Endoglin Gene Variation and Expression in the Pathogenesis of Intracranial
Aneurysms
Amin B. Kassam, M.D., Yue-Fang Chang, Ph.D., Elisa, O’Hare, MS and David G. Peters, Ph.D.
From the Department of Neurosurgery, School of Medicine (A.B.K., Y.C.) and Department of
Human Genetics, Graduate School of Public Health (E.O.H., D.G.P.), University of Pittsburgh
1
Correspondence to:
David G. Peters Ph.D.
Department of Human Genetics
A300 Crabtree Hall
University of Pittsburgh
130 DeSoto St
Pittsburgh, PA 15213
Tel No. 412-624 3018
Fax. No. 412-624 3020
Email: david.peters@mail.hgen.pitt.edu
Acknowledgement: This work was supported by the Copeland Foundation of Pittsburgh (ABK,
DGP) and NASA (NCCI-1227) (DGP).
2
Abstract
Background and Purpose: Endoglin is a member of the transforming growth factor-β family of
proteins and plays a central role in vascular growth and development.
There have been
conflicting reports that polymorphic variation in the endoglin gene is a risk factor for intracranial
aneurysms.
We sought to further investigate the intron 7 5’-TCCCCC-3’ endoglin
polymorphism as a risk factor for intracranial aneurysm and subarachnoid hemorrhage in a
population of patients from Western Pennsylvania. Given the likelihood that hemodynamic
factors play a role in aneurysm pathogenesis, we also investigated the temporal response of
endoglin to shear stress at the level of transcription in vitro.
Methods: We genotyped 98 aneurysm patients and 191 unaffected controls for a length
polymorphism in intron 7 using PCR. Human endothelial cells were cultured under laminar
shear stress and static conditions and endoglin mRNA expression measured by Serial Analysis of
Gene Expression at 4h, 8h, 12h, 20h and 24h after the onset of flow.
Results: The endoglin polymorphism was not associated with intracranial aneurysm or the
incidence of aneurysm rupture. No association was found when data were stratified by smoking
and hypertension. Endoglin mRNA was down-modulated under shear stress in vitro within 8
hours and this down-modulation was sustained over time.
Conclusion: Although the intron 7 polymorphism of the endoglin gene was not associated with
aneurysmal disease in our cohort of patients, the flow-responsive expression of endoglin may
play a role in ICA pathobiology and thus warrants further investigation.
Cover title:
Endoglin and ICA
Keywords:
Endoglin, intracranial aneurysm, genetics, shear stress
3
Introduction
Although mechanisms of aneurysm (ICA) pathogenesis are unknown, there is evidence
that both epidemiological (3,13,20) and genetic factors (32,38,39) are important. In addition, the
arteries in the Circle of Willis normally undergo continuous exposure to hemodynamic stress and
biomechanical microinjury. There is now increasing evidence that hemodynamic factors play a
considerable role in the pathogenesis of intracranial aneurysms (14,35,36).
Efforts to characterize the specific genetic component(s) of ICA have largely focused on
candidate gene-directed association studies with genes of interest being selected for study by
virtue of their role in the pathobiology of well–defined genetic disorders of which are associated
with ICAs. These have generally been the collagen vascular disorders, such as; Ehler’s Danlos
type IV. Unlike the sporadic form of ICA, these disorders are commonly the result of single gene
defects that segregate within families in a mendelian fashion.
One such example of this approach to candidate gene analysis in aneurysmal disease is
hereditary hemorrhagic telangiectasia (HHT). Endoglin gene mutations are causative of HHT,
which is a multi-system vascular dysplasia characterized by telangiectasia and arteriovenous
malformations (AVMs). DNA sequence variation in endoglin has also been associated with
sporadic intracerebral hemorrhage (ICH) (1) and two recent reports have addressed the possible
association of an intron 7 insertion polymorphism with intracranial aneurysm (ICA). One of
these studies identified significant association between this insertion polymorphism and ICA in a
cohort of Japanese patients (39) whilst the other reported that no association was observed in
Caucasian European population (17).
Clearly, it is essential that possible links between
polymorphic variation and disease be assessed in a variety of human populations so that genetic
risk may be comprehensively assessed. In light of this we investigated the possibility that the
4
insertion polymorphism in intron 7 of the endoglin gene was associated with ICA. We also
determined the role of this polymorphism as a risk factor of subarachnoid hemorrhage (SAH)
secondary to an ICA. We also investigated the possibility that the level of expression of the
endoglin gene is modulated at the mRNA level by exposure to flow-dependent mechanical forces
in primary cultures of human vascular endothelial cells.
Materials and Methods
Study Subjects.
This research was approved by the Institutional Review Board of the University of
Pittsburgh (#951220) and all participants gave written informed consent.
Peripheral blood
specimens and a demographic, medical and family history were obtained from all participants.
All participants were of mixed West European Caucasian ancestry and none had a personal or
family history of connective tissue disorders or polycystic kidney disease. A population sample
of 191 randomly ascertained residents of Western Pennsylvania of similar mixed European
ancestry were genotyped to estimate population allele frequencies.
Endoglin Genotyping.
High molecular weight genomic DNA for genotyping and sequence analysis was
prepared by standard methods (27). Genomic DNA was amplified by PCR using primers
flanking
the
intron
7
insertion
polymorphism.
(Forward
primer,
5’-
GAGGCCTGGCATAACCCT, Reverse primer, 5’-AACAGTGTGGCCACTGAT). PCR was
carried out in a total volume of 15 µl using 30 ng genomic DNA in 20 mM Tris-HCl (pH 8.4),
500 mM KCl, 1.5 mM MgCl-2- using 1 unit of Taq polymerase (InVitrogen) and 200 µM each
5
dNTP. Reactions parameters were as follows: initial denaturation at 95 oC for 4 min, then 25
cycles of denaturation at 95 oC for 30 s, annealing at 57 oC for 30 s and extension at 72 oC for 30
s. A 5 min chase reaction was then carried out at 72 oC.
(PE Applied Biosystems). PCR
resulted in amplicon sizes of 76 and 81 base pairs depending on genotype. PCR products were
resolved on a 12% polyacrylamide gel and fragments visualized by staining with ethidium
bromide and ultraviolet illumination. Allele frequencies were estimated by gene counting
Sub-Cloning and sequencing of PCR Products.
PCR reactions were carried out as described above and the the resulting amplicons cloned
into the pCRScript vector (Stratagene). Plasmids were transformed into chemically competent
XL1 Blue E.coli (Stratagene) and recombinant plasmid DNA purified by miniprep (Qiagen).
Recombinant plasmid DNA inserts were used as templates in cycle sequencing reactions using
plasmid-specific primers on an ABI 9600 (PE Applied Biosystems) using dye-labeled
terminators and products analyzed on an ABI 3700 automated DNA sequencer (PE Applied
Biosystems). DNA sequence was analyzed using the Sequencher software package (Genecodes).
Statistical Analyses of Genotyping Data.
Chi-square test was applied to compare the genotype and allele frequency between the
study groups. The analyses were carried out using statistical software SPSS.
Endothelial Cell Culture and Exposure to Shear Stress.
Primary cultures of human coronary artery endothelial cells were purchased from
BioWhittaker.
Cells were obtained at passage 3 and cultured in EGM2MV medium
6
(BioWhittaker). Cells at passage 5 were seeded at a density of approximately 5 x 104 cells/cm2
on glass microscope slides and cultured at 37°C in humidified 5% CO2 95% air. Confluent
monolayers of cells were then placed in a parallel plate flow chamber (8) under aseptic
conditions and perfused in EGM2MV at 37°C in humidified 5% CO2 95% air for 24 hour.
Control cells not exposed to LSS were also cultured in EGM2MV for an identical length of time
as LSS treated cells.
RNA isolation
Cells were harvested directly into Trizol reagent (Life Technologies) and total RNA
extracted according to the manufacturer’s instructions. RNA integrity was assessed by agarose
gel electrophoresis and its concentration and purity determined by UV spectrophotometry. RNA
pooled at a ratio of 1:1:1 from the three identical experiments was used for SAGE.
Serial Analysis of Gene Expression
15µg total RNA was used as a substrate for SAGE, which was carried out as previously
described (44). Briefly, after mRNA purification via a biotinylated oligo-dT and streptavidinconjugated paramagnetic beads (Dynal), double stranded cDNA was synthesized using the
Superscript system (Invitrogen) and then digested with NlaIII. Following ligation of a double
stranded linker, digestion with BsmF1, ditag ligation and purification via PCR, concatomer
ligation and plasmid transformation, SAGE tags were sequenced using a ABI3700 automated
DNA sequencer. Primary sequence data were analyzed using the SAGE 2000 software package,
which was kindly provided by Ken Kinzler of the Johns Hopkins University, and raw tag counts
7
subject to normalization and statistical analysis as described previously (Peters et al., 2003,
submitted).
Results
Takenaka et al (39), previously described a 6-bp intron 7 insertion polymorphism in the
endoglin gene. We could not locate this exact polymorphic site when this region of the endoglin
gene was retrieved from the Genebank database (http://www.ncbi.nlm.nih.gov/). Therefore, to
firmly establish the sequence of this polymorphic site we cloned 75 and 81bp PCR products from
this genomic region (depending on presence or absence of the polymorphism) in a plasmid
vector and directly sequenced a number of inserts. These efforts confirmed the structure of this
polymorphic site and that the 6-bp insertion is orientated 5’-TCCCCC-3’ relative to the sense
DNA strand (Figure 1).
Among the 98 aneurysmal patients, 20.6 % were male and 79.4 % were female with an
age range of 19-65 (mean 46.6, SD 12.3) and 20-75 (mean 50.7, SD 11.7) respectively. Sixtythree (65.6 %) of the individuals presented with SAH due to a ruptured ICA, whereas 33 (34.4
%) underwent elective craniotomy to repair an unruptured ICA. In two cases the rupture status
could not be definitively determined and these patients were excluded. Fifty-one percent were
diagnosed with a single ICA whereas 49 % presented with multiple ICAs. Twelve percent
reported a history of symptomatic ICA among a first or second-degree relative. None had a
personal or family history of connective tissue disorders or autosomal dominant polycystic
kidney disease. Hypertension (defined a baseline chronic blood pressure elevation where the
patient required medication at home for control) was noted in 44.3% of the patients.
Smoking
status (defined as currently smoking immediately preceding hospitalization) was available on 89
8
(or 92%) of the patients with 50.5% of the total subjects admitting to smoking cigarettes
regularly just prior to their current hospitalization.
A total of 98 aneurysm cases and 191 unaffected controls were genotyped for the 6 bp
insertion polymorphism in intron 7 (5’-TCCCCC-3’). Representative genotypes are shown in
table 1. Of the cases, 65 (66.3 %) were wild type (no insertion) homozygotes, 30 (30.6 %) were
heterozygous and 3 (3.1 %) were homozygous for the insertion polymorphism. Similarly, 126
(66 %) of the controls were wild type homozygotes, 61 (31.9 %) were heterozygotes and 4 (2.1
%) were homozygous for the insertion polymorphism (p = 0.87). Allele frequencies were
distributed almost identically between the two populations such that 160 (81.6 %) of 196 alleles
in the patient population were wild type versus 313 (81.9 %) of 382 alleles in the controls. These
differences were not statistically significant (p = 0.93) (table 2).
Given the fact that DNA sequence variation in the endoglin gene is associated with
hemorrhagic disorders, we speculated that the endoglin polymorphism might be associated with
risk of aneurysm rupture resulting in subarachnoid hemorrhage (SAH).
We tested this
hypothesis by comparing genotype and allele frequency of the intron 7 polymorphism between
ruptured and unruptured patients. No significant differences were observed between these two
groups of patients. Specifically, 40 (63.5 %) individuals whose aneurysms ruptured were wild
type homozygotes, 21 (33.3 %) were heterozygotes and 2 (3.2 %) were homozygotes for the
insertion polymorphism (table 3). Similarly, of those individuals whose aneurysms did not
rupture, 23 (69.7 %) were wild type homozygotes, 9 (27.3 %) were heterozygotes and 1 (3 %)
were homozygotes for the insertion polymorphism (table 3). Similarly, allele frequencies were
not significantly different between patients with ruptured and unruptured aneurysms with 25
9
(19.8 %) of 126 alleles in the ruptured (SAH) population and 11 (16.8 %) of 66 alleles in the
unruptured population having the insertion polymorphism (p = 0.59) (table 4).
We next explored the possibility that known modifiable risk factors for aneurysm
formation might interact with endoglin genotype. Specifically we sought to adjust for the effects
of smoking and hypertension as two critical confounding variables known to be associated with
aneurysm rupture.
Genotypic data were stratified for smoking and hypertension and the
distribution of the intron 7 polymorphism was examined.
No significant differences were
identified between the two groups of patients at the genotypic or allelic levels following this
stratification.
Despite the lack of association between endoglin gene variation and ICA, we felt that the
existing evidence implicating endoglin dysfunction in hemorrhagic vascular disease warranted
further investigation. Hemodynamic stress is strongly implicated in the pathogenesis of a variety
of hemorrhagic diseases including ICA, ICH, HHT and AVM. The complexity of vascular
geometry around bifurcated vessels results in the exposure of the vessel wall to a variety of
hemodynamic stresses including shear stress (6). We hypothesized that endoglin gene function
and/or expression might be subject to modulation by exposure to such hemodynamic flow.
Therefore, primary cultures of human coronary artery endothelial cells (HCAECs) were exposed
to laminar shear stress (LSS) in vitro in a parallel plate flow chamber. Changes in mRNA levels
of endothelial cell-specific genes were analyzed over a time course of exposure to laminar shear
stress by SAGE. We found that endoglin mRNA levels were down-modulated within 8 hours of
exposure to LSS and that this repression of transcription was sustained for at least 24 hours of
LSS exposure. Specifically, endoglin SAGE tag count was 30 tags per 30,000 at t = 0 (0.10 %),
33 tags at t = 4h (0.11 %), 20 tags at t = 8h (0.07 %), 19 tags at t = 12h (0.06 %), 11 tags at t =
10
20h (0.04 %) and 1 tag at t = 24h (0.003 %) (Figure 2). This represents a relatively rapid
reduction within 8 hours after the onset of LSS of endoglin mRNA in CAECs.
Discussion
The catastrophic consequences of a ruptured ICA, the high frequency of ICA in the
general population, the well-described modifiable risk factors for ICA and the strong evidence
that ICA has a significant genetic component demand intensive efforts to define a multifactorial
risk model for the identification of individuals who are at-risk of developing an ICA and/or at
increased risk of rupture of an existing ICA. A number of groups have begun characterizing the
genetics of ICA.
There have recently been conflicting reports that an intron 7 insertion
polymorphism in the endoglin gene is a risk factor for ICA in Japanese but not German
populations (17,39). Given the importance of identifying non-invasive predictive biomarkers for
ICA and the recent interest in genetic risk factors for this disease, the primary aim of this study
was to determine the contribution of this polymorphism to the risk of intracranial aneurysm in a
cohort of individuals recruited in Western PA, USA. Given the importance of endoglin in
vasculogenesis, angiogenesis and wound healing (41), we were also interested to extend previous
analyses by others and determine whether this DNA sequence variant might contribute to the risk
of SAH. Furthermore, we wished to assess the potential interaction of this polymorphism with
that of key modifiable risk factors such as hypertension and smoking that impact on the
likelihood of ICA ruptures. There were no statistically significant differences identified in
genotype and allele frequencies between cases and controls even after adjusting for the potential
confounding effects of smoking or hypertension.
11
Despite the above findings, the endoglin gene product clearly plays a central role in
vascular development and integrity (25,26,31) and therefore the lack of statistically significant
differences of endoglin genotype and allele frequencies between ICA cases and controls does not
rule out the possibility that endoglin regulation and function is important in ICA pathobiology.
One important pathogenic factor that may affect endoglin expression and/or function is
hemodynamic stress.
The fact that aneurysms do not form randomly along the arterial wall but at distinct
locations in the vasculature, suggests the importance of hemodynamic factors. Intracranial
aneurysms are found predominantly at arterial bifurcations and at the outer bends of highly
curved segments (4). At both these locations, the blood flow is redirected generating a resultant
force on the arterial wall to balance the change in momentum. Computational studies of flow
show that these locations are also characterized by flow separation, elevated shear stress, large
shear stress gradients and possibly an oscillating separation point (9,10,21). Additional evidence
of a link between the formation of aneurysms and hemodynamics is that aneurysms have been
found to inadvertently form as a result of surgical alterations of the cerebral blood flow (35).
A number of groups have employed model systems to characterize the biological
response to fluid shear stress in vitro. Under high fluid shear stress (>15 dynes/cm2), endothelial
cells enter a quiescent, antiproliferative, antioxidant and antithrombotic state (5,42).
Furthermore, down-regulation of vascular cell adhesion molecule (VCAM-1) (2,29), upregulation of antioxidant genes (Mn-SOD and Cu/Zn-SOD) (11,40), down-regulation of
vasoconstrictive factors (ET-1) (37,45) and up-regulation of vasodilatory factors (NOS) (18,43)
has been shown to occur. In contrast, low, or oscillatory fluid shear stress is thought to cause
endothelial cells to enter a procoagulant and prothrombotic state. For example, such conditions
12
have been shown to result in the up-regulation of ET-1 (22), endothelin converting enzyme
(ECE) (24), angiotensin converting enzyme (ACE) (34), platelet derived growth factor-B
(PDGF-B) (33) and PDGF-A (16). In keeping with these previous studies, we utilized a parallel
plate flow chamber (7) for our experiments.
Given the role of endoglin in the structural integrity of arterial tissue and the fact that
there is substantial evidence that hemodynamics play an important role in the initiation and
development of cerebral aneurysms (14,35,36) as well as other vascular diseases such as
atherosclerosis and poststenotic dilations (15,23,28), we hypothesized that regulation of endoglin
gene expression might be sensitive to changes in hemodynamic flow parameters. Using SAGE
(44), we found that endoglin mRNA levels are down-modulated within 8 hours after the onset of
flow and that this down-modulation in expression of endoglin was sustained over time for at
least 24 hours. The significance of the LSS-responsive down-modulation of endoglin is unclear
at this time but there are a number of possible reasons why endoglin is down-modulated by LSS.
Firstly, as described above, LSS has a profound antiproliferative effect on endothelial cells in
vitro (19). The fact that endoglin plays a central role in vascular development and angiogenesis
(12), both of which are proliferative processes, suggests that its expression may be related to the
LSS-dependent endothelial cell proliferation rate in vitro. This is significant since it is known
that ICAs generally form at regions of the Circle of Willis exposed to very high shear stress.
Indeed, these regions are exposed to levels of shear stress that are potentially an order of
magnitude higher than that which is experienced, for example, in the dorsal aorta (Anne
Robertson, Ph.D., personal communication). Whether altered endothelial cell proliferation rates
are a feature of ICA pathogenesis is unknown. Clearly it will be important to determine the
13
effect of endoglin gene function and expression under these high shear stress conditions both in
vitro and in vivo.
In summary, we report that a 6-bp insertion polymorphism in intron 7 of the endoglin
gene is not associated with ICA in this study population. This finding is in agreement with a
previous report by Krex et al (17), who studied the effect of this polymorphism on ICA in a
German population. Our results confirm the population-specific differences in the frequency of
this polymorphism, which is found at a significantly higher rate in Japanese (39). We also found
that this polymorphism is not associated with SAH and that the lack of association with ICA and
SAH existed even after adjusting for the potential confounding effects of hypertension and
smoking.
There is strong evidence that haplotype analysis can be a powerful tool when
dissecting the genetic basis of complex disease (30). Therefore, a limitation of this study (and
those previously performed by Krex et al.(17), and Takenaka et al. (39)) is that endoglin
haplotypes were not constructed in our case and control populations.
We did, however, find that endoglin mRNA is rapidly and significantly down-modulated
in CAECs by exposure to laminar shear stress in vitro. We believe that the stress-responsive
behavior of endoglin identified in this study, particularly on the background of previous evidence
suggesting the importance of hemodynamic stress in ICA pathogenesis, justifies further
consideration of the role of endoglin in ICA pathogenesis despite the lack of statistical
association seen in this study. It is our belief that better understanding of endoglin gene function,
expression and DNA sequence variation will shed light on ICA pathogenesis and natural history.
14
References
1.
Alberts MJ, Davis JP, Graffagnino C, McClenny C, Delong D, Granger C, Herbstreith MH,
Boteva K, Marchuk DA, Roses AD. Endoglin gene polymorphism as a risk factor for
sporadic intracerebral hemorrhage. Ann Neurol. May;41(5):683-6, 1997.
2. Ando J, Tsuboi H, Korenaga R, Takahashi K, Kosaki K, Isshiki M, Tojo T, Takada Y,
Kamiya A. Differential display and cloning of shear stress-responsive messenger RNAs in
human endothelial cells. Biochem Biophys Res Comm, 225(2):347-51, 1996.
3. Bonita R. Cigarette smoking, hypertension and risk of subarachnoid hemorrhage: A
population-based case control study. Stroke; 17:831-835, 1986.
4. Cotran RS, Kumar V and Robbins S. Pathologic Basis of Disease. 5th Edition.
W.B.
Saunders Company, 1994, p.1312.
5. Davies PF. Flow-mediated endothelial mechanotransduction. Physiol Rev, 75:519-560, 1995
6. Foutrakis GN, Yonas H, Sclabassi RJ. Finite element methods in the simulation and analysis
of intracranial blood flow. Neurol Res. Apr;19(2):174-86, 1997.
7. Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow effects on prostacyclin production by
cultured human endothelial cells. Science, 22;227(4693):1477-9, 1984.
8. Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow effects on prostacyclin production by
cultured human endothelial cells. Science. Mar 22;227(4693):1477-9, 1985.
9. Friedman MH and Ehrlich LW. Numerical simulation of aortic bifurcation flows: the effect
of flow divider curvature. J Biomechanics, 17(12):881-888, 1984.
15
10. Haljasmaa I, Robertson AM and Galdi GP. On the Effect of Apex Geometry on Wall Shear
Stress and Pressure in Two-Dimensional Models of Arterial Bifurcations. Mathematical
Models and Methods in Applied Sciences, 4(11): (to appear), 2001.
11. Inoue N, Ramasamy S, Fukai T, Nerem RM, Harrison DG. Shear stress modulates expression
of Cu/Zn superoxide dismutase in human aortic endothelial cells. Circ Res. 79:32-37, 1996.
12. Jonker L, Arthur HM. Endoglin expression in early development is associated with
vasculogenesis and angiogenesis. Mech Dev. Jan;110(1-2):193-6, 2002.
13. Juvela S, Hillbom M, Numminen H and Koskinen P. Cigarette smoking and alcohol
consumption as risk factors for aneurysmal subarachnoid hemorrhage. Stroke, 24:639-664,
1993.
14. Kayembe KN, Sasahara M and Hazama F. Cerebral Aneurysms and Variations in the Circle
of Willis. Stroke, 15:846, 1984.
15. Khachigian LM, Anderson KR, Halnon NJ, Gimbrone Jr. MA, Resnick N and Collins T. Egr1 is activated in endothelial cells exposed to fluid shear stress. Arteriosclerosis, Thrombosis
and Vascular Biology, 17:2280-2286, 1997.
16. Kraiss LW, Geary RL, Mattsson EJ, Vergel S, Au AY, Clowes AW. Acute reductions in
blood flow and shear stress induce platelet-derived growth factor-A expression in baboon
prosthetic grafts. Circ Res,79:45-53, 1996.
17. Krex D, Ziegler A, Schackert HK, Schackert G. Lack of association between endoglin intron
7 insertion polymorphism and intracranial aneurysms in a white population: evidence of
racial/ethnic differences. Stroke. Nov;32(11):2689-94, 2001.
18. Kuchan MJ, Jo H, Frangos JA. Role of G proteins in shear stress-mediated nitric oxide
production by endothelial cells. Am J Physiol, Sep;267(3 Pt 1):C753-8, 1994.
16
19. Lin K, Hsu PP, Chen BP, Yuan S, Usami S, Shyy JY, Li YS, Chien S. Molecular mechanism
of endothelial growth arrest by laminar shear stress. Proc Natl Acad Sci U S A. Aug
15;97(17):9385-9, 2000.
20. Longstreth WT, Nelson LM, Koepsell TD and vanBelle G. Cigarette smoking, alcohol use
and subarachnoid hemorrhage. Stroke, 23:1242-1249, 1992.
21. Lou Z and Yang WJ. Biofluid dynamics at arterial bifurcations. Critical Reviews in
Biomedical Engineering, 19:455-493, 1992.
22. Malek A, Izumo S. Physiological fluid shear stress causes downregulation of endothelin-1
mRNA in bovine aortic endothelium. Am J Physiol, 263(2 Pt 1):C389-96, 1992.
23. Malek AM, Alper SL and Izumo S. Hemodynamic Shear Stress and Its Role in
Atherosclerosis, JAMA, 282:2035-2040, 1999.
24. Masatsugu K, Itoh H, Chun TH, Ogawa Y, Tamura N, Yamashita J, Doi K, Inoue M,
Fukunaga Y, Sawada N, Saito T, Korenaga R, Ando J, Nakao K. Physiologic shear stress
suppresses endothelin-converting enzyme-1 expression in vascular endothelial cells. J
Cardiovasc Pharmacol, 31 Suppl 1:S42-5, 1998.
25. McAllister KA, Baldwin MA, Thukkani AK, Gallione CJ, Berg JN, Porteous ME,
Guttmacher AE, Marchuk DA. Six novel mutations in the endoglin gene in hereditary
hemorrhagic telangiectasia type 1 suggest a dominant-negative effect of receptor function.
Hum Mol Genet 4: 1983–1985, 1995.
26. McAllister KA, Grogg KM, Johnson DW, Gallione CJ, Baldwin MA, Jackson CE, Helmbold
EA, Markel DS, McKinnon WC, Murrell J, et al. Endoglin, a TGF-beta binding protein of
endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet. 8:
345–351, 1994.
17
27. Miller SA, Dykes DD, Polesky HF. A simple salting-out procedure for extracting DNA from
human nucleated cells. Nucl Acids Res; 16:1215, 1988.
28. Nerem RM. Hemodynamics and the vascular endothelium. J Biomech Engrg, 115:510–514,
1993.
29. Ohtsuka A, Ando J, Korenaga R, Kamiya A, Toyama-Sorimachi N, Miyasaka M. The effect
of flow on the expression of vascular adhesion molecule-1 by cultured mouse endothelial
cells. Biochem Biophys Res Comm, May 28;193(1):303-10, 1993.
30. Onda H, Kasuya H, Yoneyama T, Takakura K, Hori T, Takeda J, Nakajima T, Inoue I.
Genomewide-linkage and haplotype-association studies map intracranial aneurysm to
chromosome 7q11. Am J Hum Genet. Oct;69(4):804-19, 2001.
31. Pece N, Vera S, Cymerman U, White RIJr, Wrana JL, Letarte M. Mutant endoglin in
hereditary hemorrhagic telangiectasia type 1 is transiently expressed intracellularly and is not
a dominant negative. J Clin Invest. 100: 2568–2579, 1997.
32. Peters DG, Kassam AB, Yonas H and Ferrell RE. A Functional Polymorphism in the mmp-9
Promoter as a Potential Risk Factor for Intracranial Aneurysm. Stroke, 30: 2612-2616, 1999.
33. Resnick N, Collins T, Atkinson W, Bonthron DT, Dewey CF Jr, Gimbrone MA Jr. Plateletderived growth factor B chain promoter contains a cis-acting fluid shear-stress-responsive
element. Proc Natl Acad Sci U S A, 90:4591-4595, 1993.
34. Rieder MJ, Carmona R, Krieger JE, Pritchard KA Jr, Greene AS. Suppression of angiotensinconverting enzyme expression and activity by shear stress. Circ Res., Mar;80(3):312-319,
1997.
35. Sasaki T, Kodama N and Itokawa H. Aneurysm Formation and Rupture at the Site of
Anastomosis Following Bypass Surgery. J Neurosurg, 85:500-502, 1996.
18
36. Sekhar LN and Heros RC. Origin, Growth, and Rupture of Saccular Aneurysms: A Review.
Neurosurgery, 8:248-260, 1981.
37. Sharefkin JB, Diamond SL, Eskin SG, McIntire LV, Dieffenbach CW. Fluid flow decreases
preproendothelin mRNA levels and suppresses endothelin-1 peptide release in cultured
human endothelial cells. J Vasc Surg, Jul;14(1):1-9, 1991.
38. St Jean P, Hart B, Webster M, Steed D, Adamson J, Powell J and Ferrell RE. Alpha-1antitrypsin deficiency in aneurysmal disease. Hum Hered, 46:92-97, 1996.
39. Takenaka K, Sakai H, Yamakawa H, Yoshimura S, Kumagai M, Yamakawa H, Nakashima
S, Nozawa Y and Sakai N. Polymorphism of the endoglin gene in patients with intracranial
saccular aneurysms. J Neurosurg, 90(5):935-938, 1999.
40. Topper JN, Cai J, Falb D, Gimbrone MA Jr. Identification of vascular endothelial genes
differentially responsive to fluid mechanical stimuli: cyclooxygenase-2, manganese
superoxide dismutase, and endothelial cell nitric oxide synthase are selectively up-regulated
by steady laminar shear stress. Proc Natl Acad Sci U S A. Sep 17;93(19):10417-22, 1996.
41. Torsney E, Charlton R, Parums D, Collis M, Arthur HM. Inducible expression of human
endoglin during inflammation and wound healing in vivo. Inflamm Res. Sep;51(9):464-70,
2002.
42. Traub O, Berk BC. Laminar shear stress: mechanisms by which endothelial cells transduce
an atheroprotective force. Arterioscler Thromb Vasc Biol, 18(5):677-85, 1998.
43. Uematsu M, Ohara Y, Navas JP, Nishida K, Murphy TJ, Alexander RW, Nerem RM,
Harrison DG. Regulation of endothelial cell nitric oxide synthase mRNA expression by
shear stress. Am J Physiol, 269(6 Pt 1):C1371-8, 1995.
19
44. Velculescu VE, Zhang L, Vogelstein B and Kinzler KW. Serial analysis of gene expression.
Science, 270: 484-487, 1995.
45. Yoshizumi M, Kurihara H, Sugiyama T, Takaku F, Yanagisawa M, Masaki T, Yazaki Y.
Hemodynamic shear stress stimulates endothelin production by cultured endothelial cells.
Biochem Biophys Res Commun, 161(2):859-64, 1989.
20
Table 1. Endoglin Genotype Frequencies in Aneurysm Patients and Controls
Endoglin Genotype
Group
L
S
SL
Total
Aneurysm (%)
3 (3.1%)
65 (66.3%)
30 (30.6%)
98
Controls (%)
4 (2.1%)
126 (66.0%)
61 (31.9%)
191
p = 0.87
Table 2. Endoglin Allele Frequencies in Aneurysm Patients and Controls
Endoglin Allele
Group
L
S
Total
Aneurysm (%)
36 (18.4%)
160 (81.6%)
196
Controls (%)
69 (18.1%)
313 (81.9%)
382
p = 0.93
Table 3. Endoglin genotype frequencies in aneurysm patients by rupture status
Endoglin Genotype
Group
L
S
SL
Total
Ruptured ICA (%)
2 (3.2%)
40 (63.5%)
21 (33.3%)
63
Unruptured ICA (%)
1 (3.0%)
23 (69.7%)
9 (27.3%)
33
p = 0.83
21
Table 4. Endoglin Allele frequencies in aneurysm patients by rupture status
Endoglin Allele
Group
L
S
Total
Ruptured ICA (%)
25 (19.8%)
101 (80.2%)
126
Unruptured ICA (%)
11 (16.8%)
55 (83.3%)
66
p = 0.59
22
Figure 1. Primary DNA sequence of intron 7 endoglin insertion polymorphism (A) and PAGE
analysis of genotypes (B). DNA sequence is displayed in the 5’-3’ orientation and represents the
plus strand. L/S = heterozygous, SS = wild type, LL = homozygous insertion.
B
A
81 bp
TTCCCCTGCCCCTCCCCCTCCCTTCCCTTC
75 bp
TTCCCCTGCCCCTCCCTTCCCTTC
23
L/S
SS
LL
Figure 2. SAGE analysis of endoglin mRNA expression in HCAECs exposed to LSS. mRNA
expression is expressed as normalized SAGE tag counts. Tag counts were normalized in each
SAGE library to 30,000 total counts.
24