␣6-Integrin Subunit Plays a Major Role in the
Proangiogenic Properties of Endothelial Progenitor Cells
Claire Bouvard, Benjamin Gafsou, Blandine Dizier, Isabelle Galy-Fauroux, Anna Lokajczyk,
Catherine Boisson-Vidal, Anne-Marie Fischer, Dominique Helley
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
Objective—Alpha6 integrin subunit (␣6) expression is increased by proangiogenic growth factors such as vascular
endothelial growth factor (VEGF) and fibroblast growth factor. This increase correlates with enhanced in vitro tube
formation by endothelial cells and their progenitors called Endothelial Colony-Forming Cells (ECFCs). We thus studied
the role of ␣6 in vasculogenesis induced by human ECFCs, in a mouse model of hindlimb ischemia.
Methods and Results—We used small interfering RNA (siRNA) to inhibit ␣6 expression on the surface of ECFCs. For in
vivo studies, human ECFCs were injected intravenously into a nude mouse model of unilateral hind limb ischemia.
Transfection with siRNA ␣6 abrogated neovessel formation and reperfusion of the ischemic hind limb induced by
ECFCs (P⬍0.01 and P⬍0.001, respectively). It also inhibited ECFC incorporation into the vasculature of the ischemic
muscle (P⬍0.001). In vitro, siRNA ␣6 inhibited ECFC adhesion (P⬍0.01), pseudotube formation on Matrigel,
migration, and AKT phosphorylation (P⬍0.0001), with no effect on cell proliferation or apoptosis.
Conclusion—␣6 Expression is required for ECFC migration, adhesion, recruitment at the site of ischemia, and the
promotion of the postischemic vascular repair. Thus, we have demonstrated a major role of ␣6 in the proangiogenic
properties of ECFCs. (Arterioscler Thromb Vasc Biol. 2010;30:1569-1575.)
Key Words: adhesion molecules 䡲 angiogenesis 䡲 ischemia 䡲 peripheral arterial disease 䡲 vascular biology
he ␣6-integrin subunit (␣6) is a 140-kDa protein that can
associate with ␤1- or ␤4-integrin subunits. Integrin ␣6␤1
is a receptor for laminin, the main component of the basement
membrane, but can also bind other extracellular matrix
(ECM) proteins, such as the angiogenic inducer CYR61.1 It is
expressed on platelets, monocytes/macrophages, neutrophils,
and endothelial cells. Integrin ␣6␤4 primarily binds laminin;
its expression is restricted to epithelial tissues, endothelia,
and peripheral nerves; and it is responsible for adhesion
junctions called hemidesmosomes.
In mice, deletion of the gene coding for ␣6 leads to an
absence of hemidesmosomes and, consequently, to severe
skin blistering and neonatal death.2 In humans, defects in ␣6
result in hemidesmosome deficiency, causing epidermolysis
bullosa or pyloric atresia and, in most cases, early postnatal
death.3,4 No obvious vascular abnormalities have been reported in such patients or in ␣6 knockout mice, suggesting
that ␣6 does not have a major role in vasculogenesis during
embryogenesis. In contrast, ␣6 is involved in the angiogenic
properties of mature cells. For example, ␣6 is required for the
formation of vascular networks in vitro by human brain
microvascular endothelial cells5 and human umbilical vein
endothelial cells.6 Regarding immature cells, activation of
T
CD117-positive cells localized in the subepicardium of adult
human heart is associated with ␣6 expression.7 Cell transplantation experiments on irradiated mice have shown that ␣6
plays a role in hematopoietic stem cell homing to bone
marrow.8 Because hematopoietic cells and endothelial cells
might arise from a common precursor (the hemangioblast),
we investigated the possible role of ␣6 in the homing of
endothelial progenitor cells (EPCs).
EPCs are marrow-derived circulating cells involved in
postnatal vasculogenesis.9 Unlike mature endothelial cells,
EPCs are a candidate cell therapy product for postischemic
vascular regeneration,9 but EPC injection has shown limited
efficacy in the clinical setting, probably because of insufficient homing and engraftment into newly formed vessels.10
However, different subpopulations of EPCs have been
characterized: “early” EPCs called colony-forming unit endothelial cells and “late” EPCs called endothelial colonyforming cells (ECFCs). Only ECFCs can differentiate into
functionally active mature endothelial cells and form functional blood vessels.11 ECFC surface expression of ␣6 is
upregulated by growth factors, such as vascular endothelial
growth factor (VEGF) and fibroblast growth factor 212; this
correlates with enhanced formation of vascular tubes in
Received on: December 14, 2009; final version accepted on: May 12, 2010.
From the Unité de Recherche 765 (C.B., B.G., B.D., I.G.-F., A.L., C.B.-V., A.-M.F., and D.H.), INSERM, Paris, France; Faculté de Pharmacie (C.B.,
B.G., B.D., I.G.-F., A.L., C.B.-V., A.-M.F., and D.H.), Faculté de Médecine (A.-M.F., D.H.), Université Paris Descartes, Paris; Université Paris Diderot
(C.B.), Paris; and Assistance Publique-Hôpitaux de Paris, Département d’Hématologie (A.-M.F., and D.H.), Hôpital Européen Georges Pompidou, Paris.
Correspondence to Dominique Helley, MD, PhD, INSERM, Unité de Recherche 765, Faculté des Sciences Pharmaceutiques et Biologiques, 4 Ave de
l’Observatoire, 75006 Paris, France. E-mail dominique.helley@egp.aphp.fr
© 2010 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
1569
DOI: 10.1161/ATVBAHA.110.209163
1570
Arterioscler Thromb Vasc Biol
August 2010
vitro.13 To our knowledge, the role of ␣6 expression by
ECFCs in adult vasculogenesis has not been investigated.
Therefore, we examined the influence of ␣6 expression on the
proangiogenic properties of ECFCs and especially on its
possible involvement in ECFC recruitment to sites of ischemia. We used small interfering RNA (siRNA) duplexes to
inhibit ␣6 expression at the surface of human ECFCs and
then examined the effect of this inhibition on adhesion,
migration and pseudotube network formation in vitro, and
revascularization in a nude mouse model of hind limb
ischemia.
Methods
ECFC Isolation and Culture and RNA Interference
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
ECFCs were isolated, cultured, and characterized as previously
described13 and as detailed in supplemental Figure I (available online
at http://atvb.ahajournals.org).
The ECFCs were transfected as described in the Supplemental
Data.
Mouse Model of Unilateral Hind Limb Ischemia
All the protocols were approved by the Regional Ethics Committee
on Animal Experimentation (ref P2.CBV.031.07), and all experiments conformed to European Community guidelines for the care
and use of laboratory animals.
Male athymic nude Foxn-1 mice (Harlan, Gannat, France), aged 7
weeks and weighing 20 to 30 g, were anesthetized by isoflurane
inhalation; the left femoral artery was ligatured. Five hours after the
onset of ischemia, the mice received an intravenous injection of 100
␮L of vehicle (PBS), 105 transfected ECFCs, or 105 untransfected
ECFCs. Cells were transfected 96 hours before being injected into
the animals.
After 2 weeks, mice were anesthetized with pentobarbital and
placed on a heating pad at 37°C; laser Doppler perfusion imaging
was used to assess leg tissue perfusion, as previously described.14
The results are expressed as the ratio of perfusion in the ischemic
(left) leg to perfusion in the nonischemic (right) leg.
Ischemic and nonischemic gastrocnemius muscles were then
collected and slowly frozen in isopentane solution cooled in liquid
nitrogen, before being stored at ⫺80°C until histological analysis.
Capillary Density Determination
Frozen 10-␮m-thick sections of the distal part of the gastrocnemius
muscle were fixed in ice-cold acetone for 10 minutes and incubated
for 1 hour with a rat anti–mouse CD31 monoclonal antibody (clone
MEC 13.3; BD Biosciences, Franklin Lakes, NJ) and with a goat
anti–rat secondary antibody coupled to fluorescein isothiocyanate
(Abcam, Cambridge, Mass). Sections were observed by a blinded
observer (C.B.) with a confocal microscope (TCS SP2; Leica,
Wetzlar, Germany). Ten fields were analyzed per section, and
vessels number was quantified with computer software (Histolab;
Microvision Instruments, Evry, France). The results are expressed as
the ratio of the ischemic (left) leg to the nonischemic (right) leg.
Histomorphometric Analysis
Frozen 10-␮m-thick sections of ischemic gastrocnemius were fixed
in acetone and stained with hematoxylin-eosin; a blinded observer
(C.B.) analyzed the sections under a microscope linked to a computer. Necrotic areas were circled, and the areas of the selected
surfaces were calculated with Histolab software. The results are
expressed as the ratio of the necrotic surface area to the total surface
area of the section.
Human ECFC Detection in Mouse Muscles
To evaluate ECFC incorporation into the vasculature of ischemic
muscles, 1 million human ECFCs in 100 ␮L of PBS were injected
intravenously 5 hours after the onset of ischemia. Four days later, the
gastrocnemius muscles were collected as previously described. To
detect ECFCs, frozen tissue sections (10 ␮m) were fixed in ice-cold
acetone, immunostained with a biotinylated anti– human CD31
antibody (clone JC70A; DAKO, S-32355, Glostrup, Denmark), and
incubated with streptavidin-Alexa 555 (Invitrogen, Carlsbad, Calif).
The mouse vasculature was stained with a rat anti–mouse CD31
monoclonal antibody. Nuclei were stained with TOPRO3 iodide.
Incorporated ECFCs were detected with a confocal microscope, and
the results were expressed as the number of incorporated ECFCs per
section.
In Vitro Assay 72 Hours After Transfection
of ECFCs
Adhesion Assay
Plates (with 96 wells) were coated with Matrigel, and nonspecific
binding sites were saturated with BSA in PBS for 1 hour at room
temperature. The wells were then washed 3 times with adhesion
buffer (10-mmol/L Hepes; 140-mmol/L NaCl; 5.56 mmol/L glucose;
1% BSA; 5.4 mmol/L potassium chloride; 2 mmol/L calcium
chloride; and 1 mmol/L magnesium chloride, pH 7.4) and then
ECFCs suspended in adhesion buffer were distributed (30 000 cells
per well). After 20 minutes at 37°C with 5% CO2, nonadherent cells
were removed and the wells were washed 3 times. The number of
adherent cells was determined by a p-nitrophenyl phosphate colorimetric assay. The results were normalized to the untransfected ECFC
group.
Migration Assay
For the Boyden chamber migration assay, cell culture inserts (8.0 ␮m
pore size) were placed in 24-well plates and coated with laminin.
Endothelial basal medium (EBM)-2– containing 5% FCS, with or
without 40-ng/mL VEGF, was placed in the lower compartment of
the Boyden chamber. ECFCs suspended in EBM-2 containing 5%
FCS were placed in the upper compartment (15 000 cells per well).
After 6 hours at 37°C with 5% CO2, cells adhering to the lower
surface of the inserts were counted in 10 different fields per well
using a microscope with a grid eyepiece. Results are expressed as the
difference between experiments with and without VEGF and are
normalized to the untransfected ECFC group.
Matrigel Tube Formation Assay
ECFCs suspended in EBM-2 containing 5% FCS were distributed
(30 000 per well) on 48-well plates coated with growth factor–
reduced Matrigel. They were allowed to form pseudotubes for 18
hours at 37°C with 5% CO2. The total length of the pseudotubes was
quantified with computer software (Videomet; Microvision Instruments) and normalized to the untransfected ECFC control group.
Proliferation Assay
ECFCs were detached and seeded (10 000 per well) on 48-well
laminin-coated plates (1 ␮g/cm2). After 48 hours of proliferation, the
number of cells was determined by a p-nitrophenyl phosphate
colorimetric assay. The results were normalized to the untransfected
ECFC group.
Evaluation of AKT Phosphorylation
After 96 hours of transfection with siRNA, ECFCs were detached
and seeded on laminin-coated plates. One hour later, wells were
washed with PBS and cells were lysed in lysis buffer (NuPAGE).
Equal amounts of protein from each group were resolved by
SDS-PAGE on an 8% acrylamide gel and probed by immunoblotting
using anti–phosphorylated AKT and anti-AKT antibodies (Cell
Signaling, Danvers, Mass). Densitometric readings were obtained using
computer software (ImageJ). Results are expressed as the ratio of
phosphorylated AKT to total AKT, normalized to the untransfected
ECFC group.
Statistical Analysis
Results are expressed as mean⫾SEM of at least 3 experiments. Data
were analyzed by ANOVA, followed by the Fisher protected least
Bouvard et al
Endothelial Progenitor Cells and ␣6-Integrin Subunit
1571
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
Figure 2. Capillary density: ␣6 knockdown in ECFCs abrogates
their beneficial effect in postischemic neovessel formation. Representative photomicrographs of ischemic gastrocnemius muscle sections stained for mouse CD31 and quantitative analysis
of capillary density 14 days after ischemia onset. Five hours
after the onset of ischemia, mice were injected intravenously
with PBS (n⫽8) or with 105 cells suspended in PBS, as follows:
ECFCs (n⫽6), ECFCs transfected with scramble siRNA (n⫽10),
or ECFCs transfected with siRNA ␣6 (n⫽12). Data are given as
mean⫾SEM. **P⬍0.01 and ***P⬍0.001.
versus untransfected ECFCs and P⬍0.01 versus ECFCs
transfected with scrambled siRNA) (Figure 1).
Figure 1. Laser Doppler perfusion imaging: ECFC transfection
with siRNA ␣6 reduces ischemic hind limb reperfusion. Representative photomicrographs and quantitative analysis of blood
perfusion evaluated by laser Doppler perfusion imaging 14 days
after the onset of ischemia. Five hours after the onset of ischemia, mice were injected intravenously with PBS (n⫽8) or with
105 cells suspended in PBS, as follows: ECFCs (n⫽8), ECFCs
transfected with scramble siRNA (n⫽10), or ECFCs transfected
with siRNA ␣6 (n⫽11). Data are given as mean⫾SEM. *P⬍0.05,
**P⬍0.01 and ***P⬍0.001.
significant difference post hoc test, and implemented with computer
software (StatView). Differences were assumed to be significant at
P⬍0.05.
Results
Evaluation of siRNA Efficiency and Specificity
As described in the supplemental Data, siRNA ␣6 efficiently inhibited ␣6 expression (supplemental Figure II)
and did not affect the expression of other integrins (supplemental Figure III).
Loss of ␣6 Expression on ECFCs Reduces
Postischemic Hind Limb Vascular Repair
Laser Doppler Perfusion Imaging
A single intravenous injection of control ECFCs (n⫽8)
increased the ischemic to nonischemic leg blood flow ratio
relative to PBS-treated mice by 60% (P⬍0.001). ECFCs
transfected with scramble siRNA (n⫽10) also enhanced the
perfusion in the ischemic hind limb, with no significant
difference from untransfected ECFCs. In contrast, ECFCs
transfected with siRNA ␣6 (n⫽11) did not improve reperfusion, with an ischemic to nonischemic leg blood flow ratio as
low as PBS-injected mice (n⫽8). Thus, the inhibition of ␣6
expression significantly inhibited the ability of ECFCs to
promote the reperfusion of the ischemic hind limb (P⬍0.001
Capillary Density
A single injection of untransfected ECFCs (n⫽6) or ECFCs
transfected with scramble siRNA (n⫽10) increased capillary
density in the ischemic gastrocnemius muscle by a factor of
2 relative to PBS-injected mice (P⬍0.01). Once again, for the
group injected with ECFCs transfected with siRNA ␣6
(n⫽12), the ratio of ischemic to nonischemic leg capillary
density was as low as PBS-injected mice (n⫽8). The inhibition of ␣6 expression by the siRNA cancelled the beneficial
effects of ECFCs on capillary density (P⬍0.01 versus untransfected ECFCs, and P⬍0.001 versus ECFCs transfected
with scramble siRNA) (Figure 2).
Histomorphometric Analysis
The left gastrocnemius was more severely necrotic in animals
injected with PBS (n⫽4) or with ECFCs transfected with
siRNA ␣6 (n⫽6) than in animals injected with untransfected
ECFCs (n⫽4) or ECFCs transfected with scramble siRNA
(n⫽5). Quantitative analysis showed that the injection of
ECFCs transfected with scramble siRNA and untransfected
ECFCs reduced the percentage of necrotic tissue by a factor
of 2 relative to the PBS-treated animals (P⬍0.05 and
P⬍0.01, respectively). In contrast, ECFCs transfected with
siRNA ␣6 had no beneficial effect relative to PBS-treated
controls (P⬍0.001 versus untransfected ECFCs, and P⬍0.01
versus ECFCs transfected with scramble siRNA) (Figure 3).
These results are in accordance with TUNEL analysis (supplemental Figure IV).
Loss of ␣6 Reduces ECFC Incorporation Into the
Microvasculature of Ischemic Skeletal Muscle
We evaluated the number of human ECFCs (labeled red with
an anti– human CD31 antibody) incorporated into the mouse
microvasculature (labeled green). ECFCs were found in the
ischemic leg but not in the healthy leg. siRNA ␣6 –transfected
ECFCs were incorporated 5 times less efficiently than un-
1572
Arterioscler Thromb Vasc Biol
August 2010
When ECFCs were transfected with siRNA ␣6, AKT
phosphorylation after adhesion on laminin was reduced by
50% compared with untransfected ECFCs or ECFCs transfected with scramble siRNA (P⬍0.0001 for all) (Figure 6).
Discussion
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
Figure 3. Histomorphometry: ␣6 knockdown in ECFCs abrogates their protective effect on necrosis. Representative
hematoxylin-eosin photomicrographs and quantitative histomorphometric analysis of sections from ischemic gastrocnemius
muscle 14 days after ischemia onset. Five hours after the onset
of ischemia, mice were injected intravenously with PBS (n⫽4) or
with 105 cells suspended in PBS, as follows: ECFCs (n⫽4),
ECFCs transfected with scramble siRNA (n⫽5), or ECFCs transfected with siRNA ␣6 (n⫽6). Data are given as mean⫾SEM.
*P⬍0.05, **P⬍0.01, and ***P⬍0.001.
transfected ECFCs and ECFCs transfected with scramble
siRNA (n⫽5 per group, P⬍0.001) (Figure 4).
Loss of ␣6 Expression Reduces ECFC Adhesion
to ECM
The basement membrane of blood vessels damaged during
ischemia may be exposed, and integrin ␣6␤1 mediates cell
attachment to laminin, the main component of the basement
membrane. Therefore, we used an adhesion assay on Matrigel
(61% laminin, 30% collagen IV, and 7% entactin) to study
the role of ␣6 in ECFC adhesion to this substitute of
basement membrane. Transfection with siRNA ␣6 reduced
ECFC adhesion to Matrigel by 50% (P⬍0.01) compared with
all the control groups. As expected, there was no difference
between untransfected ECFCs, ECFCs treated with the transfection reagent DharmaFECT (Df) alone, and ECFCs transfected with scramble siRNA (Figure 5A).
Loss of ␣6 Expression Reduces VEGF-Induced
ECFC Migration In Vitro
After the onset of ischemia, VEGF is released and functions
as a chemoattractant to recruit cells involved in vascular
repair. Therefore, we used Boyden chambers to study the role
of ␣6 in ECFC migration toward VEGF. ECFCs transfected
with siRNA ␣6 migrated 40 times less efficiently than
untransfected ECFCs, ECFCs transfected with Df alone, and
ECFCs transfected with scramble siRNA (P⬍0.0001 for all)
(Figure 5B).
Loss of ␣6 Expression Reduces Vascular Tube
Formation by ECFCs in Matrigel and AKT
Phosphorylation After ECFC Adhesion on Laminin
When ECFCs were transfected with siRNA ␣6, pseudotube
length was reduced 15-fold compared with all the other groups:
untransfected ECFCs, ECFCs transfected with Df alone, and
ECFCs transfected with scramble siRNA (P⬍0.0001 for all)
(Figure 5C).
siRNA ␣6 Has No Effect on ECFC Proliferation,
Apopotosis or Viability
Transfection with scramble siRNA or siRNA ␣6 has no
significant effect on ECFC proliferation (Figure 5D), apoptosis, or viability (supplemental Figure V).
This study demonstrates the importance of ␣6 in the proangiogenic properties of ECFCs. As previously reported,
ECFCs injected intravenously into a nude mouse model of
hind limb ischemia improved neovessel formation and reperfusion15–17 and provided protection toward necrosis. However, inhibition of ECFC cell surface ␣6 expression by using
specific siRNA abrogated all these beneficial effects.
To understand why the cells lacking ␣6 were unable to
improve neovessel formation and reperfusion, we investigated the role of ␣6 in the homing of ECFCs, which is a key
step in cell therapy. Indeed, some studies showed that soon
after the injection, the major part of the cells is removed from
the blood circulation and found mainly in the spleen, liver,
and kidneys. Despite this loss, the remaining cells are located
in the ischemic area.18 ECFCs that have been attracted there
by VEGF or stromal cell derived factor (SDF)-1 can incorporate the damaged vasculature and form new blood vessels,
unlike colony-forming unit endothelial cells, which promote
angiogenesis only through the release of proangiogenic factors and cytokines.11 Even if it is still unclear, ECFCs may
also secrete proangiogenic factors, such as placental growth
factor-1 (PlGF1)17 and prostaglandin,16 which could explain
why ECFC injection can increase neovessel formation even
with few cells found in the ischemic area.
Qian et al8 showed that ␣6 is involved in the homing of
hematopoietic stem cells to bone marrow in a model of cell
transplantation in irradiated mice. These researchers suggested that ␣6 contributes to hematopoietic stem cell transmigration to bone marrow because it serves as a receptor for
ECM laminins, which are involved in regulating tissue
organization, cell adhesion, differentiation, and migration.19
Other researchers reported that a subpopulation of mesenchymal stem cells, expressing high levels of ␣6, showed increased migration to infarcted heart in mice.20 To determine
whether ␣6 is involved in the homing of ECFCs, we quantified the number of ECFCs incorporated into the vasculature
of skeletal muscles 4 days after their injection, as described
by Foubert et al.15 When cell surface ␣6 expression was
inhibited by siRNA, the number of ECFCs integrated into the
mouse microvasculature of the ischemic muscle was reduced
5-fold. To understand why the cells lacking ␣6 were not
recruited and integrated to the ischemic mouse vasculature,
we performed in vitro assays.
After the obstruction of an artery, the oxygen supply is
reduced and, therefore, the endothelial cells lining the walls
of the downstream vessels undergo hypoxia. The death of
these endothelial cells leaves the basement membrane partially uncovered. The integrin ␣6␤1 is a receptor for laminin,
the main component of the basement membrane. Consequently, ␣6 could be implicated in ECFC adhesion to the
basement membrane of the injured blood vessels located in
the ischemic area (supplemental Figure VI and supplemental
Figure VII). Although other integrins or adhesion proteins are
Bouvard et al
Endothelial Progenitor Cells and ␣6-Integrin Subunit
1573
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
Figure 4. ␣6 knockdown in ECFCs reduces their
recruitment to ischemic muscles. Representative
photomicrographs and quantitative analysis of
human ECFC incorporation in ischemic gastrocnemius muscles 4 days after ischemia onset. ECFCs
were identified with an anti– human CD31 antibody
(red fluorescence). The mouse vasculature was
stained with an anti–mouse CD31 antibody (green
fluorescence). Nuclei were stained with TOPRO3iodide (blue). Five hours after the onset of ischemia, 5 mice per group were injected intravenously
with 1 million cells suspended in PBS, as follows:
ECFCs, ECFCs transfected with scramble siRNA,
or ECFCs transfected with siRNA ␣6. Data are
given as mean⫾SEM. ***P⬍0.001. White arrows
show incorporated human ECFCs.
also involved, when cell surface ␣6 expression was inhibited
by siRNA, ECFC adhesion to Matrigel, a substitute of the
basement membrane, was reduced by a factor of 2. Moreover,
we verified that siRNA ␣6 had no effect on ECFC proliferation, apoptosis, or viability. These results suggest that the
low number of ECFCs transfected with siRNA ␣6 found in
the ischemic muscles was the result of poor attachment and
was not a bias due to decreased cell proliferation or viability.
Once endothelial progenitors have adhered, they must migrate
to participate to the remodeling and to form new blood vessels.
At sites of ischemia, VEGF and other angiogenic factors act as
chemoattractants for cells involved in neovascularization.21 By
using a Boyden chamber migration assay, we found that a lack
of ␣6 expression inhibited ECFC migration induced by VEGF.
These observations are in keeping with results previously obtained with other cell types. On human brain microvascular
endothelial cells, ␣6␤1 is involved in VEGF-induced adhesion,
migration, and in vitro angiogenesis.5 ␣6 Overexpression on
hepatocarcinoma cells leads them to acquire an invasive phenotype.22 Integrin ␣6␤1 is necessary for matrix-dependent focal
adhesion kinase (FAK) activation and, therefore, for the migration of hepatocarcinoma cells.23 It is also involved in the
attachment of these cells to laminin.24 The same phenomenon
has been observed in breast cancer, where ␣6 promotes carcinoma survival and progression.25,26 By using a different approach, our findings support the hypothesis that ␣6 could be
involved in the mobilization and migration of the progenitors or
stem cells from their niches.
1574
Arterioscler Thromb Vasc Biol
August 2010
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
Figure 5. Effects of ␣6 knockdown in
ECFCs on adhesion, migration, vascular
tube formation, and proliferation in vitro. A,
Adhesion assay: cells were allowed to
adhere to Matrigel for 20 minutes. The number of adherent cells was then determined
by the p-nitrophenyl phosphate colorimetric
assay. B, Migration assay: cells were
allowed to migrate to the lower compartment of the Boyden chamber, containing 40
ng/mL VEGF for 6 hours. Cells that had
migrated were stained and counted under a
microscope with an eyepiece grid. C, Vascular tube formation assay: cells were
allowed to form pseudotubes on Matrigel for
18 hours. Pseudotubes were stained and
observed under a microscope, and their
length was quantified with computer software (Videomet). D, Proliferation assay: cells
were seeded on laminin-coated plates. After
48 hours of proliferation, the number of cells
was determined by the p-nitrophenyl phosphate colorimetric assay. The ECFCs were
transfected with siRNA ␣6, scramble siRNA,
or the transfection reagent alone (Df); or they
were untransfected. Seventy-two hours after
transfection, cells were detached and used
in 4 different assays. Data are normalized to
untransfected ECFCs and are the
mean⫾SEM of at least 3 different experiments. **P⬍0.01 and ****P⬍0.0001.
When ECFCs are recruited to sites of ischemia, they can
participate in vascular repair by either exerting paracrine
effects or directly forming new blood vessels. Previous
experiments with anti–␣6 antibodies have shown that ␣6 is
involved in endothelial cell cord formation in vitro.6,13,27
Thus, we used the Matrigel model to examine the role of ␣6
in vessel formation. We found that ECFC transfection with
siRNA ␣6 strongly inhibited vascular network formation,
Figure 6. ␣6 Knockdown reduces AKT phosphorylation after
adhesion on laminin. After 96 hours of transfection with siRNA,
ECFCs were detached and seeded on laminin-coated plates.
One hour later, cells were washed and lysed. Phoshorylated
AKT and total AKT were quantified by Western blot analysis.
Data are the ratio of pAKT to total AKT, are normalized to
untransfected ECFCs, and are the mean⫾SEM of 3 different
experiments. ****P⬍0.0001.
suggesting a crucial role of ␣6 in ECM-mediated migration
and differentiation and, consequently, in new blood vessel
sprouting, orientation, and stabilization during angiogenesis.
Also, siRNA ␣6 inhibits cordlike network formation by
human breast cancer cells.28
␣6 Is involved in ECFC adhesion, migration, and pseudotube formation. To understand why, we investigated different
signaling pathways (AKT, extracellular signal regulated kinase, and p38), and we observed that AKT phosphorylation
was reduced by a factor of 2, 1 hour after adhesion on laminin,
when ␣6 was knocked down. This result could explain the
observed cellular effects because the phosphatidylinositol 3-kinase/AKT pathway has been shown to be implicated in endothelial progenitor migration and adhesion.29,30
However, ECFCs may also promote angiogenesis via indirect
effects, such as interactions with other cell types. Interestingly,
␣6 can mediate cell-cell interactions independently of laminin.
For example, ␣6␤1 has a key role in gamete fusion,31 resulting
from an interaction with membrane-anchored cell surface ligands from the A Disintegrin and Metalloproteinase (ADAM)
family. Interaction with ADAM-9 is also responsible for the
induction of fibroblast motility.32 The role of ␣6 in ECFC
interaction with other cell types should be further investigated.
In conclusion, ␣6 plays a major role in the proangiogenic
properties of ECFCs. ␣6 Is involved in ECFC adhesion to the
basement membrane and in migration toward VEGF, explaining
why this integrin subunit is required for ECFC recruitment to the
site of ischemia and for the formation of vascular tube networks.
A better understanding of the phenomenon involved in cell
recruitment at the site of injury could allow us to find new
strategies to enhance cell therapy efficiency. Regarding human
cell therapy, our results suggest that enhancing ␣6 expression on
ECFCs might improve their recruitment to sites of ischemia and
Bouvard et al
Endothelial Progenitor Cells and ␣6-Integrin Subunit
promote vascular repair.33 On the other hand, ECFCs are
involved in tumor angiogenesis,34 and ␣6 plays a role in both
tumor angiogenesis and growth.5 Therefore, our findings support
the possibility that ␣6, like other integrins, might be an interesting therapeutic target for strategies designed to disrupt tumor
angiogenesis.35
Acknowledgments
We thank the staff of Hôpital des Diaconesses for providing cord blood
samples, Bruno Saubaméa and the imaging platform for their advice on
microscopy, Françoise Grelac and Véronique Remones for their excellent technical assistance, and the staff of the Institut Médicament,
Toxicologie, Chimie, Environnement animal facility.
Sources of Funding
C. Bouvard was supported (or paid) by a research grant from Ministère
de l’Enseignement Supérieur et de la Recherche. Dr Boisson-Vidal was
paid by Centre National de la Recherche Scientifique.
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
Disclosures
None.
References
1. Leu SJ, Liu Y, Chen N, Chen CC, Lam SC, Lau LF. Identification of a
novel integrin alpha 6 beta 1 binding site in the angiogenic inducer CCN1
(CYR61). J Biol Chem. 2003;278:33801–33808.
2. Georges-Labouesse E, Messaddeq N, Yehia G, Cadalbert L, Dierich A,
Le Meur M. Absence of integrin alpha 6 leads to epidermolysis bullosa
and neonatal death in mice. Nat Genet. 1996;13:370 –373.
3. Pulkkinen L, Kimonis VE, Xu Y, Spanou EN, McLean WH, Uitto J.
Homozygous alpha6 integrin mutation in junctional epidermolysis bullosa
with congenital duodenal atresia. Hum Mol Genet. 1997;6:669–674.
4. Allegra M, Gagnoux-Palacios L, Gache Y, Roques S, Lestringant G, Ortonne
JP, Meneguzzi G. Rapid decay of alpha6 integrin caused by a mis-sense
mutation in the propeller domain results in severe junctional epidermolysis
bullosa with pyloric atresia. J Invest Dermatol. 2003;121:1336–1343.
5. Lee TH, Seng S, Li H, Kennel SJ, Avraham HK, Avraham S. Integrin
regulation by vascular endothelial growth factor in human brain microvascular endothelial cells: role of alpha6beta1 integrin in angiogenesis.
J Biol Chem. 2006;281:40450 – 40460.
6. Chabut D, Fischer AM, Colliec-Jouault S, Laurendeau I, Matou S, Le
Bonniec B, Helley D. Low molecular weight fucoidan and heparin
enhance the basic fibroblast growth factor-induced tube formation of
endothelial cells through heparan sulfate-dependent alpha6 overexpression. Mol Pharmacol. 2003;64:696 –702.
7. Castaldo C, Di Meglio F, Nurzynska D, Romano G, Maiello C, Bancone
C, Muller P, Bohm M, Cotrufo M, Montagnani S. CD117-positive cells
in adult human heart are localized in the subepicardium, and their activation is associated with laminin-1 and alpha6 integrin expression. Stem
Cells. 2008;26:1723–1731.
8. Qian H, Tryggvason K, Jacobsen SE, Ekblom M. Contribution of alpha6
integrins to hematopoietic stem and progenitor cell homing to bone marrow
and collaboration with alpha4 integrins. Blood. 2006;107:3503–3510.
9. Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T,
Witzenbichler B, Schatteman G, Isner JM. Isolation of putative progenitor
endothelial cells for angiogenesis. Science. 1997;275:964 –967.
10. Dimmeler S. ATVB in focus: novel mediators and mechanisms in angiogenesis and vasculogenesis. Arterioscler Thromb Vasc Biol. 2005;25:2245.
11. Yoder MC, Mead LE, Prater D, Krier TR, Mroueh KN, Li F, Krasich R,
Temm CJ, Prchal JT, Ingram DA. Redefining endothelial progenitor cells
via clonal analysis and hematopoietic stem/progenitor cell principals.
Blood. 2007;109:1801–1809.
12. Smadja DM, Bieche I, Helley D, Laurendeau I, Simonin G, Muller L, Aiach
M, Gaussem P. Increased VEGFR2 expression during human late endothelial
progenitor cells expansion enhances in vitro angiogenesis with up-regulation
of integrin alpha(6). J Cell Mol Med. 2007;11:1149–1161.
13. Zemani F, Benisvy D, Galy-Fauroux I, Lokajczyk A, Colliec-Jouault S,
Uzan G, Fischer AM, Boisson-Vidal C. Low-molecular-weight fucoidan
enhances the proangiogenic phenotype of endothelial progenitor cells.
Biochem Pharmacol. 2005;70:1167–1175.
14. Couffinhal T, Silver M, Zheng LP, Kearney M, Witzenbichler B, Isner
JM. Mouse model of angiogenesis. Am J Pathol. 1998;152:1667–1679.
1575
15. Foubert P, Matrone G, Souttou B, Lere-Dean C, Barateau V, Plouet J, Le
Ricousse-Roussanne S, Levy BI, Silvestre JS, Tobelem G. Coadministration
of endothelial and smooth muscle progenitor cells enhances the efficiency of
proangiogenic cell-based therapy. Circ Res. 2008;103:751–760.
16. Herrler T, Leicht SF, Huber S, Hermann PC, Schwarz TM, Kopp R,
Heeschen C. Prostaglandin E positively modulates endothelial progenitor
cell homeostasis: an advanced treatment modality for autologous cell
therapy. J Vasc Res. 2009;46:333–346.
17. Foubert P, Silvestre JS, Souttou B, Barateau V, Martin C, Ebrahimian
TG, Lere-Dean C, Contreres JO, Sulpice E, Levy BI, Plouet J, Tobelem
G, Le Ricousse-Roussanne S. PSGL-1-mediated activation of EphB4
increases the proangiogenic potential of endothelial progenitor cells.
J Clin Invest. 2007;117:1527–1537.
18. Aicher A, Brenner W, Zuhayra M, Badorff C, Massoudi S, Assmus B,
Eckey T, Henze E, Zeiher AM, Dimmeler S. Assessment of the tissue
distribution of transplanted human endothelial progenitor cells by radioactive labeling. Circulation. 2003;107:2134 –2139.
19. Colognato H, Yurchenco PD. Form and function: the laminin family of
heterotrimers. Dev Dyn. 2000;218:213–234.
20. Lee RH, Seo MJ, Pulin AA, Gregory CA, Ylostalo J, Prockop DJ. The
CD34-like protein PODXL and alpha6-integrin (CD49f) identify early
progenitor MSCs with increased clonogenicity and migration to infarcted
heart in mice. Blood. 2009;113:816 – 826.
21. Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, Inai Y,
Silver M, Isner JM. VEGF contributes to postnatal neovascularization by
mobilizing bone marrow-derived endothelial progenitor cells. Embo J. 1999;
18:3964–3972.
22. Scoazec JY, Flejou JF, D’Errico A, Fiorentino M, Zamparelli A, Bringuier
AF, Feldmann G, Grigioni WF. Fibrolamellar carcinoma of the liver: composition of the extracellular matrix and expression of cell-matrix and cell-cell
adhesion molecules. Hepatology. 1996;24:1128–1136.
23. Carloni V, Mazzocca A, Pantaleo P, Cordella C, Laffi G, Gentilini P. The
integrin, alpha6beta1, is necessary for the matrix-dependent activation of
FAK and MAP kinase and the migration of human hepatocarcinoma cells.
Hepatology. 2001;34:42– 49.
24. Torimura T, Ueno T, Kin M, Ogata R, Inuzuka S, Sugawara H, Kurotatsu
R, Shimada M, Yano H, Kojiro M, Tanikawa K, Sata M. Integrin
alpha6beta1 plays a significant role in the attachment of hepatoma cells to
laminin. J Hepatol. 1999;31:734 –740.
25. Cariati M, Naderi A, Brown JP, Smalley MJ, Pinder SE, Caldas C,
Purushotham AD. Alpha-6 integrin is necessary for the tumourigenicity
of a stem cell-like subpopulation within the MCF7 breast cancer cell line.
Int J Cancer. 2008;122:298 –304.
26. Chung J, Mercurio AM. Contributions of the alpha6 integrins to breast
carcinoma survival and progression. Mol Cells. 2004;17:203–209.
27. Davis GE, Camarillo CW. Regulation of endothelial cell morphogenesis
by integrins, mechanical forces, and matrix guidance pathways. Exp Cell
Res. 1995;216:113–123.
28. Klosek SK, Nakashiro K, Hara S, Goda H, Hasegawa H, Hamakawa H.
CD151 regulates HGF-stimulated morphogenesis of human breast cancer
cells. Biochem Biophys Res Commun. 2009;379:1097–1100.
29. Madeddu P, Kraenkel N, Barcelos LS, Siragusa M, Campagnolo P,
Oikawa A, Caporali A, Herman A, Azzolino O, Barberis L, Perino A,
Damilano F, Emanueli C, Hirsch E. Phosphoinositide 3-kinase gamma
gene knockout impairs postischemic neovascularization and endothelial
progenitor cell functions. Arterioscler Thromb Vasc Biol. 2008;28:68 –76.
30. Chavakis E, Carmona G, Urbich C, Gottig S, Henschler R, Penninger JM,
Zeiher AM, Chavakis T, Dimmeler S. Phosphatidylinositol-3kinase-gamma is integral to homing functions of progenitor cells. Circ
Res. 2008;102:942–949.
31. Barraud-Lange V, Naud-Barriant N, Saffar L, Gattegno L, Ducot B, Drillet
AS, Bomsel M, Wolf JP, Ziyyat A. Alpha6beta1 integrin expressed by sperm
is determinant in mouse fertilization. BMC Dev Biol. 2007;7:102.
32. Nath D, Slocombe PM, Webster A, Stephens PE, Docherty AJ, Murphy
G. Meltrin gamma(ADAM-9) mediates cellular adhesion through
alpha(6)beta(1)integrin, leading to a marked induction of fibroblast cell
motility. J Cell Sci. 2000;113(pt 12):2319 –2328.
33. Chavakis E, Urbich C, Dimmeler S. Homing and engraftment of progenitor cells: a prerequisite for cell therapy. J Mol Cell Cardiol. 2008;
45:514 –522.
34. Ding YT, Kumar S, Yu DC. The role of endothelial progenitor cells in
tumour vasculogenesis. Pathobiology. 2008;75:265–273.
35. Silva R, D’Amico G, Hodivala-Dilke KM, Reynolds LE. Integrins: the
keys to unlocking angiogenesis. Arterioscler Thromb Vasc Biol. 2008;
28:1703–1713.
Downloaded from http://atvb.ahajournals.org/ by guest on September 29, 2016
α6-Integrin Subunit Plays a Major Role in the Proangiogenic Properties of Endothelial
Progenitor Cells
Claire Bouvard, Benjamin Gafsou, Blandine Dizier, Isabelle Galy-Fauroux, Anna Lokajczyk,
Catherine Boisson-Vidal, Anne-Marie Fischer and Dominique Helley
Arterioscler Thromb Vasc Biol. 2010;30:1569-1575; originally published online May 27, 2010;
doi: 10.1161/ATVBAHA.110.209163
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2010 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/30/8/1569
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2010/05/27/ATVBAHA.110.209163.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
SUPPLEMENT MATERIAL
Detailed Methods:
ECFC isolation and culture
Mononuclear cells were isolated from human umbilical cord blood by density gradient
centrifugation as previously described.1 After an adhesion step, CD34+ cells were selected by
magnetic activated cell sorting. The cells thus collected were plated on 0.2% gelatin-coated
24-well plastic culture dishes at a density of 5x105 cells/well in EGM-2 medium (Lonza,
Walkersville, MD, USA). After 4 days, non adherent cells were removed and the medium was
renewed. After 10 days of culture, ECFC colonies became visible microscopically. Cells were
then detached with trypsine and expanded in EGM-2 on 0.2% gelatin coated plates and grown
at 37°C in a humidified 5% CO2 atmosphere for further analysis. ECFC were used 25 to 45
days after cord blood processing. Characterization of ECFCs is described below.
Flow cytometric characterization of ECFCs
ECFCs were detached with accutase (PAA, Laboratory, Linz, Austria), washed in HBSS
containing 2% FCS, resuspended at 5x106 cells/mL, and incubated with the following
antibodies CD31-FITC, CD14-FITC (Becton Dickinson, Franklin Lakes, NJ, USA), CD34FITC, CD144-PE, CD146-PE, CD45-FITC, (Beckman Coulter, Fullerton, CA, USA) or an
isotype control antibody from the same manufacturer. Ten thousand cells were analyzed on a
FACScan flow cytometer, using CellQuest software (Becton Dickinson, Franklin Lakes, NJ,
USA).
1
RNA interference
ECFCs were transfected at subconfluence by using the DharmaFECT-1 transfection reagent
(Dharmacon, Thermo Fisher Scientific, Lafayette, CO, USA) with pooled specific human 
integrin subunit siRNA (Table S1) or with a non targeting control siRNA, following the
reagent manufacturer’s protocol. Briefly, 24 hours before transfection, the medium was
replaced by EGM-2 without antibiotics. For transfection, the siRNA solution was mixed with
the transfection reagent in EBM-2 for 20 minutes and then added to antibiotic-free EGM-2.
The cell culture medium was then replaced by this mix containing 60 nM of siRNA (Table I).
The medium was renewed with EBM-2/5% FCS after 24 hours and then every 48 hours.
Between 72 and 96 hours after transfection, cells were detached with accutase and used in the
different assays, (always 96 hours after transfection for in vivo studies). Kinetics of α6
knockdown is described in supplemental figure II.
Gene expression analysis by quantitative real-time reverse-transcription polymerase
chain reaction (qRT-PCR)
Total RNA was isolated from ECFCs by using the RNeasy Mini Kit (Qiagen, Courtaboeuf,
France) as recommended by the manufacturer. First-strand complementary DNA (cDNA) was
synthesized from 1 µg of total RNA by using the High Capacity cDNA Archive kit, random
primer and Superscript II reverse transcriptase (Life Technologies, Foster City, CA, USA).
Alpha6 gene expression was analyzed by qRT-PCR using an ABI Prism 7900 HT Sequence
Detection System (Life Technologies, Foster City, CA, USA) with SYBR green reporter dye
(Life Technologies, Foster City, CA, USA). The following primers were used: 6 sense, 5'CACATCTCCTCCCTGAGCACA-3'; 6 antisense, 5'-TATATCTTGCCACCCATCCTT-3';
TBP
sense,
5'-TGCACAGGAGCCAAGAGTGAA-3';
TBP
antisense,
5'-
TATATCTTGCCACCCATCCTT-5'. TBP, encoding the TATA box binding protein, was
2
used as the endogenous RNA control, and each sample was normalized on the basis of its
TBP content. Results were normalized to non transfected ECFC control values.
Flow cytometric analysis of 6 cell-surface expression
At various culture times, cells were detached with Accutase (PAA Laboratory, Linz, Austria),
washed in HBSS containing 2% FCS, resuspended at 5x106 cells/mL, and incubated with a
PE-conjugated antibody against 6 (CD49f, clone G0H3, Becton Dickinson Biosciences,
Franklin Lakes, NJ, USA) or an isotype-matched mouse irrelevant antibody from the same
manufacturer. Five thousand cells were analyzed on a FACScan flow cytometer, using
CellQuest software (Becton Dickinson, Franklin Lakes, NJ, USA). Results were normalized
to non transfected ECFC control values.
Flow cytometric analysis of CD31, CD144, v cell surface
expression after transfection
After 96 hours of transfection with siRNA, cells were detached with Accutase (PAA
Laboratory, Linz, Austria), washed in HBSS containing 2% FCS, resuspended at 5x10 6
cells/mL, and incubated with the following antibodies CD31-FITC, CD49a-PE, CD49b-FITC,
CD49c-PE, CD49e-PE, CD29-FITC, CD104-PE, CDCD51/CD61-FITC (Becton Dickinson
Biosciences, Franklin Lakes, NJ, USA), CD144-PE (Beckman Coulter, Fullerton, CA, USA)
or an isotype-matched mouse irrelevant antibody from the same manufacturer. Ten thousand
cells were analyzed on a FACScan flow cytometer, using CellQuest software (Becton
Dickinson, Franklin Lakes, NJ, USA).
3
In situ apoptosis detection on ischemic muscles sections (TUNEL assay)
Frozen tissue sections (10µm) were dried, fixed in formaldehyde solution and labeled using
TACSTM 2 TdT-DAB In Situ Apoptosis Detection Kit (R&D Systems, Minneapolis, MN,
USA), following the manufacturer’s protocol.
Evaluation of Caspase 3 activity
After 96 hours of transfection with siRNA, wells were washed and the medium was changed
by a serum free medium. After six hours of serum starvation, cells were washed and lysed.
Lysates were then used in the Caspase 3 colorimetric assay kit (assay designs, Ann Harbor,
MI, USA), following the manufacturer’s protocol. The assay was done three times in
duplicate. The results were normalized to the untransfected ECFC group and represented as
means + SEM of three experiments.
Evaluation of cell viability
After 96 hours of transfection with siRNA, dead cells present in the supernatant were
collected, and living adherent cells were detached and collected. After centrifugation, the
pellets were resuspended, and cell suspension was diluted in trypan blue. The number of
living cells (no coloration) and dead cells (blue coloration) present in each well was
quantified using a Malassez cell and a microscope.
Laminin, human CD31 and mouse CD31 labeling on ischemic and non ischemic muscles
Frozen tissue sections (10 µm) were fixed in ice-cold acetone, immunostained with a
biotinylated anti-human CD31 antibody (clone JC70A, DAKO, Glostrup, Denmark), and
incubated with streptavidin-Alexa 555 (Invitrogen, Carlsbad, CA, USA). The mouse
vasculature was stained with a rat anti-mouse CD31 monoclonal antibody. And murine
4
laminin present in the muscles was stained with a rabbit anti-mouse laminin antibody. Nuclei
were stained with TOPRO3 iodide. Sections were observed under a confocal microscope.
5
Supplemental Figures
Figure I: Flow cytometric analysis of surface antigens on ECFCs.
ECFCs were positive for CD31, CD34, CD144 and CD146 but not for monocytic markers
CD45 and CD14. Isotypic control is represented in grey. The microphotograph represents
ECFCs, with their characteristic cobblestone shape.
6
Figure II: Assessment of siRNA efficiency by qRT-PCR (A) and flow cytometry (B):
kinetics of cell-surface 6 expression and mRNA quantification.
ECFCs were cultured and transfected as described in Materials and Methods. At various times
after this transfection, the quantity of 6 integrin subunit mRNA was determined by RT-PCR
(A) and its protein expression at the ECFC surface was measured by flow cytometry (B).
7
Results for ECFCs transfected with DharmaFECT alone (), scramble siRNA ( ), or siRNA
6 ( ) were normalized to untransfected control ECFCs ()). Results are means ± S.E.M. of
three different experiments. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
Neither the transfection reagent nor the scramble siRNA degraded α6 mRNA or affected α6
expression at the cell surface (no significant difference with untransfected ECFCs). The
siRNA directed against α6 efficiently induced α6 mRNA degradation for at least 144 hours
(Figure S2A). As a result, α6 integrin subunit expression was reduced on ECFCs transfected
with siRNA α6 (about 10% of control value from 48 h to 96 h (P<0.0001) and 20% after 120
h) (Figure S2B). We thus decided to use cells 72 hours after transfection for in vitro
experiments and 96 hours after transfection for in vivo experiments.
8
Figure III: siRNA α6 has no effect on CD31, CD144, v cell
surface expression after 96 hours of transfection
These results show that siRNA 6 are specific and that the observed effects are due to the loss
of 6 and not to off-targets.
9
Figure IV: In situ apoptosis detection on ischemic muscles sections (TUNEL assay)
Gastrocnemius sections (10µm) were stained using TACSTM 2 TdT-DAB In Situ Apoptosis
Detection Kit. Apoptotic cells (dark brown nucleus), and necrotic cells (brown staining in the
cytoplasm of enlarged cells) were more numerous in groups injected with PBS or with ECFC
transfected with siRNA α6 than in groups injected with untransfected ECFCs or ECFCs
transfected with scramble siRNA. Injection of ECFCs or ECFCs transfected with scramble
siRNA protected tissues from apoptosis, but when α6 is knocked down, this beneficial effect
is lost.
10
Figure V: siRNA α6 has no effect on ECFC apoptosis (A) or viability (B) after 96 hours
of transfection. Results are mean + SEM of three different experiments.
A: Apoptosis. After 96 hours of transfection, cells were serum starved for 6 hours, lysed and
used in a caspase 3 colorimetric assay.
11
There is no significant difference in caspase 3 activity between the different groups
(untransfected ECFCs, ECFCs transfected with scramble siRNA or ECFCs transfected with
siRNA 6). This result indicates that transfection with siRNA does not influence apoptosis.
B: Viability. 96 hours after transfection, dead and living cells were quantified using trypan
blue. Transfection with siRNA 6 or scramble siRNA had no effect on cell viability, the
number of dead and living cells was not significantly different in the different groups.
As a consequence, cellular effects observed on ECFCs transfected with siRNA 6 are caused
by the reduction of 6 expression and not by an increased apoptosis or a decreased viability.
12
A
C
B
D
Figure VI: expression of laminin in ischemic and non ischemic muscles
Gastrocnemius sections were stained for mouse CD31 (green) and laminin (red). Laminin is a
component of the basement membrane and of the extracellular matrix. Laminin is present
between muscle fibers and all around blood vessels, in non ischemic muscles (A, C) as well as
in ischemic muscles (B,D).
13
Figure VII: ECFCs recruited in ischemic muscles are colocalized with laminin.
Human ECFCs were identified with an anti-human CD31 antibody (red fluorescence).
Laminin was stained with an anti-mouse laminin antibody (green fluorescence). Nuclei were
stained with TOPRO3-iodide (represented in blue).
We did not find any ECFC in non ischemic muscles. In contrast, in ischemic muscles, where
the basement membrane of damaged blood vessels may be exposed, ECFC are recruited and
we can observe that they are colocalized with laminin.
14
Table I: SiRNA mix of human ITGA6 (ON-TARGETplus SMARTpool)
Sense sequence
Antisense sequence
J-007214-05 GGAUCGAGUUUGAUAACGAUU 5’-P. UCGUUAUCAAACUCGAUCCUU
J-007214-06 GGAUAUGCCUCCAGGUUAAUU 5’-P. UUAACCUGGAGGCAUAUCCUU
J-007214-07 GAAAGGGAUUGUUCGUGUAUU 5’-P. UACACGAACAAUCCCUUUCUU
J-007214-08 ACAGAUAGAUGAUAACAGAUU 5’-P. UCUGUUAUCAUCUAUCUGUUU
Legends for video files
Injected human ECFCs, shown in red, are incorporated into the green mouse microvasculature
of the ischemic muscle and form chimeric vessels. The nuclei are represented in blue.
References
1.
Zemani F, Benisvy D, Galy-Fauroux I, Lokajczyk A, Colliec-Jouault S, Uzan G,
Fischer AM, Boisson-Vidal C. Low-molecular-weight fucoidan enhances the
proangiogenic phenotype of endothelial progenitor cells. Biochem Pharmacol.
2005;70:1167-1175.
15