The Plant Journal (2006) 45, 320–334
doi: 10.1111/j.1365-313X.2005.02618.x
Light-dependent hypersensitive response and resistance
signaling against Turnip Crinkle Virus in Arabidopsis
A. C. Chandra-Shekara1, Manisha Gupte1, Duroy Navarre2, Surabhi Raina3, Ramesh Raina3, Daniel Klessig4 and Pradeep
Kachroo1,*
1
Department of Plant Pathology, University of Kentucky, Lexington, KY 40546, USA,
2
USDA-Agricultural Research Service, Washington State University, 24106 N. Bunn Road, Prosser, WA 99350, USA,
3
Biology Department, Syracuse University, Syracuse, NY 13244, USA, and
4
Boyce Thompson Institute for Plant Research, Tower Road, Ithaca, NY 14853, USA
Received 30 July 2005; revised 28 September 2005; accepted 10 October 2005.
*
For correspondence (fax 859 323 1961; e-mail pk62@uky.edu).
Summary
Resistance to Turnip Crinkle Virus (TCV) in Arabidopsis ecotype Dijon (Di)-17 is conferred by the resistance
gene HRT and a recessive locus rrt. In Di-17, TCV elicits a hypersensitive response (HR), which is accompanied
by increased expression of pathogenesis-related (PR) genes and high levels of salicylic acid (SA). We have
previously shown that HRT-mediated resistance to TCV is dependent on SA-mediated signal transduction and
that increased levels of SA confer enhanced resistance to TCV via upregulation of the HRT gene. Here we show
that HRT-mediated HR and resistance are dependent on light. A dark treatment immediately following TCV
inoculation suppressed HR, resistance and activation of the majority of the TCV-induced genes. However, the
absence of light did not affect either TCV-induced elevated levels of free SA or the expression of HRT.
Interestingly, in the dark, transgenic plants overexpressing HRT showed susceptibility, but overexpression of
HRT coupled with high levels of endogenous SA resulted in pronounced resistance. Consistent with these
results is the finding that exogenous application of SA prior to TCV inoculation partially overcame the
requirement for light. Light was also required for N gene-mediated HR and resistance to Tobacco Mosaic Virus,
suggesting that it is an important factor which may be generally required during defense signaling.
Keywords: Turnip Crinkle Virus, salicylic acid, defense, Arabidopsis, signaling, ssi2, light.
Introduction
Plants are dependent on light for their survival. In addition to providing life-sustaining energy, light is required
for various growth and developmental processes (Chory,
1997; Karpinski et al., 2003; Mustilli and Bowler, 1997).
Light also plays a role in plant defense against pathogens
and is required for activation of several defense genes
and regulation of the cell death response (Asai et al.,
2000; Brodersen et al., 2002; Fryer et al., 2003; Karpinski
et al., 1999; Mateo et al., 2004). Studies on light perception have shown that salicylic acid (SA)-induced pathogenesis-related 1 (PR-1) gene expression and bacterial
pathogen-induced SA accumulation are dependent on
light (Genoud et al., 2002; Karpinski et al., 2003; Zeier
et al., 2004). Furthermore, Arabidopsis plants grown in the
dark or under reduced light are compromised in their
320
local and systemic resistance responses to the avirulent
pathogen Pseudomonas syringae (Genoud et al., 2002;
Zeier et al., 2004). Genetic evidence supporting the role of
light in defense was provided by studies on mutants that
are defective in the perception of light. Mutations in the
photoreceptors phytochrome A (phyA) or B (phyB) not
only compromised the hypersensitive response (HR) but
also repressed the SA-induced expression of the PR-1
gene (Genoud et al., 2002). The more severe effect of the
phyA phyB double mutant on the SA-mediated pathway
further suggests that light perception has a cumulative
effect on SA signaling and plant defense.
The SA-signal transduction pathway plays a pivotal role
in plant defense signaling. Several components of the SAmediated pathway have been identified, and mutations in
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd
Light-mediated signaling against TCV 321
these lead to enhanced susceptibility to various pathogens (reviewed in Durrant and Dong, 2004). Mutations in
EDS1 (Falk et al., 1999), EDS5 (Nawrath and Metraux, 1999;
Nawrath et al., 2002), PAD4 (Jirage et al., 1999) and SID2
(Wildermuth et al., 2001) reduce or abolish pathogeninduced increases in SA levels. However, exogenously
supplied SA, or its functional analog benzo(1,2,3)thiadiazole-7-carbothioic acid (BTH), is able to induce PR-1 gene
expression in eds1, eds5, pad4, and sid2 mutants, which
suggests that these components act upstream of SA
(Chandra-Shekara et al., 2004; Nawrath et al., 2002).
Besides their role in the resistance (R ) gene-mediated
resistance response, EDS1, EDS5, PAD4 and SID2 also
participate in basal resistance to pathogens, and mutations in these genes lead to enhanced susceptibility to
virulent pathogens. The mechanisms through which EDS1
(a putative lipase), EDS5 (a member of the MATE transporter family) and PAD4 (a putative lipase) regulate
pathogen-induced SA accumulation are unclear.
Resistance to turnip crinkle virus (TCV) in Arabidopsis is
dependent on the EDS1, EDS5, PAD4 and SID2 genes of
the SA pathway (Chandra-Shekara et al., 2004). However,
TCV-induced HR and PR-1 gene expression are independent of mutations affecting the SA pathway, suggesting
that these phenotypes are independent of SA or require
much lower levels of SA. HR and resistance to TCV are
conferred by HRT, which encodes a putative resistance (R)
protein with coiled coil, nucleotide binding, and leucinerich-repeat domains. However, unless overexpressed, HRT
is insufficient to confer resistance in the absence of a
recessive allele at a second locus, rrt (Chandra-Shekara
et al., 2004; Cooley et al., 2000). Interestingly, while the
majority of TCV-resistant Arabidopsis ecotype Dijon (Di)17 plants restrict the virus to the inoculated leaves, 1–15%
of the inoculated plants show systemic spread of the virus
(Chandra-Shekara et al., 2004; Dempsey et al., 1993, 1997;
Kachroo et al., 2000; Simon et al., 1992). This suggests
that environmental factors may play a role in resistance
signaling.
In the present work, we demonstrate that HRT activates
HR and resistance via a pathway(s) that is dependent on
light, but independent of the photoreceptors phytochrome
A (PHYA) and phytochrome B (PHYB). However, the
absence of light does not affect TCV-induced elevated
levels of free SA. Exogenous application of SA or the
presence of high levels of endogenous SA only partially
restored resistance in dark-treated plants. Moreover,
HRT expression was unaffected by light and overexpression of HRT was insufficient to confer TCV resistance in
the dark. The dark treatment carried out prior to TCV
inoculation or 24 h after inoculation did not affect the HR
or resistance. Taken together, these results suggest that
light is required after TCV inoculation and acts downstream of HRT.
Results
Light modulated HR and resistance to TCV
Light is known to play an important role in several physiological and developmental processes. To examine
whether light affects resistance to viral pathogens, we assessed the effects of light on HR and resistance to TCV in
resistant (Di-17) and susceptible (Columbia; Col-0) ecotypes of Arabidopsis. After inoculation with TCV, plants
were incubated in the dark for 10, 12, 24, 48 or 72 h followed by exposure to 14 h light (178.9 lmol m)2 sec)1)/
10 h dark (0 lmol m)2 sec)1) cycles. Col-0 plants, which
lack the HRT gene, did not exhibit an HR under any of the
conditions used. In contrast, Di-17 plants grown for 10 and
12 h in the dark post TCV inoculation (drk-pi) developed a
normal HR 3 days post inoculation (dpi). However, as the
dark period was lengthened the number of HR lesions in
Di-17 plants was progressively reduced, with 24 h darktreated plants showing a marginal reduction, 48 h darktreated plants exhibiting a significant reduction and 72 h
dark-treated plants failing to develop an HR (Figure 1a). HR
development was confirmed by trypan blue staining of
mock- and TCV-inoculated leaves at 3 dpi. While the leaves
from Di-17 plants grown under normal conditions or in
12 h of darkness showed localized cell death lesions corresponding to a visible HR, the Col-0 and 48 or 72 h darktreated Di-17 plants showed dying cells throughout the leaf
and 24 h drk-pi Di-17 plants exhibited an intermediate
phenotype (Figure 1b). To determine if reduction or absence of HR correlated with the suppression of defense
gene induction, expression of the PR-1 gene was assessed
(Figure 1c). Similar levels of expression were seen in Di-17
plants grown under normal light/dark cycles and those
maintained in 12 or 24 h of darkness. By contrast, Di-17
plants maintained in 48 or 72 h of darkness showed a
marked decline in PR-1 transcript levels.
The effect of prolonged darkness on resistance was
investigated by determining the percentage of plants that
developed disease symptoms by 10–14 dpi. The Di-17 plants
showed approximately 10% susceptibility under normal
growth conditions or with 12 h drk-pi. By comparison, the
other dark-treated Di-17 plants exhibited increases in percentage susceptibility, reaching a maximum in plants darktreated for 48 and 72 hours post inoculation (hpi), where
approximately 90 to 100% were susceptible, respectively
(Figure 1d). Strikingly, Di-17 plants dark-treated for 24 hpi
showed a dramatic increase in susceptibility (approximately
75%), even though HR was nearly normal. Like the percentage of susceptible plants, the severity of disease symptoms
increased with increase in the duration of the dark treatment
(Figure 1e,f); Di-17 plants maintained in 48 and 72 h of
darkness showed more severe symptoms than plants darktreated for 24 hpi. The appearance of disease symptoms
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
322 A. C. Chandra-Shekara et al.
Figure 1. Effect of darkness on the hypersensitive response (HR), pathogenesis-related 1 (PR-1) gene expression, and resistance to Turnip Crinkle Virus (TCV).
(a) Typical morphological phenotypes of mock- and TCV-inoculated Arabidopsis plants at 3 days post inoculation (dpi). ‘Normal’ indicates a 14 h light/10 h dark
cycle. 24D, 48D and 72D indicate that these plants were kept in the dark for 24, 48 or 72 h, respectively, immediately after TCV inoculation.
(b) Microscopy of trypan blue-stained leaves from the mock- and TCV-inoculated plants shown in (a). The arrow indicates dead cells.
(c) PR-1 gene expression in the mock- and TCV-inoculated plants shown in (a). The samples were collected at 3 dpi. Ethidium bromide staining of rRNA was used as a
loading control.
(d) Percentage susceptibility seen in Dijon (Di)-17 and Columbia (Col)-0 plants upon exposure to various durations of dark treatment. The susceptible plants were
scored based on their typical TCV-induced disease symptoms, including crinkling of leaves and drooping or shortening of bolts. The number of plants analyzed is
indicated above each bar.
(e) Disease symptom rating of susceptible Di-17 plants maintained in normal conditions or subjected to 24, 48 or 72 h of dark treatment. The severity of disease
symptoms was rated according to the key on the right.
(f) Typical morphological phenotypes of mock- and TCV-inoculated Di-17 and Col-0 plants grown in normal conditions or subjected to 24, 48 or 72 h of treatment.
(g) Systemic spread of TCV to uninoculated tissue in mock-inoculated ()) and TCV-inoculated (þ) plants shown in (a). RNA was extracted from the uninoculated
tissues at 18 dpi and analyzed for the presence of the viral transcripts (TCV-U). Ethidium bromide staining of rRNA was used as a loading control.
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
Light-mediated signaling against TCV 323
Figure 1. Continued.
also correlated with the presence of TCV transcript in the
systemic un-inoculated tissue (Figure 1g). In comparison to
Di-17, the Col-0 plants subjected to dark periods of 12, 24, 48
or 72 h did not exhibit any enhanced disease symptoms.
These results suggest that light affects only R gene-mediated resistance and not basal resistance to TCV. Taken
together, our data show that HRT-mediated signaling is
dependent on light for the induction of HR and resistance to
TCV.
Light was required after TCV inoculation
To assess whether light affects HRT-mediated resistance
signaling before or after TCV inoculation, we incubated
Di-17 plants in the dark for 24 or 48 h (24D-preTCV or 48DpreTCV, respectively) prior to TCV inoculation followed by a
normal light/dark cycle after inoculation. Alternatively, after
inoculation plants were maintained for 24, 48 or 72 h under
normal light conditions before being subjected to 48 h dark
treatment (24N þ 48D, 48N þ 48D and 72N þ 48D, respectively). Di-17 plants maintained in darkness before TCV
inoculation showed normal HR and PR-1 gene expression
(Figure 2a,b). These plants were also resistant to TCV and
did not allow systemic spread of the virus (Figure 2c–e). The
Di-17 plants maintained under normal conditions for 24 or
48 h after TCV inoculation followed by a 48 or 24 h dark
treatment, respectively, also showed normal HR and high
levels of PR-1 gene expression (Figure 2a,b). Percentages of
resistant plants were similar in the TCV-inoculated Di-17
plants maintained under normal light conditions and the
plants that were maintained for 24, 48 or 72 h under normal
light conditions before being subjected to a 48-h dark treatment (Figure 2c–e). These results suggest that the lightdependent defense signaling occurs within the first 14 h
after inoculation. To further define this light-dependent
phase, the Di-17 plants were subjected to 0.30, 1, 3, 6, 12 or
14 h of light before being subjected to 48 h of darkness. No
HR or PR-1 gene expression was seen in plants that were
exposed to 0.30, 1, 3, or 6 h of light prior to the dark phase
(Figure 2f and data not shown). However, plants exposed to
12 or 14 h of light before the onset of the dark phase showed
a normal HR and high levels of PR-1 gene expression.
Interestingly, increasing the length of the light phase led to
proportionate increases in the number of resistant plants,
with light phases of 6 h and 12 h resulting in approximately
25% and approximately 70% resistance, respectively (Figure 2g). However, the percentage of resistant plants maintained under conditions of 14 h light followed by 48 h dark
was lower (70%) than that for plants subjected to normal
light/dark cycling (approximately 85%). These data suggest
that a light phase followed by a dark phase may be required
to obtain an optimal resistance response.
Extended darkness suppressed HR and resistance without
impacting free SA levels
As light has been shown to modulate SA levels (Zeier et al.,
2004), it is possible that the absence of light may lead to a
reduction in TCV-induced SA production, thereby resulting
in susceptibility. To address this possibility, we measured
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
324 A. C. Chandra-Shekara et al.
Figure 2. Effects of darkness and light prior to and post Turnip Crinkle Virus (TCV) inoculation, respectively, on hypersensitive response (HR), pathogenesis-related
1 (PR-1) gene induction, and resistance to TCV.
(a) Typical morphological phenotypes of TCV-inoculated Arabidopsis Dijon (Di)-17 plants at 3 days post inoculation (dpi). Plants were either subjected to a dark
treatment for 24 or 48 h before TCV inoculation (preTCV) and returned to a normal light/dark cycle or maintained after inoculation under normal conditions for 24, 48
or 72 h followed by 48, 24 or 0 h of dark treatment, respectively. Normal (N) indicates a 14 h light/10 h dark cycle.
(b) PR-1 gene expression in the mock- and TCV-inoculated plants shown in (a). The samples were collected at 3 dpi. Ethidium bromide staining of rRNA was used as
a loading control.
(c) Percentage susceptibility in Di-17 plants that were either subjected to a dark treatment for 24 or 48 h before TCV inoculation and returned to a normal light/dark
cycle or maintained after inoculation under normal conditions for 24, 48 or 72 h followed by a 48-h dark treatment. The susceptible plants were scored based on their
typical TCV-induced disease symptoms, including crinkling of leaves and drooping or shortening of bolts. The numbers of plants tested are indicated above each
bar.
(d) Systemic spread of TCV to uninoculated tissue in mock- and TCV-inoculated plants shown in (c). RNA was extracted from the uninoculated tissues at 18 dpi and
analyzed for the presence of the viral transcripts (TCV-U). Ethidium bromide staining of rRNA was used as a loading control.
(e) Typical morphological phenotypes of TCV-inoculated Di-17 plants shown in (c).
(f) PR-1 gene expression in TCV-inoculated plants that were grown in the light for 3, 6, 12 or 14 h prior to a 48-h dark period. The samples were collected at 3 dpi.
Ethidium bromide staining of rRNA was used as a loading control.
(g) Percentage susceptibility seen in Di-17 plants that were grown in the light for 3, 6, 12 or 14 h prior to a 48-h dark period. The susceptible plants were scored based
on their typical TCV-induced disease symptoms. The number of plants analyzed is indicated above each bar.
SA and SA glucoside (SAG) levels in Di-17 plants that were
subjected to 24 or 48 h of darkness after TCV inoculation.
Di-17 plants maintained under normal conditions or subjected to 24 or 48 h of dark treatment showed similar levels
of free SA at 3 dpi (Figure 3a). However, in comparison to
the normal-treated plants, the 24 and 48 h dark-treated Di-17
plants showed an approximately two- to seven-fold reduction in their SAG content, respectively. To determine
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
Light-mediated signaling against TCV 325
Figure 2. Continued.
Figure 3. Levels of salicylic acid (SA) and SA
glucoside (SAG). Endogenous SA (a) and SAG
(b) levels in mock- and TCV-inoculated leaves of
Arabidopsis Dijon (Di)-17 and Columbia (Col)-0
plants subjected to normal conditions (N), a 24-h
dark treatment (24D), a 48-h dark treatment (48D)
or a normal 24-h cycle followed by a 48-h dark
treatment (24N þ 48D) are shown. Samples were
harvested at 3 days post inoculation (dpi). The
values are presented as the mean of three
replicates. The error bars represent standard
deviation.
whether this reduction in SAG was responsible for susceptibility in these plants, we analyzed SA and SAG levels in
TCV-inoculated Di-17 plants that were maintained under
normal conditions for 24 h followed by a 48 h dark period.
Although these plants showed normal HR and resistance to
TCV, they accumulated approximately sevenfold lower levels of SAG as compared with normal-treated TCV-inoculated
plants (Figure 3b). In contrast to SAG levels, SA levels in
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
326 A. C. Chandra-Shekara et al.
these plants were only marginally lower than in normally
grown plants. Neither SA nor SAG levels in Col-0 plants
changed significantly in either the mock- or TCV-inoculated
dark-treated plants. Taken together, these results suggest
that increasing the length of the dark phase after TCV
inoculation proportionately affects the TCV-induced SAG
levels. However, a reduction in SAG level does not appear to
be responsible for the enhanced susceptibility seen in the
dark-treated Di-17 plants. In contrast, absence of light did not
alter the free SA levels.
Exogenous application of SA partially overcame the
requirement for light
Previously, we showed that exogenous application of SA
or BTH to HRT-containing SA-deficient mutants or to
SA-deficient salicylate hydroxylase (NahG) expressing
transgenic Di-17 plants enhanced their resistance to TCV in
a PAD4-dependent manner (Chandra-Shekara et al., 2004).
To investigate whether induction of the SA-signaling
pathway prior to TCV inoculation followed by dark treatment overcomes the requirement for light, we pretreated
Di-17 plants with BTH under normal light conditions and
then transferred these plants to the dark for 48 h after TCV
inoculation. Under these conditions, application of BTH
greatly increased the percentage of resistant plants (Figure 4a,b). However, BTH treatment was more effective
under normal light conditions; percentages of resistant
plants were higher in normally treated plants as compared
with dark-treated plants (Figure 4a). Simultaneous treatment with BTH and darkness following TCV inoculation
did not enhance the resistance response in Di-17 plants
(Figure 4c; also compare to Figure 1d), suggesting that
light was required to trigger the SA-mediated signaling.
Consistent with this data, plants treated with BTH and
kept in the dark did not induce PR-1 gene expression
(Figure 4d). As expected, BTH treatment did not affect
resistance in Col-0 plants, irrespective of the light conditions (Figure 4a). These data suggest that pre-induction of
the SA pathway in the presence of light may provide a
factor(s) required for resistance.
To examine the dependence of BTH-induced resistance in
dark-treated plants on SID2, EDS1, EDS5 and PAD4, we
assessed resistance in HRT sid2, HRT eds1, HRT eds5 and
HRT pad4 plants that were treated with BTH prior to TCV
inoculation followed by 48 h of dark treatment. Exogenous
application of BTH increased the percentage of resistant
plants in all except the HRT pad4 plants (Figure 4a,b).
Similar to BTH-treated Di-17 plants, the percentage resistance was higher in the plants maintained under normal light
conditions as compared with those subjected to a 48-h dark
treatment. Taken together, these data suggest that the BTHinduced stimulation of resistance in the dark is not dependent on EDS1, EDS5 and SID2 but does require PAD4.
Light did not affect HRT transcript levels and overexpression
of HRT was insufficient to confer resistance in the dark
Previously, we showed that overexpression of HRT conferred resistance to TCV in an rrt-independent manner. To
assess if the dark treatment impaired resistance to TCV by
affecting HRT transcript levels, we analyzed HRT overexpressing lines HRT ssi2, HRT cpr5 and E-9-4. The characterization of HRT ssi2 and E-9-4 has been described previously
(Chandra-Shekara et al., 2004). The HRT cpr5 line was created by crossing Di-17 with cpr5 and identifying F2 progeny,
which were homozygous for HRT and cpr5. While the HRT
ssi2 and HRT cpr5 plants contain high levels of endogenous
SA and SAG, the overexpression of HRT in E-9-4 is not
associated with increased SA levels (Chandra-Shekara et al.,
2004). Dark treatment did not affect basal levels or overexpression of HRT; the levels of HRT transcript in normally
treated plants were similar to those in plants subjected to
48 h of dark treatment (Figure 5a,b). Dark treatment also
failed to abolish feedback induction of EDS1 and PAD4 gene
expression in HRT ssi2 plants, which suggests that dark
treatment was unlikely to impact SA levels in these plants
(Figure 5b). However, SA treatment carried out in the dark
was unable to induce expression of EDS1, PAD4 or HRT,
suggesting that light was required for SA-mediated induction of these genes.
The increased expression of HRT in E-9-4 plants led to
elimination of visible HR and reduced cell death when
these plants were maintained in normal light conditions
(Cooley et al., 2000; Figure 5c). By contrast, the E-9-4
plants subjected to a 48-h dark period showed extensive
microscopic cell death at 3 dpi (Figure 5c). These results
are similar to those obtained with dark-treated Di-17
plants and suggest that high levels of expression of
HRT do not compensate for the loss of HR in plants
undergoing a prolonged dark treatment. The TCV-induced
HR responses in the HRT ssi2 and HRT cpr5 plants could
not be evaluated because these plants spontaneously
develop lesions on their leaves. However, dark-treated
HRT ssi2 and HRT cpr5 plants did not develop any
prominent chlorotic symptoms on their leaves, suggesting
that these plants continue to resist TCV replication and
spread. Consistent with this, dark treatment caused only a
marginal reduction in resistance (approximately 95% to
approximately 85%; Figure 5d). In contrast, resistance in
E-9-4 plants was markedly suppressed by 48 h of dark
treatment. To investigate whether the dark-induced susceptibility in E-9-4 plants can be overcome by the
exogenous application of SA or BTH, we assessed the
resistance response in BTH-pretreated E-9-4 plants (BTHpreTCV, Figure 5e) grown in the dark for 48 h post
inoculation. BTH pretreatment increased the percentage
of resistant E-9-4 plants, suggesting that induction of
SA-mediated responses partially compensated for the
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
Light-mediated signaling against TCV 327
(a)
Figure 4. Effect of exogenous application of
benzo(1,2,3)thiadiazole-7-carbothioic acid (BTH)
on resistance to turnip crinkle virus (TCV).
(a) Percentage of resistant Arabidopsis plants
obtained with Dijon (Di)-17, Di-17 NahG, HRT
sid2, HRT eds1, HRT pad4, HRT eds5 and Columbia (Col)-0 with or without BTH pretreatment
under normal light conditions or with a 48-h dark
treatment. The number of plants tested is indicated above each bar.
(b) Systemic spread of TCV to uninoculated
tissues in water- and BTH-treated and darkmaintained plants shown in (a). RNA was extracted from the uninoculated tissues at 18 days post
inoculation (dpi) and analyzed for the presence of
the viral transcripts (TCV-U). Ethidium bromide
staining of rRNA was used as a loading control.
(c) Percentage susceptibility in Di-17 plants treated with BTH in the light and the dark. The
number of plants analyzed is indicated above
each bar.
(d) Pathogenesis-related 1 (PR-1) gene expression in water- or BTH-treated Di-17 and Col-0
plants 48 h after treatments. The treated plants
were either grown in normal light conditions
(14 h light/10 h dark) or in the dark. Ethidium
bromide staining of rRNA was used as a loading
control.
(b)
(c)
absence of light. This is also consistent with the observation that both HRT ssi2 and HRT cpr5 contained high
levels of endogenous SA, and thus these plants may be
favorably predisposed for resistance to TCV, regardless of
whether a dark treatment is applied after inoculation.
Light-dependent HR and resistance to TCV were
independent of phytochromes A and B
Light-mediated signaling leading to SA-dependent PR-1 gene
expression, HR and resistance to Pseudomonas syringae was
shown to require the photoreceptors PHYA and PHYB
(d)
(Genoud et al., 2002). To determine the dependence of TCVinduced PR-1 gene expression, HR and resistance on these
photoreceptors, we crossed Di-17 with phyA or phyB mutants
and analyzed the F2 population for TCV-induced phenotypes.
Upon TCV inoculation, plants that carried HRT and were
homozygous for either the phyA or phyB mutation developed
a HR comparable to that seen in Di-17 (Figure 6a). The HR in
these plants also correlated with high levels of PR-1 gene
expression (Figure 6b), suggesting that TCV-induced HR and
PR-1 gene expression phenotypes are independent of PHYA
and PHYB. To further assess the roles of PHYA and PHYB in
resistance to TCV, we analyzed the segregation of resistance
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
328 A. C. Chandra-Shekara et al.
(a)
(b)
(d)
(c)
(e)
in HRT phyA and HRT phyB plants. Because resistance
requires both HRT and a recessive locus rrt, only approximately 25% of the HRT-containing plants in a parental cross
between Di-17 and Landsberg (or Col-0) were resistant to TCV
(Table 1). If resistance was also dependent on PHYA and/or
PHYB loci, all HRT phyA and HRT phyB plants would be
expected to show disease symptoms and viral spread. However, approximately 25% of the HRT phyA or HRT phyB
plants, as well as HRT PHYA/– or HRT PHYB/– plants, showed
resistance to TCV (Table 1, Figure 6c), suggesting that PHYA
and PHYB were not contributing to HRT-mediated resistance.
Transcriptome profiling revealed suppression of defense
genes in the dark
To determine the effects of a dark treatment on genes that are
induced or repressed after TCV inoculation, we compared the
transcriptome profile of TCV-inoculated Di-17 plants that
Figure 5. Effect of darkness on HRT, EDS1 and
PAD4 transcript levels, cell death phenotype and
resistance mediated by HRT overexpression.
(a) Reverse transcriptase–polymerase chain reaction (RT-PCR) analysis of Arabidopsis plants
maintained under normal light conditions or in
the dark for 48 h. RT-PCR was performed using
total RNA and HRT gene-specific primers (Cooley
et al., 2000) and the products were visualized on
an ethidium bromide-stained agarose gel. The
level of b-tubulin was used as an internal control
to normalize the amount of cDNA template.
(b) RT-PCR analysis of plants maintained under
normal light conditions, maintained in the dark
for 48 h or treated with SA in the light or the dark.
RT-PCR was performed using total RNA and
EDS1, PAD4, or HRT gene-specific primers and
the products were visualized on an ethidium
bromide-stained agarose gel. The level of btubulin was used as an internal control to
normalize the amount of cDNA template.
(c) Typical morphological phenotype and microscopy of trypan blue-stained leaves from Turnip
Crinkle Virus (TCV)-inoculated E-9-4 plants maintained in normal light conditions or in the dark
for 48 h. The leaves were sampled at 3 days post
inoculation (dpi).
(d) Percentage of TCV-resistant Dijon (Di)-17, E-94, HRT ssi2 and HRT cpr5 plants maintained in
normal light conditions or in the dark for 48 h.
The numbers of plants tested are indicated above
each bar.
(e) Percentage resistance in Di-17, E-9-4, and
Columbia (Col)-0 with or without BTH pretreatment and under normal light conditions or with a
48-h dark treatment. The numbers of plants
tested are indicated above each bar.
were maintained under normal light conditions or in darkness for 48 h. Profiles were compared at 3 and 7 dpi and
included approximately 1200 genes that either respond to
various biotic or abiotic stresses or have a housekeeping
function. A total of eight microarray data sets were generated
with two biological replicates for each time point; genes induced or repressed at least twofold were analyzed further. As
expected at 3 dpi, TCV-inoculated Di-17 plants maintained
under normal light conditions showed alterations in the
expression of a number of genes; these were categorized
based on their predicted function (Table S1a). Expression of
the majority of defense- and stress-related genes, which was
induced at 3 dpi in TCV-inoculated normal-treated plants,
was suppressed in dark-treated TCV-inoculated plants. The
TCV-inoculated plants maintained in normal light showed
high levels of induction of PAD3 at 3 dpi, which corresponds
well with the accumulation of high levels of camalexin
in these plants (Dempsey et al., 1997). Surprisingly,
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
Light-mediated signaling against TCV 329
induced expression of SID2 at 3 dpi but this did not cause any
further increase in SA levels in dark-treated plants. It is
possible that induction of SID2 in the dark is a result of the
failure of the TCV-induced SA signal to be properly transduced, thus leading to the absence of feedback regulation.
This possibility is supported by the finding that the darktreated plants showed delayed induction of several defense
genes at 7 dpi (Table S1b). The level of induction seen in
dark-treated samples at 7 dpi was slightly lower or comparable to that found in normally treated TCV-inoculated samples collected at 3 dpi. Taken together, these data suggest
that, while dark treatment is unable to prevent initiation of a
signaling pathway, it may be able to render it ineffective.
However, some of the signaling intermediates are likely to
accumulate during the dark treatment and mount a defense
response when light becomes available.
(a)
(b)
(c)
N gene-mediated resistance to tobacco mosaic virus was
light dependent
To examine the importance of light in other host–virus
interactions, we assessed the effects of dark treatment on N
gene-mediated local as well as systemic resistance to
Tobacco Mosaic Virus (TMV). TMV-resistant (NN ) and TMVsusceptible (nn) Xanthi-nc tobacco plants (Nicotiana tabacum) were maintained for 48 h in the dark after TMV
inoculation and analyzed for HR, PR-1 and coat protein
accumulation in inoculated and systemic un-inoculated tissues. In comparison to the NN plants that received a normal
light/dark cycle, the NN plants subjected to 48 h of dark
treatment showed an increase in the size of lesions (Table 2).
Increase in lesion size is associated with a reduced ability of
the plant to restrict the replication and spread of the virus
(Kumar and Klessig, 2003). Similar to dark-grown Di-17
plants, the dark-grown NN plants also showed a reduction
in PR-1 protein (Figure 7a). In contrast to NN plants maintained under normal conditions, the dark-treated NN plants
allowed systemic spread of the virus, resulting in severe
disease symptoms and accumulated viral coat protein in the
uninoculated leaves (Figure 7b). The susceptible nn plants
Figure 6. Effect of phytochrome A (phyA) and phytochrome B (phyB) mutations on the HRT-mediated hypersensitive response (HR), pathogenesisrelated 1 (PR-1) gene expression, and resistance to turnip crinkle virus (TCV).
(a) Typical HR in TCV-inoculated leaves of Arabidopsis Dijon (Di)-17, HRT
phyA and HRT phyB plants at 3 days post inoculation (dpi). The HRT phyA and
HRT phyB plants were homozygous for the mutant locus and had at least one
copy of the HRT gene.
(b) PR-1 gene expression in mock- or TCV-inoculated Di-17, Columbia (Col)-0
and HRT phyA or HRT phyB plants. The HRT phyA and HRT phyB plants were
homozygous for the mutant allele and had at least one copy of the HRT gene.
Ethidium bromide staining of rRNA was used as a loading control.
(c) Resistance and systemic spread of TCV in various genotypes shown in (b).
RNA was extracted from the uninoculated tissues at 16 dpi and analyzed for
the presence of viral transcripts (TCV-U). Ethidium bromide staining of rRNA
was used as a loading control.
TCV-inoculated plants maintained in the light had repressed
levels of ICS1 (SID2) expression at 3 dpi; SID2 is required for
TCV-induced SA synthesis. By comparison, dark treatment
Table 1 Analysis of segregation for resistance to turnip crinkle virus (TCV) in the F2 population derived from a cross between Dijon (Di)-17 and
phytochrome A (phyA) or phytochrome B (phyB) mutants
Crosses
Number of
plants analyzed
Di-17 · Col-0
Di-17 · Ler
Di-17 · phyA
150
122
194
Di-17 · phyB
273
Genotypea
Number of
plants obtained
HR
R
S
v2
Pb
HRT/HRT/HRT/-phyA phyA
HRT/-PHYA PHYA
HRT/-phyB phyB
HRT/-PHYB PHYB
99
85
26
43
34
31
þ
þ
þ
þ
þ
þ
21
18
8
12
11
6
78
67
18
31
23
25
0.74
0.65
0.45
0.18
0.97
0.53
0.38
0.42
0.50
0.66
0.32
0.46
a
The genotype at the HRT, phyA and phyB loci was determined by cleaved amplified polymorphic sequence analysis.
One degree of freedom.
HR, hypersensitive response; R, resistant; S, susceptible; Col, Columbia; Ler, Landsberg.
b
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
330 A. C. Chandra-Shekara et al.
Table 2 Effect of the 48-h dark treatment on local Tobacco Mosaic
Virus (TMV)-induced lesions in Xanthi-nc tobacco plants (NN)
Lesion size
Treatment
Diameter (mm)a
% increaseb
Normal
Dark
0.89 0.24
1.49 0.35
59.7
a
Mean standard deviation. Approximately 20–30 lesions were
measured from nine different zones and three different leaves.
Measurements were made using a vernier caliper.
b
Relative to normal growth conditions.
(a)
(b)
Figure 7. Effect of dark treatment on pathogenesis-related 1 (PR-1) gene
induction and resistance to tobacco mosaic virus (TMV).
(a) PR-1 induction in mock- or TMV-inoculated Xanthi-nc tobacco plants (NN
and nn). After inoculation the plants were maintained either under normal
conditions or in the dark for 48 h. The samples were collected at 2 days post
inoculation (dpi). Approximately 10 lg of total protein was fractionated using
sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and
subjected to immunoblot analysis using anti-PR-1 antibodies. Levels of
Rubisco were used as the loading control.
(b) Spread and replication of TMV in uninoculated leaves in the genotypes
shown in (a). Approximately 10 lg of total protein was fractionated using
SDS-PAGE and subjected to immunoblot analysis using anti-coat protein (CP)
antibodies. Levels of Rubisco were used as the loading control.
exhibited similar timing and severity of symptoms under
light or dark conditions. These results indicate that light is
also required for N gene-mediated HR and resistance to TMV.
Discussion
In this study, we showed that the HR and resistance to TCV
and TMV in Arabidopsis and tobacco, respectively, are
influenced by light (Figures 1 and 7). When plants inoculated
with TCV or TMV were exposed to prolonged darkness before regular day and night cycling, development of HR was
compromised and the virus spread systemically. This susceptibility in otherwise resistant plants suggests that light
acts as an important signal in host–virus interactions. The
findings of host–pathogen interaction studies using Arabidopsis or rice (Oryza sativa) with bacterial pathogens also
support the view that light-mediated or -facilitated signaling
is required for resistance (Genoud et al., 2002; Guo et al.,
1993; Zeier et al., 2004). Thus, in general, light-mediated or facilitated signaling appears to play a key role in the defense
response to pathogens.
In light of the work of Genoud et al. (2002) showing that
mutations in PHYA and PHYB repress SA induction of PR-1,
HR and resistance to P. syringae, we anticipated that these
two photoreceptors would participate in TCV-induced defense responses. However, our results indicate that HR and
resistance to TCV are independent of PHYA and PHYB
(Figure 6). Since Genoud et al. (2002) analyzed the resistance response only in the phyA phyB double mutant, it is
possible that both phyA and phyB need to be mutated to see
an effect on TCV resistance. Alternatively, it is possible that
the TCV resistance pathway is dependent on photoreceptors
other than PHYA and PHYB. In addition to PHYA and PHYB,
the Arabidopsis genome contains three other phytochromes
(PHYC, PHYD and PHYE), three cryptochromes (CRY1, CRY2
and CRY3) and two phototropins (PHOT1 and PHOT2), all of
which are involved in photoreception (reviewed in Chen
et al., 2004). Thus, it is possible that one or more of these
photoreceptors may be involved in generating or facilitating
a signal(s) required for HR and resistance to TCV. The results
of these two studies also argue that different photoreceptors
may mediate or facilitate defense responses in different
host–pathogen systems.
SA was induced to similar levels in dark-treated TCVinoculated plants and TCV-inoculated plants subjected to
normal light/dark cycling (Figure 3). By comparison, the
TCV-induced SAG levels showed a reduction after 24 or 48 h
of dark treatment. This dark-mediated reduction in SAG
suggests the possibility that darkness affects the SA
biosynthetic pathway, leading to generation of SAG. However, it is unlikely that the reduced SAG levels contribute to
susceptibility, as plants that were dark-treated 24 h after
being maintained under normal light conditions also
showed a decline in their SAG levels, and yet these plants
were resistant to TCV. Moreover, the biological activity of
SAG is dependent on its conversion to SA (Hennig et al.,
1993), which also suggests that levels of free SA, but not
SAG, are critical for resistance to TCV.
Resistance to TCV in dark-treated plants was markedly
improved upon pretreatment with exogenous SA (Figure 4a). This result is supported by the observation that
pretreatment of SA leads to potentiation of cell death, H2O2
accumulation and PR-1 gene expression (Kohler et al., 2002;
Shirasu et al., 1997). However, SA was only effective when
the plants were pretreated in the presence of light; SA
treatment carried out in the dark was unable to induce SAmediated signaling leading to resistance or PR-1 gene
expression (Figure 4c,d). In addition, the percentage of
plants resistant to TCV was reduced in SA-pretreated plants
that were shifted to darkness after inoculation, as compared
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
Light-mediated signaling against TCV 331
with those kept under normal light conditions (Figure 4a).
These results argue that both light and SA contribute to
resistance and that SA-mediated potentiation of cellular
defense responses may be light dependent. Interestingly,
light does not appear to be as critical for resistance in HRT
ssi2 and HRT cpr5 plants. These plants have constitutively
high levels of SA and remain resistant to TCV even after dark
treatment. This suggests that mutants with constitutively
high levels of SA have already activated the downstream
events that are light influenced, thus obviating the need for
light. The failure of pretreatment with SA, prior to inoculation and dark treatment, to provide as much resistance in Di17 plants as seen in HRT ssi2 and HRT cpr5 plants may reflect
less effective defense induction by transient application of
exogenous SA.
SA- or BTH-induced enhancement of resistance in the dark
was independent of EDS1, EDS5 or SID2 (Figure 4a,b). In
contrast, BTH-treatment of HRT pad4 plants did not result in
resistance in either control or dark-treated plants. This is
consistent with our earlier observation that PAD4 is required
for SA-mediated induction of HRT (Chandra-Shekara et al.,
2004). The absence of light did not compromise the SAmediated feedback induction of EDS1, PAD4 or HRT in the
HRT ssi2 plants (Figure 5b), nor did it affect the levels of HRT
in HRT-overexpressing E-9-4 plants, in which SA does not
contribute to increased expression of HRT. These observations suggest that darkness does not reduce resistance by
simply impairing the feedback loop leading to overexpression of HRT. This conclusion is further supported by the
finding that dark treatment suppressed resistance in E-9-4
plants, although it did not affect HRT overexpression.
It is interesting to note that, although the HR to TCV does
not require high levels of SA, this phenotype is dependent
on light. The HR to TCV is independent of the EDS1, EDS5,
PAD4, and SID2 genes, all of which are involved in the SA
synthesis pathway, suggesting that the pathway leading to
generation of SA is not required for the HR (Figure 8;
Chandra-Shekara et al., 2004). This possibility is supported
by the finding that HR-associated induction of PR-1 gene
expression was not seen in dark-treated plants, although SA
levels in these plants were similar to those induced in plants
maintained under normal light conditions. The presence of
near-identical levels of free SA in TCV-inoculated normally
treated and dark-treated plants also suggests that darkness
is unlikely to affect the initiation of HRT-mediated signaling.
Because light is involved in a number of physiological
responses, it is possible that lack of it weakens the general
physiology and metabolism of plants and renders them
unable to mount an effective defense response. However,
analyses of the amino acid, protein and chlorophyll content
of Arabidopsis leaves after 1 and 2 days of dark treatment
showed no or marginal variation in these metabolites
(Buchanan-Wollaston et al., 2005; Lin and Wu, 2004). In
addition, a marginal change or no change was seen in the
Figure 8. Model for induction of the hypersensitive response (HR) and
resistance to the Turnip Crinkle Virus (TCV).
The TCV-induced resistance response is initiated upon direct or indirect
interaction between the dominant resistance protein HRT and the TCV
avirulence factor, the coat protein (CP). Upon recognition of the pathogen, an
HRT-mediated response leads to the HR, accumulation of salicylic acid (SA)
and pathogenesis-related 1 (PR-1) gene expression. Both the HR and PR-1
gene expression are independent of the EDS1, PAD4, EDS5 and SID2 genes. In
contrast, resistance to TCV is dependent on the EDS1, PAD4, EDS5 and SID2
genes. Exogenous application of SA upregulates expression of HRT and this
step is mediated via PAD4 (dot–dashed line) (Chandra-Shekara et al., 2004).
Exogenous application of SA also upregulates expression of EDS1, PAD4 and
PR-1 in the light but is rendered ineffective in the dark. Absence of light during
the initial stages of HRT-mediated signaling abolishes both the HR and
resistance to TCV (thick lines). A dark treatment also impairs resistance in E-94 transgenic plants, where overexpression of HRT is not mediated by high
levels of SA (dashed line).
photochemical efficiency of photosystem (PS) II after 48 h of
dark treatment (Buchanan-Wollaston et al., 2005). It has also
been shown that lack of a carbohydrate source is not a
limiting factor that restricts SA-induced PR-1 expression or
HR under low light conditions (Genoud et al., 2002). These
findings, together with our observation that dark treatment
had no effect after 24 h of TCV inoculation, suggests that
light plays a specific role in plant defense.
Our results show that light or a light-derived or -facilitated
signal(s) is required together with the SA-dependent pathway to positively modulate resistance to TCV (Figure 8). In
addition, a light-derived or -facilitated signal(s) is also
required for the HRT-mediated pathway leading to the HR
and PR-1 gene expression. Thus, absence of either SA or
light would result in susceptibility and compromised HR.
This scenario is supported by several observations. First, a
hyperactive phytochrome pathway in the psi mutant has
been shown to amplify SA-dependent induction of the HR
and PR-1 gene expression to higher levels (Genoud et al.,
2002). Secondly, continuous or high light produced increased levels of resistance and induced elevated expression of several PR genes (Bechtold et al., 2005; Dempsey
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
332 A. C. Chandra-Shekara et al.
et al., 1993; Genoud et al., 2002). Thirdly, silencing of the
33 kDa subunit of the oxygen-evolving complex of PS II
results in increased accumulation of TMV, potato virus X and
alfalfa mosaic viruses (Abbink et al., 2002). These and
several other observations suggest that chloroplast-derived
signals and photosynthesis play an important role in host–
pathogen interactions (Tecsi et al., 1992; Allen et al., 1999;
Genoud et al., 2002; Shalitin and Wolf, 2000). Further
characterization of light-induced signaling will help unravel
this complex interaction between light and defense.
Experimental procedures
Plant growth conditions, viral infections and genetic analysis
Plants were grown in MTPS 144 Conviron walk-in chambers (Winnipeg, Manitoba, Canada) at 22C and 65% relative humidity and
with a 14-h photoperiod. The photon flux density (PFD) of the light
period was 106.9 lmol m)2 sec)1 and was measured using a digital
light meter (Phytotronic Inc., Earth City, MO, USA). After viral
inoculations, the plants were transferred to a Conviron MTR30
reach-in chamber maintained at 22C and 65% relative humidity and
with a 14-h photoperiod. The PFD of this chamber was
178.9 lmol m)2 sec)1. Dark treatments were carried out in a similar
chamber maintained at 22C and 65% relative humidity and with a 0h photoperiod (0 lmol m)2 sec)1).
Transcripts synthesized in vitro from a cloned cDNA of TCV using
T7 RNA polymerase were used for viral infections (Dempsey et al.,
1993; Oh et al., 1995). For inoculations, the viral transcript was
suspended at a concentration of 0.05 lg ll)1 in inoculation buffer,
and the inoculation was performed as described previously (Dempsey et al., 1993). Resistance and susceptibility were scored at 14 to
21 dpi and confirmed by northern gel blot analysis. Susceptible
plants showed stunted growth, crinkling of leaves and drooping of
the bolt.
For tobacco inoculations, two upper fully expanded leaves of 6–8week-old plants were infected with TMV strain U1 at a concentration
of 1 lg ml)1 in 50 mM phosphate buffer (pH 7.2) containing carborundum. Control plants were treated with phosphate buffer and
carborundum only.
Crosses were performed by pollinating flowers of Di-17 plants
with pollen from Landsberg (Ler), cpr5, phyA and phyB plants. The
genotypes of the F2 plants at the PHYA and PHYB loci were
determined by conducting cleaved amplified polymorphic
sequence (CAPS) analysis. The PHYA and PHYB loci were amplified
using GAAGTGTTGACTGCTTCCA CGAGT, TAGCAAGATGCACAGAACGCC and GTCAAGGTTCTTGTTTAAGC, TCTTTTATCTGAACTTCACT primers, respectively. The amplified products were
digested with HinfI and AccI to determine polymorphisms at the
PHYA and PHYB loci, respectively.
Trypan blue staining
Cell death was determined visually and by trypan blue staining 3
to 4 dpi. Leaf samples were vacuum-infiltrated with trypan blue
stain, which contained 10 ml of acidic phenol, 10 ml of glycerol,
20 ml of sterile water and 10 mg of trypan blue. The samples
were incubated for 2 min in a water bath set at 90C and subsequently incubated at room temperature for 2–12 h. The samples were destained in a chloral hydrate solution (25 g/10 ml
sterile water).
Chemical treatment of plants
Three-week-old plants were sprayed or subirrigated with a solution
of 500 lM SA or 100 lM BTH. Control plants were treated with water
and, 2 days after treatment, three leaves per plant were inoculated
with TCV RNA.
SA and SAG estimations
Salicylic acid extraction was based on the method of Gaffney et al.
(1993), with modifications to allow for a higher throughput approach and recovery. Anisic acid was used as an internal standard
and SA recovery averaged >80%. Results are the average of three to
six independent extractions. Samples were analyzed on an Agilent
1100 (Agilent Technologies, Palo Alto, CA, USA) with diode-array
detector and fluorescence-array detector detection, using a Novapak C18 column (Waters, Milford, MA, USA).
RNA extraction, reverse transcriptase–polymerase chain
reaction (RT-PCR) and protein work-up
Small-scale RNA extractions were performed with TRIzol reagent
(Invitrogen, Rockville, MD, USA), according to the manufacturer’s
instructions. RNA gel blot analysis and synthesis of random primed
probes were performed as described previously (Kachroo et al.,
2000). RT-PCR was performed using total RNA and HRT gene-specific primers (Cooley et al., 2000). Proteins were extracted in buffer
containing 50 mM Tris, pH 8.0, 1 mM EDTA, 12 mM b-mercaptoethanol and 10 lg ml)1 phenylmethylsulfonyl fluoride. Proteins were
fractionated using 10–12% sodium dodecyl sulfate–polyacrylamide
gel electrophoresis (SDS-PAGE) and subjected to immunoblot
analysis using a specific anti-PR-1 mouse monoclonal antibody or
anti-coat protein antibody. Immunoblots were developed using the
ECL detection kit (Roche, Indianapolis, IN, USA). All experiments
were carried out at least two times using independently prepared
RNA, cDNA or protein.
Microarray analyses
Inoculated and systemic samples post mock and TCV inoculation
were harvested at 3 and 7 dpi, respectively. TCV inoculations were
carried out twice with independently prepared viral transcripts.
Total RNA was isolated as described above.
Microarray hybridizations were conducted using cDNA microarray representing 1194 Arabidopsis genes. These cDNAs were
obtained mainly from cDNA libraries made by suppression subtractive hybridizations to identify Arabidopsis genes that are
differentially expressed in response to various biotic and abiotic
stresses (Mahalingam et al., 2003). This microarray also contains
approximately 200 Arabidopsis expressed sequence tages (ESTs)
obtained from Michigan State University that were selected by
literature survey for previously identified stress-responsive genes
(Table S2). Inserts from these cDNA clones were amplified by PCR,
purified and resuspended in 3 · SSC at a final concentration of
approximately 0.3 lg ll)1. In addition, we used the SpotReport
Array Validation System (Stratagene, La Jolla, CA, USA) for
negative and spiking controls. DNA samples were spotted in
quadruplicate at different positions on the silanized glass slides
using the OmniGrid 100 robot (Genomic Solutions Inc., Ann Arbor,
MI, USA). About 40 lg of total experimental RNA and RNA from the
SpotReport Array Validation System were mixed and used for probe
preparation. Protocols for probe preparation, slide processing,
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
Light-mediated signaling against TCV 333
pre-hybridization and hybridization are described at http://
www.lsc.psu.edu/stf/dnama/Protocols.html. Treated samples were
fluorescently labeled with Cy3 and mock samples were labeled with
Cy5 dyes. After hybridization and washing, slides were scanned in
the GenePix 4100A microarray scanner (AxonTM Instruments, Union
City, CA, USA). Spot intensities were measured using GENEPIX PRO
5.0 software (Axon) and normalized using the global normalization
method. Data points whose background-subtracted median intensities in both channels were below 60% of the background plus two
standard deviations (SDs) were flagged and removed from further
analysis. Ratios were calculated using Cy3/Cy5 by the GENEPIX PRO
5.0 software (Molecular Devices Corporation, Sunnyvale, CA, USA).
Data points (ratios) were averaged from four replicate spots for each
gene on each slide independently. Data points were removed
manually when replicate spots varied at 0.6 SD of log2 ratios or
when the data point represented a single value. Normalized data
points that fulfilled these statistical criteria were analyzed further to
identify differentially expressed genes (Table S3). Ratios for each
data point were averaged from the two replicate experiments to
determine the mean and SD using ACUITY 4.0 software (Molecular
Devices Corporation). cDNAs with mean expression ratios of 2.0 and
0.5 were considered to be differentially expressed (up- and downregulated, respectively).
Acknowledgements
We thank Aardra Kachroo for help with the protein work-up, Joanne
Holden for SA analysis, Ludmila Lapchyk for technical expertise,
Amy Crume for help with managing the plant growth facility, and
Aardra Kachroo and David Smith for critical comments on this
manuscript. We also thank Xinnian Dong for the cpr5 seeds and the
ABRC database for the phyA and phyB seeds. This work was supported by USDA grant 2003-35329-13312 to DFK and PK and NSF
(MCB 0421914) and KSEF (555-RDE-005) grants to PK. This study is
publication No. 05-12-135 of the Kentucky Agricultural Experiment
Station.
Supplementary Material
The following supplementary material is available for this article
online:
Table S1 List of genes differentially expressed after dark treatment.
Table S2 List of genes present on the array.
Table S3 Original microarray data.
This material is available as part of the online article from http://
www.blackwell-synergy.com
References
Abbink, T.E., Peart, J.R., Mos, T.N., Baulcombe, D.C., Bol, J.F. and
Linthorst, H.J. (2002) Silencing of a gene encoding a protein
component of the oxygen-evolving complex of photosystem II
enhances virus replication in plants. Virology, 295, 307–319.
Allen, L.J., MacGregor, K.B., Koop, R.S., Bruce, D.H., Karner, J. and
Bown, A.W. (1999) The relationship between photosynthesis and
a mastoparan-induced hypersensitive response in isolated mesophyll cells. Plant Physiol. 119, 1233–1242.
Asai, T., Stone, J.M., Heard, J.E., Kovtun, Y., Yorgey, P., Sheen,
J. and Ausubel, F.M. (2000) Fumonisin B1-induced cell death in
Arabidopsis protoplasts requires jasmonate-, ethylene-, and
salicylate-dependent signaling pathways. Plant Cell, 12, 1823–
1836.
Bechtold, U., Karpinski, S. and Mullineaux, P.M. (2005) The influence of the light environment and photosynthesis on oxidative
signaling responses in plant-biotrophic pathogen interaction.
Plant Cell Environ. 28, 1046–1055.
Brodersen, P., Petersen, M., Pike, H.N., Olszak, B., Skov-Petersen,
S., Oedum, N., Joergensen, L.B., Brown, R.E. and Mundy, J.
(2002) Knockout of Arabidopsis ACCELERATED-CELL-DEATH11
encoding a sphingosine transfer protein causes activation of
programmed cell death and defense. Genes Dev. 16, 490–502.
Buchanan-Wollaston, V., Page, T., Harrison, E. et al. (2005) Comparative transcriptome analysis reveals significant differences in
gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis.
Plant J. 42, 567–585.
Chandra-Shekara, A.C., Navarre, D., Kachroo, A., Kang, H.G., Klessig, D.F. and Kachroo, P. (2004) Signaling requirements and role
of salicylic acid in HRT-and rrt- mediated resistance against turnip
crinkle virus in Arabidopsis. Plant J. 40, 647–659.
Chen, M., Chory, J. and Fankhauser, C. (2004) Light signal transduction in higher plants. Annu. Rev. Genet. 38, 87–117.
Chory, J. (1997) Light modulation of vegetative development. Plant
Cell, 7, 225–234.
Cooley, M.B., Pathirana, S., Wu, H.J., Kachroo, P. and Klessig, D.F.
(2000) Members of the Arabidopsis HRT/RPP8 family of resistance
genes confer resistance to both viral and oomycete pathogens.
Plant Cell, 12, 663–676.
Dempsey, D.A., Wobbe, K.K. and Klessig, D.F. (1993) Resistance and
susceptible responses of Arabidopsis thaliana to turnip crinkle
virus. Phytopathology 83, 1021–1029.
Dempsey, D.A., Pathirana, M.S., Wobbe, K.K. and Klessig, D.F.
(1997) Identification of an Arabidopsis locus required for resistance to turnip crinkle virus. Plant J. 2, 301–311.
Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance.
Annu. Rev. Phytopathol. 42, 185–209.
Falk, A., Feys, B.J., Frost, L.N., Jones, J.D., Daniels, M.J. and Parker,
J.E. (1999) EDS1, an essential component of R gene-mediated
disease resistance in Arabidopsis has homology to eukaryotic
lipases. Proc. Natl Acad. Sci. USA, 96, 3292–3297.
Fryer, M.J., Ball, L., Oxborough, K., Karpinski, S., Mullineaux, P.M.
and Baker, N.R. (2003) Control of ascorbate peroxidase-2
expression by hydrogen peroxide and leaf water status during
excess light stress reveals a functional organization of Arabidopsis leaves. Plant J. 4, 691–705.
Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes,
S., Ward, E., Kessmann, H. and Ryals, J.A. (1993) Requirement of
salicylic acid for the induction of systemic acquired resistance.
Science, 261, 754–756.
Genoud, T., Buchala, A.J., Chua, N.-H. and Metraux, J.-P. (2002)
Phytochrome signalling modulates the SA-perceptive pathway in
Arabidopsis. Plant J. 31, 87–95.
Guo, A., Reimers, P.J. and Leach, J.E. (1993) Effect of light on
incompatible interactions between Xanthomonas oryzae pv oryzae and rice. Physiol. Mol. Plant Pathol. 42, 413–425.
Hennig, J., Malamy, J., Grynkiewicz, G., Indulski, J. and Klessig,
D.F. (1993) Interconversion of the salicylic acid signal and its
glucoside in tobacco. Plant J. 4, 593–600.
Jirage, D., Tootle, T.L., Reuber, T.L., Frost, L.N., Feys, B.J., Parker,
J.E., Ausubel, F.M. and Glazebrook, J. (1999) Arabidopsis thaliana
PAD4 encodes a lipase-like gene that is important for salicylic acid
signaling. Proc. Natl Acad. Sci. USA, 96, 13583–13588.
Kachroo, P., Yoshioka, K., Shah, J., Dooner, H.K. and Klessig, D.F.
(2000) Resistance to turnip crinkle virus in Arabidopsis is regulated by two host genes, is salicylic acid dependent but NPR-1,
ethylene and jasmonate independent. Plant Cell, 12, 677–690.
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334
334 A. C. Chandra-Shekara et al.
Karpinski, S., Reynolds, H., Karpinska, B., Wingsle, G., Creissen, G.
and Mullineaux, P. (1999) Systemic signaling and acclimation in
response to excess excitation energy in Arabidopsis. Science,
284, 654–657.
Karpinski, S., Gabrys, H., Mateo, A., Karpinska, B. and Mullineaux,
P.M. (2003) Light perception in plant disease defence signalling.
Curr. Opin. Plant Biol. 4, 390–396.
Kohler, A., Schwindling, S. and Conrath, U. (2002) Benzothiadiazole-induced priming for potentiated responses to pathogen
infection, wounding, and infiltration of water into leaves requires
the NPR1/NIM1 gene in Arabidopsis. Plant Physiol. 128, 1046–
1056.
Kumar, D. and Klessig, D.F. (2003) High-affinity salicylic acid-binding protein 2 is required for plant innate immunity and has salicylic acid-stimulated lipase activity. Proc. Natl Acad. Sci. USA,
100, 16101–16106.
Lin, J.F. and Wu, S.H. (2004) Molecular events in senescing Arabidopsis leaves. Plant J. 39, 612–628.
Mahalingam, R., Gomez-Buitrago, A., Eckardt, N., Shah, N., Guevara-Garcia, A., Day, P., Raina, R. and Fedoroff, N.V. (2003)
Characterizing the stress/defense transcriptome of Arabidopsis.
Genome Biol. 4, R20.
Mateo, A., Muhlenbock, P., Rusterucci, C., Chang, C.C., Miszalski,
Z., Karpinska, B., Parker, J.E., Mullineaux, P.M. and Karpinski, S.
(2004) LESION SIMULATING DISEASE 1 is required for acclimation to conditions that promote excess excitation energy. Plant
Physiol. 136, 2818–2830.
Mustilli, A.C. and Bowler, C. (1997) Tuning in to the signals controlling photoregulated gene expression in plants. EMBO J. 19,
5801–5806.
Nawrath, C. and Metraux, J.P. (1999) Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accu-
mulate high levels of camalexin after pathogen inoculation. Plant
Cell, 11, 1393–1404.
Nawrath, C., Heck, S., Parinthawong, N. and Metraux, J.P. (2002)
EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the
MATE transporter family. Plant Cell, 14, 275–286.
Oh, J.-W., Kong, W., Song, C., Carpenter, C.D. and Simon, A.E. (1995)
Open reading frames of turnip crinkle virus involved in satellite
symptom expression and incompatibility with Arabidopsis thaliana ecotype Dijon. Mol. Plant Microbe Interact. 8, 979–987.
Shalitin, D. and Wolf, S. (2000) Cucumber mosaic virus infection
affects sugar transport in melon plants. Plant Physiol. 123, 597–
604.
Shirasu, K., Nakajima, H., Rajasekhar, V.K., Dixon, R.A. and Lamb, C.
(1997) Salicylic acid potentiates an agonist-dependent gain control that amplifies pathogen signals in the activation of defense
mechanisms. Plant Cell, 9, 261–270.
Simon, A.E., Li, X.H., Lew, J.E., Srange, R., Zhang, C., Polacco, M.
and Carpenter, C.D. (1992) Susceptibility and resistance of Arabidopsis thaliana to turnip crinkle virus. Mol. Plant Microbe
Interact. 5, 496–503.
Tecsi, L.I., Wang, D., Smith, A.M., Leegood, R.C. and Maule, A.J.
(1992) Red clover mottle virus infection affects sink-source relationships and starch accumulation in pea plants. J. Exp. Bot. 43,
1409–1412.
Wildermuth, M.C., Dewdney, J., Wu, G. and Ausubel, F.M. (2001)
Isochorismate synthase is required to synthesize salicylic acid for
plant defense. Nature, 414, 562–565.
Zeier, J., Pink, B., Mueller, M.J. and Berger, S. (2004) Light conditions influence specific defense responses in incompatible plantpathogen interactions: uncoupling systemic resistance from
salicylic acid and PR-1 accumulation. Planta, 219, 673–683.
ª 2006 The Authors
Journal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 320–334