Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal models and cellular assays vital for testing vaccine efficacy.
2, 3, 4, 5, 7 , 8
9
11, 12/ 13
UNM/ LBERI
, 14, 17, 19,
21
UNM/ LBERI
, 26, 27, 28, 35
( ASU/ UNM)
, 49, 50, 52, 55, 56, 57
1, 25, 32, 33, 34
( UNM /ASU)
, 16, 39, 40, 43
(UTSA)
, 48, 51
41, 42, 44, 46,
(MSCR will be written)
43
(Cerus)
, 45, 47
(MSCR will not be written)
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM / LRRI
1. Date started: 11/01/2005
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions a. UNM EOH has performed 6 annual health screenings since 8/26/08 for the LVS vaccinees originally vaccinated on September 11, 2007. b. One UNM and possibly 2-3 LBERI scientists will request vaccinations in the
January 2009.
4. Significant decisions made or pending a. Dr. Lyons received UNM IRB approval to allow blood draws on the vaccinated
LBERI and UNM scientists after their LVS vaccinations. The LVS vaccinated
LBERI and UNM scientists and staff have been offered the opportunity to volunteer to donate bloods for the development of immunoassays, approximately
2 months after receiving the LVS vaccination.
b. USAMRIID temporarily halted offering the LVS vaccine as of 4/29/08, but is reopening LVS vaccinations on October 7, 2008.
c. UNM (4) and LBERI (33) are vaccinated; UNM and LBERI could offer the LVS vaccinations up to 9 more scientists to total up to 46. The CRDA with USAMRIID is valid for 2 years, ending June 2009.
5. Problems or concerns and strategies to address a. One UNM and one LBERI scientist are medically pending. One UNM scientist may be rescheduled for LVS vaccination. USAMRIID is now offering the LVS
1 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam vaccinations as of October 7, 2008 but the UNM scientists will be attending the
UNM TVDC annual meeting on that date. USAMRIID will offer UNM and LBERI a date in January 2009.
6. Deliverables completed
A total of 37 participants (33 LBERI and 4 UNM participants) have received the LVS vaccination since 9/11/07.
7. Quality of performance
Excellent
8. Percentage completed
69% of the scientific work is complete
9. Work plan for the next month a. Continue annual health screenings required by USAMRIID and being performed at UNM for the LBERI and UNM LVS vaccinees. b. UNM will be obtaining blood donations from LVS vaccinees for immunoassay development and reimbursing participants $40/ donation. c. UNM will work with 1 UNM and 2-3 LBERI scientists for the pre-vaccination health screenings required for vaccinations in January 2009.
10. Anticipated travel
Will be attending the UNM TVDC annual meeting in Phoenix AZ in October 2008.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: 9/2/2008
3. Work performed and progress including data and preliminary conclusions a. Completed a draft of the Milestone Completion Report and provided to UNM on
9/2/2008
4. Significant decisions made or pending a. A decision was made to use the Collison 3- jet nebulizer for future F. tularensis bioaerosol generation due to the ease of a technical transfer and the abundance of historical support data that is available. The data collected to date by LBERI shows that it is slightly less efficient than the Aeromist and Hospitak but is overall more consistent.
5. Problems or concerns and strategies to address a. None
6. Deliverables completed
The draft Milestone Completion report was written and submitted to UNM on 9/2/2008
7. Quality of performance
Good
8. Percentage completed
100% of the scientific work is complete
9. Work plan for next month a. Finalize the Milestone Completion Report upon receipt of comments and changes from UNM. b. Continue to update the following draft SOPs for finalization:
2 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Bioaerosol preparation
Nebulizer operation
Schu S4 stock preparation
Critical reagent preparation
10. Anticipated travel
Travel to Phoenix for the UNM TVDC annual meeting in October 2008.
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone description: Confirmation of aerosol
in NHP
Institution: LBERI
1.
2.
Date started: 11/1/06
Date completed: In progress
3. Work performed and progress including data and preliminary conclusions: a. Started writing the Milestone Completion report. Completion of the draft report is dependent on the completion of the pathology report.
4. Significant decisions made or pending
The mouse LVS and Schu S4 study data will be included in the Milestone Completion report.
5. Problems or concerns and strategies to address
None.
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
90% of the scientific work is complete
9. Work plan for next month a. Continue working on the Milestone Completion Report. b. Histology and pathology reports are pending
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone description: Small species tested for sensitivity to LVS & generation of immunity against a pulmonary challenge of SCHU S4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions a. Experiment Ftc73 (Notebook 104, pages 186-187)
3 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam i. The results from several passive immunization experiments suggested that Fischer 344 rats from Harlan Sprague Dawley may be more sensitive than Fischer 344 rats from NCI to i.t. SCHU S4 challenge; specifically, Harlan rats died earlier and more consistently
(i.e. no occasional survivor) than NCI rats after SCHU S4 challenge.
However, we have not compared the sensitivity of the two rats within a single experiment ii. In this experiment, n aïve Fischer 344 rats from Harlan Sprague
Dawley and NCI were challenged i.t. with approximately 5 x 10 1 to 5 x 10 5 SCHU S4 and monitored daily for survival iii. As shown in Fig. 1, there was no significant difference in the survival curves from NCI and Harlan rats (P = 0.58).
Figure 1. Fischer 344 rats from NCI and Harlan are similarly sensitive to i.t.
SCHU S4 challenge. Groups of 6 Fischer 344 rats from NCI (left) and Harlan
(right) were challenged i.t. with the indicated doses of SCHU S4. Survival was monitored daily. b. Experiment Ftc72 (Notebook 104, pages 154-156, 183-185) i. We noticed in several experiments that LVS vaccination extended survival but did not protect BALB/c mice against i.n. SCHU S4 challenge. We observed similar results in our tularemia program project experiments, in which BALB/c mice were vaccinated with
LVS cultured in Mueller Hinton broth instead of Chamberlain’s broth and then challenged with NMFTA1 (a biovar A strain) instead of
SCHU S4. We were extremely concerned because these results suggested that our LVS stocks may have deteriorated and that we will not be able to vaccinate mice or rats to continue our experiments. ii. To address this problem, we first vaccinated mice with higher doses of the existing LVS stock (stock 3), but that did not improve survival iii. We next prepared a new LVS stock (stock 7) from by expanding the
LVS lot 16 in Chamberlain’s broth culture and vaccinated BALB/c mice i.n. with 500 and 5000 LVS. Six weeks later, the vaccinated mice were challenged i.n. with 20 and 200 SCHU S4. iv. As show in Table 1, vaccination with 500 LVS stock 7 did not protect mice against i.n. challenge of 20 or 200 SCHU S4. However,
4 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam vaccination with 5,000 LVS stock 7 completely protected mice against i.n. challenge of 20 SCHU S4 and provided partial protection against 200 SCHU S4. Compared with historical data, protection required a higher LVS vaccination dose and a lower SCHU S4 challenge dose. v. Since it is possible that the reduced protection was due to a shift in the ratio of blue colonies to grey colonies (blue colonies being more vi. It is worth noting that during this period of time, LVS stock 3 vaccinated rats remained highly resistant to i.t. SCHU S4 challenge immunogenic and protective), we would like to compare the blue/grey ratio in the various LVS stocks we have on hand
Table 1. Survival ratio of LVS vaccinated mice challenged with SCHU S4
SCHU S4 challenge dose (cfu/ms)
20
200
LVS vaccination dose (cfu/ms)
None
0/5
0/5
500
0/5
0/5
5,000
5/5
3/5 c. We are finalizing a manuscript describing the Fischer 344 rat model. When we compared the histopathology of naïve BALB/c mice and Fischer 344 rats infected with SCHU S4, Dr. Julie Hutt, our veterinary pathologist, made the following interesting observation. i. “ The lesions associated with F. tularensis in the unvaccinated rats in this study consist of progressively worsening, pyogranulomatous to necrotizing bronchopneumonia with early bacteremic dissemination to the liver and spleen, similar to what has been observed in nonhuman primates and humans. After respiratory exposure to F. tularensis , the vaccinated rats also develop pyogranulomatous bronchopneumonia with dissemination to the liver and spleen; however, the lung lesions are much less extensive and resolve rapidly, and the lesions in the liver and spleen are mild and sporadic in occurrence. Comparison of the lung lesions in rats and mice exposed to F. tularensis by the respiratory route shows that rats develop lung lesions centered on airways (bronchopneumonia), whereas mice develop lung lesions centered on and around large blood vessels adjacent to bronchi (vasculitis and perivasculitis), with only minimal inflammation centered on alveoli or at the bronchoalveolar junction. The vascular orientation of lung lesions in mice has been demonstrated after aerosol (Conlon paper), intranasal
(Wu paper) and intratracheal (data not shown) exposures. Thus, these differences are not a just a manifestation of the route of exposure, suggesting that rats more be more suitable as a model for the pneumonic form of tularemia with secondary septicemia, while mice may be more suitable as a model for the primary septicemic form of tularemia, even after respiratory exposures. The pathogenic mechanisms for these differences warrant further investigation.
5 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam d. UNM trained Ping Chu and Heather Ray from UTSA on handling Fischer 344 rats and non-surgical intratracheal infection e. Characterization of the Fischer 344 rat model is currently being done under
Milestone 17 since we are focusing on the role of cellular and humoral immunity in vaccinated rats.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed a. Mouse model completed b. Guinea pig model completed c. Rat model completed
7. Quality of performance
NA
8. Percentage completed
82%
9. Work plan for upcoming month a. We showed in Experiment Ftc46 study 6 (Notebook 116, pages 12-17) and
Experiment Ftc46 study 7 (Notebook 116, pages 18-21) that quantum dots and the coelentrazine substrate had little impact the virulence of LVS in mice.
We will determine whether they have any effect on the virulence of SCHU S4 in rats b. Compare the blue/grey ratio in the various LVS stocks we have on hand c. Work on milestone completion reports for the mouse, rat, and guinea pigs d. Continue consultation with GCRC (General Clinical Research Center) biostatistician at UNM
10. Anticipated travel
Will be attending the TVDC annual meeting in Phoenix Arizona
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: SCHU S4 ED50 in primates determined from selection of challenge dosing
Institution: LBERI
1. Date started: 2/25/08
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions: a. The IACUC protocol was approved. b. The study protocol was written and submitted to UNM for review and approval.
4. Significant decisions made or pending
None.
5. Problems or concerns and strategies to address
Additional technical personnel will be trained on determining respiratory rates in NHP and signed off on proficiency prior to the ED50 study.
6 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
6. Deliverables completed
None.
7. Quality of performance
Good.
8. Percentage completed
15% of the scientific work is complete.
9. Work plan for next month a. Complete the study protocol and obtain UNM approval and signature. b. Perform respiratory rate training, Phase IV training, and forms training before study initiation. c. Continue planning efforts for study initiation. The current study start dates are as follows:
Round 1: 23-24Sep08 Aerosol Exposure
28-29Oct08 Term Sacs
Round 2: 14Oct08 Aerosol Exposure
18Nov08 Term Sacs
Round 3: 4Nov08 Aerosol Exposure
9Dec08 Term Sacs
10. Anticipated travel
Travel to Phoenix for the UNM TVDC annual meeting in October 2008.
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated.
Milestone description: LVS vaccination protection of aerosol Schu4 validated in primates
Institution: LBERI
1. Date started: 8/15/2008
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions
No lab work performed this month
4. Significant decisions made or pending a. As we are nearing the time in which the previously LVS vaccinated NHP will be challenged by SCHU S4 (after the LD
50
is established) the decision was made to transfer the 4 remaining LVS vaccinated NHP (2 s.c., 2 i.d. route) from Milestone
4 to Milestone 8. These 4 NHP were vaccinated in the Fall of 2006. b. As the USAMMDA protocol involves vaccination by scarification, we have decided that additional NHP will be vaccinated with LVS via scarification and subcutaneous route of administration (to serve as the control). Initially 3 NHP will be vaccinated via scarification along with 2 vaccinated via subcutaneous. This group will serve as a practice group for scarification. We will follow the development of IgG anti-LVS and SCHU S4- and LVS-driven proliferation and cytokine production (IFN
ELISPOT and potentially intracellular cytokine staining) in these NHP to verify that we can successfully vaccinate via scarification.
Following this pilot experiment another group of NHP will be vaccinated to both compare the immune response and the protection from SCHU S4 aerosol; 3 by scarification and 3 by subcutaneous. These experiments will better prepare us for the USAMMDA study.
7 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
5. Problems or concerns and strategies to address
Successfully vaccinate monkeys via scarification. This concern is being addressed by practicing scarification on several monkeys (as outlined in 4. above).
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
1%
9. Work plan for upcoming month a. Amend current IACUC protocol to describe the new scarification experiments b. Identify screened NHPs that will be assigned to these studies
10. Anticipated travel
Travel to Phoenix for the Annual TVDC meeting in October 2008
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated.
Milestone description: Aerosol SOP developed for GLP transition
Institution: LBERI
1. Date started: 8/13/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
Work was started on writing the aerosol SOP.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good.
8. Percentage completed
1%
9. Work plan for upcoming month
Continue to work on the aerosol SOP.
10. Anticipated travel
Travel to Phoenix for the UNM TVDC annual meeting in October 2008.
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated.
8 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Milestone description: I n vivo GLP model efficacy SOPS developed in one small species and primate and efficacy testing of vaccine candidates
Institution: UNM
1. Date started: 1/16/2008
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions a. No new work done this month
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
21%
9. Work plan for upcoming month
In the 7/15/08 report, the passive immunization experiments were being reported under MS11. UNM has made an active decision to move the passive immunization work to MS 17 from this point onward
10. Anticipated travel
The UNM team will travel to Phoenix AZ for the UNM TVDC annual meeting in
October 2008. No COA will be required.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Assays for detecting relevant immune responses in animals & humans developed and Compare assays in animal models (sensitivity)
Institution: UNM
1. Date started: 7/15/06 (MS12) and 12/06 (MS13)
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions a. No new work done this period
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
Mouse proliferation assay, IFN
and IL-2 Elispot, antiFt antibody titration
Rat IFN
Elispot, antiFt antibody titration
Guinea pig antiFt antibody titration
9 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
7. Quality of performance
NA
8. Percentage completed
60%
9. Work plan for upcoming month
None
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Assays for detecting relevant immune responses in animals & humans developed and compared to those in other species.
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions a. We have screened 36/40 of the newly arrived non-LVS vaccinated NHPs in the
IF Nγ ELISPOT assay and 33/40 in the proliferation assay in order to avoid choosing any high responders to serve as LVSnaïve controls. i. There is a continuum of responsiveness in the IFN
ELISPOT assay a. 8/36 of the newly screened NHPs secrete IFN
only in response to formalin fixed (FF) preparations of LVS or FF SCHU S4 b. 12/36 of the newly screened NHPs secrete IFN
in response to antigens other than or in addition to high doses of formalin fixed (FF) preparations of LVS or FF SCHU S4 (ex. Heat killed LVS or SCHU S4) c. 11/36 of the newly screened NHPs give a high background in the IFN
ELISPOT assay making their responsiveness to specific antigens difficult to determine d. 5/36 of the newly screened NHPs secrete no IFN
in response to any
LVS or SCHU S4 antigen preparations iii. There is a continuum of responsiveness in the proliferation assay a. 20/33 NHPs fail to, or only weakly, proliferate in response to all the
LVS and SCHU S4 antigens tested, as expected b. 13/33 NHPs proliferate to at least one LVS and/or SCHU S4 antigen iv. The IgG titer has been measured a. 31/36 of the newly arrived non-LVS vaccinated NHPs have an IgG anti-LVS titer less than 100,000
v. The data are summarized in Table 1 (below)
10 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Prolferative Response Production of IFN
IgG anti-
LVS titer
Experiment # above
100,000
#
NHPs tested
None (+) to at least one
Antigen
#
NHPs tested
None High background
(+) to
Formalin
Fixed antigens only
TUL 43
TUL 44
TUL 46
TUL 48
TUL 49
TUL 51
TUL 52
TUL 53
0
1
0
0
0
0
2
2
4
4
3
3
3
4
4
4
4
2
1
1
1
3
3
3
0
2
2
2
2
1
1
1
4
4
4
4
4
4
4
4
1
0
0
1
1
0
0
0
1
1
2
3
0
2
1
0
2
1
0
0
2
2
1
0
2
4
0
2
2
0
(+) to
Antigens other than, or in addition to,
Formalin
Fixed antigens
1
0
TUL 54 0 4 2 2 4 2 1 0 1
Data Interpretation: Once again, it was observed that the highest response in the IFN
ELISPOT assay is usually to LVS FF Hi. The response usually dilutes out when less stimulating antigen is used (LVS FF Mid or –Lo). A continuum of responses is observed in these non-LVS vaccinated
NHPs in both the IFN
ELISPOT assay and the proliferation assay.
Data storage:
Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assay 09042008.svd
;
TVDC (3) bound notebook (9225), pp. 41 46; 48 – 53; 58 – 63; 68 – 92; TVDC (4) bound notebook
(9235), pp. 1 - 24
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
78% of the scientific work is complete.
9. Work plan for upcoming month a. Screen the remaining 4 non-LVS vaccinated NHPs b. Re-screen any non-LVS vaccinated NHPs that gave a high background in the
IFN
ELISPOT assay c. Thaw PBMCs that have been frozen for 8 weeks in order to test their ability to secrete IFN
in the IFN
ELISPOT assay.
11 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
10 . Anticipated travel
Travel to the yearly UNM TVDC meeting in Tempe, Arizona, 10/6 – 7.
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone description: Assays in vaccinated humans validated (sensitivity)
Institution: UNM/ LBERI
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions a. Experiment Ftc76 (Notebook 116, page 22) i. The purpose of this experiment was to determine how many macrophages can be isolated from 100 ml of human blood. This is the first step toward developing a macrophage killing assay for human vaccinees ii. From 100 ml of whole blood, we recovered 1.1 x 10 8 PBMC and 8.5 x 10 6 monocytes, which produced 3.3. x 10 6 macrophages after 6 day culture in the presence of 100 ng/ml M-CSF. iii. Since the recovery was significantly lower than what we have been using to develop the mouse and rat assays, our next step is to scale down the number of cells to be used in the human macrophage assay
4. Significant decisions made or pending a. Because the number of macrophages generated with 100 ml of whole human blood was low, we have decided to purchase buffy coats representing 500ml whole human blood from the local blood donation center to develop the assay.
Our focus will be on reducing the scale of the assay to make testing human vaccineee feasible.
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
NA
8. Percentage completed
3%
9. Work plan for upcoming month a. Determine the number of macrophages necessary to obtain confluent monolayers in 24, 48 and 96 well plates b. Determine the MOI for infecting human macrophages with SCHU S4 c. Determine the viability of the macrophage monolayer and the number of SCHU
S4 in the macrophage culture after 2 and 3 days.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
12 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Milestone description: In vitro assay for analysis of cellular and humoral elements of the immune response in vaccinated human and anim al’s response to F. tularensis established
Institution: UNM
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions a. Experiment Ptran9 (Notebook123, pages 61) i. The purpose of this experiment was to determine the volume of normal and immune rat serum to use for passive immunization experiments in rats ii. We have used various volumes of immune rat serum in three previous experiments (Ptran 1, 2, and 6) to show that immune serum is protective against intratracheal SCHU S4 challenge. However, the serum volume used in Ptran 1 and 2 may be too high because normal serum also protected a fraction of the rats. In Ptran 6, as little as 0.4 ml immune serum was protective, but no normal serum control was included in the experiment. iii. In this experiment, we titrated the volumes of both normal and immune serum from 0.25 ml to 1.5 ml within the same experiment iv. As shown in Table 2, as little as 0.25 ml immune serum was sufficient to protect rats against i.t. challenge with 240 SCHU S4.
Rats with the same volume of normal serum died from this challenge
Table 2. Titration of normal and immune rat serum for passive immunization of Fischer 344 rats
Group No. Treatment 1
Survival ratio
(No alive/total) 2
1
2
3
4
1.5 ml PBS s.c. LVS vaccination
1.5 ml NRS
1.0 ml NRS
0/6
6/6
0/6
0/6
5
6
7
8
0.5 ml NRS
0.25 ml NRS
1.5 ml IRS
1.0 ml IRS
0/6
1/6
6/6
6/6
9
10
0.5 ml IRS
0.25 ml IRS
5/6
6/6
1 NRS = normal rat serum; IRS = immune rat serum
2 Target dose 1000 SCHU S4, actual lung deposition 240 SCHU S4 b. As a first step to measure T cell function in vaccinated humans, frozen
PBMC were stimulated with 5 ng/ml Con A, a non-specific activator. Since no IFN
response was detected, we believe that fresh Con A stock has to be made
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
13 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
NA
6. Deliverables completed
NA
7. Quality of performance
NA
8. Percentage completed
3%
9. Work plan for upcoming month a. Repeat rat serum titration experiment with 0.5 and 0.25 ml of serum transfer b. Repeat Con A stimulation of frozen PBMC (proliferation and IFN
production) c. Stimulate frozen PBMC with heat-killed and formalin fixed LVS and SCHU S4
(proliferation and IFN
secretion)
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Interaction between human alveolar macrophages and
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions a. Experiment Ftc36 study 13 (Notebook 115, pages 170-171) i. The purpose of this experiment was to compare the cytokine response of human alveolar macrophages in non-tissue culture tubes and in 24 well tissue culture plates after LVS or SCHU S4 infection. This is a repeat of Ftc36 study 11 and was performed to find an alternative method of culturing macrophages because cells cultured in 24 well plates tend to detach during the many washes following infection. ii. 10 6 human alveolar macrophages in 0.5 ml were transferred to 15 ml polypropylene tubes or 24 well tissue culture plates iii. The macrophages were infected with SCHU S4 at MOI of 0.1, 1, and
10 and incubated for 24 h iv. Supernatants were collected, sterile filtered and frozen at -80 v. We have not analyzed the samples yet because of the small sample size
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Good
14 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
8. Percentage completed
15%
9. Work plan for upcoming month a. Analyze cytokine production by human alveolar macrophages cultured in non-tissue culture treated tubes and on tissue culture treated plates. b. Determine the effect of recombinant IFN
on intracellular growth of SCHU S4 and LVS.
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: T cell-induced macrophage killing of intracellular bacteria
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions a. Due to the departure of the technician responsible for developing the mouse and rat macrophage killing assay, the primary goal this month was to train two technicians on these two techniques. b. Experiment PFT3(ABD Primate binder 1 & 2, electronic data D:\My
Documents\NHP studies\PFT3 LVS 6-25-08\PFT3d12 ICC analysis ) and
Experiment PFT4 (ABD Primate Binders 1&2, electronic: D:\My
Documents\NHP studies\PFT4 Naive 7-18-08) i. Analyses of all the samples collected from the NHP are in progress, but no conclusion has been made yet because of the complexity of the analyses. We hope to have conclusions for the next report
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
40%
9. Work plan for upcoming month a. Repeat the murine macrophage SCHU S4 killing assay with naïve and vaccinated splenocytes.
15 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam b. Optimize the rat macrophage SCHU S4 killing assay with naïve and vaccinated splenocytes , focusing on increasing the difference between naïve and vaccinated splencoytes. We will first titrate the MOI for infecting rat macrophages with SCHU S4 c. Continue analyses of NHP samples
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Correlates of protection: in vitro assay or other readout of effector function of Ft developed for multiple species.
Institution: LBERI
Date started: 4/8/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions a. No work was done on this Milestone this month.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None.
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed
2% of the scientific work is complete
9. Work plan for upcoming month
Set up another intracellular cytokine assay and include a positive control.
10 . Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated.
Milestone description : Confirmation of gene and protein expression (develop HTP
SOPs for ORF library production, protein library production, and protein purification)
Description: Prepare a high-throughput protein production system
Select and test ORF expression constructs
Select and test IVT Protocols
Select and test protocols for protein purification
16 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Institution:
1. Date started: 3/02/2006
2. Date completed: 9/8/2008
3. Work performed and progress including data and preliminary conclusions:
A. Thioredoxin LEE Construct Design
Last month we reported that the LEE assembly and IVT synthesis protocols that we have now developed work efficiently with LEE templates of up to 1.5kb.
Moving to the longer template format changes the HTP assembling and expression needs from 4,500 to 2,500 LEEs for full proteome coverage. To demonstrate the feasibility of the HTP scale-up with the longer templates we assembled a plate of these LEEs. Results of this study are shown on Fig. 1.
Fig. 1. HTP assembling of 1.5kb LEEs for IVT expression.
File location: R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU gels\FTU HTP IVT DNA gels\HTP Egel AMP\Long ORF 1\ FTU Long ORF
R1 Plate 02 AMP 8-28-08 01_.tif
Conclusion: Our LEE assembling protocol is suitable for HTP assembling of longer LEEs. Over 90% LEES were produced without noticeable by-products at the levels sufficient for IVT reactions.
17 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
B. Testing protocols for protein purification using anti-Thioredoxin (Trx) antibodies
Our change from using antigen samples that are free in solution to the more effective format of bead-bound antigen for presentation to T-cells led us to reevaluate the strategy of running IVT reactions in 100ul volume. Since only
~25% of the protein synthesized in the bead-bound IVT context is captured by
50ul of antibody-conjugated beads, using a 100ul reaction is wasteful. The experiment presented on Fig. 2 was set up to determine how efficient antigen binding to beads is at lower antigen levels. IVT reactions for ova, FTU0901 and FTU1695 were set up in 25ul and the newly synthesized polypeptides were captured with 50ul of anti-Trx mAb conjugated Tysol magnetic beads. We show that the supernatant fractions were almost completely depleted of the labeled polypeptides. Binding was highly efficient. Therefore, we concluded that IVT volume can be reduced 4-fold without effect on the amounts of the proteins bound to the beads.
Fig. 2. Autoradiograph displaying the depletion efficiency of IVT reactions with
50ul of aTrx mAbs Tysol beads. 1-3 polypeptides remaining in the IVT after antibody-bead depletion, 4-6 polypeptides captured on the beads. Lanes 1, 4 are FTU0901, Lanes 2, 5 are Ova, Lanes 3, 6 are FTU1695.
File location: R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU gels\FTU HTP IVT 35S gels\Thio fusion IVT\ NEB Tosyl and Invit
Carboxy bead test for shipment 8-15-08.jpg
Conclusion: The volume of IVT reaction mix used in the experiment can be reduced 4-fold (with a concombinant 4-fold reduction in polypeptide amount produced) without changing the amount of trx-tagged polypeptide captured on the anti-Trx mAbs Tysol beads. The demonstrates that additional protein produced in the 100ul vs. 25ul reaction exceeds the capacity of 50ul beads.
Using more of this expensive reagent is seemingly unnecessary since we appear to have sufficient yields on the beads to proceed with the T cell assays.
18 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
C. Set up for testing IVT products from new Trx LEE constructs in NHP T cell assays
A new set of NEB IVT made and anti-Trx mAB Tysol bead purified samples was generated and tested at UNM to stimulate frozen NHP lymph cells.
Ova FTU901 No template
Fig. 3. Evaluation of levels of cross-reactive material in E. coli IVT generated samples. Invitrogen and NEB IVT systems were used for polypeptide synthesis; products were purified on Tysol beads.
File location: R:\GeneVac\FTU\Contract\Proteome\UNM data\ ftc59s25.JPG
Conclusion: The combination of NEB IVT reaction and anti-Trx mAb Tysol bead based protein purification reduced cross-reactivity substantially. Background is considered sufficiently low to proceed with the library construction and proteome synthesis.
4. Significant decisions made or pending
MS26 is completed.
5. Problems or concerns and strategies to address
None at this time
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
100%
9. Work plan for upcoming month
N/A
19 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
10. Anticipated travel
The UNM TVDC teams from UTSA, Anza/Cerus, UNM, and LBERI are traveling to ASU for the October 2008 annual meeting.
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Optimization of T cell assays and endpoints in mice. UNM will use ASU’s protein fragments in lymph node proliferation assays to define vaccine candidates
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions a. Ftc59 study 24 (Notebook 115, pages 161-164) i. The purpose of this experiment was to determine whether New
England Biolab (NEB) PURExpress in vitro protein synthesis kit induces lower crossreactive responses than Invitrogen’s in vitro transcription/translation kit ii. The lymph node cells were collected on 8/6/08 from a Cynomolgus macaque (ID number A04715) inoculated on 6/25/08 with 10 5 LVS by bronchoscopy iii. 1.5 x 10 5 lymph node cells were plated and stimulated with 0.005,
0.05, 0.5 and 5
l of ivt reaction mix without DNA template. After an overnight incubation, the IFN
ELISpot plate was processed according to manufacturer’s instructions iv. As shown in Fig. 2, the ivt reaction mix from NEB stimulated fewer crossreactive IFN
spots across all volumes tested than the ivt reaction mix from Invitrogen. As previously observed, a large volume (5
l) of the ivt reaction mix from both vendors reduced the number IFN
-positive spots
20 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Fig. 2. Stimulation of crossreactive responses by ivt reaction mix from Invitrogen and NEB b. Ftc59 study 25 (Notebook 165, pages 165-169) i. The purpose of this experiment was to determine if it is possible to reduce the residual crossreactive response against the New England
Biolab (NEB) PURExpress in vitro protein synthesis kit by purifying the ivt product with anti-thioredoxin antibody conjugated to magnetic beads ii. The lymph node cells were collected on 7/7/08 from a Cynomolgus macaque (A00896) that was vaccinated i.d. with 10 7 LVS on
11/20/06 and boosted with 10 5 LVS by bronchoscopy on 6/15/08.
The cells were frozen in liquid nitrogen iii. The lymph node cells were thawed from liquid nitrogen and plated at
1.5 x 10 5 cells per well. iv. ASU provided 6 sets of samples in PBS:
1. OVA made with Invitrogen or NEB kits and then purified on anti-thioredoxin magnetic beads
2. Ftu901 made with Invitrogen or NEB kits and then purified on anti-thioredoxin magnetic beads
3. Ivt reaction mix from Invitrogen or NEB without DNA template v. At UNM, the protein-bound beads (sample sets 1 and 2) were pulled down with a magnet separator and the PBS was replaced with complete RPMI 1640. 10
l of the resuspended beads was diluted with 90
l of complete RPMI 1640. 40
l of the undiluted and 1:10 diluted beads were added to each of two wells with lymph node cells vi. The ivt reaction mixes without DNA template were diluted 1:10,
1:100, and 1:1000 with complete RPMI because we did not know how much protein was bound to the magnetic beads. 5
l of the undiluted and diluted samples were added to the lymph node cells vii. Figure 3 shows that bead purification reduced the residual level of crossreactivity associated the NEB kit. It should be pointed out that
5
l of ivt reaction without purification or dilution may suppress IFN
production, so the best comparison may be between the purified samples and the 0.5
l unpurified samples
21 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Figure 3. Purification of NEB ivt products with anti-thioredoxin conjugated beads reduced the residual cross reactivity
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
40%
9. Work plan for upcoming month a.
Determine whether the responses observed thus far is specific for F. tularensis by testing unvaccinated NHP lymph node cells with the samples provided by ASU
b.
Determine whether IglC can be used as a positive control for the IFN
ELISpot assay. Justin at Anza Therapeutics showed that mice vaccinated with IglC expressing Listeria monocytogenes induced very nice responses against an IglC peptide library, suggesting that IglC may be a good candidate for positive control
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
NA
22 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Milestone description: Generation of polypeptide libraries (Optimize IVT proteinfragment production, Develop IVT protocol for high-throughput production, Validate immunogenicity of protein-fragments, Full scale production of protein-fragment library, Purification of protein-fragment library, Array protein-fragment into overlapping pools, Ship to UNM)
Milestone description: Build SCHU4 proteome
Build ORF expression library corresponding to proteome (inactive)
Generate complete protein-fragment library (inactive)
Array protein-fragments into measurable pools for T cell stimulation
(inactive)
Institution:
3. Date started: 03-01-2007
4. Date completed: Pending
5. Work performed and progress including data and preliminary conclusions
A. Build ORF expression library corresponding to proteome
B. Generate polypeptide library
C. Array polypeptide library
HTP LEE assembly for IVT expression has been initiated. This month 1,008 samples have been generated, quality controlled, quantitated and dried.
Once the remaining 1,500 LEEs have been constructed we will present the details of our quality control procedures and an analysis of the quality and quantity of the constructs that we have obtained. This is planned for the next report (10/15)
Bulk orders for NEB IVT, mAbs and beads are placed.
4. Significant decisions made or pending.
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Very Good
8. Percentage completed
45%
9. Work plan for upcoming month
Initiate library production.
We are planning to initiate the protein library construction as soon as IVT and mAbs are available (~ by Oct.1). In the mean time we will continue LEE production.
10. Anticipated travel
See above
23 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Array hybridization with mouse RNA from virulent SCHU S4 infection and RT PCR confirmation of candidates
Institution: UNM
1. Date started:
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions a. Ftc59 study 22 (Notebook 104, pages 157-158) i. The purpose of this experiment was isolate RNA from SCHU S4 culture d in Chamberlain’s broth and SCHU S4 from infected mouse lungs ii. RNA has been isolated under both conditions and tested for sterility.
They have been shipped to ASU b. Ftc56 study 4 (notebook 109 pages 189-192) i. The purpose of this experiment was to prepare 200
g of SCHU S4 genomic DNA per request from ASU ii. The genomic DNA has been isolated, tested for sterility and shipped to ASU
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
15%
9. Work plan for upcoming month a. We will prepare RNA from rats 1, 3, 5, 7, and 24 hours after infection with
SCHU S4
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
24 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Milestone description: Array hybridizations with mouse RNAs from virulent Schu 4 infection & RT PCR confirmation of candidates.
Institution: UNM/
1. Date started: 08-01-2006
2.
3.
Date completed: Pending
Work performed and progress including data and preliminary conclusions
Previous Results: We have previously reported on the first round of LAPT amplifications from the first time course challenge experiment. We identified genes by varying expression pattern changes over time. We have also been optimizing parameters for the qPCR verification of microarray selected genes.
New RNA samples from a repeat time course experiment of both SCHU S4 grown in
Chamberlains media and from infected BALB/c mouse lungs were received last week from UNM. From the first time course experiment, we had problems with RNA yield after purification over RNAeasy columns on the in vitro grown SCHU S4 bacteria.
The RNAeasy purification process is needed for the LAPT protocol to ensure removal of any inhibitors of amplification. We first performed RNAeasy purifications on samples with high levels of RNA so that, should we encounter problems, the sample purifications could be repeated. Using a total of 100 micrograms we performed the purification process and the results are shown in Table 1. There was a problem noted with the sample labeled T0 in that the total number of micrograms loaded was only 6 micrograms. The difference was noted between the base levels of RNA determined between UNM and ASU. Notwithstanding, this sample, the base level
RNA measurements between ASU and UNM were within 95% of each other. The key point noted was that the purification process results in approximately a 53% recovery of the input RNA level (last column). Thus, given sufficient levels of RNA in the starting material, the amount lost in the purification process will not impede milestone progress. We would like to have a final of 20-30 micrograms of purified
RNA for the LAPT process. The remaining samples are undergoing processing and quality checks.
Sample
Total
g Total ug
Before RNAeasy After RNAeasy Percent Recovery
T0
T24
64,4 NV1
64,4,T1,1
64,4 T3,1
64,4 T3,3
64,4 T5,2
64,4 T5,3
64,4 T24, 2
6.2
120.5
91.8
102.6
94.7
74.2
100.0
141.7
90.8
3.3
26.1
60.5
61.2
66.4
43.9
63.0
46.9
49.9
52.8
21.6
65.9
59.6
70.1
59.2
63.1
33.1
55.0
25 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Notebook/File locations …,
ASU: Notebook 804, New Mexico Time Course, pages107.
UNM: Experiment ID Ftc64.3 and Ftc64.4, Notebook 104 page 157
We had noted in the previous report that there were some anomalies of the qPCR that needed to be addressed. Using optically clear PCR plates we had noticed that there were negative peaks observed at higher temperatures during a melting curve analysis of the amplifications that were very predominant at high temperatures. This may have resulted from a primer design problem. After consulting with the thermocycler manufacturer, several modifications were done by including a different style plate seal and we tested a white wall plate. In the comparison shown below in
Figure 1, when the exact same reaction mixtures were run in the white wall plates
(right hand side of the Figure 1) and optically clear plates (left hand side of Figure 1), the negative peaks on the melting curve were much reduced to not detected in the white wall plates. Thus, the potential problem was a physical plate attribute and not the result of a primer design problem.
A second question that we addressed was noted in the shift of the melting curve for qPCR when we moved from genomic DNA used to calibrate the standard curve for the quantitation phase of the assay. We noted that when we utilized a reconstitution
RNA sample (SCHU S4 RNA diluted into normal mouse lung RNA to simulate the type of sample that we will be analyzing), there was a significant shift in the peak of the qPCR melting curve for all of the primers undergoing testing of the subsequent cDNA as compared to genomic DNA. The shifts can be detected in Figure 1 above.
The shift could be the result of a primer design problem leading to secondary structures of primer dimers leading to secondary PCR products. To test this possibility, we utilized the amplification reaction and simply performed agarose gel electrophoresis to determine if secondary products were detected. The results are
26 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam shown in Figure 2 reveal that no secondary products were identified. Moreover, it was noted that with each Ft primer set that no PCR product was detected in normal mouse lung alone. In addition, there was generally a consistent decrease in the amount of the product that paralleled the input level of RNA in the reconstitution sample. We conclude that the primers accurately amplify their intended target and that the shift results from the addition of excess normal mouse lung RNA causing the shift in melting curves.
4.
5.
Significant decisions made or pending
None
Problems or concerns and strategies to address
We designed and tested a set of primers for 16S ribosomal RNA for a control gene to perform the relative quantitation of target genes. The initial study revealed a product with normal mouse lung alone. We verified that the sequence of the primer should not amplify any gene in the mouse genome by BLAST analysis, but need to identify the problem or select another gene to use for relative quantitation.
6.
7.
8.
9.
Deliverables completed
None
Quality of performance
Good
Percentage completed
50%
Work plan for upcoming month
Process new time course samples for LAPT analyses.
27 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Assess gene expression levels of 6 current validated qPCR primer sets in the current
RNA from the initial dose response and time course experimental sample set.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Construct single mutants in
subsp.
(SCHU S4) (iglC, pdpD, iglD, iglA, iglB)
49.1: Construct
subsp.
(SCHU S4)
49.2
Construct
subsp.
(SCHU S4), Construct
subsp.
(SCHU S4)
49.3
Construct
subsp.
(SCHU S4), Construct
subsp.
(SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
In order to generate mutants in SCHU S4 we need to develop tools to generate successful deletions. Therefore, our focus is two fold, one is cloning experiments to get our target deletions into vectors that we can use in creating these deletions and experiments with
SCHU S4 itself using constructs that we believe will allow us to make deletions into SCHU
S4.
I. Cloning: a. We continued with the cloning of the pdpD deletion containing the flip recombinase recognition sites (Flp) from the pwsK30 plasmid into pUC118 vector. We decided to change one of th e oligo’s used to generate the ≈3200 bp pdpD::ErmC::Flp DNA fragment from the original pKEK1188 pwsk30 construct. This oligo has a Sal I restriction site instead of the KpnI site originally designed; this will allow for directional cloning of this fragment and will reduce the re-ligation background of the pUC118 plasmid. The oligo pdpD up Sal I (5’-gcacgc gtcgac ctaagccagtaaaataagcatac3’) will be paired with the original pdpDS4KpnIF oligo. The PCR product pdpD::ErmC::Flp was generated using the mentioned oligos and pKEK1188 as the template; this was subsequently digested at
37°C overnight with Sal I restriction endonuclease in parallel with the pUC118 vector.
Both were then phenol:chloroform extracted and ethanol precipitated. Then the second digesti on was done with KpnI restriction endonuclease overnight at 37°C. Both the PCR product and the pUC118 digested DNAs were run on a 1% agarose gel and purified by using the Qiagen’s gel Extraction Kit. The resulting purified DNAs were used in a ligation r eaction overnight at 16°C. Subsequently, DH5α competent cells were transformed with this ligation reaction and this resulted in hundreds of colonies. The control re-ligation pUC118 Sal I/KpnI digested only had 11 colonies. Eight of the resulting colonies were grown in a liquid culture overnight (37C) and subsequently prepared plasmid mini preparations using the Qiagen kit. These plasmids were digested with Bgl II since the resulting correct pUC118 construct will yield a different digestion profile than that of the pKEK1188 construct and the re-ligation pUC118 only will not be cut by the Bgl II enzyme. (Figure 1). Data located in UTSA TVD Notebook 5, pages 149-
151.
28 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Figure 1.
1 Kb
5.0 *
1 2 3 4 5 6 7 8 9 10
*
Legend
1. 1 Kb Ladder
2. C1 pUCpdpD::E::Flp
3. C2 pUCpdpD::E::Flp
4. C3 pUCpdpD::E::Flp
5. C4 pUCpdpD::E::Flp
6. C5 pUCpdpD::E::Flp
7. C6 pUCpdpD::E::Flp
8. C7 pUCpdpD::E::Flp
9. C8 pUCpdpD::E::Flp
10. 1 Kb Ladder
0.5 ¤
Figure 1 represents the Bgl II digestion profile of eight plasmids isolated from colonies potentially containing pUC118 + pdpD::ErmC::Flp Sal I/KpnI plasmid (Cx pUCpdpD::E::Flp). The correct clone should yield three distinct bands at 5200 bp, 1000 bp and ≈300 bp this pattern results because of the cloned DNA contains various Bgl II sights and the pUC118 plasmid has no Bgl II sights. It appears that lanes 2 thru 9 yielded the correct banding profile indicating that UTSA has eight possible clones containing the correct pUC118 + pdpD::ErmC::Flp Sal I/KpnI plasmid. Data located in
UTSA TVD Notebook 5, page 150.
29 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Figure 2 .
Bgl II
1 Kb
1 2 3 4 5 6 7
4.5
0.8
3.2
1.2
Legend
1. 1 Kb Ladder
2. Uncut pUC118
3. pUC118
4. pKEK1188
5. Uncut C8 pUC+pdpD::E::Flp
6. pKEK1188
7. C8 pUC+pdpD::E::Flp
1 2 3 4 5 7 6
EcoRI
Figure 2 represents digestion profiles run with vector controls to help in verifying a correct pUC118+pdpD::E::Flp construct. Lanes 2 and 5 represent uncut vector (pUC118 and C8 pUC+pdpD::ErmC::Flp, respectively). Lower panel is EcoRI digestions of pUC118. pKEK1188 (pwsK30 pdpD construct) and C8 pUC+pdpD::E::Flp a potential correct clone.
The EcoRI will linearize the pwsK30 original plasmid pKEK1188 and will cut the newly cloned pUC vector containing the pdpD::ErmC::Flp construct twice resulting in a band at
≈1200 bp and ≈5300 bp (lane 7) In addition, the Bgl II digestion (upper panel) profile will yield four bands in the pwsk30 construct (pKEK1188, lane 4 and 6) and only three bands for the pUC118+pdpD::ErmC::Flp since pUC118 vector does not have a Bgl II site. The largest band for the pUC118 correct construct will be at a higher bp size than that in the pwsk30 construct (pKEK1188). So the two profiles indicate that the cloned pdpD::E::flp construct is in the pUC118 vector and not in the original pwsK30. We will verify correct construct with PCR experiments using oligos directed to the pUC origin and the ErmC sequence, respectively. These will sent for sequencing for confirmation. Data located in
UTSA TVD Notebook 5, pages 151.
II. Experiments to generate mutants in Schu4: a. From the previous report clones V17S4 and V17T4 were passaged on TSA+++
70 ug/ml Kanamycin (Kan) plates. The single colonies that resulted were patched on TSA+++Kan plates and 10 colony lifts (from each clone set) were taken and used in a PCR reaction using the forward and reverse VgrG specific oligos used in screening previously (Figure 3).
30 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Figure 3.
1 Kb
2.0
0.5
1 2 3 4 5 6 7 8 9 10 11 12 13
Legend
1. 1 Kb Ladder 14. V17S4A
2. KKT1 15. V17S4B
3. V17orig
4. V17T4A
5. V17T4B
6. V17T4C
7. V17T4D
16. V17S4C
17. V17S4D
18. V17S4E
19. V17S4F
20. V17S4G
8. V17T4E
9. V17T4F
10. V17T4G
11. V17T4H
12. V17T4I
13. V17T4J
21. V17S4H
22. V17S4I
23. V17S4J
2.0
0.5
1 2 3 14 15 16 17 18 19 20 21 22 23
Figure 3 represents PCR profiles generated when using oligo set FTT1346 fwd NdeI and
VgrG rev EcoRI with DNA templates from the second passaged VgrG clone candidates
(V17S4 and V17T4). The label of the letters at the end of each description indicates this are the second passaged clones isolated. Lanes 2 and 3 are controls for the wild type and original VgrG clone pick to further cycle, respectively. Lanes 4 thru 13 represent the single colony picks from the V17T4 cycled clones. These profiles illustrated that six of the ten screened yielded only the mutant band of VgrG only (lanes 5 through 9 and 11).
In addition, the other screen mutants did yield the mutant band (1600 bp) as well as the wild type band (900 bp). Lanes 14 thru 23 represent the single colony picks from the
V17S4 cycled clones. The V17S4 passaged single clones picked, all illustrated both the wild type (900 bp) and mutant band 1600 bp). Data located in UTSA TVD Notebook 7, page 27. b. Prepared genomic isolations from the six potential correct VgrG mutants in the V17T4 group and further tested these clones by using the intron oligo set EBS Universal and
VgrG rev EcoRI. This will confirm that this insertion is at the correct location on the chromosome (expected ba nd size would be ≈800 bp). In addition, re-did the original
PCR oligo set with a higher fidelity Taq polymerase HiFi KOD from Novagen. This was done to subsequently use some of these products and send off for sequencing (Figure 4).
Furthermore, the V17S4J clone from figure 3 was passaged once again on TSA+++ Kan plates to generate a third passaged clone isolate. We were able to get seven single colonies from this passage and these were screen by PCR with the VgrG specific oligos mentioned and found that three of the seven picked colonies yielded the mutant band only in its profile. These three clones were used to isolate genomic DNA and again screen by PCR using the VgrG specific oligos and the HiFi KOD Taq polymerase enzyme
(figure 5). Finally we passaged the V17T4 E and F clones on a non-select TSA+++ plate and grew at 42 °C to cure the plasmid from the bacteria and generate single clones to test for Kanamycin sensitivity. Selected 10 Kanamycin sensitive clones from the E and F
31 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam groups and labeled these picks as V17T4ef.1 thru V17T4ef.10. Genomic isolations were made from these clones and tested by PCR with the VgrG specific oligo set (figure 5).
Data located in UTSA TVD Notebook 7, pages 27 thru 30.
Figure 4 .
1 Kb
1.5
0.4
1 2 3 4 5 6 7 8 9 10
Legend
1. 1 Kb Ladder
2. KKT1
3. V17 orig
4. V17T4B
5. V17T4C
6. V17T4D
7. V17T4E
8. V17T4F
9. V17T4H
10. V17S4J
1.5
0.5
1 2 3 4 5 6 7 8 9 10
Figure 4 represents PCR profiles generated using the VgrG specific oligo set (lower panel) and the EBS Universal oligo set (upper panel), respectively. The DNA templates used in these reactions are the six genomic isolations from the V17T4 group (B, C, D, E,
F and H) and one of the V17S4 group clone J. The EBS Universal oligo set (upper panel) should yield a product band size of ≈800 bp and the VgrG specific oligo set (lower panel) should yield the correct VgrG mutant size of ≈1600 bp and no wild type band present (900 bp). Lanes 2 and 3 are the wild type and original clone controls, respectively. Lanes 4 thru 9 seem to be correct mutants as they only show the ~1600 bp mutant size. These results confirmed that these clones are correct by PCR and we’ve sent V17T4E and V17T4F vgrG specific oligo set products for sequencing. Data located in UTSA TVD Notebook 7, page 28.
32 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Figure 5 .
1 Kb
3.0
0.4
4.5
1 2 3 4 14 15 16
Legend
1. 1 Kb Ladder
2. KKT1
3. V17 orig
10. V17T4ef.7
11. V17T4ef.8
4. V17T4ef.1 12. V17T4ef.9
5. V17T4ef.2 13. V17T4ef.10
6. V17T4ef.3 14. V17S4J2
7. V17T4ef.4 15. V17S4J4
8. V17T4ef.5 16. V17S4J6
9. V17T4ef.6
0.5
1 2 3 4 5 6 7 8 9 10 11 12 13
Figure 5 represents PCR profiles using the potential correct VgrG mutants as templates with the VgrG specific oligo set. The upper panel are the three clones from the V17S4J group which was passaged and found to only contain the mutant profile PCR product (1600 bp) (lanes 14, 15 and 16). The lower panel consists of mostly the cured plasmid clones of V17T4ef group clones .1 thru .10
(lanes 4 thru 13). The controls wild type and original V17 clone are in lanes 2 and 3 for comparison. All tested mutants in this experiment seem to be correct with a dominant band size of 1600 bp in the lower panel. Data located in UTSA
TVD Notebook 7, page 30. b. Completed the igLD mouse experiment challenge with wildtype SchuS4 (KKT1) the final empirically calculated challenge dose was 776 cfus. This dose was delivered intranasally to each mouse and all groups of mice tested with this challenge died by day 5. Therefore, the various inoculated igLD mutant doses had no protection with this challenge dose. Data located in UTSA TVD Notebook
5, page 146.
Table1 : The protective efficiency against wild type Schu S4
Group of mice
Route of challenge
Dose of challenge(CFU)
D1 D2
Survival rate
D3 D4 D5 igLD 1E3 igLD 1E4
I.n.
I.n.
776
776
5/5
5/5
5/5 5/5 3/5 0/5
5/5 5/5 5/5 0/5 igLD 1E5 igLD 1E6
PBS
I.n.
I.n.
I.n.
776
776
776
5/5
5/5
5/5
5/5 5/5 4/5 0/5
5/5 5/5 5/5 0/5
5/5 5/5 1/5 0/5 c. Did some ordering for enzymes and general supplies for ongoing experiments.
33 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6.
Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
76%
9. Work plan for upcoming month b. Will continue to verify a correct vgrG mutant by analyzing the received sequencing data and prepare a Southern blot to verify expected location on the genome. c. Will start a mouse experiment once the vgrG mutant is confirmed to be correct to determine if this mutant is attenuated as expected based on the U112 vgrG mutant. d. Did not get to do the repeated Western on the igLD mutant this past month and will try this coming month. e. If time allows will continue the verification of the pUC pdpD::Flp::ErmC clone, by doing
PCR with ErmC specific oligos and pUC origin specific oligos and send the PCR products for sequencing. Once this clone is confirmed to be correct, UTSA will do a transformation experiment to try and generate a complete pathogenicity island removal from the
SchuS4.
10. Anticipated travel
I will not be attending the Arizona meeting.
11.Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp.
;
LVS
, and Ft subsp.
(SCHU S4)
strains,
50.2: phenotyping and immunologic characterization of
subsp.
(SCHU S4)
strains, Ft subsp.
plus
double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp.
(SCHU S4)
strains
Institution: UTSA
1. Date started: 05/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
50A: (1) Measure humoral responses after KKT10 ( iglD mutant of SCHU S4) intranasal immunization. (Note book # 9, page 3-5). BALB/c mice were intranasally immunized with KKT10 (10 4 , 10 5 , 10 6 , or 10 7 ) or PBS as mock control. Blood was collected at day 28 after vaccination. Specific anti-KKT10 total antibody titer as well as IgG1 and IgG2a isotypes were determined by ELISA. Antigens, either UVirradiated KKT10 (10 6 /well) or HEL (Han Egg Lysozyme, 50ng/well, an unrelated antigen as control), were coated onto 96-well microplates and reacted with serial
34 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam dilutions of sera. Goat anti mouse Ig(H+L), IgG1 and IgG2a antibody conjugated with peroxidase were used as the secondary antibody to determine serum antibody isotypes and titers. As shown in Fig. 1 , mice immunized with KKT10 produced significant amounts of specific serum antibody at day 28 after priming for all vaccination doses.
3000
2500
2000
Mock/P BS
10 4 CFU
10 5 CFU
10 6 CFU
10 7 CFU
1500
1000
500
0
Total Ab IgG1 IgG2a
Fig. 1.
Humoral response to KKT10 (SCHU S4 ΔiglD) immunization.
BALB/c mice were intranasally immunized with 10 4 , 10 5 , 10 6 or 10 7 CFU of
KKT10 or PBS alone as mock vaccination. Sera were collected 4 weeks after immunization and used to determine titers of anti-KKT10 specific antibody.
Isotyping analyses indicated only Th2 (IgG1)- type antibodies were detected in mice after the KKT10 immunization via the intranasal route. No KKT10 specific antibody was detected in mice mock-vaccinated with PBS at day 28 after immunization. All tested serum samples showed no reactivity to the unrelated HEL protein ( HEL data not shown).
(2) Assays for cell-mediated immune responses after oral KKF235 (
iglB of F. novicida ) immunization using cellular cytokine recall assay. (Note book # 9, page 1-
2). BALB/c mice were immunized orally with KKF235 (10 3 CFU) or mock immunized with PBS. Spleens, cervical lymph nodes, and mesenteric lymph nodes were collected from mice at day 14 after immunization, single cells were made and stimulated with
UV-inactivated KKF235 (10 4 or 10 5 bacteria) or HEL (hen egg lysozyme) as control.
Supernatant of the cell culture was collected 72 h after addition of stimuli and assayed for the production of cytokines (IFN-
, IL-2, IL-4 and IL-12). The cytokine recall results are summarized in Fig. 2. Antigen-specific cytokine productions were only found in KKF235 primed cells, but not in any examined PBS-mock immunized samples. High amount of IFNγ was induced in KKF235-primed spleen cells recalled with UV-inactivated KKF235 (10 4 and 10 5 CFU). Significant amount of IL-2 can be detected in KKF235-primed cervical lymph nodes, and the IL-12 was induced in both primed cervical and mesenteric lymph nodes. On the other hand, a minimal amount of IL-4 (Th-2 type cytokine) was detected in all examined samples (data not shown).
Finally, the unrelated antigen, HEL, did not stimulate any measurable amount of cytokines (data not shown). These data indicate that oral immunization with KKT10 induced robust Th1 type cell mediated immune response in mice.
35 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
20
Spleen
40
CLN
Mock/P B S
K K F235
15 30
10
5
20
10
0
500
104
CLN
400
300
200
100
0
105
1 0 4
10 4
1 0 5
10 5
UV-KKF235
0
500
1 0 4
MLN
400
300
200
100
0
1 0 5
1 0 4
10 4
UV-KKF235
1 0 5
10 5
Fig. 2 . Cellular cytokine recall responses to oral KKF235 immunization. Spleen, cervical lymph nodes (CLN), and mesenteric lymph nodes (MLN) were collected from KKF235 or PBS-mock vaccinated mice, single cells were made and reacted with UV-inactivated KKF235 cells. Cytokines were measured from supernatants at 72 h after additions of stimuli.
50B : Survival after LVS I.G. vaccination and CD4 + T cell depletion /F. t. subsp. tularensis SCHU S4 challenge. (Notebook #8, pages 111-113, 117, 123-129) Groups of Balb/c mice (8 mice/group) were vaccinated IG with 10 3 CFU of LVS or mock vaccinated (PBS) and rested for three weeks. One group of mice were treated IP with
250
g of neutralizing anti-CD4 antibody, grown up by the hybridoma cell line GK1.5
(ATCC), at days -2, -1, 0 and every subsequent third day after intranasal challenge with 80 CFU of F.t.
SCHU S4. One group of mice received IP injections of rat IgG2b and another group received no treatment as positive controls. Some mice, which were given parallel IP treatments, were sacrificed at day 4 after challenge in order to measure the level of CD4+ T-cell depletion. Single cell suspensions of splenocytes were incubated with APC-CY7 labeled CD4 antibody and measured for fluorescence by flow cytometry. As shown in Fig 3 , splenocytes from mice which received the rat
IgG2b control contained 17.6% CD4+ T-cells. Splenocytes from mice which received the anti-CD4 antibody contained only 0.6% CD4+ T-cells which was comparable to the fluorescence of the APC-CY7 isotype control at 0.5%. These results show that the anti-CD4 antibody treatment adequately depleted the splenic compartments of
CD4 + T-cells as desired. Mice which received the F.t
. SCHU S4 challenge were then monitored daily for survival and weight loss. As shown in Fig. 4 , mice which received either rat IgG2b or no treatment exhibited a high level of survival (87%). Mice which received the anti-CD4 antibody showed delayed effects of bacterial challenge and started to die by day 7 after challenge. At day 14, 50% of these mice were still surviving. As expected, all mock vaccinated mice succumbed to infection by day 6 after challenge. These results indicate that while other cell types may be able to
36 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam control initial severity of disease, CD4 + T-cells play an important role in clearance of infection.
0.0% 0.4% 17.6%
0.5% 0.6%
Fig. 3. in vivo depletion of CD4+ T-cells. BALB/c mice were given IP injections of 250
g of either anti-CD4 antibody or rat IgG2b as a control at D -2, -1, 0 and 3. On day 4, single cell suspensions of splenocytes were stained with APC-CY7 labeled CD4 antibody and fluorescence was measured by flow cytometry.
37 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
100
80
60
40
20
M oc k (PBS)
LVS
LVS/Rat IgG2b
LVS/anti-CD4 Ab
B
0
110
0 2 4 6 8 10 12 14
105
100
95
90
85
80
0 2 4 6 8 10 12 14
Days After Challenge
Fig.4. Protective efficacy of LVS intragastric immunization followed by anti-CD4 antibody treatment and F. tularensis SCHU S4 challenge. Groups of BALB/c mice (8 mice per group) were immunized IG with 10 3 CFU of LVS and rested for three weeks. Mice were then treated
IP with 250
g of either anti-CD4 antibody or rat IgG2b as a control (day -2, -1, 0 and every subsequent third day), or given no treatment. On day 0, all mice were challenged with 80 CFU of SCHU S4 and monitored daily for (A) survival and (B) weight loss
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
80% of scientific work completed on milestone 50A (original plans)
83% of scientific work completed on milestone 50B (intragastric plan)
81.5% normalized overall average work completed on MS 50A and 50B.
9. Work plan for upcoming month
50A: (1) Measure humoral responses after KKT10 ( iglD mutant of SCHU S4) oral immunization.
(2) Evaluation of protective efficacy of KKT10 oral immunization against SCHU
S4 challenge.
50B : (1) Survival after LVS I.G. vaccination and B cell depletion/SCHU S4 challenge.
10. Anticipated Travel
The TVDC annual meeting on Oct.6-7, 2008 in Arizona.
11. Upcoming Contract Authorization (COA) for subcontractors
None
38 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Milestone description: Create RecA mutants in F. tularensis subsp. tularensis(Schu S4)
Institution: UTSA
1. Date started: 9/15/2007
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
Creation of a LUX operon plasmid in Ft
3.1 A new focus of this milestone is to introduce LUX operon (LuxC, LuxD, LuxA, LuxB and
LuxE) into the plasmid pKEK843 containing Ft groELp promoter to allow the generation of the bioluminescent LVS and U112. Lux operon is a set of genes which encode the emission of visible light.
3.1.1 In last monthly technical report, we reported that the plasmid pKEK1194 carrying
Lux operon under the Francisella promoter was constructed. To transform pKEK1194 into wild type U112, U112 competent cells were made. 0.5ml overnight culture of U112 was added into 4.5ml TSB++ liquid medium and incubated at 37
C for 3-4 hours with shaking. After 3-4 hours incubation, the cells were washed with 800ul 0.5M Sucrose at 6000rpm for 5 minutes. The cells were washed for 3 times totally, and the final pellet was resuspended in 200ul 0.5M
Sucrose. 3ul pKEK1194 plasmid DNA was added into 200ul U112 competent cells, and transferred into 0.2cm Gene Pulser Cuvette. The DNA/cells mixture was incubated at room temperature for 10 minutes before being electroporated.
After electroporation at 2.5KV, 600
and 25
F,1.0ml TSB++ liquid medium was added into the electroporated cells and transferred into a culture tube. After 2-3 hours incubation at 37
C with shaking, the transformed cells were spread onto fresh TSA++/Kanamycin(50ug/ml) agar plate and incubated at 37
C for 2-3 days.
3.1.2 About 52 transformants selected on TSA++/Kan agar plate were tested for bioluminescence from lux operon using the luminometer. pKEK1194 in DH5
was set up as the positive control and wild type U112 as the negative control
.Only colony52 was detected giving the positive signal, and it was designated as
KKF341. Data was shown below on Chart1.
Chart1: Bioluminescence of U112/lux operon
39 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
U112/pKEK1194 Bioluminescence
8000000
7000000
6000000
5000000
4000000
3000000
2000000
1000000
0
E.
Co li/p
KE
K1
19
4 wt
U
11
2
C olo ny1
C olo ny2
C olo ny3
C olo ny4
C olo ny5
C olo ny6
C olo ny7
C olo ny8
C olo ny9
C olo ny1
0
Co lon y5
2
Co lon y1
1
Co lon y1
2
Sample
Data recorded on UTSA TVDC notebook #2, page143 for Chart1.
3.1.3 The plasmid pKEK1194 carrying lux operon was transformed into wild type LVS using the same procedure as Step3.1.1. About 52 transformants were selected and 10 were tested for bioluminescence from lux operon with pUTminiTn3kmlux in DH5
pir for the positive control and wild type LVS for the negative control.
Data was shown on Chart2.
Chart2: Bioluminescence of LVS/lux operon
Series1
40 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Bioluminescence of LVS/Lux operoon
250000
200000
150000
100000
Series1
50000
0 pU
Tm in iTn
5km lu x wt
L
VS
Co lo ny1
Co lo ny2
Co lo ny3
Co lo ny4
Co lo ny5
Co lo ny6
Co lo ny7
Co lo ny8
Co lo ny9
Co lo ny1
0
Sample
Data recorded on UTSA TVDC notebook #2, page147 for Chart2.
From Chart2, only RLU of colony7 was close to wt LVS (the negative control), so it was eliminated from the possibility of U112 carrying lux operon. The other 9 colonies were considered as U112 with lux operon, and colony3 was designated as KKF337.
3.1.4 From Chart1 and 2, we observed that the reactive light unit from
U112/pKEK1194 or LVS/pKEK1194 (about 200,000 RLU at most) was much lower than DH5
/pKEK1194 (over 7,000,000 RLU on Chart1). The reason might be that lux operon worked much better under E.Coli promoter in
DH5
/pKEK1194 than it did under Francisella promoter in U112/pKEK1194 or
LVS/pKEK1194
Data recorded on UTSA TVDC notebook #2, page140-148.
4 Significant decisions made or pending
None.
5.
Problems or concerns and strategies to address
None
6. Deliverables completed
KKF337 (LVS carrying Lux operon under the Ft promoter )
KKF341 (U112 carrying Lux operon under the Ft promoter)
7. Quality of performance
Good
8. Percentage completed .
About 37% of scientific work completed.
41 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
9. Work plan for upcoming month i. Preparation for construction of recA and IglC double mutant in Schu S4.
10. Anticipated travel
The TVDC annual meeting on Oct.6-7, 2008 in Arizona.
11. Upcoming Contract Authorization (COA) subcontractors
None.
Milestone description: Compare Cellular Immunogenicity of
and
-
Based Vaccine Platforms. Measure cellular immunogenicity of live-attenuated vaccine platforms. Compare immunogenicity of KBMA tularemia vaccine platforms
Institution: Cerus/Anza
1. Date started: 4/1/2008
2. Date completed: P ending
3. Work performed and progress including data and preliminary conclusions
Summary of objectives: We will construct and prepare live and KBMA Listeria monocytogenes
(Lm) vaccines expressing Ft antigens. To directly compare the cellular immunogenicity of Lm and Ft-based vaccines, each Lm vaccine candidate will express an antigen fused to a model ovalbumin epitope SIINFEKL (SL8) and these will be compared to Ft vaccines expressing pepO-
SL8 fusions (provided by UTSA). We will measure the ability of each vaccine to stimulate a CD8
T cell response in vitro using a B3Z assay. We will measure the cytokine responses elicited by vaccination with each platform in mice, compare the CD8 T cell response to SL8 after prime and boost vaccinations in mice using intracellular cytokine staining (ICS) and ELIspot assays and measure the potency of the T cells elicited by use of an in vivo cytotoxicity assay.
We previously demonstrated that iglC-SL8 fusion proteins are expressed to a higher level than katG-SL8 in the cytosol of macrophages. Live-attenuated vaccines expressing either antigen were able to stimulate the B3Z-T cell line that responds to the SL8 peptide. The IglC-SL8 fusion protein induced a stronger immune response in mice than katG-SL8 by ICS and ELISpot.
Incorporation of a constitutively active prfA allele into the chromosome of the live-attenuated LM-
IglC-SL8 vaccine increased immunogenicity by 2-fold. Inclusion of a much larger tag (containing an additional 4 epitopes from vaccinia virus) decreased the immunogenicityof the Lm vaccine.
1) Cloning of Listeria monocytogenes (Lm) tularemia vaccine strains.
A summary of vaccine candidates that have been constructed is presented in table #1 below. Strains highlighted in yellow have new information. The strain BH2106
actA
inlB ActAN100-KatG-SL8 did not stimulate B3Z cells and was remade, the new strain number is BH2282. For this reason, the bivalent strain
actA
inlB BH2184 also needs to be remade using BH2282 as the correct background, and is in progress. Expression of KatG-SL8 from the
actA
inlB
uvrABprfA G155S strain BH2172 did stimulate B3Z cells, and thus the bivalent vaccine strain expressing iglC-B8R and KatG-SL8 was constructed in this background (BH2292) and will be tested for immunogenicity in the upcoming month.
42 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Table 1
Strain Genetic Background
CRS-100 actA
inlB
BH137 actA
inlB
BH1222
actA
inlB
BH2282
actA
inlB
BH1228
actA
inlB
uvrAB
BH1398 actA
inlB
uvrAB
BH2094 actA
inlB
uvrABprfA G155S
BH2172 actA
inlB
uvrABprfA G155S
BH2098 actA
inlB
BH2100
BH2180
actA
BH2182
actA actA
inlB
inlB inlB
uvrABprfA G155S
uvrABprfA G155S
BH2184 actA
inlB
Antigen Cassette none
ActAN100-Ova
ActAN100-IglC-SL8
ActAN100-KatG-SL8
ActAN100-IglC-SL8
ActAN100-KatG-SL8
ActAN100-IglC-SL8
ActAN100-KatG-SL8
ActAN100-IglC-VacQuad-SL8
ActAN100-IglC-VacQuad-SL8
ActAN100-IglC-B8R (@ comK)
ActAN100-IglC-B8R (@ comK)
Status
Sequence verified
Sequence verified
Sequence verified remade
Sequence verified
Sequence verified
Complete
Complete
Complete
Complete
Complete
Complete
BH2292 actA
inlB
uvrABprfA G155S
ActAN100-IglC-B8R (@ comK)
ActAN100-KatG-SL8 (@tRNA arg )
ActAN100-IglC-B8R (@ comK)
ActAN100-KatG-SL8 (@tRNA arg )
Remake in progress
Complete
2) Quality control of 400mL-scale LVS vaccine lots. The LVS-pepO-SL8 vaccine lot (NB#
963-092) titer is 3 x 10 9 cfu/mL with no contaminants detected. DVC lot 16 LVS (amplified according to the TVDC SOP (NB# 2001-012) had visible contamination and will be destroyed and remade. 3 new vials of DVC lot 16 LVS were received from UNM for this purpose.
4. Significant decisions made or pending
Because the vaccinia virus quadrotope tag significantly decreased the immunogenicity of the iglC vaccine, this tag will not be used for further immunogenicity studies.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
7. None Quality of performance
Excellent
8. Percentage completed
15%
9. Work plan for upcoming month
We will evaluate the immunogenicity of the bivalent Lm
actA
inlB
uvrABprfA G155S strain expressing IglC-B8R and KatG-SL8 fusion proteins and compare the immunogenicity with each monovalent strain and with co-administration of both.
We will reconstruct the bivalent IglC/KatG vaccine strain on the
actA
inlB background
We will perform B3Z assays on the newly-constructed strains
We will remake a vaccine stock of DVC lot 16 LVS according to the TVDC SOP
10. Anticipated travel
Will travel to the UNM TVDC annual meeting in Phoenix AZ on October 6 and 7, 2008
11. Upcoming Contract Authorization (COA) for subcontractors
None
43 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Milestone description: Characterize the Cellular Immune Response that Correlates with Protection Against an LVS Challenge and demonstrate that Cerus Strains of
Live and KBMA Lm-IglC and Lm-KatG Protect Against a SchuS4 Challenge
Institution: Cerus/Anza
1. Date started: 6/1/2008
2. Date completed: P ending
3. Work performed and progress including data and preliminary conclusions
Summary of objectives: We will measure the T-cell response to IglC induced by live and KBMA
Lm expressing IglC compared with those elicited by Ftn or LVS vaccination. We will produce an
IglC overlapping peptide library (15aa overlapping by 11aa) to identify IglC epitopes that are recognized by mouse T cells. We will use the IglC peptide library for ELISpot and ICS assays to measure the IglC-specific T cell responses induced after vaccination with live and KBMA Lm-IglC and compare to live and KBMA Ftn and LVS vaccination. We will demonstrate that the mechanism of protection induced by Lm vaccines is cellular, by depletion of T cell populations and passive transfer studies. We will demonstrate that strains of Live and KBMA Lm -IglC-SL8 and Lm -KatG-SL8 protect against a SchuS4 challenge and we will produce lots of KBMA vaccine and send to UNM for testing in animal models (mice and rats).
Previously, we determined that Lm strains expressing IglC can induce IglC-specific immune responses in five different strains of mice (Balb/c, C57BL/6, FVB/NJ, C3H/HeJ, and SJL/J) one week after IV administration with 1
10 6 CFU of LmIglC (∆ actA
inlB ∆ uvrAB prfA* G155S-IglC-
SL8; BH2094). Immune responses were primarily observed to peptides in IglC pool2 (peptides
26-51). By performing ELISpot asays using individual peptides, we were able to map the responses to specific regions of the IglC protein. Using ICS and flow cytometry we were able to determine which responses were mediated by CD4- or CD8-positive T cells.
1) Analysis of boost responses . 21 days after primary vaccination with Lm-IglC strain BH2094, animals were given a boost vaccination with 1
10 6 CFU by IV. One week after the boost vaccination, animals were sacrificed and spleen cells were harvested and analyzed by ICS and
ELISpot. Data from the prime and boost vaccination were compared. By ELISpot analysis (figure
1) a boost vaccination increased the responses to pool 2 peptides only in Balb/c mice. The responses in C57BL/6 mice and SJL mice were weaker and were not boosted by a second vaccination. By ICS analysis (figure 2) the boosted pool2 response from Balb/c mice was CD4positive T cells and resulted in a 2 to 3-fold increase in T cell frequency.
44 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
800
600
400 unstim iglC pool 1 iglC pool 2
LLO pool
Prime
Boost
200
0.10
0
Balb/c C57BL/6 SJL
Figure 1, ELISpot analysis after a single vaccination (circles) and a boost vaccination (triangles) with Lm-IglC in Balb/c, C57BL/6, and SJL mice. IM08-059 #1 and #2, Notebook #2000; pp 11-14,
16-21. iglC pool1 iglC pool2
2.5
0.15
CD4 CD4
CD8 CD8
2.0
1.5
0.05
0.00
1.0
0.5
0.0
C57BL/6 SJL C57BL/6 SJL
Figure 2, ICS data after a single vaccination and a boost vaccination in Balb/c, C57BL/6, and SJL mice. IM08-059 #1 and #2, Notebook #2000; pp 11-14, 16-21.
2) Repeat analysis of primary responses . 7 days after primary vaccination with 1
10 6 CFU
Lm-IglC strain BH2094 by IV route, animals were sacrificed and spleen were harvested and analyzed by ELISpot and ICS. By ELISpot analysis (figure 3), responses to pool 2 peptides were measured in Balb/c, C57BL/6, and C3H/HeJ mice that were similar in magnitude to those previously reported. By ICS analysis (figure 4), there was a low, but measurable CD8 response to pool1 peptides in Balb/c mice, as seen previously. Using ICS and individual peptides mapped previously (figure 5), in Balb/c mice, a small CD8 response was seen to peptide 9 and a strong response to peptide 34 was seen. In C57BL/6 mice strong CD8 responses were seen to peptide
45 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
34 and 35, and in C3H mice CD4 responses were seen to peptides 23 and 35 and CD8 responses were seen to peptides 33 and 34. These results were similar to those previously reported.
500
400 unstim iglC pool 1 iglC pool 2
LLO pool
300
200
100
0
Balb/c C57BL/6 C3H/HeJ
Figure 3, ELISpot analysis after a single Lm-IglC vaccination in Balb/c, C57BL/6, and C3H/HeJ mice. IM08-074, Notebook #2000; pp 15, 17-21 iglC pool1 iglC pool2
1.5
0.15
CD4
CD8
1.0
0.10
CD4
CD8
0.5
0.05
0.0
0.00
-0.5
-0.05
Figure 4, ICS analysis after a single Lm-IglC vaccination in Balb/c, C57BL/6, and C3H/HeJ mice.
IM08-074, Notebook #2000; pp 15, 17-21
46 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
C3H mice
C57BL/6 mice
Balb/c mice
0.8
0.15
1.5
CD4
CD8
CD4
CD8
0.6
1.0
0.10
0.4
0.5
0.05
0.2
0.0
9 33 34 0.00
34 35
0.0
23 33 34 35
CD4
CD8
Figure 5, ICS analysis after a single Lm-IglC vaccination in Balb/c, C57BL/6, and C3H/HeJ mice.
IM08-074, Notebook #2000; pp 15, 17-21.
3) Fine peptide mapping of CD8 responses . Splenocytes from either primed or boosted mice were analyzed by ELISpot using 9mers that overlapped by a single amino acid and spanned the previously-mapped reactive 15mers. In Balb/c mice, a small CD8 response was seen to 15mer peptide#9, but the magnitude of this response increased by approximately 2 fold when cells were stimulated with 9mers 9.3 and 9.4 (figure 6). Because there were 2 consecutive 9mers that were reactive, a 10mer spanning 9.3 and 9.4 will be ordered to determine if a 10mer will stimulate these T cells optimally. In C57BL/6 mice, CD8 responses to peptide 34 and 35 were mapped using 9mers identifying a single dominant 9mer (#33.10) which is completely contained in both peptides 33 and 34 (figure 7). In C57BL/6 mice the boosted responses were of higher magnitude than the primary responses, but in both cases responses to the 9mer #33.10 were generally twice the magnitude of the responses to 15mer #35. In C3H/HeJ mice, CD8 responses to peptides 33 and 34 were mapped using the same 9mer panel spanning peptides 33-35 (figure
8). The response was mapped to an optimal 9mer peptide #33.5 (contained in both 33 and 34) which yielded stronger responses that either the 15mer peptides 33 or 34.
.
9
9
9.6
9.5
9.4
9.3
9.2
9.6
9.5
9.4
9.3
9.2
9.1
9.1
1-1
1-2 unstim unstim
0 10
IFN-
20
SFC/2e5 cells
30
Figure 6, ELISpot analysis with 9mer peptides after a boost vaccination (left panel IM08-059 #2,
Notebook #2000; pp 16-21) and a single vaccination (right panel, IM08-074, Notebook #2000; pp
15, 17-21) with Lm-IglC in Balb/c mice.
1-1
1-2
47 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
WGIMIDLSNLELYPI
TDEAWGIMIDLSNLE
35
34
WGIMIDLSNLELYPI
TDEAWGIMIDLSNLE
35
34
LSNLELYPI
DLSNLELYP
IDLSNLELY
MIDLSNLEL
IMIDLSNLE
GIMIDLSNL
WGIMIDLSN
AWGIMIDLS
EAWGIMIDL
DEAWGIMID
TDEAWGIMI
KTDEAWGIM
YKTDEAWGI
EYKTDEAWG
QEYKTDEAW
33.15
33.14
33.13
33.12
33.11
33.10
33.9
33.8
33.7
33.6
33.5
33.4
33.3
33.2
33.1
unstim
2-1
2-2
LSNLELYPI
DLSNLELYP
IDLSNLELY
MIDLSNLEL
IMIDLSNLE
GIMIDLSNL
WGIMIDLSN
AWGIMIDLS
EAWGIMIDL
DEAWGIMID
TDEAWGIMI
KTDEAWGIM
YKTDEAWGI
EYKTDEAWG
QEYKTDEAW
33.15
33.14
33.13
33.12
33.11
33.10
33.9
33.8
33.7
33.6
33.5
33.4
33.3
33.2
33.1
unstim
IFN-
SFC/2e5 cells IFN-
SFC/2e5 cells
Figure 7, ELISpot analysis with 9mer peptides after a boost vaccination (left panel IM08-059 #2,
Notebook #2000; pp 16-21) and a single vaccination (right panel, IM08-074, Notebook #2000; pp
15, 17-21) with Lm-IglC in C57BL/6 mice.
WGIMIDLSNLELYPI
TDEAWGIMIDLSNLE
35
34
LSNLELYPI 33.15
DLSNLELYP
IDLSNLELY
MIDLSNLEL
IMIDLSNLE
33.14
33.13
33.12
33.11
33.10
GIMIDLSNL
WGIMIDLSN
AWGIMIDLS
EAWGIMIDL
DEAWGIMID
TDEAWGIMI
KTDEAWGIM
YKTDEAWGI
EYKTDEAWG
QEYKTDEAW
33.9
33.8
33.7
33.6
33.5
33.4
33.3
33.2
33.1
unstim
2-1
2-2
IFN-
SFC/2e5 cells
48 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
Figure 8, ELISpot analysis with 9mer peptides after a single vaccination (IM08-074, Notebook
#2000; pp 15, 17-21) with Lm-IglC in C3HHeJ mice.
These ICS and ELISpot results demonstrate that IglC induces a cellular immune response when secreted from a live-attenuated Lm vaccine strain and we have mapped CD4 and
CD8 responses to individual peptides in different strains of mice. Using optimized peptides for each strain of mouse will enable ICS and ELISpot assays to be used with the broadest dynamic range. In the coming month we will attempt to determine whether mice vaccinated with LVS induce an immune response to the same peptides as those induced by Lm and we will compare the magnitude of these immune responses.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
UNM and Anza area negotiating the MTA language to allow sharing of information and reagents from UCLA.
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
16%
9. Work plan for upcoming month
Anza will order 10mer peptides to identify optimal CD8 T cell epitopes from
C57BL/6 mice
Anza will vaccinate mice with LVS and Lm to compare the IglC responses
Anza will vaccinate mice with various Lm vaccines to determine whether IglC,
KatG, or both protect against lethal LVS infection
Once MTA is approved, live and KBMA Lm lots can be sent to UNM for evaluation in SchuS4 challenge model
10. Anticipated travel
Will travel to the UNM TVDC annual meeting in Phoenix AZ on October 6 and 7,
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone description: Optimization of KBMA
Vaccination Route and Regimen.
Institution: Cerus/Anza
1. Date started: 6/1/ 2008
P ending
3. Work performed and progress including data and preliminary conclusions
Summary of objectives: We will compare various routes of administration including IV, IM, IN,
ID and oral. For oral, IN, and ID administration in mice, we will first mutate the inlA gene of
Lm to allow for binding of murine E-cadherin in order to mimic the human interaction as described in Wollert et al., Cell, 2007). We will compare the potency of the inlA gain of function mutants to our traditional platform strain. Routes will be ranked by ability to induce a cellular immune response using ELISpot, ICS, and in vivo cytotoxicity. We will optimize dosing regimen of most potent and tolerable route. Lm expressing IglC and/or KatG will be used to evaluate immunogenicity. Optimized route and regimen will be confirmed by SchuS4 protection studies at UNM.
49 of 50
Tularemia Vaccine Development Contract: Technical Report
Period: 8/01/2008 to 8/31/2008
Due Date: 9/15/2008 and Prepared by: Rick Lyons, Barbara Griffith ,Terry Wu, Bob
Sherwood, Dana Pohlman, Michelle Valderas, Trevor Brasel, Julie Wilder, Justin Skoble,
Kathryn Sykes, Stephen Johnston, Mitch Magee, Karl Klose and Bernard Arulanandam
We have previously constructed vaccine candidates that contain the inlA gain of function mutations (Table 2). The sequence of the wild-type EGDe inlA gene (from the Lm strain used in the Wollert manuscript) was synthesized and the inlA gene in our platform strain was replaced ( inlA WT ) in our live-attenuated and KBMA platform strains as there are a number of differences in the sequence between the native sequences between these strains. Two point mutations, S192N and Y369S, were incorporated into the EGDe inlA sequence ( inlA M ) and inserted into the chromosome of our live-attenuated and KBMA platform strains. Into these 4 strains the ActAN100-iglC-SL8 expression cassette was inserted using the integration vector pINT. Expression analysis of the iglC-SL8 cassette has yet to be performed. Once the expression has been confirmed, biodistribution, virulence and immunogenicity studies (ICS and ELIspot) will be performed.
This month C57BL/6 mice were vaccinated with BH2164 (Lm
actA
inlBinlA WT
ActAN100-IglC-SL8) and BH2194 (Lm
actA
inlBinlA M ActAN100-IglC-SL8) by both the IV and oral route to determine whether the inlA M gain of function contributes to immunogenicity.
We will evaluate systemic cellular immunity by ICS and ELISpot using SL8 peptide and recently-mapped peptide 33.10
Table 2
Strain Genetic Background
CRS-100 actA
inlB
BH2130 actA
inlBinlA WT
BH2164 actA
inlBinlA WT
Antigen Cassette none none
ActAN100-IglC-SL8
BH2170 actA
inlBinlA M
BH2194 actA
inlBinlA M none
ActAN100-IglC-SL8
BH2132 actA
BH2166
actA
BH2134
actA
inlB
inlB
inlB
uvrABprfA uvrABprfA
G155S
G155S inlA inlA
WT
WT
none
ActAN100-iglC-SL8 uvrABprfA G155S inlA M none
BH2168 actA
inlB
uvrABprfA G155S inlA M ActAN100-iglC-SL8
Status
Sequence verified
Sequence verified
Sequence verified
Sequence verified
Sequence verified
Sequence verified
Sequence verified
Sequence verified
Sequence verified
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
3%
9. Work plan for upcoming month
Immunogenicity of inlA WT and inlA M live-attenuated strains expressing IglC-SL8 will be evaluated in after IV and oral administration.
Infectivity of inlA WT and inlA M expressing live-attenuated strains will be evaluated in the
CACO2 cell line.
10. Anticipated travel
Will travel to the UNM TVDC annual meeting in Phoenix AZ on October 6 and 7,
11. Upcoming Contract Authorization (COA) for subcontractors
None
50 of 50
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )