The neuronal and non-neuronal substance P,
VIP and cholinergic systems in the colon in
ulcerative colitis
Maria Jönsson
From the Department of Integrative Medical Biology,
Anatomy, and the Department of Surgical and
Perioperative Sciences, Surgery.
Umeå 2009
Copyright © Maria Jönsson 2009
ISBN: 978-91-7264-731-2
ISSN: 0346-6612
New series no: 1248
Printed by: Arkitektkopia, Umeå, Sweden
Figure 1: Illustration by the author, modified from Human Anatomy, Mc Graw
Hill, Second Edition, 2008.
Figure 2: Illustration by Gustav Andersson.
Figures 3-8. Photo images by the author.
Abbreviations
ACh
AP
BSA
CGRP
ChAT
CNS
EIA
ELISA
FITC
GI
Htx
IBD
IHC
IR
ISH
-LI
M2
NK-1R
PACAP
PAP
PBS
RT
SP
SSC
STE
TACR1
TRITC
UC
VAChT
VIP
VPAC1
acetylcholine
alkaline phosphatase
bovine serum albumin
calcitonin gene-related peptide
choline acetyltransferase
central nervous system
enzyme immunosorbent assay
enzyme-linked immunosorbent assay
fluorescein isothiocyanate
gastrointestinal
hematoxylin
inflammatory bowel disease
immunohistochemistry
immunoreactions
in situ hybridization
-like immunoreactions
muscarinic receptor 2
neurokinin-1 receptor
pituitary adenylate cyclase-activating polypeptide
peroxidase-antiperoxidase
phosphate-buffered saline
room temperature
substance P
saline sodium citrate
sodium chloride–tris–EDTA buffer
tachykinin receptor 1
tetramethylrhodamine isothiocyanate
ulcerative colitis
vesicular acetylcholine transporter
vasoactive intestinal peptide
vasoactive intestinal peptide/pituitary adenylate cyclase
activating polypeptide receptor-1
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Table of Contents
Abstract
List of publications
Introduction
Anatomy of the large intestine
Histology of the colon
Intestinal innervation – General aspects
The enteric nervous system
Neurotransmitters in the GI tract
The cholinergic system
The neuronal cholinergic system
The non-neuronal cholinergic system
Acetylcholine receptors
Neuropeptides
General aspects
Substance P and its receptors
VIP and its receptors
Interrelationship between VIP/SP and the cholinergic system
CGRP
Eosinophils
Inflammatory bowel diseases (IBD) – general aspects
Ulcerative colitis (UC)
Background for the studies in this thesis
7
8
9
9
9
11
11
12
12
12
13
13
14
14
14
15
15
16
16
16
17
18
20
Aims
Materials and Methods
Patient material
Tissue sampling and preparation
Blood sampling and preparation
Sectioning
Morphology staining
Staining and counting of eosinophils
Immunohistochemistry (IHC)
Pre-treatment procedures
Immunofluorescence
Peroxidase anti-peroxidase staining (PAP)
Primary antibodies
Control stainings
In situ hybridization (ISH)
EIA (Enzyme Immunosorbent Assay)
Tissue homogenisation
EIA procedure
In vitro receptor autoradiography
21
21
22
22
22
23
23
23
23
25
25
25
25
25
26
26
26
27
5
Maria Jönsson, 2009
Quantitative analysis
Correlations VIP binding/VIP IHC/mucosa morphology
Semiquantitative analyses
Statistics
Ethical considerations
Results and Discussion
Methodological considerations
Concerning the patient material
Concerning antibodies and tests for specificity
Morphology (Papers I-V)
Substance P and the NK-1R
SP innervation (Paper I)
SP levels in mucosa (Paper IV)
Local production of SP (Paper III)
NK-1R expression (Paper I, III)
Eosinophil infiltration in relation to NK-1R expression (Paper I)
VIP and VIP receptors
VIP innervation (Paper II, III)
VIP levels in the mucosa (Paper IV)
Local production of VIP (Paper III)
VIP receptors
VIP binding (Paper II)
VPAC1 IHC (Paper III)
Neuropeptides in plasma and correlations to other parameters (Paper IV)
Neuropeptide levels in plasma
27
28
28
28
28
29
29
29
29
30
31
31
31
31
33
33
34
34
34
34
35
35
35
36
36
Correlations between plasma and mucosa levels and the degree
of mucosal derangement
The cholinergic system (Paper V)
The cholinergic innervation
Observations favouring a local production of ACh
Muscarinic receptor M2
Interpretations concerning the non-neuronal cholinergic system
Future treatment possibilities
Summary of the main findings
Summary of main conclusions
Funding
Svensk populärvetenskaplig sammanfattning
Introduktion
Bakgrund till dessa studier
Material och metoder
Sammanfattning av resultat
Tack
References
6
36
37
37
38
39
39
40
41
42
44
45
45
46
47
47
49
51
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Abstract
Ulcerative colitis (UC) is a chronic relapsing inflammatory bowel disease.
Neuropeptides, especially vasoactive intestinal peptide (VIP) and substance P (SP),
have long been considered to play key roles in UC. Among other effects, these
neuropeptides have trophic and growth-modulating as well as wound-healing effects.
Furthermore, whilst VIP has anti-inflammatory properties, SP has pro-inflammatory
effects. It is generally assumed that the main source of SP and VIP in the intestine is
the tissue innervation. It is not known whether or not they are produced in the
epithelial layer. The details concerning the expressions of their receptors in UC are
also, to a great extent, unclear. Apart from the occurrence of peptidergic systems in
the intestine, there are also neuronal as well as non-neuronal cholinergic systems.
The pattern concerning the latter is unknown with respect to UC.
The studies in this thesis aimed to investigate the expression of SP and VIP and
their major receptors (NK-1R and VPAC1) in UC colon, compared to non-UC colon.
The main emphasis was devoted to the epithelium. A second aim was to examine for
levels of these neuropeptides in blood plasma in UC. Another aim was to examine for
the non-neuronal cholinergic system in UC, thus, to investigate whether there is
acetylcholine production outside nerves in the UC colon. Methods used in the thesis
were immunohistochemistry, in situ hybridization, enzyme immunosorbent assay,
and in vitro receptor autoradiography.
For the first time, mRNA for VIP and SP has here been found in the colonic
epithelium. That was especially noted in UC mucosa showing a rather normal
morphology, and in non-UC mucosa. Marked derangement of the mucosa was found
to lead to a distinct decrease in VIP binding, and also a decrease in the expression
level of VIP receptor VPAC1 in the epithelium. In general, there was an upregulation
of the SP receptor NK-1R in the epithelium when the mucosa was deranged. The
plasma levels of SP and VIP were higher for UC patients compared to healthy
controls. There were marked correlations between the levels of the peptides in
plasma, their levels in the mucosa and the degree of mucosal
derangement/inflammation. A pronounced nonneuronal cholinergic system was
found in both UC and non-UC colon. Certain changes occurred in this system in
response to inflammation/derangement in UC.
The present study shows unexpectedly that expressions for VIP and SP are not
only related to the nerve structures and the inflammatory cells. The downregulation
of VPAC1 expression, and the tendencies of upregulation of NK-1R expression levels
when there is marked tissue derangement, may be a drawback for the intestinal
function. The study also shows that there is a marked release of neuropeptides to the
bloodstream in parallel with a marked derangement of the mucosa in UC. The
cholinergic effects in the UC colon appear not only to be associated with nerverelated effects, but also effects of acetylcholine produced in local non-neuronal cells.
The thesis shows that local productions for not only acetylcholine, but also SP and
VIP, occur to a larger extent than previously considered.
7
Maria Jönsson, 2009
List of publications
This thesis is based on the following original papers:
I. Substance P and the neurokinin-1 receptor in relation to eosinophilia in
ulcerative colitis.
Jönsson M, Norrgård Ö, Forsgren S.
Peptides. 2005;26:799-814.
II. Decrease in binding for the neuropeptide VIP in response to marked
inflammation of the mucosa in ulcerative colitis.
Jönsson M, Norrgård Ö, Hansson M, Forsgren S.
Ann N Y Acad Sci. 2007;1107:280-289.
III. Presence of mRNA for VIP and Substance P and presence of VPAC1 and
NK-1 receptor expressions in the colonic epithelium of man – changed
patterns in ulcerative colitis.
Jönsson M, Norrgård Ö, Forsgren S.
Manuscript
IV. New aspects concerning ulcerative colitis and colonic carcinoma: analysis
of levels of neuropeptides, neurotrophins, and TNFalpha/TNF receptor in
plasma and mucosa in parallel with histological evaluation of the intestine.
Johansson M*, Jönsson M*, Norrgård Ö, Forsgren S.
* The first two authors contributed equally to this work.
Inflamm Bowel Dis. 2008;14:1331-1340.
V. Presence of a marked nonneuronal cholinergic system in human colon:
study of normal colon and colon in ulcerative colitis.
Jönsson M, Norrgård Ö, Forsgren S.
Inflamm Bowel Dis. 2007 Nov;13:1347-1356.
The original papers are published after permission from the publishers, and
in this thesis will be referred to by their Roman numerals.
8
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Introduction
Anatomy of the large intestine
The large intestine, also called the large bowel, has a length of approximately
1.5 meters. The large intestine is the last part of the digestive system and
consists of cecum with vermiform appendix, colon, and rectum. Below the
rectum is the anal canal. The colon is divided into four different segments,
named ascending colon, transverse colon, descending colon and sigmoid
colon (see Fig. 1).
Fig 1. The anatomy of the large intestine.
The overall function of the large intestine is the completion of fluid
absorption, the manufacturing of certain vitamins, the formation of feces,
and the expulsion of feces from the body. Bacteria are very frequent in the
feces.
Histology of the colon
The colonic wall is divided into different layers: mucosa, submucosa, the
muscle layers and the serosa (Fig. 2). The mucosa consists of the epithelial
layer and the lamina propria. Beneath the lamina propria there is a smooth
muscle layer, the muscularis mucosae, which is a thin muscle layer that
consists of longitudinal and circular strands.
The mucosa is lined with a simple columnar epithelium, and consists of
columnar absorptive cells, goblet cells, and endocrine cells. Paneth cells
9
Maria Jönsson, 2009
infrequently occur. There are also some intraepithelial lymphocytes in the
basolateral part of the epithelium. The absorptive cells absorb water and
electrolytes. The goblet cells are unicellular mucus glands that secrete mucin
to lubricate the lumen. The endocrine cells affect both local cells (paracrine
function) and distant cells (endocrine function), and they also secrete
products into the lamina propria.
Villi are, in contrast to the situation for the small intestine, not formed in
the colon. Straight tubules (crypts; glands) extend through the entire
thickness of the mucosa. These crypts, called crypts of Lieberkühn, have a
length of up to 0.5 mm. Goblet cells are frequent in these crypts, and there
are proliferating, in principle undifferentiated cells, at the bottom of the
crypts. There is a rapid regeneration of the epithelium, with a replacement
every 6 to 7 days (1).
The lamina propria contains scattered fibroblasts, immunoactive cells and
lymph nodules that extend into the submucosa. Furthermore, there are
nerve fibers (cf. below), blood vessels, and lymphatic vessels in the lamina
propria. The arteries have their origin in the superior mesenteric (iliocolic,
right and middle colic arteries) and inferior mesenteric (left colic artery,
sigmoidal arteries and superior rectal artery) arteries. The veins drain into
the portal vein.
Fig. 2. The histology and innervation of the large intestine.
10
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
The submucosa is a layer of loose connective tissue that derives its name
from its position beneath the mucosa. In the submucosa, the submucous
plexus with its nerve branches and frequent blood vessels are located.
Scattered immunoactive cells are also found here.
The smooth muscle layer consists of the inner circular layer and the outer
longitudinal layer. Between these muscle layers a main part of the myenteric
plexus is located (Fig. 2). Groups of nerve cells (small ganglia) and large
nerve bundles can be seen here. The branches of the plexus are distributed
throughout the muscle layers. The outer longitudinal muscle layer is not
continuous, but forms muscle fascicles known as taeniae coli. These
discontinuities allow segments of the colon to contract independently.
There is also a serous coat, which is composed of a thin connective tissue
layer covered by mesothelium. It expands into the appendices epiploicae in
its free portion. These are extensions that mainly consist of adipose tissue.
Intestinal innervation – General aspects
The enteric nervous system
The British physiologist Langley described the autonomic nervous system
(ANS) in a classic monography in 1921 (2). In this monography, but in fact,
also previously, in 1917 (3), the enteric nervous system (ENS) was described
to a certain extent. The ENS belongs to the ANS. The ENS can nevertheless
function independently of the central nervous system (CNS). When isolated
from the CNS, the ENS can thus mediate reflex activity. The ENS modulates
the processes of motility, secretion, microcirculation and reflexes in the
gastrointestinal (GI) tract (4) (see Fig. 2). In recent years, the interplay
between the ENS and the immune system has also been increasingly
appreciated (5).
The ENS is a complex and well-organized network of neurons. The ENS
consists of 100 millions of neurons, and these are organized into the
myenteric and submucous plexuses (6). The myenteric plexus (plexus of
Auerbach) provides motor innervation to the muscle layers and some
secretomotor innervation to the mucosa. The myenteric ganglia, to a certain
extent, innervate adjacent myenteric ganglia and submucous ganglia. The
submucous plexus (plexus of Meissner) innervates the muscularis mucosae,
intestinal endocrine cells, glandular epithelium and submucosal blood
vessels (4). Different submucous ganglia can give branches to each other (7,
8). The neurons of the ENS form varicosities in their terminal parts.
Functionally, the neurons in the ENS are motor, sensory or interneurons
(9). The motor neurons stimulate or inhibit smooth muscle contraction and
gland secretion. The interneurons interconnect neurons of the myenteric and
submucous plexuses, hereby interconnecting sensory and motor neurons to
each other (10). There is also an extrinsic innervation to the intestine; this
11
Maria Jönsson, 2009
innervation is in certain literature referred to as the “external part” of the
ENS. The extrinsic innervation corresponds to preganglionic neurons of the
parasympathetic nervous system (vagal nerve and nerves from sacral
segments), postganglionic fibers of the sympathetic innervation, and sensory
neurons. The first mentioned are destined for the ganglionic accumulations
of the myenteric and submucous plexuses. The sympathetic fibers emerge via
the celiac plexus and are particularly destined for the blood vessels.
There are primary sensory neurons that respond to mechanical, chemical
and thermal stimuli. It is a matter of debate to what extent the sensory nerve
endings are of an efferent nature and part of the intrinsic ENS. The sensory
neurons that innervate the mucosa are described to partly be extrinsic and
partly conform to intrinsic afferent neurons (11). In any case, sensory
neurons play a protective role through several mechanisms. These include
sensations of pain, induction of autonomic reflexes, induction of
neuroendocrine responses, and initiation of protective tissue reactions at the
site of assault (12). Within the gut, the protective mechanisms triggered by
sensory neurons comprise alterations in blood flow, secretion and motility,
and modifications of immune function.
The neurons in the mucosa are in close contact with two important nonneural surveillance systems: endocrine and immune cells (12).
Neurotransmitters in the GI tract
Neurotransmitters are substances that transmit signals between neurons and
from neurons to cells, and that activate receptors. The neuron is classified as
cholinergic if it secretes acetylcholine (ACh) and adrenergic if it secretes
noradrenaline (norepinephrine). The classical transmitters of the GI tract are
ACh and noradrenaline. However, as early as the 1960s, non-adrenergic,
non-cholinergic (NANC) neurons were also found to be involved in the
innervation of the GI tract (13) (see (8) for a review). Several neuropeptides,
functioning as neuromodulators, and also mediators such as nitric oxide are
known to be involved in the NANC innervation.
The cholinergic system
The neuronal cholinergic system
The neuronal cholinergic system (parasympathetic system) is classically
constructed of preganglionic and postganglionic parts. The cell bodies of the
latter are coalesced into large or small ganglia. Concerning the colon, these
ganglia correspond to accumulations of neuronal cell bodies within the
submucous and myenteric plexuses. The ENS corresponds thus to a large
extent to the postganglionic parts of the cholinergic system (cf. above).
ACh is synthesized in nerve terminals from choline and acetyl-CoA by
choline acetyltransferase (ChAT), and is then translocated to synaptic
12
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
vesicles by the vesicular acetylcholine transporter (VAChT) (14). ACh is then
stored in the vesicles until it is released on demand (15).
It has long been considered that the neuronal cholinergic system is
involved in ulcerative colitis (UC). Already in 1953, studies on dogs
suggested that the cholinergic drug mecholyl could cause ulcerative colitislike symptoms (16). In any case, it has been shown that electrical stimulation
of the vagus nerve attenuates the release of pro-inflammatory cytokines (17,
18). A “cholinergic anti-inflammatory pathway” is hereby achieved (17, 19).
Parasympathetic stimulation leads to an increase in the secretory activity of
the goblet cells and parasympathetic reflexes are mainly responsible for
defecation reflexes.
The non-neuronal cholinergic system
ACh production occurs in cholinergic neurons, but also in non-neuronal
cells, such as cells in the surface epithelium in the skin (20), lymphocytes
(21), and vascular endothelial cells (22). ACh has also been found in bacteria,
algae, and primitive plants, showing that it has been an important molecule
in evolution for about 3 billion years. The non-neuronal ACh is, in contrast
to the neuronal ACh, a local signalling molecule. Non-neuronal ACh has
growth-related functions, immune- and barrier functions, and functions
related to the organization of the cytoskeleton and locomotion (15, 23), and it
is also suggested to be involved in the basic cell functions via cellular
signalling pathways (15). Of particular interest is the fact that the cholinergic
anti-inflammatory pathway (17, 18) also involves the non-neuronal
cholinergic system (24).
It is not known whether non-neuronal cells have storage capabilities for
ACh. It is possible that there is a continuous synthesis, diffusion, release and
hydrolysis (15). With regard to the human intestine, it is known that
epithelial cells, the endothelium and certain inflammatory cells demonstrate
expression of ChAT (25, 26).
Acetylcholine receptors
The effects of ACh are mediated by activation of the muscarinic or nicotinic
receptors. Five muscarinic G-protein-coupled ACh receptors, M1, M2, M3, M4
and M5, have been identified in mammals (see (27) for a review). The
receptors have different functions and properties, although the exact
functional roles of all these subtypes have to date not been fully elucidated.
Among the functions related to stimulation of muscarinic receptors are
effects on cell growth and proliferation (28, 29). The M2 receptor is the
major muscarinic receptor subtype expressed by smooth muscle tissues in
the GI tract (30), although a smaller population of the M3 receptor is also
coexpressed with M2 (30). The muscarinic receptors on smooth muscle do on
the whole belong to the M2 and M3 subtypes.
13
Maria Jönsson, 2009
Neuropeptides
General aspects
Neuropeptides are small molecules used by neurons for communication.
However, they are not only important for neurotransmission, but they also
have effects on tissue growth and differentiation, inflammation,
immunomodulation and tumour growth. The production of neuropeptides
occurs in the cell body of the neurons, and they are then transported to the
varicosities and are released after stimulation. Thereafter they interact with
their specific receptors. Frequently there is a co-localization of two or several
neuropeptides in neurons (see (31) for a review). Neuropeptides can be
released from the tissues to the bloodstream.
It is known that not only neuronal cells, but also local cells in the tissues,
can produce neuropeptides (32, 33). The levels of neuropeptide production
in these cells are usually low. Culturing, lesions or other manipulations cause
upregulation and/or induction of neuropeptide levels in the cells (32).
Tumours that express a neuroendocrine phenotype are known to secrete
neuropeptides with paracrine/autocrine growth factor activity (34).
Three neuropeptides frequently discussed in inflammatory situations,
including those of the intestine, are vasoactive intestinal peptide (VIP),
substance P (SP), and calcitonin gene-related peptide (CGRP).
Substance P and its receptors
Von Euler and Gaddum discovered SP in 1931 (35). This peptide consists of
11 amino acids, and belongs to the tachykinin family of peptides. SP is
classically a peptide produced in sensory neurons, is a pain mediator and is
involved in vasoregulation and so-called neurogenic inflammation (36, 37).
SP is also involved in immunomodulatory activities and has long been
considered to play a key role in IBD (38). SP has pro-inflammatory actions
(39).
SP has profound effects for intestinal physiology. Thus, it is involved in
the regulation of motility and transmural and electrolyte transport as well as
in the regulation of blood flow in the intestine (40, 41). SP has excitatory
effects in the GI canal, mediating smooth muscle contractions (42). SP also
has trophic and growth-modulating functions in various tissues (43, 44) as
well as wound-healing effects (45), and is involved in activating the emetic
reflex (46).
SP is present in enteric efferent neurons but also in sensory innervation. It
is synthesized by enteric cholinergic motor neurons, and hence, SPcontaining nerve fibers are frequent in the smooth musculature. SPcontaining nerve fibers are also present in the submucous plexus, blood
vessel walls and lamina propria (47).
14
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Non-neuronal cells can produce SP. That includes keratinocytes (33), and
Leydig cells (48). SP is also reported to be produced in human eosinophils
(49) and macrophages (50), and has also been detected in T-lymphocytes in
the intestine (51).
The preferred receptor for SP is the neurokinin-1 receptor (NK-1R) (52,
53), but SP can also bind to NK-2R with low affinity (54). NK-1R is a
member of the superfamily of guanin nucleotide binding-coupled receptors,
which interact with G-proteins to promote high-affinity binding and signal
transduction (54). Binding of SP to the NK-1R mediates rapid endocytosis
and internalization of the receptor (55).
VIP and its receptors
Vasoactive intestinal peptide (VIP) belongs to the VIP-glucagon peptide
family, and was originally isolated from small intestine by Said and Mutt
(56). VIP is mainly present in parasympathetic neurons (57, 58). VIP is
frequently expressed in the enteric neurons.
In contrast to SP, VIP has anti-inflammatory properties (59). It is involved
in the regulations of intestinal motility and blood flow (60), and the
secretion of electrolytes and water (61). VIP effects on the intestinal smooth
muscle are inhibitory. Similar to SP, VIP also has trophic and growthmodulating functions in various tissues (43, 62), and VIP is furthermore
reported to have wound-healing effects (45). VIP has a paracrine function
between developing neurons and glia (63) and VIP produced by lymphocytes
can function in an autocrine/paracrine way in regulating the immune system
(64). As well as in neurons, VIP is also reported to be produced by
inflammatory cells in the intestine (65, 66).
VIP has effects on class II family of G-protein-coupled receptors named
VPAC1 and VPAC2 (67). VPAC1 and VPAC2 do not discriminate between VIP
and another peptide, pituitary adenylate cyclase-activating polypeptide
(PACAP) (68). PACAP binds to the PAC1 receptor, while VIP has a low
affinity for the PAC1 receptor. The VIP/PAC receptor reported to dominate
in the human colonic mucosa is the VPAC1 receptor (69). The VPAC1
receptor is also called VIP receptor 1 (VIPR1).
Interrelationship between VIP/SP and the cholinergic system
It is well known that the neuropeptides VIP and SP are related to the ENS.
VIP and SP expressions are thus frequently encountered for the ENS
neurons. VIP is actually frequently co-localized with ACh in parasympathetic
innervation, why VIP can act as a cholinergic cotransmitter (70). SP
cooperates with ACh in the coordination of the peristaltic propulsion (71).
Nevertheless, both VIP (72) and SP (73) can have direct effects on the
smooth muscle cells of the intestine. M2 is, apart from being present on
smooth muscle cells in the intestine, also present on nerve fibers. M2 is thus
15
Maria Jönsson, 2009
expressed together with SP in the myenteric and submucous ganglia and
with VAChT and ChAT in cholinergic nerve fibers (74).
CGRP
Calcitonin gene-related peptide (CGRP) belongs to the calcitonin family of
peptides (75). CGRP is shown to be co-localized with SP in a majority of
sensory nerve fibers (76). However, in the intestine, there are also
intramural neurons that contain CGRP (77). CGRP is, similar to SP, involved
in the regulation of blood flow (78), in the modulation of intestinal motility
(79), and in wound healing (45).
Eosinophils
Various types of immunoactive cells are found in the intestinal wall. That
includes lymphocytes, macrophages, mast cells, and neutrophils (80). It has
been suggested that lymphocytes are involved in the disease process in UC.
Eosinophils are an additional important cell type that may be involved in the
pathogenesis of UC (81). These are white blood cells that contain red
granulae in the cellular cytoplasm. Activation of the cells leads to the release
of granular proteins (82).
Eosinophils play an important role in IBD. They are considered to be proinflammatory and pro-motility agents, and to produce effects such as
diarrhoea, inflammation, tissue destruction, but, as recently suggested, even
repair of injured epithelia (83). An increased release of eosinophil granulae
occurs in UC (84).
Eosinophils migrate to places of inflammatory or allergic reactions, or
parasitic infections. An increase in numbers of eosinophils has been reported
in UC (85). The accumulation of eosinophils in the intestinal mucosa in UC
is stimulated by different cytokines (86). Elevated levels of chemokines
relevant to eosinophil chemotaxis can be detected in serum and feces of
patients with active IBD (81).
Substances other than cytokines, including neuropeptides, have been
shown to attract eosinophils and to stimulate chemotaxis (87-89). SP has
thus been shown to have a stimulatory effect on degranulation of eosinophils
(90). It has also been shown that eosinophils can produce both SP and VIP in
healthy and inflamed human intestine (49).
Inflammatory bowel diseases (IBD) – general aspects
Ulcerative colitis (UC) and Crohn’s disease (CD) are the two forms of IBD.
UC was first described at the beginning of the 20th century, and Crohn and
collaborators (91) described CD in 1932. Nevertheless, symptoms resembling
IBD, such as chronic diarrhea, were described even before the time of Christ.
Both UC and CD are chronic relapsing diseases, destructive to the GI tract.
There is a chronic inflammatory reaction in the gut wall. The triggering
16
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
factors are unknown. Changed immunologic mechanisms are likely to be
involved.
UC affects the lower GI tract. The disease begins in the rectum and
spreads to the colon. CD affects all sections of the GI tract. UC affects only
the mucosa, while CD affects all layers of the wall. In about 5% of IBD cases,
it is not possible to establish a definite diagnosis of UC or CD (92), due to the
fact that some overlapping in the features of the diseases exists.
IBD runs in families (93). The risk of having IBD is about 1 in 10-20 if a
first-degree relative has the disease. The risk of developing IBD also varies
according to countries and ethnic groups. For example, Jewish people have a
5-8 fold increased risk of IBD compared to non-Jews (94).
Ulcerative colitis (UC)
Typical symptoms of UC are bloody diarrhoea with mucus, urgent need to go
to the toilet, rectal bleeding, abdominal pain, fever, weakness, and weight
loss. It is an intermittent disease, and asymptomatic periods can last from
months to years. The course of the disease is not predictable. The prevalence
of UC is about 3 per 1000 individuals (95). The incidence is the same for
men and women (96). UC affects people of all ages, but there is a peak in
onset at the age of 20-29 years (97). The disease can also have its onset in
childhood (98).
The etiology of UC remains elusive. It has been shown that stress
presumably not plays a role in the initiation of the disease (99), but that
stress is involved in the reactivation of the disease (100). The possibility that
an infectious organism such as Helicobacter pylori is involved has been
proposed (101), but the result of various human studies concerning this
aspect are not consistent. There are indications that breastfeeding is a
protecting factor against UC (102). What is known is that there exists an
inverse association between smoking and UC. Some studies have reported
that smoking has a protective effect against the development of UC (103).
Other studies show that patients who have undergone appendectomy for
appendicitis have a lowered risk of UC (104).
UC treatment consists of corticosteroids, and various immunosuppressive
and non-steroid anti-inflammatory drugs. Recently, anti-TNF treatment has
also been used. In severe cases, colectomy needs to be considered. The
cumulative colectomy rate 10 years after diagnosis is about 10% (105). In
some cases, the disease is very severe and requires immediate surgery.
If UC is present, there is a risk of developing colorectal cancer. The risk of
colorectal cancer begins to rise 8-10 years after diagnosis of UC. Therefore,
an endoscopic surveillance program is important (106). Recent studies
estimate that the risk of colorectal cancer in UC patients is 2-3 times greater
than in the general population (107).
17
Maria Jönsson, 2009
UC affects the mucosa and the inflammation is restricted to the mucosal
layer. The mucosal derangement that may occur appears as heavy infiltration
of various leukocytes into the lamina propria, architectural irregularity in the
crypts, crypt abscesses, and destruction of the epithelium, including a
decrease in numbers of goblet cells (108).
Background for the studies in this thesis
As can be seen above, the effects of various signal substances are of
importance for both the normal and the inflamed colon. This includes the
substances released from the neuropeptidergic and cholinergic systems.
Nevertheless, there are a large number of aspects that is unclear in this
respect. The major aspects that are also the basis for the performance of the
studies in the present thesis follow:
•
The levels of SPergic and VIPergic innervations in severe UC
disease. Variable results concerning the levels of SP- and VIPinnervations have been noted in previous studies on UC. The number of
SP-containing nerve fibers has thus been reported to be decreased (109,
110), to be elevated (111, 112), or to be unaltered (113) in UC. An
unchanged (113) or decreased (109, 110) level of VIP concentration/VIP
innervation has, furthermore, been noted with regard to UC. Thus, from
these studies it is unclear whether certain changes in neuronal SP/VIP
levels are definitely related to the UC process.
•
Is there an occurrence of VIP and SP production in the colonic
epithelium? It is well known that SP and VIP are not only confined to
the intestinal innervation but they are also produced by inflammatory
cells in the intestine (cf. above). This means that the VPAC1 and NK-1
receptors that are present can be affected by peptides from both of these
sources.
However, is there still another source of SP/VIP? A candidate is the
epithelial layer. Here it should be recalled that VIP, to some extent, may
function in a paracrine manner with regard to secretion in the rat
stomach (114). VIP- and SP-expressing endocrine cells occur in the
digestive tract of the turbot (115). SP-containing endocrine cells have
also been observed in the intestine of species such as axolotls (116) and
rainbow trout (117).
Endocrine cells expressing VIP or SP have not been detected in
human intestine (118). The same holds true for the other cell types in the
intestinal epithelium. It is thus not previously known whether or not
there are signs of SP/VIP production in the human colonic epithelium.
Instead, it is in the innervation, and to some extent in the inflammatory
cells, that both SP and VIP are regularly detected. On the other hand, it
18
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
has been shown that corneal epithelial cells demonstrate SP expression
(33) and that both SP and VIP expression has been noted for human
nasal epithelium (119). These observations demonstrate that further
studies on this aspect of the intestinal epithelium are warranted.
•
VIP/SP levels in blood vs. those in the mucosa. As described
above, neuropeptides are released to the blood stream. Certain studies
examining this aspect for VIP have been performed concerning UC.
However, they have reported inconsistent results (66, 110, 120). There is
no information at all for SP in this respect concerning UC.
It would be of great interest to find out whether or not the SP/VIP
levels in UC differ from those of non-UC patients. It would also be of
great interest to know whether there are certain correlations between the
SP/VIP levels in blood and those in the mucosa in UC, and the
magnitude of mucosa derangement. No correlative study on these
aspects has previously been performed. Of interest is whether analyses of
neuropeptide levels in blood give a hint of the UC disease.
•
The NK-1 and VPAC1 receptors in severe UC disease. As is the
case for the levels of SP/VIP innervation, there are uncertain facts
concerning the expression levels of the SP/VIP receptors in UC.
Concerning the predominating VIP receptor (VPAC1) there is actually no
information at all in UC. Concerning NK-1R, there are some reports (121,
122). Nevertheless, there is little information on the levels of expression
of this receptor in relation to the degree of mucosal derangement. That
includes also a lack of information concerning NK-1 receptor expression
in relation to the level of eosinophil infiltration. As both SP and VIP have
immunomodulatory and various other effects in the colon, further
information on the levels of their receptors in UC is welcome.
•
The non-neuronal cholinergic system in UC. There is no
information at all concerning the non-neuronal cholinergic system in
UC. This is a drawback as ACh is known to have marked
autocrine/paracrine effects, including effects on growth and
proliferation, angiogenesis, and presumably, wound healing (28, 29,
123). Furthermore, as described above, the cholinergic system can have
an anti-inflammatory effect, and there are inter-relationships between
ACh effects and effects of SP and VIP. It would be of great interest to
know to what extent the cholinergic effects in UC are related to effects
via the innervation, and via non-neuronal pathways.
19
Maria Jönsson, 2009
Aims
In this thesis, the following aspects for both normal and UC colon were
examined for. The aims were:
•
To study the distribution and levels of SP and VIP in the colonic wall.
How are the SP- and VIP-innervations correlated to the degree of
mucosal derangement?
•
To study the possible expressions of VIP and SP in the epithelial layer.
•
To study the levels of expression of the SP- and VIP-preferred receptors.
To what extent are they expressed in the epithelium and how are these
receptors correlated to the degree of mucosal damage?
•
To study the SP/VIP levels in both blood and mucosa from the same
patients, and to correlate these to the degree of mucosal derangement.
•
To study the patterns of the non-neuronal cholinergic system.
20
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Materials and Methods
Patient material
For an overview of the patients and the healthy controls used in the thesis,
see Table 1.
Paper
Methods used
Total number
of patients
analyzed
Gender
(Male/Female)
Age (years;
mean, range)
I
Htx, PAP, TRITC,
Congo Red
35 (17 UC, 18
non-UC)
UC: 11/6
UC: 38 (21-64)
Non-UC: 10/8
Non-UC: 65
(26-91)
Htx, PAP, TRITC,
In vitro receptor
autoradiography
38 (21 UC, 17
non-UC)
UC: 14/7
UC: 39 (21-64)
Non-UC: 7/10
Non-UC: 64
(41-83)
Htx, PAP, TRITC,
FITC, In situ
hybridization
43 (23 UC, 20
non-UC)
UC: 18/5
UC: 37 (20-62)
Non-UC: 10/10
Non-UC: 68
(45-90)
Htx, EIA
Mucosa: 39 (20
UC, 19 nonUC)
Mucosa; UC:
17/3
Mucosa; UC:
37 (20-79)
Non-UC: 8/11
Non-UC 70
(54-90)
II
III
IV
Plasma: 76 (24
UC, 23 non-UC,
30 healthy
controls)
Plasma; UC:
19/5
Non-UC: 12/11
Healthy: 13/17
Plasma; UC:
37 (20-79)
Non-UC: 70
(54-90)
Healthy: 41
(21-62)
V
Htx, TRITC, FITC,
In situ
hybridization
43 (23 UC, 20
non-UC)
UC: 18/5
UC: 37 (20-62)
Non-UC: 10/10
Non-UC: 68
(45-90)
Table 1. Overview of patients and methods used. In total, intestine of 46 UCpatients and 42 non-UC patients, and plasma of 24 UC, and 23 non-UC
patients as well as 30 healthy controls were used in Papers I-V.
All UC and non-UC patients were undergoing surgery at the University
Hospital of Umeå. The UC patients were operated on due to severe UC
disease. Some of the patients were operated in an acute stage of the disease
21
Maria Jönsson, 2009
and some of the patients were operated in a more chronic stage. All UC
patients underwent total colectomies and ileostomies, leaving the rectum.
The UC patients were sent home with their ileostomas 1 to 2 weeks
postoperatively. The non-UC patients were operated on for their disease,
which in most cases (all but three) corresponded to colonic carcinoma, and
were not receiving any chemotherapy or irradiation prior to the surgery. The
remaining three non-UC patients had volvolus, perforated diverticulitis and
diverticulosis. Many of the UC patients, and one non-UC patient, had been
treated with corticosteroids.
The healthy volunteers donating blood samples (Paper IV) did not suffer
from any disease and were not treated with any form of medication.
Tissue sampling and preparation
The tissue specimens were taken during operations (cf. above) and were,
concerning both UC and non-UC patients, taken from the most aboral part of
the sigmoid colon. Concerning the non-UC carcinoma patients, the
specimens were taken at least 10 cm from the visible margin of the tumor,
and represented macroscopically non-cancerous tissue. The tissue specimens
were directly after the surgery transported on ice to the laboratory. Some
specimens were immediately dissected, mounted on thin cardboard in OCT
embedding medium, frozen in liquid propane chilled with liquid nitrogen,
and stored at –80°C. Other specimens were fixed by immersion overnight at
4°C in an ice-cold solution of 4% formaldehyde in 0.1 M phosphate buffer
(pH 7.0). Then they were washed in Tyrode´s solution, containing 10%
sucrose, at 4°C overnight. The specimens were further dissected, mounted,
frozen and stored as described above.
The mucosa samples intended for EIA analyses were weighed and then
directly frozen in liquid nitrogen and stored at –80°C.
Blood sampling and preparation
Blood samples from UC and non-UC patients were collected in the morning,
on the day of the surgery (Paper IV). Blood samples from the healthy
controls were also taken in the morning. Venous blood samples were
collected in EDTA-treated tubes. 1.3 mg EDTA and 50 µL Trasylol were
added to each mL of blood. The blood was centrifuged at 4000 rpm for 15
min in 4°. The plasma was collected, transferred to new tubes, and frozen at
–80°C.
Sectioning
Series of sections were cut using a cryostat. For immunohistochemistry, 7-8
µm sections were cut and for in situ hybridization, 10 µm thickness was used.
The sections aimed for immunohistochemical purposes were mounted on
22
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
slides precoated with crome-alun gelatin. For in situ hybridization, Super
Frost Plus slides were used.
Morphology staining
In order to display the morphology, the sections were stained in Harris
hematoxylin (Htx) solution for 2 min. They were then rinsed in distilled
water, dipped in 0.1% acetic acid for a few seconds, and then washed in
running water for 5 min. The sections were then counterstained with eosin
for 1 min, dehydrated in ethanol and mounted in Permount.
Staining and counting of eosinophils
In order to detect eosinophils (Paper I), staining for Congo Red was
performed. The reliability of the Congo Red method was tested by comparing
sections stained with Congo Red with parallel sections stained with mouse
monoclonal anti-eosinophil peroxidase antibody (MAB 1087, Chemicon).
The parallel Congo Red and antibody stainings showed similar results.
The number of eosinophils per area of the lamina propria was counted
from sections of randomly chosen UC patients (six patients) and six non-UC
patients. 10 areas of 10,000-15,000 µm2 were counted in each section.
Furthermore, semiquantitative determinations of eosinophil numbers in the
lamina propria was made for all other specimens.
Immunohistochemistry (IHC)
Immunohistochemistry (IHC) was used in Papers I, II, III, V. Two different
IHC methods were used, immunofluorescence [tetramethylrhodamine
isothiocyanate (TRITC) or fluorescein isothiocyanate (FITC)] and peroxidase
anti-peroxidase (PAP) staining. Test stainings were made in order to reveal
which method that was the most appropriate for each antibody. For certain
antibodies, both immunofluorescence and PAP staining were used. During
the tests, stainings for other types of tissues were also performed, in order to
display reference information. Test stainings were also made in order to
clarify if chemically fixed or unfixed tissue was appropriate for each
antibody. For details concerning the preferred method (PAP/TRITC/FITC),
and the preferred tissue processing (fixed or unfixed), for the antibodies
used, see Table 2.
Pre-treatment procedures
In some cases, microwave antigen retrieval was applied (Paper I). The
sections were placed in 0.01 M citrate buffer, pH 6.0, and boiled in a
microwave oven for 3x5 min. The buffer was changed between each 5 min
cycle. After the last cycle, the slides were allowed to cool to room
temperature, in the buffer, and were then washed 3x5 min in PBS.
23
Maria Jönsson, 2009
Another pre-treatment method frequently used (Papers I, II, III, V) was
acid potassium permanganate solution (1 vol. of 2.5% KMnO4 and 1 vol. of
5% H2SO4 in 80 vol. of distilled water, pH 2.0) for 2 min (124). This pretreatment was found to be very useful in increasing the specific reactions for
certain of the antibodies. That included both stainings with PAP and
immunofluorescence methods. For details of when this pre-treatment
procedure was used, see the respective papers.
Antigen
Code
Source
Type
Dilution
Tissue
Method
Papers
SP
84500004
Biogenesis
Rabbit
1:100,
1:200
Fixed
PAP
I, III
SP
Mas 035
Sera-Lab
Rat
1:100
Fixed
PAP
I
SP
I675/00
2
UCB
Rabbit
1:100,
1:200
Fixed
TRITC
I
NK-1R
NB 300119
Novus
Rabbit
1:100
Unfixed,
postfixation
TRITC
I
NK-1R
S8305
Sigma
Rabbit
1:100
Fixed
PAP,
TRITC
I, III
NK-1R
Pc 481
Oncogene
Rabbit
1:100
Unfixed,
Fixed
TRITC
I
NK-1R
Pc 324
Oncogene
Rabbit
1:100
Fixed
TRITC
I
NK-1R
AB5060
Chemicon
Rabbit
1:100
Unfixed,
postfixation
TRITC
I
VIP
RPN
1582
Amersham
Rabbit
1:200
Fixed
PAP,
TRITC
II
VIP
H-064
Phoenix
Rabbit
1:500,
1:200
Fixed
PAP,
TRITC
II, III
AChR M2
M9858
Sigma
Rabbit
1:100
Unfixed
TRITC
V
ChAT
AB144P
Chemicon
Goat
1:25
Fixed
FITC
V
VAChT
Sc7716
Santa Cruz
Goat
1:25
Fixed
FITC
V
Chromogranin A
PH176
The Binding
Site
Sheep
1:100
Fixed
FITC
V
VPAC1
sc15958
Santa Cruz
Goat
1:100
Fixed
FITC
III
Table 2. Primary antibodies
24
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Immunofluorescence
Incubation with primary antibodies was performed for 1h at 37°C or
overnight at 4°C. The sections were stained with tetramethylrhodamine
isothiocyanate (TRITC) or fluorescein isothiocyanate (FITC) to detect
immunoreactions. For some of the antibodies, pre-treatment was performed
(see above). For all the details in the immunofluorescence method protocols,
see papers I, II, III, V.
Peroxidase anti-peroxidase staining (PAP)
The PAP method was used to detect immunoreactions for some of the
substances. The sections were incubated with the respective primary
antibodies for 1h at 37°C. For the details in the PAP method protocols, see
papers I-III.
Primary antibodies
For an overview of the antibodies used for the immunohistochemical
stainings, see Table 2.
Control stainings
Numerous control stainings were performed to clarify if specific
immunoreactions were obtained with the antibodies. The commonly used
methods were preabsorbtion of the antibody with the corresponding antigen,
and replacement of the primary antibody with PBS or normal serum. Parallel
stainings on other tissues were also performed. For details of the
preabsorbtions, see the respective papers.
In situ hybridization (ISH)
In situ hybridization (ISH) was performed in Papers III and V. For details of
the probes used, see Table 3. ISH was performed according to an established
protocol (125) with a few modifications.
All the details in the protocol are described in Papers III and V. In brief,
the sections were air-dried at room temperature (RT), fixed in filtersterilized 4% paraformaldehyde in 0.1M-phosphate buffer (ph 7.4) at RT,
and thereafter washed in saline sodium citrate (SSC) for 10 min. The sections
were then placed in 0.2 M HCl at RT to inhibit endogenous alkaline
phosphatase activity. Then they were placed in a mixture of 195 ml DEPCH2O, 2.7 ml triethanolamine, 0.355 ml HCl and 0.5 ml acetic anhydride in
RT in order to acetylate the slides. The slides were then rinsed in SSC. The
ssDNA probe (see Table 3) was added to 15 µl of hybridization solution in a
tube, denaturated for 5 min at 80°C and then put on ice. Each section was
then subjected to the probe-containing solution, covered with coverslips,
sealed with nail polish, and incubated at 56°C overnight. The slides were
25
Maria Jönsson, 2009
washed in SSC and thereafter in STE-buffer, and then incubated in 100 µl
RNase A at 37°C. Then followed washing, first in SSC containing 50%
formamide at 56°C, then in SSC and thereafter in buffer. Then followed
incubation with normal horse serum in buffer for 1h, whereafter the sections
were incubated with the AP-labelled anti-DIG antibody at RT. After that the
slides were washed in buffers. Then the enzyme (AP) substrate solution was
sterile filtered and added. Incubation was performed at 4° overnight. Placing
of the slides in buffer stopped the colour reaction, and the slides were then
counterstained in methyl green and mounted in Pertex.
Probe
Code
Dilution*
Sequence
Papers
ChAT
GD1001
-CS
25-50 ng
CCATAGCAGCAGAACATCTCCGTGGT
TGTGGGCACCTGGCTAGTGGAGAG
V
SP
GD1001
-CS
25-50 ng
CGTTTGCCCATTAATCCAAAGAACTGC
TGAGGCTTGGGTCTCCG
III
VIP
GD1088
-OP
50 ng
ACTGGTGAAAACTCCATCAGCATGCC
TGGC
III
TACR1
(NK-1R)
GD1001
-DS
10-50 ng
TGACCACCTTGCGCTTGGCAGAGACT
TGCTCGTGGTAGCGGTCAGAGG
III
Table 3. Probes used for in situ hybridisation. All the probes were Green
Star*TM DIG10 Oligonucleotide probes and were ordered from Gene Detect,
New Zealand. The corresponding sense DIG-hyperlabelled ssDNA probes
were used as negative controls. *Dilution refers to ng in 15 µl of hybridization
solution. β-actin (GD5000-OP), at a dilution of 25 ng in 15 µl hybridization
solution, was regularly used as a positive control.
EIA (Enzyme Immunosorbent Assay)
Both colonic mucosa and blood plasma were analyzed by the EIA method
(Paper IV).
Tissue homogenisation
The mucosa samples were homogenized in a prepared buffer (for details, see
paper IV) in a 1:20 relation. The homogenization procedures were performed
on ice. The tubes were thereafter centrifuged at 4°, 13 000 g, for 15 min. The
supernatant was then transferred to new tubes and stored at –80°.
EIA procedure
The SP, VIP and CGRP concentrations were analyzed using commercially
available enzyme immunoassay kits (see Table 4). The minimum detection
level for these kits was 0.25 ng/mL. The assays were performed in
accordance with the supplier’s instructions. Reference samples were
26
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
included in all plates, in order to obtain comparable results between
different plates. Thus, more than one plate for each substance was needed.
Antigen
Code
Source
SP
EK-061-05
Phoenix Pharmaceuticals, CA, USA
VIP
EK-064-16
Phoenix Pharmaceuticals, CA, USA
CGRP
EK-015-02
Phoenix Pharmaceuticals, CA, USA
Table 4. EIA kits used. All kits were used in Paper IV. Additional EIA/ELISA
kits were used (TNFalpha, TNF receptor and NGF/BDNF, cf. Paper IV) but
these were beyond the scope of the current thesis.
In vitro receptor autoradiography
In vitro receptor autoradiography, a technique that has been frequently used
in detecting receptors (126), and which permits morphometric evaluation via
counting of silver grains, was used (Paper II).
Specimens from five randomly chosen UC patients and five non-UC
patients were analyzed. Five areas from mucosa from each section (level)
were randomly chosen, photographs being taken from these areas
concerning both total binding and non-specific binding. We analyzed three
levels from each patient. We analyzed approximately 2.5 mm2 per level. The
total areas analyzed were 32.5 mm2 for non-UC patients and 37.5 mm2 for
UC patients.
Sections were mounted on poly-L-lysine-coated slides and air dried for 2 h
at 4°C, and were then pre-incubated for 30 min at 23°C, in one of two
solutions. One was a solution of 0.0005% polyethylenamine in 50 mM trisHCl buffer (pH 7.4) to uncouple endogenously bound VIP. The other was the
same solution also containing 1.250 µM VIP (Sigma), 0.1% bacitracin and 1%
bovine serum albumin to saturate the VIP binding sites. The sections were
then incubated in a humid environment for 60 min at 23°C in 50 mM TrisHCl containing 0.125nM [125I]VIP (Amersham), 0.1% bacitracin and 1% BSA.
By incubating the sections with 0.125 nM [125I]VIP in the presence of 1.250
µM unlabeled VIP, non-specific binding was assessed.
Thereafter followed washings, fixation with glutaraldehyde, further
washing and covering with LM-1 nuclear emulsion (Amersham), exposure
and then development in Kodak D19, fixation in 30% sodium thiosulphate,
and staining with Mayer’s hemalum solution. Parallel sections were stained
for morphology.
Quantitative analysis
The areas used for detection of VIP binding in the mucosa were randomly
chosen. Analysis of the autoradiograms was made via a dark-field
27
Maria Jönsson, 2009
microscope (Zeiss Axioskop 2 plus) that was equipped with a CCD camera
(Olympus DP70) connected to a computer with image software (Image Pro
Plus 5.0). The optical system was adjusted in the way that 1280 x 1024 pixels
of the monitor screen corresponded to an analyzed area of 800 x 640 µm of
the tissue specimen, i.e. 1.6 x 1.6 pixels per 1.00 µm tissue. The grey-scaled
image was converted into a binary image. The silver grains were noticed
against a neutral background. The same discrimination level was used in
every computation. Thereafter, the specific binding of [125I]VIP was
determined.
Correlations VIP binding/VIP IHC/mucosa morphology
The degree of VIP binding, categorized in a 5-graded scale, was compared
with the morphologic appearance of the mucosa (5-graded scale) and an
overall estimation of the level of VIP innervation in the lamina propria.
Semiquantitative analyses
Semiquantitative analyses were used (Papers I, II, IV, V) in order to evaluate
the degrees of mucosal derangement. When making the evaluation
concerning levels of derangement, marked derangement was defined as large
affection of crypt morphology, markedly increased lamina propria area on
behalf of epithelial area, and pronounced infiltration of inflammatory cells
into the lamina propria. The level of immunohistochemical expressions of
different substances was also determined semiquantitatively (Papers III, V).
Statistics
The results were evaluated using the software SPSS 11.0 for Macintosh. 2independent sample test according to Mann-Whitney, unpaired student’s ttest, paired samples t-test, independent samples t-test, Pearson correlation
analysis was used (cf. the respective Papers). We considered P-values ≤ 0.05
to be significant.
Ethical considerations
Informed consent was obtained from all individuals, both patients and
healthy controls. The Ethical Committee at Umeå University granted
permission for these human studies (dnr 01/332). The experiments were
conducted according to the principles expressed in the Declaration of
Helsinki.
28
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Results and Discussion
Methodological considerations
Concerning the patient material
It should be stressed that the material of UC patients was from patients
operated on due to severe disease, which did not respond to pharmacological
treatment. Thus, the material did not conform to biopsies of patients with
very mild disease. Via the way the material was obtained, much larger
specimens could be taken and analyzed compared to what would have been
possible with biopsies. Furthermore, the entire colonic wall could be
examined. The patients operated on in a non-acute stage were chronically ill
and were also in need of surgery.
The great majority of the non-UC patients were suffering from colorectal
carcinoma. We did not observe any general differences between non-UC
patients operated on for other reasons and the colonic carcinoma patients.
The mean age of the non-UC patients was considerably higher compared
to the UC patients. Nevertheless, when comparing specimens of the youngest
individuals with those of the oldest in the non-UC group, we did not observe
any obvious differences in the immunohistochemical pattern of the antibody
reactions (data not published).
Concerning antibodies and tests for specificity
It is crucial that optimal procedures are used in order to produce the most
distinct and specific reactions concerning both IHC and ISH. Thus,
evaluations of test stainings using chemically fixed and unfixed tissue
specimens, different pre-treatment methods, and different staining protocols
were made. Furthermore, the procedures used are based on several years’
experience of these issues in the laboratory. Preabsorbtion was performed
with the majority of the antibodies to confirm their specificities in IHC. For
ISH, stainings with a sense probe were always performed in parallel. In the
antibody test procedures, reference stainings on other tissues were also
performed.
It was found especially crucial to use different methods and different
antibodies in order to clearly depict the NK-1R expression patterns using
IHC. Thus, five different NK-1R antisera and varying staining protocols were
used. Specific reactions were noted to somewhat varying extents by using the
different methodological procedures and the different antisera. This is
presumably related to the fact that there are known variations in specificities
and affinities between different NK-1R antibodies (127), to the occurrence of
tissue and species variations in NK-1R detectability (128, 129), the
29
Maria Jönsson, 2009
occurrence of different NK-1R subtypes (130), and to the fact that the
fixation procedures used can affect the extent of NK-1R detectability (131).
One should always be cautious concerning the aspects of specificity. E.g.
with respect to detection of SP, it should be noted that recently discovered
peptides belonging to the tachykinin family demonstrate a high degree of
cross-reactivity with anti-SP antibodies. These peptides include members
related to hemokinins and endokinins (132, 133). Thus, the question arises
as to whether the currently used SP EIA kit not only detects SP-related
peptides but also hemokinins and endokinins. The C-terminal structure of
SP, hemokinins and endokinin A/B are thus very similar. There is no
information from the supplier on this aspect.
Morphology (Papers I-V)
Although the material of all UC patients collectively was obtained from
colectomy operations, the general morphology displayed variations between
different samples. Nevertheless, the mucosa displayed, as expected,
significantly more derangement in the UC group compared to the non-UC
group (Fig. 3). Some of the UC samples showed only minor derangement.
We also noted that there to some extent were variations in morphology
between different samples of the same individual.
Fig. 3. Morphology of the mucosa from non-UC (a) and UC patients (b) stained for haematoxylin-eosin. Note
the marked infiltration of inflammatory cells and the absence of crypts in (b).
30
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Substance P and the NK-1R
SP innervation (Paper I)
Nerve fibers showing SP-like immunoreaction (LI) were found in the lamina
propria (Fig. 4). They occurred in varying numbers. Nevertheless, the
variability was not related to variability in the extent of mucosal
derangement. SP-LI was also observed in nerve fascicles in the submucosa,
in nerve fibers in the ganglionic accumulations of the submucous plexus,
perivascularly, and in the myenteric plexus, including in the innervation of
the smooth muscle layers. SP-LI was also observed in neuronal perikarya of
both the submucous and the myenteric plexuses. No obvious differences in
general innervation patterns were observed between the UC and non-UC
groups.
These results on SP innervation patterns in the human colon agree with
those previously described for UC and controls (113, 134, 135). Thus, there
are to some extent inter-individual variations, which can explain the findings
of increased, unaltered or decreased levels of SP-innervation in previous
studies (cf. Introduction). This can in turn be related to the continuing
inflammatory responses in the UC process. It appears as if a downregulation
of the type observed for VIP innervation (cf. below) not occurs for SPinnervation in response to severe UC.
SP levels in mucosa (Paper IV)
Using EIA, it was demonstrated that the SP levels in the mucosa were
significantly higher in UC patients compared to non-UC patients. The levels
were about three times higher in the UC mucosa. Overall, it is thus obvious
that there is a general difference between UC mucosa and non-UC mucosa in
this aspect. Here it is of importance to realize that the SP levels detected with
EIA are not only related to SP-innervation but also to SP produced in local
cells such as inflammatory cells and epithelium (see further below).
Local production of SP (Paper III)
SP mRNA was found in epithelial cells and lamina propria and submucosal
cells. Epithelial SP mRNA was mainly observed in non-UC mucosa and in
UC mucosa demonstrating only minor derangement. Immunoreactions for
SP were on the other hand not observable in the epithelium, or in the lamina
propria/submucosal cells.
One explanation may be that the production levels of SP in epithelium are
too low to be detected by our immunohistochemical methods. In accordance
with such an explanation are the previous findings that there are
comparatively low levels of SP gene expression in non-neuronal SPexpressing cells, as compared to neuronal such cells, (136) and that
neuropeptide levels in neuropeptide-synthesizing non-neuronal cells are
31
Maria Jönsson, 2009
very low (32). Another possible explanation is that SP is only produced
under certain circumstances. There are several regulating steps in the
pathway from DNA to protein, and the process can be inhibited before the
protein synthesis (137). The mRNA is furthermore needed in a certain
amount in order to lead to protein production. Nevertheless, the former
interpretation seems more attractive. In any case, as it is described in
Introduction, SP expression is nowadays shown for human epithelium in
other parts of the body. Inflammatory cells have also been shown to express
SP (51, 138).
Fig. 4. SP-LI in nerve fibers in lamina propria of an UC patient.
Fig. 5. NK-1R in lamina propria cells of a non-UC patient.
32
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
NK-1R expression (Paper I, III)
NK-1R immunoreactions were detected in nerve fibers of nerve fascicles in
the submucosa, and also in the smooth muscle and myenteric and
submucous plexuses and in blood vessel walls.
NK-1R immunoreactions, as well as to certain extents TACR1 mRNA, were
also found in the epithelium of both UC and non-UC patients. The reactions
were weak in some of the samples, demonstrating that there are
interindividual differences. It was frequently observed that the epithelial NK1R reactions were particularly pronounced in areas demonstrating marked
mucosal derangement. The level of NK-1R expression has also been noted to
be increased in certain other situations, such as during the inflammation
seen in the rat intestinal epithelium after exposure to Clostridium difficile
toxin A (139).
Distinct NK-1R immunoreactions (Fig. 5) and TACR1 mRNA were also
detected in cells in lamina propria and submucosa. Lamina propria cells
demonstrating NK1-R gene expression were earlier observed in the IBD
mucosa (51, 121, 122). These were interpreted as lymphocytes, macrophages
and eosinophilic granulocytes (122). As will be discussed below, we have also
in our laboratory noted that a subpopulation of the lamina propria cells
exhibiting NK-1R are eosinophils (unpublished observations).
Eosinophil infiltration in relation to NK-1R expression (Paper I)
It is well known that different types of white blood cells are present in lamina
propria during the inflammatory process in UC. As a part of this thesis, the
level of infiltration of the eosinophils was evaluated. One main finding was
the notion that there were marked interindividual variations in eosinophil
numbers in both the UC and the non-UC groups. One explanation for this
may be the occurrence of differences in allergic backgrounds. However, in
the great majority of the UC samples demonstrating pronounced
inflammation and/or morphologic derangement, there was a large number
of eosinophils in the mucosa. This suggests that the eosinophils are involved
in the disease process in UC. It is previously reported that there is an
increased activation and degranulation of eosinophils in UC (84). Lampinen
and collaborators have found that eosinophils were more numerous and
more active in patients with active UC than in controls, and these findings
indicates that these cells are possibly pro-inflammatory and tissue damaging
cells (83).
The fact that numerous eosinophils in the lamina propria usually occurred
in specimens with marked NK-1R expression in the epithelium, may suggest
that the NK-1 receptor may play a role in the extravasation of eosinophils.
We have also recently observed that NK-1R is present in eosinophils in the
human colonic mucosa (unpublished observations). It is therefore possible
that NK-1R receptors are involved in this extravasation. In accordance with
33
Maria Jönsson, 2009
this suggestion are the findings that SP is of importance for eosinophil
infiltration in the airways (140, 141). It is previously described that NK-1R
participates in neutrophil accumulation in inflamed skin (142).
VIP and VIP receptors
VIP innervation (Paper II, III)
Nerve fibers demonstrating VIP-like immunoreactivity (-LI) were found in
lamina propria, especially in the superficial parts. They were also found in
submucosal nerve fascicles, submucosal and myenteric plexuses, and in the
smooth muscle. Concerning the mucosa, VIP-LI nerve fibers were most
numerous in mucosa demonstrating a rather normal morphology.
Comparatively fewer nerve fibers demonstrating VIP-LI were found in parts
of the mucosa where the infiltration of inflammatory cells was the most
marked.
The general observations on the pattern of VIP innervation conform to the
previously described pattern for the normal colon and the colon in UC (e.g.
(113, 135, 143)). The findings of a decrease in VIP-innervation in relation to
marked UC-inflammation do to a certain extent conform to previous studies
(109, 110). The observations show that there, in contrast to the situation for
SP-innervation, is a down-regulation of VIP innervation when the
inflammation is marked.
VIP levels in the mucosa (Paper IV)
There were significantly higher levels of VIP in the mucosa in UC patients
compared to non-UC patients, in examinations using the EIA method. Thus,
in contrast to the fact that VIP innervation appears to be downregulated in
response to severe UC, there was not a correlative decrease in VIP levels as
seen by EIA. This may be explained by the fact that some of the
inflammatory cells are producing VIP, and that we also have observed signs
of VIP production within the epithelial layer (see further below).
Local production of VIP (Paper III)
mRNA for VIP was found in submucosal and lamina propria cells. VIP
immunoreactions were also observed in those cells. This is in accordance
with the previous findings that VIP is produced by inflammatory cells in the
intestine (65, 66, 144).
Epithelial VIP mRNA was found, with the exception of very deranged
mucosa. The epithelial reactions were mainly observed in basal crypt
epithelium. Very weak VIP immunoreactions were also seen in the basal
crypt epithelium. Expression of VIP has not previously been demonstrated in
colonic epithelium.
34
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
If we assume that VIP to some extent is produced in the epithelial layer,
the peptide can have autocrine/paracrine effects within the layer. This is
mainly a fact for normal epithelium and epithelium that is not much
deranged. In accordance with an occurrence of autocrine/paracrine VIP
effects in the intestinal epithelium are the findings that VIP is involved in the
regulation of proliferation of intestinal epithelial cells (145). It is since long
considered that VIP has marked trophic and growth-modulating functions
(63). Concerning the intestine, VIP is described to have immunomodulatory
effects on intestinal epithelial cells via a regulation of IL-8 secretion (146).
VIP receptors
The distribution and the magnitude of occurrence of VIP receptors in UC
and non-UC mucosa were examined by two different methods. VIP in vitro
receptor autoradiography and VPAC1 immunohistochemistry were applied.
The background for using autoradiography was that the magnitude of
binding sites over large areas could be analyzed for, and the background for
using antibodies against VPAC1 is the known fact that this is the VIP/PACAP
receptor that is known to predominate for the human intestine, at least
concerning the smooth muscle (69).
VIP binding (Paper II)
Via in vitro receptor autoradiography, the binding sites for VIP in the colonic
mucosa were studied. A significant difference was found between non-UC
and UC patients. The non-UC patients displayed more VIP-binding sites in
the mucosa compared to UC-patients. As was the case for VIP innervation,
VIP binding sites were most clearly observed in the superficial parts of the
mucosa. In lamina propria areas demonstrating accumulation of
inflammatory cells, there was a very low degree of VIP binding.
VPAC1 IHC (Paper III)
Distinct VPAC1 IR was noted for the epithelial layer (Fig. 6). However, there
were low levels of VPAC1 IR in UC specimens demonstrating a marked
inflammation. VPAC1 IR was also noted for cells of the lamina propria and
submucosa, in muscularis mucosae and in blood vessel walls.
The observations of a low degree of VPAC1 IR in deranged and inflamed
mucosa correspond to the observations seen for deranged mucosa
concerning VIP binding sites. The findings suggest collectively that there are
limited VIP effects in colonic areas that are highly inflamed by the UC
disease. As VIP has both anti-inflammatory (59) and trophic effects (43), this
fact may be negative for the colon.
35
Maria Jönsson, 2009
Fig. 6. In (A) VPAC-1-IR in the epithelium of crypts, and in the muscularis mucosae (to the left). In (B) the
same area after preabsorbtion of the antibody. Non-UC patient.
Neuropeptides in plasma
parameters (Paper IV)
and
correlations
to
other
Neuropeptide levels in plasma
The plasma levels of VIP and SP, as well as those of CGRP, were studied
concerning both UC and non-UC patients (colonic carcinoma patients).
Additionally, plasma from healthy controls was studied. For all three
neuropeptides, the UC group was showing the highest plasma levels, and
healthy controls were displaying the lowest levels (see Paper IV, Table 3).
The differences between UC patients and healthy controls were more marked
than those between colonic carcinoma patients and healthy controls. The
observations show that there is an increased release to the blood of all three
neuropeptides analyzed in UC. Concerning the UC-group, the VIP, SP and
CGRP levels in plasma were significantly higher in patients treated with
corticosteroids and/or non-steroid anti-inflammatory/immunosuppressive
drugs, compared to those that were not given any medication.
It has not previously been shown that the plasma levels of several
neuropeptides collectively are increased in UC. It is previously described that
plasma levels of different cytokines are different in UC compared to healthy
individuals (147).
Correlations between plasma and mucosa levels and the degree
of mucosal derangement
Correlative analyses of neuropeptide levels in plasma vs. mucosa from the
same individuals gave the opportunity to study possible associations
36
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
between the levels in plasma and those in mucosa, and if there were
correlations to the extent of morphologic affection. In plasma, there were
correlations (Paper IV, Table 8) between the levels of all three neuropeptides
(SP vs. VIP, SP vs. CGRP and VIP vs. CGRP respectively). There were also
correlations between VIP and SP in mucosa (Paper IV, Table 7). For VIP,
there was furthermore a significant correlation between levels in plasma and
mucosa (P <0.05). Concerning SP, the correlation between plasma and
mucosa levels was only almost significant (P <0.10). Interestingly, there was
a marked correlation between the degree of mucosa derangement and the
plasma levels of the three neuropeptides. The levels of all three
neuropeptides in the mucosa were higher when there was a marked
derangement.
The observations show that the levels of the three neuropeptides in both
plasma and mucosa to a large extent are related to the extent of colitis
involvement. It is apparent that the production levels for all three are
increased in parallel with the disease process. Furthermore, that there are
marked correlations between VIP and SP for both plasma and mucosa. It is
also apparent that high levels of VIP and SP in mucosa parallel high levels in
plasma.
It is of interest to have markers for UC to examine for in blood- and/or
stool samples from patients, both concerning diagnostic issues to
discriminate UC from other diseases, and to monitor and predict the disease
course. CRP is a valuable marker to detect and follow up disease activity in
Crohn’s disease (148). Elevations in CRP are, however, of smaller magnitude
in patients with active UC than active Crohn’s disease (149). For UC, antineutrophil cytoplasmic antibodies have been found in sera in 60% of the
patients (150). In stool, markers for calprotectin have been studied; this
marker followed the disease activity in UC patients (151). The observations
on three neuropeptides analyzed in Paper IV concerning plasma give a hint
for the further use of examining for neuropeptide plasma levels in UC
analyses.
The cholinergic system (Paper V)
The cholinergic innervation
Immunoreactions for ChAT and VAChT were noted for nerve fibers of the
lamina propria, the submucous plexus, and the myenteric plexus, including
the smooth muscle innervation. These observations are related to the
postganglionic part of the parasympathetic nervous system and thus to the
ENS. ChAT immunoreactions have also previously been observed for the
submucous and myenteric plexuses of the intestine of man (152-154).
37
Maria Jönsson, 2009
Observations favouring a local production of ACh
The non-neuronal cholinergic system was extensively examined for in Paper
V. The ACh synthesizing enzyme ChAT, and the ACh transporter VAChT
were studied. ChAT IR was found in endocrine cells of the epithelial crypts.
There were significantly more immunoreactive endocrine cells found in nonUC patients, compared to UC patients. ChAT IR was also found in lamina
propria cells and submucosal cells. Weak ChAT IR was noted for blood vessel
walls.
Whereas ChAT IR was not detected with certainty in the epithelial layer,
ChAT mRNA reactions were observed in the epithelium. That included the
situation for goblet cells. ChAT mRNA was also observed in cells in the
lamina propria, and also in some blood vessel walls in the submucosa.
VAChT IR was observed in the epithelium (Fig. 7). There were
significantly higher levels of VAChT IR in the epithelium of non-UC patients
compared to UC patients. VAChT IR was also found in cells in the lamina
propria. The levels of VAChT in the epithelial layer were significantly
correlated to the levels of VAChT in lamina propria (reactive cells and nerve
fibers grouped together).
Fig. 7. VAChT IR is present in the epithelium of crypts, and in cells in the lamina propria of a non-UC patient.
38
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Muscarinic receptor M2
Immunoreactions for the ACh receptor M2 were clearly observed in the
mucosal epithelium (Fig. 8). There was a tendency of more pronounced M2
IR in UC epithelium compared to non-UC epithelium. M2 IR were also noted
for blood vessel walls, nerve fascicles and the smooth muscle layers.
Fig. 8. M2 immunoreactions in the epithelium of crypts of a non-UC patient.
Interpretations concerning the non-neuronal cholinergic system
The patterns of the non-neuronal cholinergic system for the human colon in
UC are here established. Thus, it is evident that the observations suggest that
a local ACh production occurs. Here it should be recalled that although
immunoreactions for ChAT previously have been demonstrated for the
epithelium and some inflammatory cells in the human intestine (25, 26), the
ChAT patterns in UC have never been analyzed before. Furthermore, ChAT
ISH and VAChT IHC have not before been applied on the human intestine.
Concerning the epithelium it is likely that ACh released from cells of this
layer interacts with the epithelial ACh receptors. When discussing this
aspect, it should be recalled that muscarinic receptors are not only related to
effects on ion transport and secretory activity, but also to effects on cell
growth and proliferation (28, 29). Thus, marked cholinergic
autocrine/paracrine effects may precede in the colonic epithelial layer.
Cells in lamina propria and submucosa are apparently a part of the nonneuronal cholinergic system. Accordingly, lymphocytes have been described
to constitute an independent non-neuronal cholinergic system, synthesizing
and producing ACh and expressing both muscarinic and nicotinic receptors
(155).
39
Maria Jönsson, 2009
Of great interest is the nowadays accepted concept of a cholinergic antiinflammatory pathway (19). One example showing this is the finding that
ACh released in response to activation of the vagal nerve has effects on the
local inflammation (156). The concept may involve the non-neuronal
cholinergic system (24). This may be of great importance in an inflammatory
situation like UC.
The importance of the non-neuronal cholinergic system in UC is
completely unknown. As inflammatory cells can produce ACh and as this
system is markedly present in the colon, the importance of this system in UC
should be the scope of future studies.
Future treatment possibilities
Information about expressions and magnitudes of VIP/SP and cholinergic
systems in UC is not only of academic interest. Information on these aspects
may be of relevance when discussing future treatment possibilities for UC. It
is suggested that VIP treatment (157, 158), as well as blocking of the NK-1
receptor (71, 139, 159), may be useful in this disease. Experimental studies
on animals favor that NK-1R blocking (160, 161) and VIP treatment (157)
might be useful in colitis.
Experimental studies do also favor that VIP treatment may have effects in
other inflammatory situations, such as experimental autoimmune
encephalomyelitis (162). However, in certain experimental studies, VIP
treatment was found unable to modulate colitis (163). It might be that
interference with several mediators, i.e. multitarget therapy, can be an
alternative in inflammatory disorders (164). It is thus well known that a large
number of interactions occur between neuromodulators and cytokines.
Interfering with neuropeptide effects in parallel with the use of other
medications is considered as one alternative in inflammatory disorders
(165). The fact that VIP treatment down-regulates the production of several
inflammatory mediators, including TNFalpha (162) is nevertheless
promising. Anti-TNF treatment has been used for several years concerning
troublesome Crohn’s disease (166) and has also nowadays been introduced
for severe UC. There is good response for some, but not for all patients (167169).
Also the cholinergic/nicotinergic systems are relevant when discussing
treatment possibilities. It is known that UC is a disease that mainly affects
non-smokers. Nicotine has its effect on nicotinic acetylcholine receptors,
distributed both in neurons but also in nonneuronal cells (170). Trials with
transdermal nicotine (patches) showed however that these were not better
than placebo in the maintenance of remission of UC (171).
There are several studies which suggests that muscarinic receptor
antagonists or agonists may be beneficial in different situations, for example
40
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
obesity (172), Alzheimer’s disease (173), schizophrenia (174), overactive
bladder (175), and even cancer (176).
In a study of Hirota and collaborators muscarinic receptor M3 knock-out
mice were more sensitive in developing colitis compared to wild type mice
(177), showing that manipulations of the cholinergic system may be of
advantage in treating UC.
Most of the UC patients have relapses in their disease. Medications to
reduce the likelihood of those relapses may be of advantage also in reducing
the long-term complications of the disease. Maybe a combination of several
agonists/antagonists interfering with several neuropeptides, cytokines or
other neuromodulators are alternatives in treating UC in the future.
Summary of the main findings
•
There is mRNA for SP and VIP in the colonic epithelium as seen by in
situ hybridization.
•
The level of VIP innervation but not the level of SP innervation is
decreased in mucosa areas showing marked inflammation.
•
There are marked reactions for the VPAC1 receptor in the colonic
epithelium, the reactions being particularly pronounced in normal and
little affected mucosa.
•
The levels of VIP receptors in the mucosa, as seen by in vitro receptor
autoradiography, are decreased in areas of the UC mucosa that show
marked inflammation/derangement.
•
There is an association between marked derangement of the mucosa,
pronounced infiltration of eosinophils in lamina propria, and a marked
NK-1R expression in the epithelial layer. Thus, epithelial NK-1R
immunoreactions are often the most marked where the mucosa shows a
pronounced morphologic derangement. There were usually numerous
eosinophils in the underlying mucosa in these areas.
•
In accordance with previous observations, there is presence of VIP
immunoreaction, VIP mRNA, VPAC1 immunoreaction, SP mRNA and
NK-1R immunoreaction in cells in lamina propria and submucosa.
•
There are elevated levels of SP, VIP and CGRP in both plasma and
mucosa in UC patients. There are marked correlations between the levels
of the three peptides with regard to both plasma and mucosa. There are
41
Maria Jönsson, 2009
also, to a certain extent, correlations between the levels of SP and VIP in
mucosa vs. plasma.
•
The levels of the neuropeptides in plasma and mucosa are correlated to
the degree of mucosal derangement.
•
Reaction patterns observed for ChAT and VAChT suggest that there is a
marked local production of ACh in the colon. Thus, there is a nonneuronal cholinergic system. Some changes in this system occur in UC.
•
Marked muscarinic M2 immunoreactions occur in several tissue
compartments. There was a tendency towards higher M2
immunoreactions in the epithelium of UC patients than in non-UC
patients.
Summary of main conclusions
•
It seems as if there is not only a VIP- and SP-supply to the intestine via
the innervation and inflammatory cells, but presumably also via the
epithelium. Nevertheless, further studies are needed to clearly show the
existence of productions of the peptides in the epithelium.
•
The colon is supplied with not only a neuronal but also a non-neuronal
cholinergic system. This fact has not previously been considered for IBD.
The non-neuronal cholinergic system may be highly involved in the
processes that occur in the colon. The existence of a cholinergic antiinflammatory pathway speaks in favor of such a suggestion.
•
The epithelium is shown to be markedly influenced by SP, VIP, as well as
ACh. A marked presence of receptors for all these was noted.
Autocrine/paracrine SP, VIP, and ACh effects are likely to occur.
•
The findings suggest that there is a downregulation of both VIP
innervation and VIP receptors in mucosal areas that are greatly inflamed
and deranged.
•
In contrast to the situation for VIP, SP innervation appears not to be
reduced when there is marked inflammation, and the levels of SP
receptor (NK-1R) are, instead, often pronounced in such cases.
•
The changes seen regarding VIP and SP receptors in relation to
inflammation/derangement may be a drawback for intestinal function.
42
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
•
It may be that the NK-1R is involved in the extravasation of eosinophils
in the colonic mucosa.
•
New information on the existence of correlations between neuropeptide
levels in mucosa and plasma and the mucosal affection has been
obtained via correlative studies on all three parameters for the individual
patients. More mucosal affection leads to more neuropeptide production
in the mucosa and higher levels of these in the blood.
•
In conclusion, regarding the importance of both the SP/VIP systems and
the cholinergic system in the colon, both neuronal and non-neuronal
components should be taken into consideration.
43
Maria Jönsson, 2009
Funding
•
The Faculty of Medicine, Umeå University
•
The County Council of Västerbotten
•
Lions Cancer Research Foundation
•
The foundation “Nio meter liv”
•
Dagmar Ferbs minnesfond
•
Arnerska forskningsfonden
•
JC Kempes Minnes Stipendiefond
•
Wallenbergs stiftelse för resestipendium vid Umeå Universitet
•
Anna Cederbergs stiftelse
44
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Svensk populärvetenskaplig
sammanfattning
Introduktion
Ulcerös colit (UC) är en kronisk inflammatorisk tarmsjukdom som går i
skov. Den drabbar slemhinnan i tjocktarmen. Under ett skov får patienten
blodiga slemmiga diarréer, feber och magsmärtor. Skoven kan komma tätt
eller med flera års intervaller. Sjukdomens förlopp går inte att förutsäga.
Sjukdomen behandlas med kortison och olika antiinflammatoriska
mediciner. En del av patienterna blir inte hjälpta av den medicinska
behandlingen och måste få tjocktarmen bortopererad. För vissa görs detta på
därför att de aldrig blir riktigt besvärsfria. För andra görs det under akuta
skov som faktiskt kan bli livshotande. Andelen UC-patienter som genomgår
operation varierar mellan olika studier men har beskrivits vara ungefär 10 %
efter 10 års sjukdom. UC drabbar människor i alla åldrar, men vanligaste
åldern för insjuknande är 20-29 år. Sjukdomen drabbar även barn. Med
sjukdomen följer också en ökad risk för cancer i tjocktarm och ändtarm.
Risken har beskrivits vara 2-3 gånger högre jämfört med den för friska.
Tjocktarmsväggen är uppbyggd av en slemhinna (mukosa) som har ett
lager celler längst ut (epitel). Mukosan består av inbuktningar (kryptor) och
en del som kallas lamina propria där det bland annat finns immunceller och
nervtrådar. Under mukosan finns submukosan. I submukosan finns blodkärl
och en omkopplingsstation för nerver som kallas submukösa plexat. Under
submukosan finns två muskellager, och mellan dessa muskellager finns en
annan omkopplingsstation för nerver som kallas myenteriska plexat (för
bilder över tarmens uppbyggnad, se Fig 1 sid 9 samt Fig 2 sid 10).
Neurotransmittorer är substanser som överför signaler mellan olika
nerver, och mellan nerver och celler. Den neurotransmittor som studerats i
den här avhandlingen är acetylkolin. Acetylkolin tillverkas i nervändar med
hjälp av ett enzym som heter ChAT. Det transporteras sedan till sin
lagringsplats (vesiklar) med hjälp av transportören VAChT. Man har numera
även funnit att acetylkolin kan produceras i celler som inte är nervceller.
Detta kallas för det icke-neuronala kolinerga systemet. Acetylkolin påverkar
receptorer, och i denna avhandling fokuseras på den så kallade
muskarinerga receptorn M2. Acetylkolin har bland annat effekter på
immunsystem och tillväxtprocesser.
Vidare har neuropeptiderna substans P (SP), VIP och CGRP studerats.
Neuropeptider är inblandade i vävnadstillväxt, inflammation, tumörtillväxt
mm. SP är bland annat inblandad vid upplevelse av smärta, vid reglering av
blodflöde, vid sårläkning, och vid aktivering av kräkreflexen. VIP är bland
annat inblandad vid reglering av blodflöde, tarmrörelser, och sårläkning.
Viktiga skillnader funktionellt dem emellan är att VIP är en anti45
Maria Jönsson, 2009
inflammatorisk substans och SP en pro-inflammatorisk substans, och vidare
verkar de olika på motoriken i tarmen.
Eosinofiler är en typ av vita blodkroppar som mycket väl kan vara
inblandade vid utvecklingen av UC. Aktivering av dessa celler gör att de
tömmer ut granula som förstör vävnaden, skapar inflammation, och i tarmen
kan detta leda till bland annat diarré. Det har också nyligen föreslagits att
eosinofiler även ska kunna reparera skadat epitel.
Bakgrund till dessa studier
Effekterna av signalsubstanserna acetylkolin, SP och VIP är viktiga för både
frisk och inflammerad tarm. Men det är många faktorer som är oklara (för
referenser, se Introduction). Det gäller:
•
Nivåerna av SP och VIP i nerver vid svår UC-sjukdom. Det finns
stora variationer i resultaten från studier som tidigare gjorts. Utifrån
dessa tidigare studier är det oklart om förändringar i SP- och VIPinnervering hör ihop med sjukdomsprocessen vid UC.
•
Ifall det finns produktion av VIP och SP i epitelet i tarmen? Det
är välkänt att SP och VIP inte enbart produceras i nerver utan också av
inflammationsceller. Men man vet inte om SP och VIP också produceras
i epitelet i tarmen. Man vet däremot att de produceras i epitel på några
andra platser i kroppen.
•
Nivåerna av SP och VIP i blod jämfört med nivåerna av dessa i
mukosa. Neuropeptider frisläpps från vävnader till blodet. Det är okänt
om det finns någon koppling mellan nivåerna av dessa i blod och
nivåerna i tarmens mukosa. Det som är intressant är om man kan mäta
dessa substanser i blodet och på så sätt få någon vägledning om hur
sjukdomen ser ut i tarmen.
•
Receptorerna för SP och VIP vid svår UC-sjukdom. Det finns
oklarheter i nivåerna av receptorerna (bindningsställena) för SP och VIP
vid UC. Man vet heller inte om nivåerna av receptor har någon koppling
till hur skadad tarmen är vid UC.
•
Det icke-neuronala kolinerga systemet vid UC. Det finns inga
tidigare studier gjorda angående det icke-neuronala kolinerga systemet
vid UC. Det kolinerga systemet kan ha en anti-inflammatorisk effekt, och
acetylkolin har effekter på tillväxt, blodkärlsbildning, och troligen
sårläkning. Därför är det intressant att studera detta vid UC.
46
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Material och metoder
I den här studien har material studerats från UC-patienter som varit så
sjuka att de varit tvungna att få sin tarm bortopererad. Som kontroller har
tarm från patienter som opererat bort tjocktarmen av andra skäl, oftast på
grund av tjocktarmscancer använts. Då har en till synes frisk tarmbit minst
10 cm från tumören undersökts. Även blodprov har tagits från både UCpatienter och kontrollerna. Det har även tagits blodprov från helt friska
försökspersoner.
Tarmbitarna har snittats i 0,007 mm tunna snitt och har sedan färgats in
med olika metoder (immunhistokemi, in situ hybridisering och
autoradiografi). En del av tarmbitarna har dessutom lösts upp i vätska och
analyserats med den biokemiska metoden EIA. Även blodet har analyserats
med den metoden.
Projektet är godkänt av etisk kommitté. Alla patienter har informerats och
de har gett sitt samtycke till att vara med i studien.
Sammanfattning av resultat
•
Det finns i princip ett samband mellan graden av tarmskada, antalet
eosinofiler i mukosan, samt graden av SP-receptor i epitelet. Där skadan
är stor finns oftast en stor mängd SP-receptor i epitelet och många
eosinofiler i den underliggande mukosan. Det kan vara till nackdel för
mukosan eftersom SP är en pro-inflammatorisk substans. Fynden talar
också för att SP kan vara inblandad i rekryteringen av eosinofiler till den
inflammerade mukosan.
•
Det finns vissa tecken på en produktion av VIP och SP i epitelet i tarmen.
Uttryck för dessa ses nämligen på så kallad mRNA-nivå. Alltså kan det
vara så att VIP och SP inte bara tillförs tarmen via nerver och
inflammationsceller vilket man tidigare trott.
•
Det finns ett färre antal receptorer för VIP i tarm som är mycket skadad,
jämfört med lindrigt skadad och normal tarm. Det är en nackdel
eftersom VIP har anti-inflammatoriska egenskaper.
•
Nivåerna av neuropeptiderna SP, VIP och CGRP är högre i både blod och
tarm hos UC-patienter jämfört med kontroller. Det finns ett samband
mellan skadad mukosa, och nivåerna av neuropeptiderna i både tarm
och blod. Mer skada på mukosan leder till högre nivåer av
neuropeptiderna i mukosan och i blodet. Parallell analys av alls dessa tre
neuropeptider i blodprov kan alltså ge en fingervisning om graden av
inflammation/skada av mukosan.
47
Maria Jönsson, 2009
•
Bevis visas för att en lokal produktion av acetylkolin sker i celler i
tarmen. Det har förut inte visats för UC tarm. Det finns alltså inte bara
ett neuronalt kolinergt system i tarmen utan också ett icke-neuronalt
sådant system. Det sker en del förändringar i detta vid UC.
•
Ett huvudbudskap är att fynden talar för att det, mer än vad man förut
trott, sker en lokal produktion av SP, VIP och acetylkolin i mukosan i
tarmen. Detta kan ha en viktig betydelse vid UC.
48
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
Tack
Den här doktorsavhandlingen utgår huvudsakligen från avdelningen för
Anatomi och har genomförts i samarbete med avdelningen för Kirurgi. Jag
vill tacka alla som på olika sätt varit till hjälp under dessa år.
Sture Forsgren, min huvudhandledare. Jag tror inte att det är särskilt många
doktorander som fått uppleva en sådan engagerad handledare. Din dörr har
alltid stått öppen och du har aldrig funnits mer än ett telefonsamtal bort.
Lämnar jag ett manuskript för synpunkter innan jag går hem på
eftermiddagen så ligger det på min stol följande morgon, med kommentarer.
Tack Sture, för ditt engagemang!
Örjan Norrgård, min bihandledare. Utan dig hade jag inte haft något
tarmmaterial att forska på. Tack också för att du har delat med dig av
värdefulla kunskaper om den kliniska delen.
Alla patienter som donerat tarm och blod till forskningen. Även de friska
kontrollpersoner som lät oss få lite blod. Tack också till Karin Forsgren för
hjälpen med blodtappningen.
Alla på avdelningen för Anatomi. Särskilt för alla trevliga fredagsfikastunder.
Ulla Hedlund, för att du alltid delar med dig av tips och tricks, protokoll, och
framförallt din erfarenhet, samt att du alltid funnits för uppmuntrande
peppning. Lena Jonsson, som fanns som hjälp under mitt första år på lab.
Sekreterarna Anna-Lena Tallander och Anita Dreyer-Perkiömäki för
administrativ hjälp. Anna-Lena, ingen kan göra lika innovativa
tipspromenader som du kan.
Tomas Carlsson, för att du gjorde ett skräddarsytt program åt mig så att jag
kunde räkna ytor och celler. Göran Dahlgren, för att du hjälpte mig de
gånger min Mac inte ville bete sig som en PC.
Magnus Hansson för medförfattarskap.
Mina kollegor som jag har delat rum med under dessa år. Ola, vi tyckte inte
alltid lika men vi har lärt oss mycket genom olikheterna. Gustav, att räkna
celler räknas tydligen inte som tics. Tack för fina illustrationer, även om alla
inte gick att publicera… Patrik, Dennis, Johan, Alex, Hanna, Berit, Elisabeth,
Solveig… jag har väl inte glömt någon nu?
49
Maria Jönsson, 2009
Malin Johansson, min kollega, rumskamrat, förlossningskamrat och
framförallt vän. Tack för alla skratt, särskilt på hotell Zara i Neapel.
Både forskande och icke-forskande vänner, som berikar livet.
Mamma och pappa, för att ni alltid trott på mig och alltid ställt upp, vad det
än är. Elin, min härliga syster.
Peter, min sambo, som alltid kan få mig att se saker ur en ny vinkel. För att
du förstår, och för att vi är vi.
Mina älskade barn, Hugo och Adam. Min inspiration. För att ni inte är
förstående inför forskningen, så att jag går hem i tid varje dag. Ni är bäst i
hela världen!
50
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
References
1.
Gartner L, Hiatt J. Color textbook of Histology. 1997:332-336
2.
Langley J. The autonomic nervous system. London: Heffner. 1921
3.
Trendelenburg
P.
Physiologishe
und
pharmakologische
Versuche
über
die
Dünndarmperistaltik. Arch exp Path Pharmak. 1917;81:55-129
4.
Altaf MA, Sood MR. The nervous system and gastrointestinal function. Dev Disabil Res
Rev. 2008;14:87-95
5.
Ben-Horin S, Chowers Y. Neuroimmunology of the gut: physiology, pathology, and
pharmacology. Curr Opin Pharmacol. 2008;8:490-495
6.
Furness JB, Costa M. Types of nerves in the enteric nervous system. Neuroscience.
1980;5:1-20
7.
Ekblad E, Winther C, Ekman R, et al. Projections of peptide-containing neurons in rat
small intestine. Neuroscience. 1987;20:169-188
8.
Furness JB. Types of neurons in the enteric nervous system. J Auton Nerv Syst.
2000;81:87-96
9.
Ekblad E, Bauer AJ. Role of vasoactive intestinal peptide and inflammatory mediators in
enteric neuronal plasticity. Neurogastroenterol Motil. 2004;16 Suppl 1:123-128
10.
Goyal RK, Hirano I. The enteric nervous system. N Engl J Med. 1996;334:1106-1115
11.
Furness JB, Kunze WA, Bertrand PP, et al. Intrinsic primary afferent neurons of the
intestine. Prog Neurobiol. 1998;54:1-18
12.
Holzer P. Role of visceral afferent neurons in mucosal inflammation and defense. Curr
Opin Pharmacol. 2007;7:563-569
13.
Burnstock G, Campbell G, Bennett M, et al. Innervation of the Guinea-Pig Taenia Coli:
Are There Intrinsic Inhibitory Nerves Which Are Distinct from Sympathetic Nerves? Int
J Neuropharmacol. 1964;3:163-166
14.
Eiden LE. The cholinergic gene locus. J Neurochem. 1998;70:2227-2240
15.
Wessler I, Kilbinger H, Bittinger F, et al. The non-neuronal cholinergic system in
humans: expression, function and pathophysiology. Life Sci. 2003;72:2055-2061
16.
Nickel WF, Jr., Gordon GM, Andrus WD. Studies on several cholinergic drugs as
possible etiologic agents in ulcerative colitis. Gastroenterology. 1953;24:556-559
17.
Czura CJ, Tracey KJ. Autonomic neural regulation of immunity. J Intern Med.
2005;257:156-166
18.
de Jonge WJ, van der Zanden EP, The FO, et al. Stimulation of the vagus nerve
attenuates macrophage activation by activating the Jak2-STAT3 signaling pathway. Nat
Immunol. 2005;6:844-851
19.
Tracey KJ. The inflammatory reflex. Nature. 2002;420:853-859
51
Maria Jönsson, 2009
20.
Wessler I, Reinheimer T, Kilbinger H, et al. Increased acetylcholine levels in skin
biopsies of patients with atopic dermatitis. Life Sci. 2003;72:2169-2172
21.
Kawashima K, Fujii T. Extraneuronal cholinergic system in lymphocytes. Pharmacol
Ther. 2000;86:29-48
22.
Kirkpatrick CJ, Bittinger F, Unger RE, et al. The non-neuronal cholinergic system in the
endothelium: evidence and possible pathobiological significance. Jpn J Pharmacol.
2001;85:24-28
23.
Wessler I, Kirkpatrick CJ, Racke K. Non-neuronal acetylcholine, a locally acting
molecule, widely distributed in biological systems: expression and function in humans.
Pharmacol Ther. 1998;77:59-79
24.
Kawashima K, Fujii T. The lymphocytic cholinergic system and its contribution to the
regulation of immune activity. Life Sci. 2003;74:675-696
25.
Ratcliffe EM, deSa DJ, Dixon MF, et al. Choline acetyltransferase (ChAT)
immunoreactivity in paraffin sections of normal and diseased intestines. J Histochem
Cytochem. 1998;46:1223-1231
26.
Klapproth H, Reinheimer T, Metzen J, et al. Non-neuronal acetylcholine, a signalling
molecule synthezised by surface cells of rat and man. Naunyn Schmiedebergs Arch
Pharmacol. 1997;355:515-523
27.
Eglen RM. Muscarinic receptor subtypes in neuronal and non-neuronal cholinergic
function. Auton Autacoid Pharmacol. 2006;26:219-233
28.
Mayerhofer A, Fritz S. Ovarian acetylcholine and muscarinic receptors: hints of a novel
intrinsic ovarian regulatory system. Microsc Res Tech. 2002;59:503-508
29.
Metzen J, Bittinger F, Kirkpatrick CJ, et al. Proliferative effect of acetylcholine on rat
trachea epithelial cells is mediated by nicotinic receptors and muscarinic receptors of the
M1-subtype. Life Sci. 2003;72:2075-2080
30.
Iino S, Nojyo Y. Muscarinic M(2) acetylcholine receptor distribution in the guinea-pig
gastrointestinal tract. Neuroscience. 2006;138:549-559
31.
Hokfelt T, Broberger C, Xu ZQ, et al. Neuropeptides--an overview. Neuropharmacology.
2000;39:1337-1356
32.
Ubink R, Calza L, Hokfelt T. 'Neuro'-peptides in glia: focus on NPY and galanin. Trends
Neurosci. 2003;26:604-609
33.
Watanabe M, Nakayasu K, Iwatsu M, et al. Endogenous substance P in corneal epithelial
cells and keratocytes. Jpn J Ophthalmol. 2002;46:616-620
34.
Petit T, Davidson KK, Lawrence RA, et al. Neuropeptide receptor status in human tumor
cell lines. Anticancer Drugs. 2001;12:133-136
35.
von Euler U, Gaddum J. An unidentified depressor substance in certain tissue extracts. J
Physiol (London). 1931;72:74-87
36.
52
Foreman JC. Peptides and neurogenic inflammation. Br Med Bull. 1987;43:386-400
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
37.
Gamse R, Posch M, Saria A, et al. Several mediators appear to interact in neurogenic
inflammation. Acta Physiol Hung. 1987;69:343-354
38.
Gross KJ, Pothoulakis C. Role of neuropeptides in inflammatory bowel disease. Inflamm
Bowel Dis. 2007;13:918-932
39.
Collins SM. The immunomodulation of enteric neuromuscular function: implications for
motility and inflammatory disorders. Gastroenterology. 1996;111:1683-1699
40.
Holzer P, Holzer-Petsche U. Tachykinins in the gut. Part II. Roles in neural excitation,
secretion and inflammation. Pharmacol Ther. 1997;73:219-263
41.
Riegler M, Castagliuolo I, So PT, et al. Effects of substance P on human colonic mucosa
in vitro. Am J Physiol. 1999;276:G1473-1483
42.
Bartho L, Holzer P. Search for a physiological role of substance P in gastrointestinal
motility. Neuroscience. 1985;16:1-32
43.
Goll R, Poulsen JH, Schmidt P, et al. Peptide-evoked release of amylase from isolated
acini of the rat parotid gland. Regul Pept. 1994;51:237-254
44.
Fan TP, Hu DE, Guard S, et al. Stimulation of angiogenesis by substance P and
interleukin-1 in the rat and its inhibition by NK1 or interleukin-1 receptor antagonists.
Br J Pharmacol. 1993;110:43-49
45.
Luger TA, Lotti T. Neuropeptides: role in inflammatory skin diseases. J Eur Acad
Dermatol Venereol. 1998;10:207-211
46.
Herrstedt J. New perspectives in antiemetic treatment. Support Care Cancer.
1996;4:416-419
47.
Brodin E, Sjolund K, Hakanson R, et al. Substance P-containing nerve fibers are
numerous in human but not in feline intestinal mucosa. Gastroenterology. 1983;85:557564
48.
Chiwakata C, Brackmann B, Hunt N, et al. Tachykinin (substance-P) gene expression in
Leydig cells of the human and mouse testis. Endocrinology. 1991;128:2441-2448
49.
Metwali A, Blum AM, Ferraris L, et al. Eosinophils within the healthy or inflamed
human
intestine
produce
substance
P
and
vasoactive
intestinal
peptide.
J
Neuroimmunol. 1994;52:69-78
50.
Pascual DW, Bost KL. Substance P production by P388D1 macrophages: a possible
autocrine function for this neuropeptide. Immunology. 1990;71:52-56
51.
Qian BF, Zhou GQ, Hammarstrom ML, et al. Both substance P and its receptor are
expressed in mouse intestinal T lymphocytes. Neuroendocrinology. 2001;73:358-368
52.
Nakanishi S. Mammalian tachykinin receptors. Annu Rev Neurosci. 1991;14:123-136
53.
Regoli D, Nantel F. Pharmacology of neurokinin receptors. Biopolymers. 1991;31:777783
54.
Hershey AD, Krause JE. Molecular characterization of a functional cDNA encoding the
rat substance P receptor. Science. 1990;247:958-962
53
Maria Jönsson, 2009
55.
O'Connor TM, O'Connell J, O'Brien DI, et al. The role of substance P in inflammatory
disease. J Cell Physiol. 2004;201:167-180
56.
Said SI, Mutt V. Polypeptide with broad biological activity: isolation from small
intestine. Science. 1970;169:1217-1218
57.
Lundberg JM, Anggard A, Fahrenkrug J, et al. Vasoactive intestinal polypeptide in
cholinergic neurons of exocrine glands: functional significance of coexisting transmitters
for vasodilation and secretion. Proc Natl Acad Sci U S A. 1980;77:1651-1655
58.
Domeij S, Dahlqvist A, Forsgren S. Studies on colocalization of neuropeptide Y,
vasoactive
intestinal
polypeptide,
catecholamine-synthesizing
enzymes
and
acetylcholinesterase in the larynx of the rat. Cell Tissue Res. 1991;263:495-505
59.
Kim WK, Kan Y, Ganea D, et al. Vasoactive intestinal peptide and pituitary adenylyl
cyclase-activating polypeptide inhibit tumor necrosis factor-alpha production in injured
spinal cord and in activated microglia via a cAMP-dependent pathway. J Neurosci.
2000;20:3622-3630
60.
Grider JR, Jin JG. Vasoactive intestinal peptide release and L-citrulline production from
isolated ganglia of the myenteric plexus: evidence for regulation of vasoactive intestinal
peptide release by nitric oxide. Neuroscience. 1993;54:521-526
61.
Polak JM, Bloom SR. The neuroendocrine design of the gut. Clin Endocrinol Metab.
1979;8:313-330
62.
Gressens P, Hill JM, Gozes I, et al. Growth factor function of vasoactive intestinal
peptide in whole cultured mouse embryos. Nature. 1993;362:155-158
63.
Gozes I, Brenneman DE. Neuropeptides as growth and differentiation factors in general
and VIP in particular. J Mol Neurosci. 1993;4:1-9
64.
Pozo D, Delgado M. The many faces of VIP in neuroimmunology: a cytokine rather a
neuropeptide? FASEB J. 2004;18:1325-1334
65.
Delgado M. VIP: a very important peptide in T helper differentiation. Trends Immunol.
2003;24:221-224
66.
Todorovic V, Janic B, Koko V, et al. Colonic vasoactive intestinal polypeptide (VIP) in
ulcerative
colitis--a
radioimmunoassay
and
immunohistochemical
study.
Hepatogastroenterology. 1996;43:483-488
67.
Harmar AJ, Arimura A, Gozes I, et al. International Union of Pharmacology. XVIII.
Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate
cyclase-activating polypeptide. Pharmacol Rev. 1998;50:265-270
68.
Laburthe M, Couvineau A, Tan V. Class II G protein-coupled receptors for VIP and
PACAP: structure, models of activation and pharmacology. Peptides. 2007;28:1631-1639
69.
Schulz S, Rocken C, Mawrin C, et al. Immunocytochemical identification of VPAC1,
VPAC2, and PAC1 receptors in normal and neoplastic human tissues with subtypespecific antibodies. Clin Cancer Res. 2004;10:8235-8242
54
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
70.
Willard AL. A vasoactive intestinal peptide-like cotransmitter at cholinergic synapses
between rat myenteric neurons in cell culture. J Neurosci. 1990;10:1025-1034
71.
Holzer P. Tachykinins as targets of gastroenterological pharmacotherapy. Drug News
Perspect. 1998;11:394-401
72.
Yamamoto H, Kuwahara A, Fujimura M, et al. Motor activity of vascularly perfused rat
duodenum. 2. Effects of VIP, PACAP27 and PACAP38. Neurogastroenterol Motil.
1999;11:235-241
73.
Harrington AM, Hutson JM, Southwell BR. Immunohistochemical localization of
substance P NK1 receptor in guinea pig distal colon. Neurogastroenterol Motil.
2005;17:727-737
74.
Harrington AM, Hutson JM, Southwell BR. Immunohistochemical localisation of presynaptic muscarinic receptor subtype-2 (M2r) in the enteric nervous system of guineapig ileum. Cell Tissue Res. 2008;332:37-48
75.
Juaneda C, Dumont Y, Quirion R. The molecular pharmacology of CGRP and related
peptide receptor subtypes. Trends Pharmacol Sci. 2000;21:432-438
76.
Gibbins IL, Furness JB, Costa M, et al. Co-localization of calcitonin gene-related
peptide-like immunoreactivity with substance P in cutaneous, vascular and visceral
sensory neurons of guinea pigs. Neurosci Lett. 1985;57:125-130
77.
Ekblad E, Håkanson R, Sundler F. Microanatomy and chemical coding of peptidecontaining neurons in the digestive tract. . In: Daniel E, ed. Neuropeptide function in the
gastrointestinal tract: CRC Press, Boca Raton, Florida; 1991:131-179
78.
Holzer P. Local effector functions of capsaicin-sensitive sensory nerve endings:
involvement of tachykinins, calcitonin gene-related peptide and other neuropeptides.
Neuroscience. 1988;24:739-768
79.
Holzer P, Bartho L, Matusak O, et al. Calcitonin gene-related peptide action on intestinal
circular muscle. Am J Physiol. 1989;256:G546-552
80.
Al-Haddad S, Riddell RH. The role of eosinophils in inflammatory bowel disease. Gut.
2005;54:1674-1675
81.
Wedemeyer J, Vosskuhl K. Role of gastrointestinal eosinophils in inflammatory bowel
disease and intestinal tumours. Best Pract Res Clin Gastroenterol. 2008;22:537-549
82.
Weller PF. The immunobiology of eosinophils. N Engl J Med. 1991;324:1110-1118
83.
Lampinen M, Ronnblom A, Amin K, et al. Eosinophil granulocytes are activated during
the remission phase of ulcerative colitis. Gut. 2005;54:1714-1720
84.
Raab Y, Fredens K, Gerdin B, et al. Eosinophil activation in ulcerative colitis: studies on
mucosal release and localization of eosinophil granule constituents. Dig Dis Sci.
1998;43:1061-1070
85.
Bischoff SC, Wedemeyer J, Herrmann A, et al. Quantitative assessment of intestinal
eosinophils and mast cells in inflammatory bowel disease. Histopathology. 1996;28:1-13
55
Maria Jönsson, 2009
86.
Lampinen M, Carlson M, Hakansson LD, et al. Cytokine-regulated accumulation of
eosinophils in inflammatory disease. Allergy. 2004;59:793-805
87.
Wiedermann FJ, Kahler CM, Reinisch N, et al. Induction of normal human eosinophil
migration in vitro by substance P. Acta Haematol. 1993;89:213-215
88.
Numao T, Agrawal DK. Neuropeptides modulate human eosinophil chemotaxis. J
Immunol. 1992;149:3309-3315
89.
Dunzendorfer S, Meierhofer C, Wiedermann CJ. Signaling in neuropeptide-induced
migration of human eosinophils. J Leukoc Biol. 1998;64:828-834
90.
Kroegel C, Giembycz MA, Barnes PJ. Characterization of eosinophil cell activation by
peptides. Differential effects of substance P, melittin, and FMET-Leu-Phe. J Immunol.
1990;145:2581-2587
91.
Crohn B, L G, GD O. Regional ileitis. A pathological and clinical entity. JAMA.
1932;99:1323-1329
92.
Odze R. Diagnostic problems and advances in inflammatory bowel disease. Mod Pathol.
2003;16:347-358
93.
Russell RK, Satsangi J. IBD: a family affair. Best Pract Res Clin Gastroenterol.
2004;18:525-539
94.
Roth MP, Petersen GM, McElree C, et al. Geographic origins of Jewish patients with
inflammatory bowel disease. Gastroenterology. 1989;97:900-904
95.
Ehlin AG, Montgomery SM, Ekbom A, et al. Prevalence of gastrointestinal diseases in
two British national birth cohorts. Gut. 2003;52:1117-1121
96.
Bernstein CN, Blanchard JF, Rawsthorne P, et al. Epidemiology of Crohn's disease and
ulcerative colitis in a central Canadian province: a population-based study. Am J
Epidemiol. 1999;149:916-924
97.
Molinie F, Gower-Rousseau C, Yzet T, et al. Opposite evolution in incidence of Crohn's
disease and ulcerative colitis in Northern France (1988-1999). Gut. 2004;53:843-848
98.
Heyman MB, Kirschner BS, Gold BD, et al. Children with early-onset inflammatory
bowel disease (IBD): analysis of a pediatric IBD consortium registry. J Pediatr.
2005;146:35-40
99.
Li J, Norgard B, Precht DH, et al. Psychological stress and inflammatory bowel disease:
a follow-up study in parents who lost a child in Denmark. Am J Gastroenterol.
2004;99:1129-1133
100.
Hollander D. Inflammatory bowel diseases and brain-gut axis. J Physiol Pharmacol.
2003;54 Suppl 4:183-190
101.
Bohr UR, Glasbrenner B, Primus A, et al. Identification of enterohepatic Helicobacter
species in patients suffering from inflammatory bowel disease. J Clin Microbiol.
2004;42:2766-2768
56
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
102.
Klement E, Cohen RV, Boxman J, et al. Breastfeeding and risk of inflammatory bowel
disease: a systematic review with meta-analysis. Am J Clin Nutr. 2004;80:1342-1352
103.
Calkins BM. A meta-analysis of the role of smoking in inflammatory bowel disease. Dig
Dis Sci. 1989;34:1841-1854
104.
Andersson RE, Olaison G, Tysk C, et al. Appendectomy and protection against ulcerative
colitis. N Engl J Med. 2001;344:808-814
105.
Solberg C, Lygren I, Jahnsen J, et al. Clinical course during the first 10 years of
ulcerative colitis: results from a population-based inception cohort (IBSEN Study).
Scand J Gastroenterol. 2008;19:1-10
106.
Lindberg J. Ulcerative colitis. Colorectal cancer risk and surveillance in an unselected
population. . Umeå University Medical Dissertations. 2007
107.
Bernstein CN, Blanchard JF, Kliewer E, et al. Cancer risk in patients with inflammatory
bowel disease: a population-based study. Cancer. 2001;91:854-862
108.
Le Berre N, Heresbach D, Kerbaol M, et al. Histological discrimination of idiopathic
inflammatory bowel disease from other types of colitis. J Clin Pathol. 1995;48:749-753
109.
Kimura M, Masuda T, Hiwatashi N, et al. Changes in neuropeptide-containing nerves in
human colonic mucosa with inflammatory bowel disease. Pathol Int. 1994;44:624-634
110.
Renzi D, Mantellini P, Calabro A, et al. Substance P and vasoactive intestinal
polypeptide but not calcitonin gene-related peptide concentrations are reduced in
patients with moderate and severe ulcerative colitis. Ital J Gastroenterol Hepatol.
1998;30:62-70
111.
Keranen U, Kiviluoto T, Jarvinen H, et al. Changes in substance P-immunoreactive
innervation of human colon associated with ulcerative colitis. Dig Dis Sci. 1995;40:22502258
112.
Mazumdar S, Das KM. Immunocytochemical localization of vasoactive intestinal peptide
and substance P in the colon from normal subjects and patients with inflammatory
bowel disease. Am J Gastroenterol. 1992;87:176-181
113.
Lee CM, Kumar RK, Lubowski DZ, et al. Neuropeptides and nerve growth in
inflammatory bowel diseases: a quantitative immunohistochemical study. Dig Dis Sci.
2002;47:495-502
114.
Rudholm T, Wallin B, Theodorsson E, et al. Release of regulatory gut peptides
somatostatin, neurotensin and vasoactive intestinal peptide by acid and hyperosmolal
solutions in the intestine in conscious rats. Regul Pept. 2009;152:8-12
115.
Reinecke M, Muller C, Segner H. An immunohistochemical analysis of the ontogeny,
distribution and coexistence of 12 regulatory peptides and serotonin in endocrine cells
and nerve fibers of the digestive tract of the turbot, Scophthalmus maximus (Teleostei).
Anat Embryol (Berl). 1997;195:87-101
116.
Maake C, Kloas W, Szendefi M, et al. Neurohormonal peptides, serotonin, and nitric
oxide synthase in the enteric nervous system and endocrine cells of the gastrointestinal
57
Maria Jönsson, 2009
tract of neotenic and thyroid hormone-treated axolotls (Ambystoma mexicanum). Cell
Tissue Res. 1999;297:91-101
117.
Holmgren S, Vaillant C, Dimaline R. VIP-, substance P-, gastrin/CCK-, bombesin-,
somatostatin- and glucagon-like immunoreactivities in the gut of the rainbow trout,
Salmo gairdneri. Cell Tissue Res. 1982;223:141-153
118.
Lolova IS, Davidoff MS, Itzev DE. Histological and immunocytochemical data on the
differentiation of intestinal endocrine cells in human fetus. Acta Physiol Pharmacol
Bulg. 1998;23:61-71
119.
Chalastras T, Nicolopoulou-Stamati P, Patsouris E, et al. Expression of substance P,
vasoactive intestinal peptide and heat shock protein 70 in nasal mucosal smears of
patients with allergic rhinitis: investigation using a liquid-based method. J Laryngol
Otol. 2008;122:700-706
120.
Duffy LC, Zielezny MA, Riepenhoff-Talty M, et al. Vasoactive intestinal peptide as a
laboratory supplement to clinical activity index in inflammatory bowel disease. Dig Dis
Sci. 1989;34:1528-1535
121.
Goode T, O'Connell J, Anton P, et al. Neurokinin-1 receptor expression in inflammatory
bowel disease: molecular quantitation and localisation. Gut. 2000;47:387-396
122.
Renzi D, Pellegrini B, Tonelli F, et al. Substance P (neurokinin-1) and neurokinin A
(neurokinin-2) receptor gene and protein expression in the healthy and inflamed human
intestine. Am J Pathol. 2000;157:1511-1522
123.
Jacobi J, Jang JJ, Sundram U, et al. Nicotine accelerates angiogenesis and wound
healing in genetically diabetic mice. Am J Pathol. 2002;161:97-104
124.
Hansson M, Forsgren S. Immunoreactive atrial and brain natriuretic peptides are colocalized in Purkinje fibres but not in the innervation of the bovine heart conduction
system. Histochem J. 1995;27:222-230
125.
Panoskaltsis-Mortari A, Bucy RP. In situ hybridization with digoxigenin-labeled RNA
probes: facts and artifacts. Biotechniques. 1995;18:300-307
126.
Reubi JC, Waser B, Schmassmann A, et al. Receptor autoradiographic evaluation of
cholecystokinin, neurotensin, somatostatin and vasoactive intestinal peptide receptors
in gastro-intestinal adenocarcinoma samples: where are they really located? Int J
Cancer. 1999;81:376-386
127.
Grubor B, Ramirez-Romero R, Gallup JM, et al. Distribution of substance P receptor
(neurokinin-1 receptor) in normal ovine lung and during the progression of
bronchopneumonia in sheep. J Histochem Cytochem. 2004;52:123-130
128.
Kido MA, Yamaza T, Goto T, et al. Immunocytochemical localization of substance P
neurokinin-1 receptors in rat gingival tissue. Cell Tissue Res. 1999;297:213-222
129.
Bandari PS, Qian J, Yehia G, et al. Differences in the expression of neurokinin receptor
in neural and bone marrow mesenchymal cells: implications for neuronal expansion
from bone marrow cells. Neuropeptides. 2002;36:13-21
58
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
130.
Baker SJ, Morris JL, Gibbins IL. Cloning of a C-terminally truncated NK-1 receptor from
guinea-pig nervous system. Brain Res Mol Brain Res. 2003;111:136-147
131.
Yip L, Kwok YN, Buchan AM. Cellular localization and distribution of neurokinin-1
receptors in the rat stomach. Auton Neurosci. 2003;104:95-108
132.
Kurtz MM, Wang R, Clements MK, et al. Identification, localization and receptor
characterization of novel mammalian substance P-like peptides. Gene. 2002;296:205212
133.
Page NM, Bell NJ, Gardiner SM, et al. Characterization of the endokinins: human
tachykinins with cardiovascular activity. Proc Natl Acad Sci U S A. 2003;100:6245-6250
134.
Forsgren S, Hockerfelt U, Norrgard O, et al. Pronounced substance P innervation in
irradiation-induced enteropathy--a study on human colon. Regul Pept. 2000;88:1-13
135.
Keranen U, Jarvinen H, Karkkainen P, et al. Substance P--an underlying factor for
pouchitis? Prospective study of substance P- and vasoactive intestinal polypeptideimmunoreactive innervation and mast cells. Dig Dis Sci. 1996;41:1665-1671
136.
Lai JP, Douglas SD, Ho WZ. Mimic-based RT-PCR quantitation of substance P mRNA in
human mononuclear phagocytes and lymphocytes. Methods Mol Biol. 2002;193:129-147
137.
Alberts B, Bray D, Lewis J, et al. In: al. BAe, ed. Molecular biology of the cell: Garland
Publishing; 1994:403
138.
Ho WZ, Lai JP, Zhu XH, et al. Human monocytes and macrophages express substance P
and neurokinin-1 receptor. J Immunol. 1997;159:5654-5660
139.
Pothoulakis C, Castagliuolo I, Leeman SE, et al. Substance P receptor expression in
intestinal epithelium in clostridium difficile toxin A enteritis in rats. Am J Physiol.
1998;275:G68-75
140.
Baluk P, Bertrand C, Geppetti P, et al. NK1 receptors mediate leukocyte adhesion in
neurogenic inflammation in the rat trachea. Am J Physiol. 1995;268:L263-269
141.
Teramoto S, Tanaka H, Kaneko S, et al. Neurokinin-1 and neurokinin-2 antagonism
inhibits long-term acid fog-induced airway hyperresponsiveness. Chest. 2003;123:524529
142.
Cao T, Pinter E, Al-Rashed S, et al. Neurokinin-1 receptor agonists are involved in
mediating neutrophil accumulation in the inflamed, but not normal, cutaneous
microvasculature: an in vivo study using neurokinin-1 receptor knockout mice. J
Immunol. 2000;164:5424-5429
143.
Hockerfelt U, Henriksson R, Franzen L, et al. Irradiation induces marked
immunohistochemical expression of vasoactive intestinal peptide in colonic mucosa of
man. Dig Dis Sci. 1999;44:393-401
144.
Belai A, Boulos PB, Robson T, et al. Neurochemical coding in the small intestine of
patients with Crohn's disease. Gut. 1997;40:767-774
145.
Simopoulos C, Gaffen JD, Bennett A. Effects of gastrointestinal hormones on the growth
of human intestinal epithelial cells in vitro. Gut. 1989;30:600-604
59
Maria Jönsson, 2009
146.
Toumi F, Neunlist M, Denis MG, et al. Vasoactive intestinal peptide induces IL-8
production in human colonic epithelial cells via MAP kinase-dependent and PKAindependent pathways. Biochem Biophys Res Commun. 2004;317:187-191
147.
Goral V, Celenk T, Kaplan A, et al. Plasma cytokine levels in ulcerative colitis.
Hepatogastroenterology. 2007;54:1130-1133
148.
Vermeire S, Van Assche G, Rutgeerts P. C-reactive protein as a marker for inflammatory
bowel disease. Inflamm Bowel Dis. 2004;10:661-665
149.
Fagan EA, Dyck RF, Maton PN, et al. Serum levels of C-reactive protein in Crohn's
disease and ulcerative colitis. Eur J Clin Invest. 1982;12:351-359
150.
Duerr RH, Targan SR, Landers CJ, et al. Anti-neutrophil cytoplasmic antibodies in
ulcerative colitis. Comparison with other colitides/diarrheal illnesses. Gastroenterology.
1991;100:1590-1596
151.
Roseth AG, Aadland E, Jahnsen J, et al. Assessment of disease activity in ulcerative
colitis by faecal calprotectin, a novel granulocyte marker protein. Digestion.
1997;58:176-180
152.
Schneider J, Jehle EC, Starlinger MJ, et al. Neurotransmitter coding of enteric neurones
in the submucous plexus is changed in non-inflamed rectum of patients with Crohn's
disease. Neurogastroenterol Motil. 2001;13:255-264
153.
Porter AJ, Wattchow DA, Brookes SJ, et al. The neurochemical coding and projections of
circular muscle motor neurons in the human colon. Gastroenterology. 1997;113:19161923
154.
Neunlist M, Aubert P, Toquet C, et al. Changes in chemical coding of myenteric
neurones in ulcerative colitis. Gut. 2003;52:84-90
155.
Fujii T, Takada-Takatori Y, Kawashima K. Basic and clinical aspects of non-neuronal
acetylcholine: expression of an independent, non-neuronal cholinergic system in
lymphocytes and its clinical significance in immunotherapy. J Pharmacol Sci.
2008;106:186-192
156.
Borovikova LV, Ivanova S, Zhang M, et al. Vagus nerve stimulation attenuates the
systemic inflammatory response to endotoxin. Nature. 2000;405:458-462
157.
Abad C, Martinez C, Juarranz MG, et al. Therapeutic effects of vasoactive intestinal
peptide in the trinitrobenzene sulfonic acid mice model of Crohn's disease.
Gastroenterology. 2003;124:961-971
158.
Gonzalez-Rey E, Delgado M. Therapeutic treatment of experimental colitis with
regulatory dendritic cells generated with vasoactive intestinal peptide. Gastroenterology.
2006;131:1799-1811
159.
Rijnierse A, van Zijl KM, Koster AS, et al. Beneficial effect of tachykinin NK1 receptor
antagonism in the development of hapten-induced colitis in mice. Eur J Pharmacol.
2006;548:150-157
60
Neuronal and non-neuronal SP, VIP and cholinergic systems in the colon
160.
Di Sebastiano P, Grossi L, Di Mola FF, et al. SR140333, a substance P receptor
antagonist, influences morphological and motor changes in rat experimental colitis. Dig
Dis Sci. 1999;44:439-444
161.
Pothoulakis C, Castagliuolo I, LaMont JT, et al. CP-96,345, a substance P antagonist,
inhibits rat intestinal responses to Clostridium difficile toxin A but not cholera toxin.
Proc Natl Acad Sci U S A. 1994;91:947-951
162.
Gonzalez-Rey E, Fernandez-Martin A, Chorny A, et al. Therapeutic effect of vasoactive
intestinal peptide on experimental autoimmune encephalomyelitis: down-regulation of
inflammatory and autoimmune responses. Am J Pathol. 2006;168:1179-1188
163.
Newman R, Cuan N, Hampartzoumian T, et al. Vasoactive intestinal peptide impairs
leucocyte migration but fails to modify experimental murine colitis. Clin Exp Immunol.
2005;139:411-420
164.
Gomariz RP, Juarranz Y, Abad C, et al. VIP-PACAP system in immunity: new insights
for multitarget therapy. Ann N Y Acad Sci. 2006;1070:51-74
165.
Keeble JE, Brain SD. A role for substance P in arthritis? Neurosci Lett. 2004;361:176179
166.
Sands BE. Why do anti-tumor necrosis factor antibodies work in Crohn's disease? Rev
Gastroenterol Disord. 2004;4 Suppl 3:S10-17
167.
Rutgeerts P, Sandborn WJ, Feagan BG, et al. Infliximab for induction and maintenance
therapy for ulcerative colitis. N Engl J Med. 2005;353:2462-2476
168.
Kohn A, Prantera C, Pera A, et al. Infliximab in the treatment of severe ulcerative colitis:
a follow-up study. Eur Rev Med Pharmacol Sci. 2004;8:235-237
169.
Jarnerot G, Hertervig E, Friis-Liby I, et al. Infliximab as rescue therapy in severe to
moderately
severe
ulcerative
colitis:
a
randomized,
placebo-controlled
study.
Gastroenterology. 2005;128:1805-1811
170.
Gahring LC, Rogers SW. Neuronal nicotinic acetylcholine receptor expression and
function on nonneuronal cells. AAPS J. 2005;7:E885-894
171.
Thomas GA, Rhodes J, Mani V, et al. Transdermal nicotine as maintenance therapy for
ulcerative colitis. N Engl J Med. 1995;332:988-992
172.
Maresca A, Supuran CT. Muscarinic acetylcholine receptors as therapeutic targets for
obesity. Expert Opin Ther Targets. 2008;12:1167-1175
173.
Fisher A. Cholinergic treatments with emphasis on m1 muscarinic agonists as potential
disease-modifying agents for Alzheimer's disease. Neurotherapeutics. 2008;5:433-442
174.
Scarr E, Dean B. Muscarinic receptors: do they have a role in the pathology and
treatment of schizophrenia? J Neurochem. 2008;107:1188-1195
175.
Hegde SS. Muscarinic receptors in the bladder: from basic research to therapeutics. Br J
Pharmacol. 2006;147 Suppl 2:S80-87
61
Maria Jönsson, 2009
176.
Paleari L, Grozio A, Cesario A, et al. The cholinergic system and cancer. Semin Cancer
Biol. 2008;18:211-217
177.
Hirota CL, McKay DM. M3 muscarinic receptor-deficient mice retain bethanecholmediated intestinal ion transport and are more sensitive to colitis. Can J Physiol
Pharmacol. 2006;84:1153-1161
62