Xu_Supplementary Methods (Nature #2005-07-07913C) in MS Word (PC format)
Supplementary methods
<meth1ttl> Methods
<meth1hd> Genetics and molecular biology
trp-4 deletion mutants were isolated by TMP/UV-based mutagenesis
screens and were backcrossed 7 times to N2 prior to behavioral analysis 1.
Primers used in deletion screens are: ttcctcctgaaacagaagcatgacac (forward) and
tggttcgcccgtctgtaagctc (reverse). A third primer (ctaccagcctgtcgacgaggac)
residing within the deleted segments was used in conjunction with the reverse
primer to confirm the absence of the wild-type copy of trp-4 gene in trp-4
homozygous mutants. The 5’ and 3’ end of trp-4 coding regions shown in figure 1
were determined by RACE.
To make trp-4::yfp for microinjection, a 19 kb genomic fragment
encompassing the promoter (extends to the stop codon of the upstream gene)
and coding regions of trp-4 was fused in frame to YFP by PCR, and the resulting
PCR product was directly injected into trp-4 mutant animals. Pdat-1::trp-4 (the
transgene driving expression specifically in the dopamine neurons) and Ptwk16(DVA)::trp-4 (the transgene driving expression specifically in DVA) were
generated with a similar strategy; the first exon and intron of the trp-4 gene were
not included in both transgenes to avoid possible enhancer elements. dat-1
encodes a dopamine transporter and is specifically expressed in the dopamine
neurons 3. Ptwk-16(DVA)::trp-4 utilizes the DVA-specific enhancer element in
the first intron of twk-16 to drive expression of trp-4 in DVA4. To make Ptwk16(DVA)::GCaMP and Ptwk-16(DVA)::DsRed2, the coding region of GCaMP and
DsRed2 (Clontech) was PCRed from its original plasmid and inserted behind the
twk-16(DVA) promoter, respectively. The same G-CaMP transgene was utilized
1
Xu_Supplementary Methods (Nature #2005-07-07913C) in MS Word (PC format)
for all calcium imaging studies by crossing it into different genetic backgrounds.
Laser ablations were performed on L1 or L2 animals as previously described 2.
The P values in figure 3 and figure 1 were determined by ANOVA with
Dunnett test by comparing DVA and/or DVC ablated animals and mock ablated
animals (for figure 3), and by comparing trp-4(sy695) or trp-4(sy696) and wildtype (for figure 1). The P values in figure 2 were determined with Student’s t-test
by comparing animals moving on bacteria and those on agar.
<meth1hd> Calcium imaging
Calcium imaging was performed on a Zeiss Axiovert 200 microscope
under a 40x objective. Images were acquired with a Roper CoolSnap CCD
camera and processed by Ratiotool software (ISeeimaging). G-CaMP and
DsRed2 (Clontech) fluorescence was excited at 484 nm and 535 nm,
respectively. The fluorescence intensity of DsRed2 slowly decreases because of
its relatively fast bleach compared to G-CaMP. The tail of individual animals was
glued on an agarose pad with Nexaband cyanoacrylate glue (Fisher). Upon
application of solution to the pad (14 mM Hepes [pH 7.4], 4 mM KCl, 145 mM
NaCl, 1.2 mM MgCl2, 2.5 mM CaC12, and 10 mM glucose), animals then began
to bend their body in the liquid, stimulating a robust increase in calcium level in
DVA. To manually bend worm’s body, a glass pipette mounted on a
micromanipulator was used to hold worm’s nose tip. To estimate bending
angles, the experiment was then repeated under a 10x objective to allow for
visualization of the entire animal, which is not possible under a 40x objective;
thus, the estimation was indirect. Other protocols such as gentle touch of the
body and nose did not elicit significant calcium response in DVA (n=5). To do so,
2
Xu_Supplementary Methods (Nature #2005-07-07913C) in MS Word (PC format)
we glued the worm laterally on an agarose pad as previously described 5. A
glass probe with a rounded tip was mounted on a micromanipulator, and the
touch stimuli were delivered by moving the probe against the nose, the anterior
or posterior part of the worm body to cause a deflection of <10 M.
References
1.
2.
3.
4.
5.
Jansen, G., Hazendonk, E., Thijssen, K. L. & Plasterk, R. H. Reverse genetics by
chemical mutagenesis in Caenorhabditis elegans. Nat Genet 17, 119-21 (1997).
Bargmann, C. I. & Avery, L. Laser killing of cells in Caenorhabditis elegans.
Methods Cell Biol 48, 225-50 (1995).
Nass, R., Hall, D. H., Miller, D. M., 3rd & Blakely, R. D. Neurotoxin-induced
degeneration of dopamine neurons in Caenorhabditis elegans. Proc Natl Acad Sci
U S A 99, 3264-9 (2002).
Salkoff, L. et al. Evolution tunes the excitability of individual neurons.
Neuroscience 103, 853-9 (2001).
O'Hagan, R., Chalfie, M. & Goodman, M. B. The MEC-4 DEG/ENaC channel of
Caenorhabditis elegans touch receptor neurons transduces mechanical signals. Nat
Neurosci 8, 43-50 (2005).
3