Microbiology (2004), 150, 641–647
DOI 10.1099/mic.0.26867-0
Identification of a topoisomerase IV in
actinobacteria: purification and characterization of
ParYR and GyrBR from the coumermycin A1
producer Streptomyces rishiriensis DSM 40489
Elisabeth Schmutz, Susanne Hennig, Shu-Ming Li and Lutz Heide
Eberhard-Karls-Universität Tübingen, Pharmazeutische Biologie, Auf der Morgenstelle 8,
D-72076 Tübingen, Germany
Correspondence
Lutz Heide
heide@uni-tuebingen.de
Shu-Ming Li
shuming.li@uni-tuebingen.de
Received 27 October 2003
Revised 10 December 2003
Accepted 11 December 2003
The biosynthetic gene clusters of the gyrase inhibitors coumermycin A1 and clorobiocin
contain two different resistance genes (gyrBR and parY R). Both genes code for B subunits of
type II topoisomerases. The authors have now overexpressed and purified the encoded proteins,
as well as the corresponding A subunits GyrA and ParX. Expression was carried out in
Streptomyces lividans in the form of hexahistidine fusion proteins, allowing purification by nickel
affinity chromatography. The complex of GyrA and GyrBR was found to catalyse ATP-dependent
supercoiling of DNA, i.e. to function as a gyrase, whereas the complex of ParX and ParYR catalysed
ATP-dependent decatenation and relaxation, i.e. the functions of topoisomerase IV (topo IV).
This is believed to represent the first topo IV identified in the class of actinobacteria, and the first
demonstration of the formation of a topo IV as a resistance mechanism of an antibiotic producer.
INTRODUCTION
Bacterial DNA gyrase and topoisomerase IV (topo IV) are
type II topoisomerases, involved in controlling the topological state of bacterial DNA by ATP-dependent reaction
mechanisms (Maxwell & Lawson, 2003; Ullsperger &
Cozzarelli, 1996). DNA gyrase, which is present in all
known bacteria, has the unique ability to introduce negative
supercoils into DNA, energetically driven by ATP hydrolysis. It is composed of the subunits GyrA and GyrB, which
form a (GyrA)2(GyrB)2 heterotetramer. Topo IV is composed of the subunits ParC and ParE, which form a similar
tetrameric structure (ParC)2(ParE)2. The best-examined
function of topo IV is the decatenation of daughter
chromosomes following DNA replication; in addition,
topo IV relaxes superhelical DNA. The subunits GyrA and
ParC contain the catalytic centre for DNA cleavage and
rejoining, while the GyrB and ParE subunits contain the
catalytic centre for ATP hydrolysis.
Most bacteria possess both these type II topoisomerases.
However, a different situation is encountered in members
of the class of actinobacteria: the genome sequences of
coryneform bacteria (Corynebacterium glutamicum; Corynebacterium efficiens) and of mycobacteria (Mycobacterium
tuberculosis; Mycobacterium leprae) contain only genes for
a single type II topoisomerase (i.e. gyrA and gyrB), but no
homologues of parC and parE. Correspondingly, the gyrase
of Mycobacterium smegmatis was demonstrated to be an
Abbreviations: kDNA, kinetoplast DNA; topo IV, topoisomerase IV.
0002-6867 G 2004 SGM
efficient decatenase (Manjunatha et al., 2002), and seems to
carry out the functions of both gyrase and topo IV. So far,
the existence of a separate topo IV has not been shown in
the class of actinobacteria. Recently, however, the complete
genome sequences of two additional actinobacteria have
become available in the database, i.e. of Streptomyces coelicolor (SCO) and of Bifidobacterium longum (BL). These
organisms contain genes for the DNA gyrase subunits A
and B (gyrA and gyrB) and in addition two genes for another
type II topoisomerase, currently annotated as ‘putative
DNA gyrase subunit A’ and ‘subunit B’. These genes will
hereafter be called parX (SCO5822 and BL1434) and parY
(SCO5836 and BL1429). In a sequence comparison of gyrase
and topo IV genes from Gram-positive organisms, these
parX and parY genes can neither be classified as gyrase nor
as topo IV, but form independent groups on their own
(Fig. 1). No experimental data are available on the function
of their encoded proteins.
Recently, we have identified type II topoisomerase genes
as resistance genes within the biosynthetic gene clusters of
novobiocin, clorobiocin and coumermycin A1 (Schmutz
et al., 2003). These aminocoumarin antibiotics are potent
inhibitors of the subunit B of gyrase (Maxwell, 1997), and
are produced by different Streptomyces strains. These
organisms protect their own gyrase from the inhibitory
effect of the aminocoumarins by de novo synthesis of
an aminocoumarin-resistant gyrase B subunit during antibiotic formation (Schmutz et al., 2003; Thiara & Cundliffe,
1988, 1989, 1993). The gene encoding this subunit (named
gyrBR) was found in all three gene clusters (Schmutz et al.,
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
Printed in Great Britain
641
E. Schmutz and others
Fig. 1. Phylogenetic trees based on sequence similarities of the genes encoding the B and A subunits of type II
topoisomerases in Gram-positive bacteria. The phylogeny was constructed using DNASIS for Windows, version 2 (Hitachi)
scoring with a gap penalty of 5?0, a K-tuple of 2?0, a fixed gap penalty of 10?0 and a floating gap penalty of 10?0. The number
of top diagonals and window size were both set at 5. Bacterial strains are: S. ris., Streptomyces rishiriensis; S. coe.,
Streptomyces coelicolor; B. lon., Bifidobacterium longum; B. sub., Bacillus subtilis; S. aur., Staphylococcus aureus; M. tub.,
Mycobacterium tuberculosis; C. glu., Corynebacterium glutamicum; C. per., Clostridium perfringens (cited from Schmutz
et al., 2003).
2003). Interestingly, the biosynthetic gene clusters for
clorobiocin and coumermycin A1 contained an additional
resistance gene (named parYR) which showed high sequence
similarity to parY of S. coelicolor (Fig. 1). Upon expression
in Streptomyces lividans, both gyrBR and parYR conferred
resistance to aminocoumarin antibiotics.
In the present study, we have investigated the function of
GyrBR and ParYR from the coumermycin A1 producer
Streptomyces rishiriensis DSM 40489. Both proteins were
overexpressed and then purified by nickel affinity chromatography. After the additional purification of the GyrA and
ParX subunits, we assembled the active heterotetrameric
(GyrA)2(GyrBR)2 and (ParX)2(ParYR)2 topoisomerases
in vitro and investigated their supercoiling, decatenation
and relaxation activity. (ParX)2(ParYR)2 was found to
have a pronounced decatenating activity and is believed to
represent the first topo IV identified in actinobacteria.
METHODS
Bacterial strains, plasmids and culture conditions. For
standard cloning procedures Escherichia coli XL1 Blue MRF9
(Stratagene) and standard protocols as described by Sambrook &
Russell (2001) were used. S. lividans TK23 (Kieser et al., 2000) was
used as host strain for the isolation of the Streptomyces vector pGM9
(Muth et al., 1989) and was grown in YMG medium (Kieser et al.,
2000) at 28 uC for 2–3 days. For preparation of genomic DNA from
S. coelicolor, YMG medium was used. Protoplast preparation and
transformation of S. lividans T7 (Heinzelmann et al., 2001) for
protein expression was carried out according to standard methods
(Kieser et al., 2000). E. coli transformants with pET-24a(+) or
pGM9 fusion plasmids were selected with kanamycin (50 mg ml21);
transformants with pRSET B were selected with carbenicillin
(50 mg ml21). For selection of transformants of S. lividans T7,
642
kanamycin (50 mg ml21) was used. Transformants of S. lividans
TK24 with pUWL201 expression constructs (Schmutz et al., 2003)
were selected with thiostrepton (50 mg ml21).
PCR amplification and cloning of topoisomerase genes. The
primers used for PCR amplification of the topoisomerase genes are
listed in Table 1. gyrBR and parYR were amplified from the cosmid
4-2H described previously (Schmutz et al., 2003). For amplification
of the S. coelicolor genes gyrA and parX genomic DNA was used as
template. Two different programmes for the amplification were
used. For gyrBR, parYR and gyrA the conditions were 1 cycle at 95 uC
(5 min), followed by 30 cycles at 95 uC (90 s), 60 uC (90 s) and
72 uC (5 min), and finally 1 cycle at 72 uC (10 min). parX was
amplified by denaturation at 96 uC (5 min), followed by 30 cycles
at 96 uC (2 min) and 72 uC (6 min), and finally 1 cycle at 72 uC
(10 min). Each 100 ml volume of reaction mixture contained about
100 ng template cosmid DNA or 2–5 mg genomic DNA, 20 pmol of
each primer, 0?2 mM dNTPs (each, final concentration), Pfu DNA
polymerase reaction buffer (2 mM MgSO4, final concentration), 5 %
(v/v) DMSO, and 3 units of Pfu DNA polymerase (Promega). The
PCR products were digested with the restriction enzymes given in
Table 1 and ligated into pRSET B (Invitrogen) (resulting in pRSET
B-gyrBR, pRSET B-parYR and pRSET B-gyrA, respectively) or pET24a(+) (Novagen) (resulting in pET-24a-parX). To obtain plasmids
replicating in Streptomyces, the pRSET B derivatives pRSET B-gyrBR,
pRSET B-parYR and pRSET B-gyrA were digested with HindIII and
fused with HindIII-digested pGM9. The construct pET-24a-parX
was linearized with BglII and fused with BglII-digested pGM9.
Complementation of gyrB and parE temperature-sensitive
mutants of E. coli. The E. coli strains N4177 (Menzel & Gellert,
1983) and W3110parE10 (Kato et al., 1990) contain either gyrB or
parE with a mutation repressing the function of the resulting proteins at high temperature. Both strains were transformed either with
pRSET B-gyrBR or with pRSET B-parYR. Transformed cells were
grown on LB agar plates (Sambrook & Russell, 2001) containing
carbenicillin (50 mg ml21) and IPTG (0?5 mM). As a positive control pAG111 containing gyrB from E. coli (Hallett et al., 1990) transformed into strain N4177 was used. Cells transformed with pAG111
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
Microbiology 150
Topoisomerase IV in actinobacteria
Table 1. Nucleotide sequences of primers used for PCR
Introduced restriction sites are underlined and the respective restriction enzymes are given.
Primer
Nucleotide sequence (5§–3§)
Enzyme
gyrBC-1
gyrBC-2
parY-1
parY-2
gyrA-4
gyrA-5
parX-1
parX-2
GCCCGAAAGAGCTCGAGTGTGACTAC
CGGTGTCCAAGCTTAGATGTCGAGGA
AGGAGAGCACTCGAGGAGTACATTCC
AGATCCGCGACAGAAGCTTGCTCAGA
CAGGAAAGATCTTCACCAGCAATGAC
ACTCTCTAAGCTTGCTACTCGGCCGA
AGCCGGCACATATGGCCCGCCGTAGTACGAAGAC
GACAGAAGCTTGACCGGGCCCGCCACCACCGAC
XhoI
HindIII
XhoI
HindIII
BglII
HindIII
HindIII
NdeI
were grown on LB agar plates supplemented with carbenicillin
(50 mg ml21). One set of plates was incubated at 30 uC overnight,
and the other was incubated at 42 uC overnight. Complementation
was determined by the ability of the transformants to grow at 42 uC.
Protein expression and purification. S. lividans T7 strains
harbouring the expression constructs were cultured in YEME
medium (Kieser et al., 2000) supplemented with kanamycin
(10 mg ml21) for 2 days at 28 uC in baffled flasks. Each flask
containing 200 ml YEME medium, supplemented with kanamycin
(10 mg ml21) and thiostrepton (25 mg ml21), was inoculated with
4 ml of the preculture. After 24 h cultivation at 28 uC (170 r.p.m. in
baffled flasks with steel springs) cells were harvested by centrifugation (5000 g, 4 uC, 10 min) and frozen overnight at 270 uC. For
lysis the cells were thawed and resuspended in 1 ml lysis buffer
(50 mM NaH2PO4, pH 8?0, 300 mM NaCl, 8 mg lysozyme ml21)
per g (wet wt) and incubated on ice for 30 min. Cells were broken
by sonication (Branson Sonifier 250) for 10 min in 2 min intervals.
The lysate was cleared by centrifugation (17 000 g, 4 uC, 30 min).
The His-tagged proteins were purified by nickel affinity chromatography by using Ni-nitrilotriacetic acid resin (Qiagen). Some
changes to the manufacturer’s standard protocol were necessary in
the washing procedure to obtain nearly homogeneous protein fractions. The imidazole concentration in the washing buffer was
increased to 30–40 mM, and in the case of GyrBR, urea (2 M) was
added to remove traces of GyrA subunit. After elution of the recombinant proteins with 250 mM imidazole, the buffer was exchanged
by gel filtration on Sephadex G-25 NAP-10 columns (Amersham
Biosciences). The storage buffer contained 50 mM KH2PO4, pH 7?5,
1 mM DTT, 0?2 mM EDTA and 50 % (v/v) glycerol. Refolding of
denatured GyrBR protein was achieved by incubation overnight in
storage buffer at 4 uC before storage at 220 uC.
The collected fractions were analysed by SDS-PAGE according to the
method of Laemmli (1970) in 10 % gels.
DNA gyrase and topo IV activity assays. DNA gyrase and topo
IV holoenzymes were reconstituted by mixing approximately equimolar amounts of recombinant GyrA and GyrBR and ParX and
ParYR subunits in the reaction mixture, respectively. Enzyme activity
was detected by incubation for 1 h at 30 uC in a total reaction
volume of 20 ml containing 25 mM HEPES/KOH, pH 8?0, 10 mM
magnesium acetate, 56 mM KCl, 2 mM DTT, 10 mM spermidine,
2 mM ATP and 50 mg BSA ml21. As substrates, 100 ng relaxed
pBR322, 400 ng kinetoplast DNA (kDNA) (Topogen) and 100 ng
supercoiled pBR322 were used for detection of supercoiling, decatenation and relaxation activity, respectively. The reaction was stopped
by adding 4 ml loading buffer containing 200 mM EDTA, 30 %
glycerol and 0?25 % bromphenol blue. Assays were analysed by
electrophoresis on 0?8 % agarose gels in Tris/acetate/EDTA (TAE
http://mic.sgmjournals.org
buffer) and staining with ethidium bromide. Electrophoresis with
chloroquine was carried out on a 1?6 % agarose gel with 8?1 mg
chloroquine phosphate ml21 (corresponding to 5 mg ml21 chloroquine base) in TAE buffer. Electrophoresis was performed in TAE
buffer containing the same chloroquine concentration and run overnight. The gel was then washed three times for 30 min in 10 mM
MgSO4 in TAE buffer, and in distilled water before staining with
ethidium bromide.
For testing the aminocoumarin resistance of supercoiling activity,
10–500 mg ml21 novobiocin (dissolved in buffer) was added to the
incubation mixture. For testing the aminocoumarin resistance of
decatenation activity, 2?5–100 mg ml21 novobiocin (dissolved in
buffer) was added. IC50 was defined as the novobiocin concentration
causing 50 % inhibition of the supercoiling or of the decatenation
reaction.
Supercoiled plasmid DNA of pBR322 was obtained by isolation from
E. coli XL1 Blue MRF9 with ion-exchange columns (Nucleobond AX
kits, Macherey-Nagel). Relaxation of supercoiled pBR322 was carried
out with topoisomerase I (Amersham Biosciences) according to the
manufacturer’s instructions.
RESULTS
Complementation experiments with
temperature-sensitive gyrB and parE
mutants of E. coli
In E. coli, temperature-sensitive mutations affecting either
gyrB or parE have been isolated (Kato et al., 1990; Menzel
& Gellert, 1983). These mutants grow normally at 30 uC.
If the temperature is raised to 42 uC, the function of the
respective enzyme is repressed and the mutant stops
growing, since both gyrase and topo IV are essential for
growth. Complementation of such mutants can be achieved
with genes encoding a gyrase B subunit or a topo IV ParE
subunit, respectively, restoring growth at elevated temperature (Kato et al., 1992).
In order to test the function of gyrBR and parYR from the
coumermycin cluster, both genes were cloned into the
pRSET B vector. Each was transformed into the temperaturesensitive gyrB or parE mutants of E. coli. However, neither
of the genes allowed growth at raised temperature. In contrast, transformation with a vector containing the respective
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
643
E. Schmutz and others
topoisomerase gene from E. coli easily restored growth of
the E. coli temperature-sensitive mutants at high temperature. This indicated that the GyrBR and ParYR proteins
from Streptomyces did not form functional type II topoisomerases with GyrA or ParC from E. coli, and therefore
no conclusion could be drawn on the functions of GyrBR
and ParYR.
1
2
GyrBR
GyrA
The pRSET B vectors constructed for expression in E. coli
(see above) encoded hexahistidine fusion proteins of
GyrBR and ParYR, suitable for purification by nickel affinity
chromatography. In order to allow replication of these
vectors and expression of GyrBR and ParYR in S. lividans,
they were fused with the vector pGM9, which contains an
origin of replication for Streptomyces (Muth et al., 1989).
The resulting vectors were introduced into S. lividans T7,
which contains a thiostrepton-inducible gene for T7 RNA
polymerase (Heinzelmann et al., 2001). After induction,
crude protein extracts were prepared and subjected to
nickel affinity chromatography. This resulted in nearly
homogeneous ParYR protein, detected in the SDS gel at
the expected molecular mass of 81 kDa (Fig. 2, lane 3). The
GyrBR protein, however, appeared to form a very stable
complex with GyrA of S. lividans T7 and therefore coeluted
with GyrA (data not shown). Complete removal of GyrA
was finally achieved by elution of the nickel affinity column
with 2 M urea. GyrBR remained on the column and could
subsequently be eluted with 250 mM imidazole, although
in denatured form. Removal of imidazole and storage
overnight at 4 uC resulted in the renaturation of GyrBR.
The protein still contained two minor impurity bands
(Fig. 2, lane 1), which however did not interfere with the
assay. The additional required subunits GyrA and ParX
were cloned from the completely sequenced organism
S. coelicolor, expressed in S. lividans T7 and purified by
essentially the same procedure (see Methods), resulting in
nearly homogeneous proteins (Fig. 2, lanes 2 and 4).
644
ParYR
4
ParX
5
Mass
marker
kDa
250
150
100
Expression and purification of GyrBR, ParYR,
GyrA and ParX
Attempts to purify GyrBR and ParYR as hexahistidine
fusion proteins after expression in E. coli using the pRSET
B vector were unsuccessful, since the proteins were contained in insoluble form in inclusion bodies. Therefore,
Streptomyces strains were chosen for further expression
experiments. GyrBR and ParYR were first expressed in
S. lividans TK24, using the Streptomyces expression vector
pUWL201. Affinity chromatography on novobiocinSepharose (Staudenbauer & Orr, 1981; Thiara &
Cundliffe, 1988) allowed the purification of the genuine
aminocoumarin-sensitive GyrB protein from S. lividans,
which could be reconstituted with GyrA from the same organism to yield active gyrase. However, the aminocoumarinresistant GyrBR and ParYR proteins did not bind to the
affinity column and apparently eluted with the bulk of the
proteins. Therefore, a different purification strategy had to
be devised.
3
75
50
37
Fig. 2. Purification of the type II topoisomerase subunits by
nickel affinity chromatography. SDS-PAGE was carried out on
a 10 % polyacrylamide gel and the gel was stained with
Coomassie brilliant blue R-250.
Investigation of supercoiling, decatenation and
relaxation activities
Gyrase introduces negative supercoils into DNA, energetically driven by hydrolysis of ATP. Topo IV catalyses the
catenation/decatenation of DNA and relaxes supercoiled
DNA, with both reactions being dependent on the presence
of ATP (Maxwell & Lawson, 2003).
Using relaxed and supercoiled pBR322 as well as catenated
kinetoplast DNA, we investigated the supercoiling, relaxation and decatenation activity of the purified topoisomerase subunits in different combinations. As shown in
Fig. 3(a) (lane 2), the complex of GyrA and GyrBR efficiently
catalysed the supercoiling reaction. However, no ATPdependent relaxation or decatenation was catalysed by this
protein (lanes 2 in Fig. 3b, c), consistent with the expectation that the (GyrA)2(GyrBR)2 complex functions as a gyrase.
On the other hand, the complex of ParX and ParYR
showed clear relaxation and decatenation activity (lanes
3 in Fig. 3b, c), proving that these proteins function as
subunits of topo IV. The subunits of gyrase and topo IV
could not be interchanged: combinations of ParX with
GyrBR, or of GyrA with ParYR, were not enzymically active
in any of the three test systems (Fig. 3, lanes 4 and 5). All
three observed reactions were dependent on the presence
of ATP (Fig. 3, lanes 6).
From the experiment shown in Fig. 3(a) (lane 3), it
appeared that the complex of ParX and ParYR showed a
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
Microbiology 150
Topoisomerase IV in actinobacteria
(a) Supercoiling assay
1
_
_
2
GyrA
3
ParX
4
5
GyrA ParX
(b) Relaxation assay
6
GyrA
GyrBR ParYR ParYR GyrBR GyrBR
-ATP
1
_
_
(c) Decatenation assay
2
3
4
5
GyrA
ParX
GyrA
ParX
6
1
_
_
ParX
GyrBR ParYR ParYR GyrBR ParYR
2
3
4
5
GyrA
ParX
GyrA
ParX
6
ParX
GyrBR ParYR ParYR GyrBR ParYR
-ATP
-ATP
Catenated kDNA
Relaxed pBR322
Supercoiled pBR322
Relaxed kDNA
Fig. 3. DNA gyrase and topo IV activity assays: (a) supercoiling assay; (b) relaxation assay; (c) decatenation assay. Assay
conditions were as described in Methods. In all assays equal amounts of the purified proteins were used. Assays were
analysed by loading on a 0?8 % agarose gel and electrophoresis in TAE buffer. Gels were stained with ethidium bromide.
low supercoiling activity. However, when the experiment
was repeated and gel electrophoresis was performed in the
presence of 5 mg chloroquine ml21, it was obvious that the
complex of ParX and ParYR had no supercoiling activity
(Fig. 4).
Aminocoumarin resistance of GyrBR and ParYR
In our previous study (Schmutz et al., 2003), we had shown
in vivo that gyrBR and parYR confer resistance to novobiocin
(a) Agarose gel without chloroquine
Supercoiling
assay
1
2
3
_
GyrA
ParX
_
ParYR
GyrBR
Relaxed
pBR322
Supercoiled
pBR322
and coumermycin A1, i.e. that they are likely to encode
aminocoumarin-resistant topoisomerase subunits. This
was now investigated in vitro. The gyrase of S. lividans
is highly sensitive to novobiocin, with an IC50 value of
approximately 0?5 mg ml21 (Thiara & Cundliffe, 1988), very
similar to the IC50 of E. coli gyrase, which was determined
as approximately 0?6 mg ml21 (Peng & Marians, 1993).
In contrast, we observed an IC50 of 50 mg ml21 for the
complex of GyrA and GyrBR. Likewise, bacterial topo IV is
_
(b) Agarose gel with 5 µg chloroquine ml 1
Supercoiling
Relaxation
assay
assay
1
2
3
4
5
_
_
GyrA
ParX
ParX
R
R
R
_
_
GyrB
ParY
ParY
Relaxation
assay
4
5
_
ParX
R
_
ParY
Supercoiled
pBR322
Relaxed
pBR322
Fig. 4. Supercoiling and relaxation assay with DNA gyrase and topo IV. Each assay was divided and equal amounts were
loaded on a 1 % agarose gel in TAE buffer (a) and a 1?6 % agarose gel with 5 mg chloroquine ml”1 in TAE buffer (b). Both
gels were stained with ethidium bromide.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
645
E. Schmutz and others
sensitive to aminocoumarins (Hardy & Cozzarelli, 2003;
Peng & Marians, 1993), with an IC50 of 1?5 mg ml21
reported for the (ParC)2(ParE)2 complex of E. coli (Peng
& Marians, 1993). In contrast, the (ParX)2(ParYR)2 complex investigated in this study showed an IC50 of 20 mg ml21
in the decatenation assay.
DISCUSSION
In this study, we present for the first time evidence for the
existence of a topo IV in actinobacteria. Mycobacteria and
corynebacteria possess only a single type II topoisomerase,
which apparently has both supercoiling and decatenating
activity (Manjunatha et al., 2002). We have shown that
streptomycetes (which also belong to the actinobacteria)
contain both a gyrase, which consists of GyrA and GyrB
subunits and catalyses the supercoiling of DNA, and a topo
IV, consisting of the ParX and ParY subunits and catalysing
the ATP-dependent decatenation and relaxation of DNA.
The topo IV which was investigated in the present study
in vitro and in our previous study in vivo (Schmutz et al.,
2003) contained the ParX subunit of S. coelicolor and the
ParYR subunit from the coumermycin biosynthetic gene
cluster of S. rishiriensis. This demonstrates the compatibility of the topo IV subunits from different Streptomyces
strains. In the same way, the compatibility of the gyrase
subunits A and B from different strains was shown. In
contrast, the failure to complement E. coli gyrB and parE
mutants with gyrBR and parYR from Streptomyces indicated
that the Streptomyces proteins may not form functional
topoisomerases with their counterparts from E. coli, as
observed previously (Simon et al., 1995). However, our
results do not rule out the possibility of a partial complementation, which may be observable under less stringent
conditions.
Genome sequencing of S. coelicolor and Bifidobacterium
longum has demonstrated in each organism the presence
of a gyrA and a gyrB gene as well as of a parX and a parY
gene (Figs 1 and 5). For both organisms, the genes corresponding to parX and parY are at present annotated as
‘putative DNA gyrase subunits’ in the database. Our study
has now shown that these genes encode a topo IV rather
than a gyrase.
In the genomes of most Gram-positive bacteria, parE and
parC are immediately adjacent genes, probably transcribed
as a single operon, as observed for gyrB and gyrA (Fig. 5). In
contrast, in S. coelicolor and in B. longum, parX and parY
have opposite orientations and are separated by a stretch of
13 and 8 kb, respectively. Therefore parX and parY are
regulated by different promoters. A similar situation is
encountered in Streptomyces avermitilis, which has recently
been sequenced (Omura et al., 2001).
gyrBR and parYR from the coumermycin biosynthetic gene
cluster in S. rishiriensis protect this organism from the
toxic effect of its own antibiotic. A gyrBR gene is also found
in the biosynthetic gene cluster of novobiocin (Steffensky
et al., 2000), and the function of this gene and the regulation of its expression has been investigated by Thiara &
Cundliffe (1988, 1989, 1993). The fact that the coumermycin cluster contains not only a gyrBR gene but also a
parYR gene (which is absent in the novobiocin cluster) is
consistent with the very high affinity of coumermycin A1
both for gyrase and for topo IV (Peng & Marians, 1993),
Fig. 5. Genomic organization of gyrase and
topo IV genes in Gram-positive bacteria.
646
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
Microbiology 150
Topoisomerase IV in actinobacteria
creating the need to efficiently protect both enzymes in
the coumermycin producer. This finding gives additional
support to the hypothesis that topo IV is a biological target
of coumermycin A1, as well as of clorobiocin, since the
biosynthetic gene cluster of the latter antibiotic contains
both gyrBR and parYR resistance genes (Schmutz et al.,
2003).
Present evidence suggests that for gyrase inhibitors of the
fluorquinolone type, gyrase is the primary target in Gramnegative organisms, but often topo IV is the primary target
in Gram-positive organisms (Blanche et al., 1996). In
contrast, for gyrase inhibitors of the aminocoumarin type,
gyrase appears to be the primary target both in Gramnegative and in Gram-positive organisms, with topo IV
representing a secondary target (Blanche et al., 1996; Hardy
& Cozzarelli, 2003). The high affinity of coumermycin and
clorobiocin to both their primary and secondary targets
may explain the need of the antibiotic producers to create
a resistance mechanism protecting both targets, which is
realized by the expression of the GyrBR and ParYR proteins.
Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F. & Hopwood, D. A.
(2000). Practical Streptomyces Genetics. Norwich, UK: John Innes
Foundation.
Laemmli, U. K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Manjunatha, U. H., Dalal, M., Chatterji, M., Radha, D. R.,
Visweswariah, S. S. & Nagaraja, V. (2002). Functional characterisa-
tion of mycobacterial DNA gyrase: an efficient decatenase. Nucleic
Acids Res 30, 2144–2153.
Maxwell, A. (1997). DNA gyrase as a drug target. Trends Microbiol 5,
102–109.
Maxwell, A. & Lawson, D. M. (2003). The ATP-binding site of type II
topoisomerases as a target for antibacterial drugs. Curr Top Med
Chem 3, 283–303.
Menzel, R. & Gellert, M. (1983). Regulation of the genes for E. coli
DNA gyrase: homeostatic control of DNA supercoiling. Cell 34,
105–113.
Muth, G., Nussbaumer, B., Wohlleben, W. & Puehler, A. (1989).
A vector system with temperature-sensitive replication for gene
disruption and mutational cloning in streptomycetes. Mol Gen Genet
219, 341–348.
Omura, S., Ikeda, H., Ishikawa, J. & 11 other authors (2001).
Genome sequence of an industrial microorganism Streptomyces
avermitilis: deducing the ability of producing secondary metabolites.
Proc Natl Acad Sci U S A 98, 12215–12220.
ACKNOWLEDGEMENTS
Peng, H. & Marians, K. J. (1993). Escherichia coli topoisomerase IV.
We thank K. Drlica and A. Maxwell for providing the temperaturesensitive E. coli strains and the plasmid pAG111. We also thank
J. Altenbuchner for providing the S. lividans T7 strain and G. Muth for
the plasmid pGM9.
This work was supported by a grant from the Deutsche
Forschungsgemeinschaft (to L. Heide and S.-M. Li).
REFERENCES
Purification, characterization, subunit structure, and subunit interactions. J Biol Chem 268, 24481–24490.
Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory.
Schmutz, E., Mühlenweg, A., Li, S.-M. & Heide, L. (2003). Resistance
genes of aminocoumarin producers: two type II topoisomerase
genes confer resistance against coumermycin A1 and clorobiocin.
Antimicrob Agents Chemother 47, 869–877.
Simon, H., Roth, M. & Zimmer, C. (1995). Biochemical comple-
Blanche, F., Cameron, B., Bernard, F. X. & 8 other authors (1996).
Differential behaviors of Staphylococcus aureus and Escherichia coli
type II DNA topoisomerases. Antimicrob Agents Chemother 40,
2714–2720.
mentation studies in vitro of gyrase subunits from different species.
FEBS Lett 373, 88–92.
Hallett, P., Grimshaw, A. J., Wigley, D. B. & Maxwell, A. (1990).
Staudenbauer, W. L. & Orr, E. (1981). DNA gyrase: affinity
chromatography on novobiocin-Sepharose and catalytic properties.
Nucleic Acids Res 9, 3589–3603.
Cloning of the DNA gyrase genes under tac promoter control:
overproduction of the gyrase A and B proteins. Gene 93, 139–142.
Steffensky, M., Mühlenweg, A., Wang, Z.-X., Li, S.-M. & Heide, L.
(2000). Identification of the novobiocin biosynthetic gene cluster of
Hardy, C. D. & Cozzarelli, N. R. (2003). Alteration of Escherichia coli
Streptomyces spheroides NCIB 11891. Antimicrob Agents Chemother
44, 1214–1222.
topoisomerase IV to novobiocin resistance. Antimicrob Agents
Chemother 47, 941–947.
Heinzelmann, E., Kienzlen, G., Kaspar, S., Recktenwald, J.,
Wohlleben, W. & Schwartz, D. (2001). The phosphinomethylmalate
Thiara, A. S. & Cundliffe, E. (1988). Cloning and characterization of
a DNA gyrase B gene from Streptomyces sphaeroides that confers
resistance to novobiocin. EMBO J 7, 2255–2259.
isomerase gene pmi, encoding an aconitase-like enzyme, is involved
in the synthesis of phosphinothricin tripeptide in Streptomyces
viridochromogenes. Appl Environ Microbiol 67, 3603–3609.
Thiara, A. S. & Cundliffe, E. (1989). Interplay of novobiocinresistant and -sensitive DNA gyrase activities in self-protection of
the novobiocin producer, Streptomyces sphaeroides. Gene 81, 65–72.
Kato, J., Nishimura, Y., Imamura, R., Niki, H., Hiraga, S. & Suzuki, H.
(1990). New topoisomerase essential for chromosome segregation in
E. coli. Cell 63, 393–404.
Thiara, A. S. & Cundliffe, E. (1993). Expression and analysis of two
gyrB genes from the novobiocin producer, Streptomyces sphaeroides.
Mol Microbiol 8, 495–506.
Kato, J., Suzuki, H. & Ikeda, H. (1992). Purification and charac-
Ullsperger, C. & Cozzarelli, N. R. (1996). Contrasting enzymatic
terization of DNA topoisomerase IV in Escherichia coli. J Biol Chem
267, 25676–25684.
activities of topoisomerase IV and DNA gyrase from Escherichia coli.
J Biol Chem 271, 31549–31555.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 78.47.19.138
On: Sat, 01 Oct 2016 08:23:53
647