Oxford Nanopore
February 2014
Copyright Oxford Nanopore Technologies 2013 -
Selected Slides for PGC
Delegates
non confidential
Copyright Oxford Nanopore Technologies 2013 -
Company Overview
!
Formed in 2005 to develop a novel single-molecule sensing system for DNA
sequencing, proteins and other analytes
!
Products: GridION™ and MinION™ electronic devices + range of nanopores
!
DNA ‘strand sequencing’ approaching the market
!
Total investment to date £145M
!
Experienced management and Board, 170 employees
!
Broad intellectual property portfolio: in-house and through collaborations including
Harvard, Oxford, UCSC
Copyright Oxford Nanopore Technologies 2013 -
Nanopore Sensing Summary
Nanopore = ‘very small hole’
!
Ion flow
Nanopore
Salt solution
Electrically Insulating Membrane
+
Applied potential
Translocation
Salt solution
Copyright Oxford Nanopore Technologies 2013 -
Nanopore Sensing Summary
Nanopore = ‘very small hole’
!
Ionic current flows through the pore
!
Introduce analyte of interest into the pore
Current
!
•
Identify target analyte by the characteristic disruption or block to the electrical current
•
Block or ‘State’, Dwell, Noise
Block
Time
Dwell
Copyright Oxford Nanopore Technologies 2013 -
Sensor Array
!
Miniaturised array or membrane and custom sensing circuitry – Chip and ASIC
Pore
Membrane array
!
A single nanopore per well
!
100s to 1000s of channels
!
Many analytes per pore, per channel, per run
!
Channels/pores asynchronous – no ‘cycles’
ASIC Channels
Copyright Oxford Nanopore Technologies 2013 -
Imaging the Wet Sensor Chip Array
!
Fluorescence imaging used to optimise wet membrane chemistry
•  Structure defines and pins the pretreatment to control fluidic assembly
•  Membranes hold dyed buffer in wells creating individual compartments
Chip surface patterning borrows
from natural phenomena
Membranes self assemble
Copyright Oxford Nanopore Technologies 2013 -
Platform Technology:
Instruments for scaled nanopore analysis
One instrument:
Scalable, groupable, networked, real-time
Miniaturised USB
device
Entry / Field /
Small runs
Desktop
Mid range
Installation
Copyright Oxford Nanopore Technologies 2013 -
Supercenter
8
MinION Device
!
Reader and Chip/Flowcell
!
Simple, low cost and robust USB3.0 device
Copyright Oxford Nanopore Technologies 2013 -
MinION Workflow
DNA / cDNA
Standard
specimen
Sample prep
< 1 hour single
tube assay
Add to MinION
1 minute
Real time data streaming
Analysis using cloud
Real time data streams
immediately
Copyright Oxford Nanopore Technologies 2013 -
MinION Instrument
!
MinION instrument in scalable production
Copyright Oxford Nanopore Technologies 2013 -
Strand Sequencing
Previous publications by Oxford Nanopore collaborators
!
Key challenges : movement and decoding
1996
2009
2010
2012
Copyright Oxford Nanopore Technologies 2013 -
Motors and Readers
!
Different classes of enzymes used
!
Over 160 enzymes tested
!
Processive up to 100 kb and 100,000 bps
!
Rate controlled by cofactors, 20-1000 bps
!
Modifications to the nanopore yields different
current profiles
!
Wide range of nanopores that can provide
sequence information
!
Over 1,000 pores and pore mutants tested
4 seconds – 80 bases (20 bps)
0.5 seconds – 200 bases (400bps)
Copyright Oxford Nanopore Technologies 2013 -
Strand Sequencing – Enzyme Modes
Different movement schemes
!
Can be run with or against the applied field
!
Depending on direction of the enzyme, DNA is fed through pore either 3’→ 5’ or 5’→ 3’
!
Both systems can traverse a hairpin and sequence both strands
E2
E3 / E4
Moving against field
Moving with field
!
Nanopore strips the complementary DNA
!
Enzyme stops DNA above the pore
!
Enzyme stops DNA motion above the pore
!
Cofactors fuel enzyme to push DNA with the field
!
Cofactors fuel enzyme to pull DNA against the field
!
Enzyme and DNA dissociate to give open nanopore
!
DNA is pulled completely out of the nanopore
!
Highly flexible and modular input chemistry, changes
data.
Copyright Oxford Nanopore Technologies 2013 -
Movement Scheme
!
Proprietary enzyme feeds the template and complement through custom nanopore
!
Truly “free-running” system – enzymes self load and strand exits automatically
Copyright Oxford Nanopore Technologies 2013 -
Basic System Dynamics
Single Molecule
!
Data acquired as full length reads – real time
!
Data throughput = No. pores x average speed/pore
!
Output = Throughput x Runtime
!
No fixed run time → Refresh from solution
!
DNA strand not changed – can recover sample
Copyright Oxford Nanopore Technologies 2013 -
Sample Tethering
!
Tethering the sample to the membrane gives 20,000x sensitivity
•
Sample collected on the membrane
•
2D vs 3D diffusion of sample to the pore
•
10 ng DNA / MinION (0.01 nM, 5 kbase)
•
Can trade sample conc for runtime
!
Allows for the use of unamplified material – NO PCR, reading the NATIVE DNA
!
PCR samples can be used if preferred – allows comparison to native bases
Copyright Oxford Nanopore Technologies 2013 -
Raw Data
States
Base Caller Input Signal
Time
Current
Time
Current
Nanopore Strand Read
Current
Current
Raw Data and Data Reduction
Time
Feature Detection
Copyright Oxford Nanopore Technologies 2013 -
•
Hidden Markov model
•
Only four options per transition
•
Pore type = distinct kmer length
•
Form probabilistic path through
measured states currents and
transitions
Sequence
Events
Data
Data
Data Workflow – (5-mer example)
ONT1 CCGACTCCGGTTACCCGCGTTGATTTGCTGGGGCAGGGCCG
|||||||||||||||:|||||||||||||||||||||||||
REF CCGACTCCGGTTACCAGCGTTGATTTGCTGGGGCAGGGCCG
•
e.g. Viterbi algorithm
Copyright Oxford Nanopore Technologies 2013 -
Base called Nanopore Reads
!
Typical errors from ONT nanopore data
!
Majority of errors resolved with depth – some perfect stretches
!
Deletions more prevalent than insertions
!
Occasional systematic error (to be resolved with improved model)
Copyright Oxford Nanopore Technologies 2013 -
MinION Throughput
!
!
Sequencing time measured to show nanopore occupancy for MinION runs
Most pores sequencing correctly most of the time.
Sequencing
Unclassified
Pore
Zero
Occupied
Copyright Oxford Nanopore Technologies 2013 -
Lambda Coverage from MinION (1 short run)
!
Routine development run performed daily on MinIONs using the Sequencing Kit
!
Lambda shotgun samples provide good coverage of the genome
!
Many reads at 10s of kb
!
Lambda standard control run (e.g. burn in)
500 x
Pore Occupancy
Genome coverage
Template and Complement
Copyright Oxford Nanopore Technologies 2013 -
Library Preparation (examples with ONT kits)
!
Examples of library preparation methods
Copyright Oxford Nanopore Technologies 2013 -
Read Lengths
!
Read length determined by sample fragmentation, not platform
!
Pores are digitally quantitative – in real time
Mass
Scardovia wiggsiae
1.6 Mb
5 µg DNA – Broad
finished reference
Nanopore (scaled)
Agilent Bioanalyzer
Read Length (bases)
Copyright Oxford Nanopore Technologies 2013 -
Read Lengths
Highly processive enzymes allow very long strand sequencing reads
•
Electrical system - no photodamage
Read 1
Single molecule – works with genomic DNA
Read 2
Read 3
> 50 kbase easily obtained from single reads
Not limited by fidelity of the system – limited by sample fragmentation
•
Quality of reads independent of read length – no difference between base 1 and base
50,000
@ 40k
•
@ 20k
@ 10k
!
•
@ 30k
!
Copyright Oxford Nanopore Technologies 2013 -
Full Length Lambda Reads on MinION
MinIONs routinely used for long read datasets
~48 kbases, up to 30bps/pore
Raw Current
!
Time
de novo Data
Prediction
Copyright Oxford Nanopore Technologies 2013 -
Strand Chemistry – Two Pores
PoreK / PoreA – Training
!
PoreA trained to a basic level using a k-mer model
!
PoreK requires a different k-mer model.
!
Two pore system likely product feature
!
Difficult states occur at
different positions on the
PoreA and the PoreK
traces
!
Two+ pores have
non-correlated errors.
Giving higher
consensus accuracy
at lower coverage
SD
PoreA
SD
PoreK
Strand Position
Copyright Oxford Nanopore Technologies 2013 -
GridION Instrument
!
GridION in late development. Follows MinION
!
Higher throughput, more pores, longer run times - cheaper cost per base
Copyright Oxford Nanopore Technologies 2013 -
MinION Access Program
!
Underway, high demand
!
Broad range of novel applications
!
Open development model
!
Ultra low costs
!
Community driven
!
https://www.nanoporetech.com/technology/the-miniondevice-a-miniaturised-sensing-system/a-guide-to-map
Copyright Oxford Nanopore Technologies 2013 -