1/2 studies. Lancet 2014 [Epub ahead of print].
5 Pan CK, Heilweil G, Lanza R et al. Embryonic
stem cells as a treatment for macular degeneration. Expert Opin Biol Ther 2013;13:1125–1133.
6 Wongpichedchai S, Weiter JJ, Weber P
et al. Comparison of external and internal
approaches for transplantation of autologous
retinal pigment epithelium. Invest Ophthalmol
Vis Sci 1992;33:3341–3352.
7 Sugino IK, Sun Q, Wang J et al. Comparison
of FRPE and human embryonic stem cellderived RPE behavior on aged human Bruch’s
membrane. Invest Ophthalmol Vis Sci 2011;
52:4979–4997.
8 Ho TC, Del Priore LV. Reattachment of
cultured human retinal pigment epithelium
to extracellular matrix and human Bruch’s
membrane. Invest Ophthalmol Vis Sci 1997;
38:1110–1118.
9 Diniz B, Thomas P, Thomas B et al. Subretinal implantation of retinal pigment epithelial
www.StemCellsTM.com
We thank Christine Spee for her help with cell preparation and
Ernesto Barron and Eric Barron for their help with figure preparation and design. This work was supported by California Institute
for Regenerative Medicine Grant DR1-01444, a grant from the
Arnold and Mabel Beckman Foundation to the Doheny Eye Institute, and Award P30CA014089 from the National Cancer Institute. The content is solely the responsibility of the authors and
does not necessarily represent the official views of the National
Cancer Institute or the National Institutes of Health.
AUTHOR CONTRIBUTIONS
J.H.: conception and design, collection and/or assembly of data,
data analysis and interpretation, manuscript writing; D.Z.: conception and design, data analysis and interpretation, manuscript
writing; D.R.H.: conception and design, data analysis and interpretation, financial support, administrative support, manuscript
writing, final approval of manuscript.
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
D.R.H. is founder and an uncompensated consultant of Regenerative Patch Technologies, has uncompensated patents submitted
through the University of Southern California, and is a compensated consultant for Oversight Committee for NYSTEM. The other
authors indicated no potential conflicts of interest.
cells derived from human embryonic stem cells:
Improved survival when implanted as a monolayer. Invest Ophthalmol Vis Sci 2013;54:
5087–5096.
10 Marmorstein AD. The polarity of the
retinal pigment epithelium. Traffic 2001;2:
867–872.
11 Sonoda S, Sreekumar PG, Kase S et al. Attainment of polarity promotes growth factor
secretion by retinal pigment epithelial cells:
Relevance to age-related macular degeneration. Aging (Albany, NY Online) 2010;2:28–42.
12 Sonoda S, Spee C, Barron E et al. A protocol for the culture and differentiation of highly
polarized human retinal pigment epithelial
cells. Nat Protoc 2009;4:662–673.
13 Cai J, Nelson KC, Wu M et al. Oxidative
damage and protection of the RPE. Prog Retin
Eye Res 2000;19:205–221.
14 Handa JT. How does the macula protect
itself from oxidative stress? Mol Aspects Med
2012;33:418–435.
15 Beatty S, Koh H, Phil M et al. The role of
oxidative stress in the pathogenesis of agerelated macular degeneration. Surv Ophthalmol 2000;45:115–134.
16 Bowes Rickman C, Farsiu S, Toth CA et al.
Dry age-related macular degeneration: Mechanisms, therapeutic targets, and imaging. Invest
Ophthalmol Vis Sci 2013;54:ORSF68-80.
17 Yildirim Z, Ucgun NI, Yildirim F. The role of
oxidative stress and antioxidants in the pathogenesis of age-related macular degeneration.
Clinics (Sao Paulo) 2011;66:743–746.
18 Tokarz P, Kaarniranta K, Blasiak J. Role of
antioxidant enzymes and small molecular
weight antioxidants in the pathogenesis of
age-related macular degeneration (AMD). Biogerontology 2013;14:461–482.
19 Nowak JZ. Oxidative stress, polyunsaturated fatty acids-derived oxidation products
and bisretinoids as potential inducers of
CNS diseases: Focus on age-related macular
degeneration. Pharmacol Rep 2013;65:288–
304.
20 Bailey TA, Kanuga N, Romero IA et al. Oxidative stress affects the junctional integrity of
retinal pigment epithelial cells. Invest Ophthalmol Vis Sci 2004;45:675–684.
21 Burke JM, Kaczara P, Skumatz CM et al.
Dynamic analyses reveal cytoprotection by
RPE melanosomes against non-photic stress.
Mol Vis 2011;17:2864–2877.
22 Zhu D, Deng X, Spee C et al. Polarized secretion of PEDF from human embryonic stem
cell-derived RPE promotes retinal progenitor
cell survival. Invest Ophthalmol Vis Sci 2011;
52:1573–1585.
23 Ho TC, Yang YC, Cheng HC et al. Activation
of mitogen-activated protein kinases is essential for hydrogen peroxide -induced apoptosis
in retinal pigment epithelial cells. Apoptosis
2006;11:1899–1908.
24 Kim BJ, Ryu SW, Song BJ. JNK- and p38
kinase-mediated phosphorylation of Bax leads
to its activation and mitochondrial translocation and to apoptosis of human hepatoma
HepG2 cells. J Biol Chem 2006;281:21256–
21265.
25 Yang P, Peairs JJ, Tano R et al. Oxidantmediated Akt activation in human RPE cells.
Invest Ophthalmol Vis Sci 2006;47:4598–
4606.
26 Rojo AI, Salinas M, Martı́n D et al. Regulation of Cu/Zn-superoxide dismutase expression via the phosphatidylinositol 3 kinase/Akt
pathway and nuclear factor-kappaB. J Neurosci
2004;24:7324–7334.
©AlphaMed Press 2015
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
CONCLUSION
ACKNOWLEDGMENTS
20
©AlphaMed Press 2015
space in RCS rats. Invest Ophthalmol Vis Sci
2005;46:2552–2560.
35 Thurman JM, Renner B, Kunchithapautham
K et al. Oxidative stress renders retinal pigment epithelial cells susceptible to complement-mediated
injury. J Biol Chem 2009;284:16939–16947.
36 Ramachandran S, Morris SM, Devamanoharan P et al. Radio-isotopic determination of
hydrogen peroxide in aqueous humor and
urine. Exp Eye Res 1991;53:503–506.
37 Richer SP, Rose RC. Water soluble antioxidants in mammalian aqueous humor: Interaction with UV B and hydrogen peroxide. Vision
Res 1998;38:2881–2888.
38 Spector A, Ma W, Wang RR. The aqueous
humor is capable of generating and degrading
H2O2. Invest Ophthalmol Vis Sci 1998;39:
1188–1197.
39 Jin GF, Hurst JS, Godley BF. Hydrogen peroxide stimulates apoptosis in cultured human
retinal pigment epithelial cells. Curr Eye Res
2001;22:165–173.
40 Kim MH, Chung J, Yang JW et al. Hydrogen peroxide-induced cell death in a human
retinal pigment epithelial cell line, ARPE-19.
Korean J Ophthalmol 2003;17:19–28.
41 Papadopoulos MC, Koumenis IL, Xu L
et al. Potentiation of murine astrocyte antioxidant defence by bcl-2: Protection in part
reflects elevated glutathione levels. Eur J Neurosci 1998;10:1252–1260.
42 Jang JH, Surh YJ. Potentiation of cellular
antioxidant capacity by Bcl-2: Implications for
its antiapoptotic function. Biochem Pharmacol
2003;66:1371–1379.
43 Ellerby LM, Ellerby HM, Park SM et al.
Shift of the cellular oxidation-reduction potential in neural cells expressing Bcl-2. J Neurochem
1996;67:1259–1267.
44 Tait SW, Green DR. Mitochondria and cell
death: Outer membrane permeabilization and
beyond. Nat Rev Mol Cell Biol 2010;11:621–
632.
45 Aouacheria A, Cibiel A, Guillemin Y et al.
Modulating mitochondria-mediated apoptotic
cell death through targeting of Bcl-2 family proteins. Recent Pat DNA Gene Seq 2007;1:43–
61.
46 Hanada M, Feng J, Hemmings BA. Structure, regulation and function of PKB/AKT: A major therapeutic target. Biochim Biophys Acta
2004;1697:3–16.
47 Li X, Bijur GN, Jope RS. Glycogen synthase
kinase-3beta, mood stabilizers, and neuroprotection. Bipolar Disord 2002;4:137–144.
48 Franke TF, Hornik CP, Segev L et al.
PI3K/Akt and apoptosis: Size matters. Oncogene 2003;22:8983–8998.
49 Ghatan S, Larner S, Kinoshita Y et al. p38
MAP kinase mediates bax translocation in nitric
oxide-induced apoptosis in neurons. J Cell Biol
2000;150:335–347.
50 Tsuruta F, Sunayama J, Mori Y et al. JNK
promotes Bax translocation to mitochondria
through phosphorylation of 14-3-3 proteins.
EMBO J 2004;23:1889–1899.
S TEM C ELLS T RANSLATIONAL M EDICINE
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
27 Pugazhenthi S, Nesterova A, Sable C et al.
Akt/protein kinase B up-regulates Bcl-2 expression through cAMP-response elementbinding protein. J Biol Chem 2000;275:10761–
10766.
28 Carr AJ, Smart MJ, Ramsden CM et al. Development of human embryonic stem cell therapies for age-related macular degeneration.
Trends Neurosci 2013;36:385–395.
29 Little CW, Cox C, Wyatt J et al. Correlates
of photoreceptor rescue by transplantation of
human fetal RPE in the RCS rat. Exp Neurol
1998;149:151–160.
30 Lund RD, Adamson P, Sauvé Y et al. Subretinal transplantation of genetically modified
human cell lines attenuates loss of visual function in dystrophic rats. Proc Natl Acad Sci USA
2001;98:9942–9947.
31 Sheng Y, Gouras P, Cao H et al. Patch
transplants of human fetal retinal pigment epithelium in rabbit and monkey retina. Invest
Ophthalmol Vis Sci 1995;36:381–390.
32 Stanzel BV, Liu Z, Somboonthanakij S
et al. Human RPE stem cells grown into polarized RPE monolayers on a polyester matrix are
maintained after grafting into rabbit subretinal
space. Stem Cell Rev 2014;2:64–77.
33 Wenkel H, Streilein JW. Evidence that
retinal pigment epithelium functions as an
immune-privileged tissue. Invest Ophthalmol
Vis Sci 2000;41:3467–3473.
34 Wang S, Lu B, Wood P et al. Grafting of
ARPE-19 and Schwann cells to the subretinal
Polarization of RPE Monolayer and Oxidative Stress
Subspecialty Collections
This article, along with others on similar topics, appears in the following collection(s):
Embryo Development
http://stemcellstm.alphamedpress.org//cgi/collection/embryo-development Pluripotent Stem Cells
http://stemcellstm.alphamedpress.org//cgi/collection/embryonic-stem-cells-induced-pluripotent-stem-cells
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
Polarized Human Embryonic Stem Cell-Derived Retinal Pigment Epithelial Cell
Monolayers Have Higher Resistance to Oxidative Stress-Induced Cell Death
Than Nonpolarized Cultures
Jamie Hsiung, Danhong Zhu and David R. Hinton
Stem Cells Trans Med 2015, 4:10-20.
doi: 10.5966/sctm.2014-0205 originally published online November 19, 2014
Downloaded from http://stemcellstm.alphamedpress.org/ by David Hinton on January 7, 2015
The online version of this article, along with updated information and services, is
located on the World Wide Web at:
http://stemcellstm.alphamedpress.org/content/4/1/10