Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 3, 4, 5, 7, 11, 12/13(UNM/LBERI), 14, 17, 19, 21(UNM/LBERI), 26, 27,
28, 35(ASU/UNM), 49, 50, 52, 55
Completed milestones: 1, 25, 32, 33, 34 (UNM/ASU), 16, 39, 40, 43 (UTSA), 48, 51
Milestones terminated after initiation: 41, 42, 44, 46, (MSCR will be written)
Milestones terminated before initiated: 43 (Cerus), 45, 47 (MSCR will not be written)
Inactive milestones: 6, 8, 9, 10, 15, 18, 20, 22, 23, 24, 29, 30, 36, 37, 38, 53, 54, 56,
57, 58, 59
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. 4 UNM participants completed 28 day follow-ups.
b. 1 LBERI participant completed 28 day follow-up.
c. 1 UNM participant scheduled for 4/29/08 did not go to USAMRIID and may be
rescheduled in the future.
d. 13 LVS vaccinees have volunteered to donate blood for immunoassay development
under the TVDC.
4. Significant decisions made or pending
a. Dr. Lyons received UNM IRB approval to allow blood draws on the vaccinated LBERI and
UNM scientists after their LVS vaccinations. The LVS vaccinated LBERI and UNM
scientists and staff are being offered the opportunity to volunteer to donate bloods for the
development of immunoassays, approximately 2 months after receiving the LVS
vaccination.
b. USAMRIID has temporarily halted offering the LVS vaccine as of 4/29/08, until a new
study protocol is activated, possibly by late summer 2008
c. UNM (4) and LBERI (33) are vaccinated; UNM and LBERI could offer the LVS
vaccinations up to 9 more scientists to total up to 46. The CRDA with USAMRIID is valid
for 2 years, ending June 2009.
5. Problems or concerns and strategies to address
a. One UNM and one LBERI scientist are medically pending. One UNM scientist may be
rescheduled for LVS vaccination. The next LVS vaccinations will not occur until
USAMRIID’s new protocol is activated.
Page 1 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
b. The UNM TVDC Project Manager has requested pricing for the annual health screening
to be performed at the UNM Employee Occupational Health Services for the LBERI and
UNM LVS vaccinees.
6. Deliverables completed
a. A total of 37 participants (33 LBERI and 4 UNM participants) have received the LVS
vaccination since 9/11/07.
7. Quality of performance
Excellent
8. Percentage completed
66%
9. Work plan for the next month
a. Obtain UNM EOHS pricing for the annual health screening required by USAMRIID and
being performed at UNM for the LBERI and UNM LVS vaccinees.
b. UNM will be obtaining blood donations from LVS vaccinees for immunoassay
development and reimbursing participants $40/ donation.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
UNM will be requesting a modification to COA#15, once the annual health screening cost is
established.
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
No bioaerosol optimization testing was performed during the month of April.
4. Significant decisions made or pending
a. UNM and NIAID performed a site visit on 4/24/08. After data collected to date was
discussed, the decision was made to use the following parameters for all future
bioaerosol exposures:
i.
Bioaerosols will be generated from Brain Heart Infusion Broth (BHIB) using the
Aeromist nebulizer operated at 10 psig delivered.
ii.
Challenge material will be F. tularensis (SCHU S4) harvested from fresh, 48h
Chamberlains broth cultures produced via inoculation with a single colony
obtained from a 48h BCGA culture (both grown at 37°C); Chamberlains
suspensions will be grown in 50 mL volumes in 500 mL baffled flasks at 150 rpm
in the dark.
iii.
The relative humidity of the exposure system will be maintained at 60-90%.
iv.
Bioaerosols will be collected into BHIB plus antifoam A using the AGI-4 impinger.
v.
All colony enumeration procedures will be performed on BCGA and will be
allowed to incubate at 37°C for 48h ± 8h.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
Aeromist selected as generator
7. Quality of performance
Good
Page 2 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
8. Percentage completed
98%
9. Work plan for next month
a. Complete Milestone Completion Draft Report
b. Complete and submit SOP drafts used on MS3
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 4
Milestone description: Confirmation of aerosol in vivo in NHP
Institution: LBERI
1. Date started: 11/1/06
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions:
a. A direct comparison of Collison and Aeromist bioaerosol delivery to 20 mice was
performed. This follow-on study focused on lung deposition as influenced by the two
generators. Aeromist-generated SCHU S4 demonstrated slightly higher deposition rates
in mice versus bacteria that were generated using the Collison nebulizer. Data
(summarized below) are located in the following folder: \\Saturn\absl3\Agent and Study
Specific Data and Miscellaneous Documents\STUDY SPECIFIC DATA\FY07-083 and 089 (TUL-04)\9APR08 Mouse exposure.
Page 3 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Group
Animal #
Animal
Weight
(g)
Sample
Time
(min)
Challenge
Material
Aerosol
Concentration
Calculated
inhaled
volume
Delivered
dose
Deposited
dose
CFU/L
L
CFU
CFU
%
Dep
A
LB18488
19.8
10
Collison Low
2.40E+04
0.21
5007
173
3.5
A
LB18494
19.5
10
Collison Low
2.40E+04
0.21
4946
0
0.0
A
LB18446
23.7
10
Collison Low
2.40E+04
0.24
5791
132
2.3
A
LB18440
25.1
10
Collison Low
2.40E+04
0.25
6066
86
1.4
A
LB18449
23.0
10
Collison Low
2.40E+04
0.24
5652
44
0.8
B
LB18487
19.8
10
Collison High
4.51E+05
0.21
94209
22
0.0
B
LB18495
20.2
10
Collison High
4.51E+05
0.21
95746
1304
1.4
B
LB18496
19.1
10
Collison High
4.51E+05
0.20
91505
368
0.4
B
LB18444
25.0
10
Collison High
4.51E+05
0.25
113769
1925
1.7
B
LB18441
22.0
10
Collison High
4.51E+05
0.23
102591
2479
2.4
C
LB18492
20.0
10
Aeromist Low
1.93E+04
0.21
4062
108
2.7
C
LB18490
19.6
10
Aeromist Low
1.93E+04
0.21
3996
65
1.6
C
LB18442
26.3
10
Aeromist Low
1.93E+04
0.26
5069
44
0.9
C
LB18450
23.0
10
Aeromist Low
1.93E+04
0.24
4548
109
2.4
C
LB18448
22.4
10
Aeromist Low
1.93E+04
0.23
4452
66
1.5
D
LB18493
19.3
10
Aeromist High
1.44E+05
0.20
29529
672
2.3
D
LB18491
20.1
10
Aeromist High
1.44E+05
0.21
30515
1120
3.7
D
LB18497
18.3
10
Aeromist High
1.44E+05
0.20
28285
1887
6.7
D
LB18443
24.3
10
Aeromist High
1.44E+05
0.25
35578
912
2.6
D
LB18445
23.3
10
Aeromist High
1.44E+05
0.24
34389
0
0.0
Mean
Dep %
1.6
1.2
1.8
3.0
Data demonstrate that, in general, the Aeromist presented slightly better deposition in the
SCHU S4-challenged mice; however, this conclusion warrants further testing because of
the small number of animals used for this study and the variability observed among all
subjects. These data do demonstrate, however, that breathing patterns between mice in
a nose-only exposure chamber may vary significantly. Furthermore, all presented data
are best estimates based on a calculated inhaled volume; the true inhaled volumes are
unknown.
4. Significant decisions made or pending
As concluded in MS3 and taking into account the mouse lung deposition data presented here, the
Aeromist and fresh Chamberlains broth culture will be used for all future NHP exposures.
5. Problems or concerns and strategies to address
A means of estimating SCHU S4 deposition fraction following NHP aerosol challenges needs to
be determined. During the UNM and NIAID site visit held on 4/24/08, it was discussed to use a
subset of animals to determine the actual deposited CFUs in the NHP lung.
6. Deliverables completed
None
Page 4 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
7. Quality of performance
Good
8. Percentage completed
40%
9. Work plan for next month
Perform bioaerosol challenge with two additional primates to confirm that aerosolized fresh
Chamberlain’s broth SCHU S4 is virulent in NHPs. The chosen primates have been screened for
background titer and will be moved into the ABSL-3 Facility on May 9, 2008; challenge is set to
take place on May 14, 2008. The challenge delivered dose will be 25,000 CFU SCHU S4, which
is approximately 1 log higher than December 2007 NHP challenge dose. Aeromist generator will
be used. The primates will be observed daily for up to 28 days for clinical signs of illness. NHP
will be offered enriched vegetable/fruit food, as a clinical measure of health status. NHP will not
be euthanized unless moribund. Post mortem will be similar to NHP study of Dec 2007 but will
also include also include Mesenteric lymph nodes, nasal cavity, gastrointestinal tract.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 5 - UNM
Milestone description: Small species tested for sensitivity to LVS & generation of immunity
against a pulmonary challenge of SCHU S4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc70 study 1 (Notebook 115, pages 98-100)
i. We have repeatedly observed occasional survivors in SCHU S4 challenge
experiments when the other rats in the group challenged with the same dose
died. We do not know if this is due to individual variation in susceptibility or
to technical errors in delivering the inoculum. We have been using a nonsurgical inoculation method that involves inserting a flexible catheter down
the trachea and have occasionally seen the catheter end up in the
esophagus instead.
ii. To address the possible technical problem, we plan to do a side-by-side
comparison between the non-surgical inoculation method and a surgical
inoculation that the laboratory has been using for years to infect mice. The
advantage of the surgical method is that we can see the needle being
inserted into the trachea
iii. We have been practicing the surgical method with LVS and will perform the
side-by-side comparison after we have demonstrated competency and
consistency.
b. Characterization of the Fischer 344 rat model is currently being done under Milestone
11, as the efforts on the Fischer 344 rat model are shifting toward GLP model
efficacy
4. Significant decisions made or pending
The rat model is being further developed under MS 11
Page 5 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
5. Problems or concerns and strategies to address
None
6. Deliverables completed
a. Mouse model completed
b. Guinea pig model completed
c. Rat model completed
7. Quality of performance
NA
8. Percentage completed
70%
9. Work plan for upcoming month
a. Complete sub-milestone completion reports for the mouse, rat, and guinea pigs
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 7
Milestone description: SCHU S4 LD50 in primates determined from selection of challenge
dosing
Institution: LBERI
1. Date started: 2/25/08
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions:
SCHU S4 LD50 determination in cynomolgus macaques is in the planning stages. The objective
of the study is to determine the actual 50% effective dose (ED50) in cynomolgus macaques
following inhalation exposure to Francisella tularensis SCHU S4. ED50 will be used instead of
LD50 because of IACUC and USDA concerns associated with the LD50.
We will plan three rounds of exposure. The goal will be to subsequently narrow down the ED50
value based on morbidity/mortality observations in the primates. Exposures will be performed as
follows:
a. 3 groups of 4 animals (n=12 total). Target doses will be below, at, and above the
achieved values obtained for the December 2007 NHP virulence study and the May 2008
virulence study.
b. 2 groups of 4 animals (n=8 total). Target doses will be below and above the estimated
ED50 value observed in the first round.
c. 2 groups of 4 animals (n=8 total). Target doses will be below and above the estimated
ED50 value observed in the first and second rounds.
The endpoints for each set of exposures will be clinical observations, temperature monitoring,
body weight records, gross necropsy, and viable bacterial blood/tissue cultures.
Tentative start dates are as follows:
a. Phase I: 6/8/08
b. Phase II: 7/21/08
c. Phase III: 9/10/08
Page 6 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
4. Significant decisions made or pending
Confirmation of firm start dates pending. Specific procedures and endpoints need to be detailed
in protocol format.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Fair
8. Percentage completed
5%
9. Work plan for next month
a. Confirm dosing scheme.
b. Confirm endpoints and schedule appropriate personnel.
c. Initiate ABSL-3 move-in and challenge dates.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 11 - UNM
Milestone description: In vivo GLP model efficacy SOPS developed in one small species and
primate and efficacy testing of vaccine candidates
Institution: UNM
1. Date started: 1/16/2008
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ptran2 (Notebook 112, page 75-82)
i. The purpose of this experiment was to repeat Experiment Ptran 1, which
showed that immune rat serum was sufficient to protect naïve rats from a
lethal i.t. SCHU S4 challenge. The experimental design was exactly the
same as Ptran1.
ii. As seen previously in Ptran1, 100% of the rats with immune serum survived
i.t. challenge with ~ 56 SCHU S4 (Fig. 1).
iii. However, the protection mediated by immune serum was different from that
generated by active LVS vaccination and the difference can be seen in two
ways: 1) the spleens from all six rats with immune serum were much larger
than those from LVS vaccinated rats [Fig. 2] and 2) the bacterial load in the
lungs, liver and spleen of the rats with immune serum were consistently
higher than those in LVS vaccinated rats [Fig. 3]. These results suggested
that passive and active immunization protects rats through different
mechanism.
iv. Disappointingly, even more rats with normal serum survived SCHU S4
challenge in this experiment (4 of 6) than in Ptran1 (2 of 6), suggesting that
the protection by immune serum may not be mediated by antibodies.
Page 7 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Nevertheless, it is possible that too much too much serum may have induced
non-specific protective effects and may be eliminated by titrating the amount
of serum.
Figure 1. Passive immunization of Fischer 344 rats against i.t. SCHU S4 challenge. Naïve
Fischer 344 rats (n = 6 per group) were injected i.p. with 2.5 ml of normal or immune rat sera
and challenged i.t. with ~56 SCHU S4
`
Figure 2. Splenomegaly in passively immunized rats challenged with SCHU S4. Rats that
were actively vaccinated with LVS (Vacc) or passively vaccinated with immune rat serum
(V.S) were killed 15 d after SCHU S4 challenge and observed for gross differences
Page 8 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Figure 3. Higher tissue bacterial burden in passively vaccinated rats. Rats that were actively
vaccinated with LVS (A) or passively vaccinated with immune serum (P) were killed 15 d after
SCHU S4 challenge to determine the bacterial burden in the lungs, liver and spleen. Each
symbol represents one animal
b. Experiment Cdep1 (Notebook 112, page 26-30, 45-53, 72-74 )
i. The purpose of this experiment was to determine the role of CD4 and CD8 T
cells in the protection generated in rats by s.c. LVS vaccination against
SCHU S4 challenge
ii. We purchased the OX-8 (anti-CD8) and W3/25 (anti-CD4) hybridomas from
ECACC and the isotype control TS2/18.1.1 hybridoma from ATCC and
contracted with Taconic to produce ascites fluids in mice.
iii. OX-8 is a depleting antibody and W3/25 is a non-depleting, inactivating
antibody that has the same as a depleting antibody in a rat model of
Pneumoncystis pneumonia [TD Thullen et al. Infect Immun (2003) 71:62926297]. As shown in a preliminary in vivo depletion experiment below,
injection of 100 g of the OX-8 ascites fluid depleted CD8 T cells from rats
while injection of the W3/25 ascites fluid had no effect on the number of CD4
T cells compared with injection of the TS2/18.1.1 ascites fluid. We recognize
that there is no way to verify that the W3/25 ascites fluid had any effect on
the CD4 T cells in this experiment and therefore we are in the process of
acquiring the CD4 T cell depleting antibody OX-38 from ECACC
iv. To determine the effects of depleting CD4 or CD8 T cells, rats that had been
vaccinated 3 months earlier were treated i.p. with 1 mg of ascites fluid and
challenged with ~105 SCHU S4. We are currently monitoring the rats and will
report the result in the June 2008 technical report.
Page 9 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Figure 4. Distribution of CD4 and CD8 in spleen of rats treated in vivo with isotype, anti-CD4
or anti-CD8 ascites fluid. Naïve rats were injected i.p. with 100 g of ascites fluid and 3 d
later the cellular content of the spleen was determined
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
9%
9. Work plan for upcoming month
a.
b.
c.
d.
Titrate amount of immune rat serum required for protection of rats against SCHU S4
Titrate the amount of F. tularensis-specific antibodies in immune sera
Monitor the CD4 and CD8-depleted rats in Cdep1
Repeat Cdep1 and challenge earlier after vaccination
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 12/13-UNM
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and Compare assays in animal models (sensitivity)
Institution: UNM
1. Date started: 7/15/06 (MS12) and 12/06 (MS13)
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. No new work done this month.
Page 10 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
Mouse proliferation assay, IFN and IL-2 Elispot, anti-Ft antibody titration
Rat IFN Elispot, anti-Ft antibody titration
Guinea pig anti-Ft antibody titration 
7. Quality of performance
Good
8. Percentage completed
60%
9. Work plan for upcoming month
a. Measure the number of multifunctional cells in the lungs, lung draining lymph nodes,
and spleens from vaccinated BALB/c mice (protective) and C57BL/6 mice (nonprotective) and from BALB/c mice vaccinated intranasally (protective) and
subcutaneously (non-protective)
b. Determine whether LVS vaccinated mice with an active SCHU S4 infection could be
used to increase the sensitivity of the IFN Elispot assay
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 12/13
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and compared to those in other species.
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. Occasionally we observe responses to LVS in PBMCs prepared from non-LVS vaccinated
NHPs in both the IFNγ ELISPOT and proliferation assays
i. We have determined that all NHPs need to be screened for background reactivity to
LVS in order to avoid choosing any high responders to serve as naïve controls or LVS
vaccinees
ii. In the past month, we have screened 12 naïve NHPs for their responsiveness to LVS
and SCHU S4, both heat-killed (HK) and formalin-fixed (FF) preparations
iii. Figure 1 shows the results of the proliferation assay. Figure 2 shows the results of
the IFNγ ELISPOT assays.
Page 11 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Relative Light Units (Mean +/- SEM
Relative Light Units (Mean +/- SEM
Relative Light Units (Mean +/- SEM
Media
LVS hk Hi
4.0E5
LVS hk Mid
A.: TUL 33
LVS ff Hi
LVS ff Mid
3.0E5
LVS ff Lo
LVS hk Super
SCHUS4 hk Super
2.0E5
SCHUS4 hk Hi
SCHUS4 hk Mid
1.0E5
SCHUS4 ff Super
SCHUS4 ff Hi
SCHUS4 ff Mid
0
A04643
A04645
A05254
A05262
A04169
A04308
A04713
A05403
A05988
A05997
4.0E5
B.: TUL 34
3.0E5
2.0E5
1.0E5
0
A02314
4.0E5
C.: TUL 35
3.0E5
2.0E5
1.0E5
0
A04999
Page 12 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Figure 1 (above): Proliferation of PBMCs from non-LVS vaccinated NHPs to LVS and SCHU S4
antigens. All cells were plated at 1 x 106/ml.
350
A.: TUL 33
300
250
200
150
100
50
0
IFNgamma Spots (Mean +/- SEM)
A04643
A04645
A05254
A05262
350
300
B.: TUL 34
250
200
150
100
50
0
A02314
A04169
A04308
A04713
Page 13 of 53
Tularemia Vaccine Development Contract: Technical Report
IFNgamma Spots (Mean +/- SEM)
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Media
350
C.: TUL 35
300
LVS hk Hi
LVS hk Mid
LVS ff Hi
250
LVS ff Mid
200
LVS ff Lo
LVS hk Super
150
SCHUS4 hk Super
SCHUS4 hk Hi
100
SCHUS4 hk Mid
50
SCHUS4 ff Super
SCHUS4 ff Hi
0
A04999
A05403
A05988
A05997
SCHUS4 ff Mid
Figure 2 (above): IFNγ production by PBMCs from non-LVS vaccinated NHPs to LVS and SCHU S4
antigens. All PBMCs plated at 1.33 x 106/ml.
Data Interpretation
i. We observed that the PBMCs from some NHPs exhibited responses to LVS or
SCHU S4.
ii. NHPs whose PBMCs exhibited high responses in the proliferation assay did not
necessarily exhibit high responses in the IFNγ ELISPOT assay (i.e. compare
A04643 or A04999).
iii. In general, if PBMCs responded, they responded the most to LVS ff Hi,
particularly in the IFNγ ELISPOT assay.
iv. We would rather avoid using the following NHPs in a study as a naïve control:
A04643, -4645, 5997, -4308, 4713 and -4999.
v. In addition, A02314 was shown to have a relatively high reactivity to LVS in the
IgG1 ELISA assay; thus, we would not want to use this animal as a naïve control
or an LVS vaccine.
vi. We selected A05254 and A05262 for the upcoming pathogenicity study;
scheduled for aerosol exposure to SCHU S4 on 5/14/08.
Data storage:
Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assay050508.svd;; TVDC 1
TVDC 2 bound notebook (8935): TUL 33 (pps.48 to 55), and TUL 34 (56 to 63); and TUL 35 (66 to 72).
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
97% of scientific work has been completed
9. Work plan for upcoming month
1. Continue to test PBMCs from LVS-vaccinated and non-vaccinated NHPs in the IFN ELISPOT
assay to determine the effect of HK and FF LVS at different concentrations.
Page 14 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
2. Screen the remaining new non-LVS vaccinated NHPs in the proliferation, IFNγ ELISPOT and
IgG anti-LVS ELISA assays.
3. Continue to test the effect of the Cerus freeze-thaw protocol on the performance of the
PBMCs in the immunoassays.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 14-UNM
Milestone description: Assays in vaccinated humans validated (sensitivity)
Institution: UNM/LBERI
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. 13 LBERI/UNM LVS vaccinees are willing to donate blood for the immunoassay
development at UNM.
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
1%
9. Work plan for upcoming month
a. Work with the Decode project group in the Lyons lab to develop SOP for isolating
PBMCs from the peripheral blood of control and vaccinees
b. Develop the IFN Elispot and proliferation assays
c. Develop SOP for quantifying multifunctional T cell cells in control and human LVS
vaccinees
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Page 15 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Milestone 17
Milestone description: In vitro assay for analysis of cellular and humoral elements of the
immune response in vaccinated human and animal’s response to T. tularensis established
Institution: UNM
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
None this month
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
N
8. Percentage completed
1%
9. Work plan for upcoming month
a. Work with the Decode project group in the Lyons lab to develop SOP for inducing
differentiation of monocytes to macrophages
b. Develop SOP for infecting human monocyte-derived macrophages with LVS and
SCHU S4
c. Determine whether PBMC from vaccinees can induce infected monocyte-derived
macrophages to kill intracellular bacteria
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 19-UNM
Milestone description: Direct cytokine effects on growth of F. tularensis in human
macrophages determined.
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc36 study 9 (Notebook 115, pages 81-82)
i. The purpose of this experiment was to determine the cytokine profile of
human alveolar macrophages infected with LVS and SCHU S4
ii. Human alveolar macrophages were infected with LVS and SCHU S4 at MOI
of 1:1, 10:1 and 100:1 (bacteria to macrophages) and then either left
untreated or treated with 15 ng/ml recombinant human IFN. Supernatants
Page 16 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
were collected 1 day after infection for cytokine analysis. The cytokine profile
of the infected macrophages will be reported in the June 2008 technical
report
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Needs improvement
8. Percentage completed
11%
9. Work plan for upcoming month
a. Repeat the cytokine analysis of human alveolar macrophages infected with LVS and
SCHU S4.
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 21
Milestone description: Correlates of protection: in vitro assay or other readout of effector
function of Ft developed for multiple species.
.
Institution: LBERI
1. Date started: 4/8/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. All reagents were ordered in order to set up the intracellular cytokine staining assay in
the NHP PBMCs.
b. Assay was completed on May 6, 2008 using 3 LVS-vaccinated NHPs and data will be
presented to the NIAID in June.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
1% of scientific work has been completed.
Page 17 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
9. Work plan for upcoming month
Set up the intracellular cytokine staining assay using LVS-vaccinated NHPs.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated.
Milestone 21-UNM
Milestone description: Correlates of protection: in vitro assay or other readout of effector
function of Ft developed for multiple species. (T cell-induced macrophage killing of intracellular
bacteria)
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. No new work done
4. Significant decisions made or pending
a. We have been trying to develop the macrophage killing assay into a functional assay
for effective vaccination of mice, rats and humans. So far, we have found that
i. The number of LVS recovered from infected murine macrophages after 3
days can vary widely among replicates within an experiment but the inhibition
of LVS growth was reproducible across experiments;
ii. The number of SCHU S4 recovered from infected murine macrophages
after 3 days can vary widely across experiments and IFN did not
reproducibly inhibit SCHU S4 growth;
iii. The optimal MOI for infecting rat macrophages with LVS is 1:10 (LVS to
macrophages).
5. Problems or concerns and strategies to address
None
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
27%
9. Work plan for upcoming month
a. Improve the consistency in the numbers of LVS and SCHU S4 recovered from
infected murine macrophages after 3 days by:
i. Increasing the incubation period with bacteria and macrophages. We had
previously titrated the MOI with a 1 hr incubation followed by gentamicin
treatment and found MOI of 1:20 to be ideal. Now we will focus on the
incubation time
ii. Promoting the interaction between bacteria and macrophages by centrifuging
the bacteria onto the cells
b. Determine the effect of adding immune T cells on bacterial growth in murine
macrophages
Page 18 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
c.
Determine the MOI for infecting rat macrophages with SCHU S4
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 26
Milestone description: Confirmation of gene and protein expression (develop HTP SOPs
for ORF library production, protein library production, and protein purification)
Description: Prepare a high-throughput protein production system
 Select and test ORF expression constructs
 Select and test IVT Protocols
 Select and test protocols for protein purification
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions:
A. Select and test ORF expression constructs
1. Proper conformation appears to be critical for efficient separation of cross-reacting
molecules from polypeptides by:
i. size filtration
ii. acetone precipitation
iii. Affinity (Ni-binding) purification
2. Decision was made to evaluate methods to improve folding or alternative methods of
purification that are folding-independent.
3. We placed thioredoxin (trx) into our LEE IVT construct designs. The design is shown
in Fig. 1.
ORF
T7-Pro
T7-Pro
Thio.
Thio.
T7-Term
6-His
6-His
ORF
T7-Term
Fig. 1. Thio-fusion LEE schematic.
Page 19 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
4. We have also constructed the same thio expression unit into the E. coli expression
vector pET32b. This will enable us to make recombinant proteins as in vivoproduced controls for the IVT produced samples, if necessary.
5. IVT templates and recombinant bacterial expression plasmids are in the process of
being used to produce an FTU protein that was folding properly without the thio and
another FTU polypeptide that appeared to be misfolding without the thio fusion. No
data is currently available.
B. Select and test IVT Protocols
1. The IVT protocols developed for E. coli based IVT systems have been adapted for rabbit
retic IVT system.
2. We built LEE’s for rabbit reticulocyte expression of a panel of FTU genes and ovalbumin.
The gel in Fig. 2 shows these template-constructs.
1 2
3 4 5 6 7 8
9 10
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Ovalbumin
FTU 721A
FTU 721B
FTU 721C
FTU 1696Aa
FTU 1696Ba
empty
FTU 901
FTU 1712
FTU 1695
Fig. 2. LEE constructs built for FTU protein production in mammalian rabbit retic system.
Data location: Research/CIM/GeneVac/FTU/Contract/Proteome/FTU IVT Data/FTU gels/FTU HTP IVT
DNA gels/Wheat germ constructs/LEE Amplification trial #2 with mod 3-27-08.jpg
3. The rabbit retic IVT products do not stimulate non-specific reactivity in the T cells assay.
Therefore feasibility of using this system was evaluated relative to the issue of reduced
protein yields, when compared to yields generated from bacterial lysate systems.
4. The observed protein yield of 2-20 ng/reaction is within the manufacturer suggested
range. These results are displayed in Table 1.
Page 20 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Table 1. Comparison of yields from bacterial and mammalian in vitro protein synthesis
systems
Template
E.coli lysate
(total ug)
Rabbit Reticulocytes (total
ug)
Ova
68.04
0.003
FTU 721A
28.72
0.002
FTU 721B
18.69
0.003
FTU 721C
6.51
0.003
FTU 901
27.28
0.004
FTU 1695
17.46
0.005
FTU 1696 Aa
27.67
0.003
FTU 1696 Ba
123.44
0.006
FTU 1712
3.43
0.007
Data location: R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU Scintilation results\FTU
IVT Purification TCA results\Comparison IVT yield of E.coli based and Rabbit Reticulocytes
system
5. The results confirm a significant increase in effort and cost would be required to switch to
the mammalian system. Therefore, further efforts toward developing a purification
method for removing the cross-reacting material from the E. coli lysate are warranted.
C. Select and test protocols for protein purification
1. Our current purification protocol provides high quality, clean polypeptide. However yields
are highly variable, many producing no detectable product at all. This can be observed
across the panel of 9 samples shown in Fig. 3 below.
2. Urea is used to denature the IVT Product so as to facilitate His tag exposure and nickel
bead binding.
3. The even numbered lanes are polypeptides post-bead elution (with imidazole) as purified
product. The odd numbered lanes are unpurified, total IVT prior to affinity purification.
4. We conclude that this protocol is not sufficiently robust for our application
Page 21 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Coomassie
1 2
Autoradiograph
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
1,2. Ovalbumin
3,4. FTU 721A
5,6. FTU 721B
7,8 FTU 721C
9,10. FTU 901
11,12.
13,14.
15,16.
17,18.
FTU 1695 Odd #lanes: IVT lysate, unpuriified
FTU 1696Aa Even # lanes: affinity purified eluent
FTU 1696Ba
FTU 1712
Fig. 3. Current IVT polypeptide purification protocol works on some samples but not others.
Data location: Research/CIM/GeneVac/FTU/Contract/Proteome/FTU IVT Data/FTU gels/FTU HTP IVT
Coomassie gels/UNM ship IVT 04-09-08.jpg and research/CIM/GeneVac/FTU/Contract/Proteome/FTU
IVT Data/FTU gels/FTU HTP IVT 35S gels/FTU 9 RR and Ni Purification for UNM ship 4-9-08 01.tif
5. Another requirement for developing an optimal protocol is to optimize the
amount/volume of nickel affinity beads to add to an IVT lysate sample in the
polypeptide purification step.
Page 22 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
1 2 3 4 5 6 7 8 9 10
1
2
3
4 5
6
7
8
9 10
Lanes:
1: IVT,
2: blank
Odd numbers (except 1): Supernatant
3, 4: 5ul beads Even numbers (except 2): Elution
5, 6: 10ul beads
Polypeptide sample is a mixture of: Ova, FTU 721A , FTU 721C,
7, 8: 15ul beads
FTU 1695, and FTU 1696Aa
9, 10: 20ul beads
Fig. 4. Optimizing volume of Ni-magnetic beads used for purification.
Data location: Research/CIM/GeneVac/FTU/Contract/Proteome/FTU IVT Data/FTU gels/FTU HTP IVT
Coomassie gels/Ni magnetic bead volume test 04-16-08.jpg and
/research/CIM/GeneVac/FTU/Contract/Proteome/FTU IVT Data/FTU gels/FTU HTP IVT 35S gels/Ni
magnetic bead volume test 04-17-08.tif
6. The results shown above in Fig. 4 indicate that all five of the polypeptides in
the mixed sample can be optimally retrieved by using the maximum tested
amount of 20ul. We conclude that at least 20ul of bead volume should be
used. We will test further increases to identify optimum.
7. Toward improving exposure of the His tag to nickel beads, we tested the
effect on polypeptide yields of adding the nickel beads to the IVT reaction
during synthesis, rather than after synthesis versus current method of using
urea denaturation following synthesis to expose tag.
Page 23 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
1: 10ul IVT, unpurified
2: 20ul supernatant of 6M urea denatured protein bound on Ni magnetic beads
3: 10ul supernatant from protein purification from Ni magnetic beads incubated during
IVT reaction
(All have been normalized to 10% of total volume)
Fig. 7. Comparing two protocols relative to the efficiency of polypeptide binding to
magnetic Ni beads. Current protocol: adding urea and beads post IVT reaction vs.
Tested protocol: adding beads during IVT reaction, without use of urea.
Data location: Research/CIM/GeneVac/FTU/Contract/Proteome/FTU IVT Data/FTU gels/FTU HTP IVT
35S gels/FTU 9 Urea Ni-IVT purification quantification 04-17-08 02.tif
8. We conclude that by adding beads during reaction we can avoid the use of
urea without loss of polypeptide yield.
9. The next step is to assess performance of these and other samples in T cell
assays (conducted at UNM). The criteria for success are to identify robust,
scalable protocols for generating sufficient quantities of consistent antigen
test material that are able to specifically stimulate immune T cells, in the
absence of nonspecific T cell activity.
10. In these T cell experiments, there is no well-characterized FTU immunogen.
This means that we do not have the opportunity to include an FTU positive
control. In lieu of a F. tularensis antigen, we are using the well-characterized
ovalbumin system as our positive control for specific antigen stimulation of
immune T cells. Within the ovalbumin protein there is a known peptide that
binds a known MHC, and is recognized by a known T cell receptor. This T
cell receptor is cloned and has been used to construct a transgenic mouse
expressing the cognate T cell receptor. Approximately 40% of the
splenocytes will be expressing this receptor. In an immunized animal closer
to ~1% may be expressing a cognate receptor. UNM has these mice and has
used their splenocytes as OVA immune T cells. We have chemically
synthesized the short peptide that binds the cognate MHC, and is recognized
by the OVA T cell. We have in vitro synthesized the full length ova protein in
our systems, and also used “store bought” protein as control for our
protocols. The full length proteins must be taken up by antigen presenting
cells, processed, and then finally bound and presented by the appropriate
Page 24 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
MHC. By contrast the peptide is directly loaded onto the MHC, without
internalization , etc. Consequently, the peptides will more efficiently activate T
cells.
11. Antigen stimulation samples (IVT polypeptides) used in T cell assay Trial #1:.
a. (columns 7)FTU protein with E.coli IVT “as is” (unpurified).
b. (columns 8) Products from current affinity purification method of, adding
urea then Ni magnetic beads post reaction for affinity purification,
followed by imidazole elution.
c. (columns 9) Products from: Incubation of Ni beads during IVT reaction.
Beads were washed. After washing, the beads were resuspended in
PBS. No urea used in protocol.
d. (columns 10) Same binding protocol as in 8, except products were not
eluted from beads: Denature IVT proteins with 6M urea prior to binding
to the Ni magnetic beads. After washing, the beads were resuspended
in PBS and directly added to T cell assay.
e. (columns 11) Products were bound to protein G-beads instead of Ni
magnetic beads. IVT proteins attached to the beads via protein Gbound anti-His antibody. Beads were washed. After washing, the beads
were resuspended in PBS and used directly in T cell assay.
(columns 12) FTU protein with Rabbit reticulocyte IVT “as is”
(unpurified).
f. Row legends are provided alongside plate figure.
g. Control rows contain the following antigens/samples on the splenocytes
No
Ag
*Control row legend, column 7 through 12:
OVA
Sigma OVA
Blank protein G
peptide
protein
beads
Blank Ni
beads
IVT no template
(C12)
Page 25 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
12. IFN ELISpots were performed at UNM: Trial #1
Ovalbumin
Ovalbumin(1/10)
FTU 721A
FTU 721B
FTU 721C
FTU 901
FTU 1695
Control row*
FTU 1696Aa
FTU 1712
FTU 1696Ba
Control row*
Fig. 5. ELISpot of splenocytes from OVA transgenic mice (control splenocytes) .
Right and left panels are duplicates.
Data location: UNM Experiment ID Ftc59 study 16, Notebook 115, pages 85-94
This set of positive control samples demonstrate to us that the OVA peptide and proteins
are both able to stimulate T cells from immune mice to release IFNAs expected the
peptide stimulates a greater number of T cells than the proteins. (columns 2 and 8 in the
control rows vs. columns 3 and 4 in the control rows. We also note that our IVT
ovalbumin protein stimulates a similar number of T cells as does the commercial protein.
We also note that there is no nonspecific stimulation of OVA immune T cells by the FTU
antigens.
13. The same antigen samples described above were used on splenocytes
harvested from LVS-immunized mice. The results are below.
Page 26 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
*Control row legend, column 7 through 12:
Sigma OVA
Blank protein G Blank Ni
No Ag OVA peptide
protein
beads
beads
IVT no template
(C12)
Ovalbumin
Ovalbumin(1/10)
FTU 721A
FTU 721B
FTU 721C
FTU 901
FTU 1695
Control row*
FTU
1696Aa
FTU 1712
FTU
1696Ba
Control row*
Fig. 6. ELISpot of splenocytes from LVS immunize mice. Right and left panels are
duplicates.
Data location: UNM Experiment ID Ftc59 study 16, Notebook 115, pages 85-94
13. Toward enhancing the sensitivity of the T cells, and thereby reducing the
necessary amount of purified antigen needed for the assay, we compared the
performance of bead-bound versus soluble antigen in the T cell assay (IFN –
release ELISPOT).
Page 27 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
14. From these experiments (columns 8 vs. 9-11 of Fig. 6) we conclude that
relative to bead binding efficiency: adding beads during the reaction works as
well as full urea denaturation of the samples post reaction.
15. We concluded from these results that bead-bound antigen requires less
material than soluble sample to stimulate similar levels of cytokine release: in
Fig. 6, compare number of spots a8 to the number in a9-11.
16. If we use bead bound samples, then reducing nonspecific binding to beads
will increase sensitivity of the assay.
17. Next we tested whether we could decrease nonspecific binding in the T cell
assays by preclearing (or depleting) E. coli IVT lysates with nickel beads prior
to using the lysates in a synthesis reaction.
Total protein (ug)
20
18
Ova
16
FTU 1695
14
12
10
8
6
4
2
0
0
25
50
100
Amount of beads (ul)
Fig. 8. Effect of pre-clearing E. coli lysate on total IVT yield.
Data location: R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU Scintilation results\FTU IVT
Purification TCA results\E coli lysate depletion and Ni IVT Purification UNM shipment 8M Urea and
4-29-08
16. The first step in exploring this idea is to determine whether the depletion
adversely affects IVT yields.
17. We conclude from the data in Fig. 8 that up to 50ul of beads can be used to
pre clear the IVT lysate without compromising the capacity of the same lysate
to synthesize polypeptides from LEE DNA templates.
18. A further quantitative analysis was also conducted and shown in Table 2.
Page 28 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Table 2. Effect of pre-clearing E.coli lysate on yield of polypeptide binding to
Ni-beads
Bead
Without pre25 ul
50 ul
100 ul
volume: clearing
IVT Sup Bound IVT Sup Bound IVT Sup Bound IVT Sup Bound
(ug) (ug) to
(ug) (ug) to
(ug) (ug) to
(ug) (ug) to
bead
bead
bead
bead
Ova
FTU
1695
17.04 11.40 5.63
15.5 7
8.5
8.73 1.12 7.61
6.9 2.5 4.4
17.3 6.9 10.4
9.8 4.1
5.7
9.6
3.7 1.3
2.4
3
6.6
Data location: R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU Scintilation results\FTU
IVT For shipment TCA results\E coli lysate depletion and bovine sera bead blocking Ni IVT
Purification UNM shipment 8M Urea and 4-22-08
19. To determine whether nickels beads may not need to be “expended’ in a
preclearing step, the beads were pre-blocked with serum, and then directly
used in the IVT reactions.
20. This protocol showed that a significant reduction in polypeptide yield was a
result of preblocking (Table 3), therefore we conclude that this is not an
optimal approach.
Table 3: Effect of blocking Ni beads with fetal bovine sera prior to polypeptide
binding
Without blocking
FBS blocking
(8M urea)
Ova
81%
61%
FTU 1695
80%
65%
Data location: R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU Scintilation
results\FTU IVT For shipment TCA results\E coli lysate depletion and bovine sera bead
blocking Ni IVT Purification UNM shipment 8M Urea and 4-22-08
20. The preclearing of beads and the co-incubation of beads during synthesis
were trialed in a T cell assay. The critical readouts are low nonspecific
reactivity and high antigen specific reactivity. Our “positive” control is a storebought ova protein used to stimulated ova transgenic mice. We must infer
activity with unknown FTU immunogens and in an unfamilarized model of
disease.
Page 29 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
21. The samples for this trial, UNM Trial #2, were to test the depleting protocols;
these were run in parallel with the experiments presented in tables 2 and 3.
a. Clearing of Ni binding proteins from E.coli lysate prior to IVT reaction
b. Blocking Ni magnetic beads with Fetal Bovine Sera prior to binding of
FTU proteins to the beads.
22. In Fig 9, the wells at the top section of the plate (rows a to d) have OVA
transgenic splenocytes, the bottom section wells (rows e to h) were plated
with LVS vaccinated splenocytes.
23. Red circled wells: show that all cross reactivity from E. coli lysate is removed
using in the “IVT no template pre-cleared with 25ul Ni beads” : compare a1 to
c1 (OVA T cells) and e1 to g1 (LVS Tcells). This shows that the LVS
vaccinated splenocytes are not cross reacting. We have removed the crossreacting material from the E. coli IVT lysate by using the pre-cleared IVT
lysates in the IVT reactions.
24. Sufficient amounts of active antigen were produced to stimulate the OVA
mouse splenocytes, which is our positive control (green circle: a2-c2), relative
to commercial protein (d2). We note that there is little if any increase in spot
counts in the FTU test wells performed in triplicate, e3-g3 relative to a1-g1;
however, there is no nonspeicif stimulation. Since we do not know whether
FTU 1695 will stimulate IFNg this result is not a concern. The fact that the
samples no longer stimulate nonspecific stimulation is progress.
Page 30 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
O
V
A
L
V
S
Columns a-c and e-g:
Columns d and h:
ivt no
ivt no
ivt no
template OVA 25 FTU 1695 template OVA 50 FTU 1695 template
OVA FTU 1695 ivt no
25 µL Ni
µL Ni
25 µL Ni 50 µL Ni
µL Ni
50 µL Ni 100 µL Ni 100 µL Ni 100 µL Ni template
beads
beads
beads
beads
beads
beads
beads
beads
beads
BSA
Sigma
OVA
protein
Sigma
OVA
protein
Sigma
OVA
protein
OVA
peptide
OVA
peptide
OVA
peptide
No Ag
No Ag
OVA
BSA
FTU 1695
BSA
No Ag
Fig. 9. ELISpot results from Trial #2
UNM Experiment ID Ftc59 study 17, Notebook 115, pages 101-108
25. We conclude that adding the Ni beads during the IVT reactions improves
polypeptide “capture”, without requiring use of urea prior to sample use in T
cell assays.
26. We conclude that pre-clearing the IVT lysates with beads prior to IVT
significantly reduces non-specific T cell reactivity, without reducing antigen
specific stimulation of immune T cells.
4. Significant decisions made or pending
We hope to have a team decision before the end of the month on our HTP FTU library
construction, protein production, and purification protocols to employ for this program
5. Problems or concerns and strategies to address
We are reasonably confident that we have now identified a set of purification protocols will be
cost, time, and effort efficient, and produce consistent levels of high quality polypeptide
material to specifically stimulate immune splenocytes. We will repeat experiments to confirm
and “tweak”.
6. Deliverables completed
None
Page 31 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
7. Quality of performance
Very good
8. Percentage completed
99.7%
9. Work plan for upcoming month
Currently we are:
 Testing the thio (thioredoxin) constructs for folding efficiency
 Generating a small set of final test proteins, magnetic Ni and protein G beads for
final evaluation in T-cell assay.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 27-UNM
Milestone description: Optimization of T cell assays and endpoints in mice. (UNM will use
ASU’s protein fragments in lymph node proliferation assays to define vaccine candidates)
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
UNM has been supporting ASU’s effort to troubleshoot the crossreactivity problem with
the in vitro translated proteins. Details of the UNM ELIspot work performed are described
by ASU under MS26
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
None
6. Deliverables completed
NA
7. Quality of performance
Fair
8. Percentage completed
20%
9. Work plan for upcoming month
Perform IFN ELISpot assays for ASU as the need arises
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
NA
Page 32 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Milestone 28
Milestone description: Generation of polypeptide libraries (Optimize IVT proteinfragment production, Develop IVT protocol for high-throughput production, Validate
immunogenicity of protein-fragments, Full scale production of protein-fragment library,
Purification of protein-fragment library, Array protein-fragment into overlapping pools, Ship
to UNM)
Milestone description: Build SCHU4 proteome
 Build ORF expression library corresponding to proteome (active)
 Generate complete protein-fragment library (inactive)
 Array protein-fragments into measurable pools for T cell stimulation
(inactive)
Institution: ASU-Sykes
1. Date started: 03-01-2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
A. Build ORF expression library corresponding to proteome
PCR primers are ready for ORF library production. We will proceed following decisions on
expression system, yield needs, delivery format, pooling capacity, and purification
requirements.
B. Generate polypeptide library
C. Array polypeptide library
4. Significant decisions made or pending.
The decision to complete the polypeptide purification/optimizations of milestone 26 will be made
this month
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Very Good
8. Percentage completed
35%
9. Work plan for upcoming month
Prepare for initiating library production.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 35 - UNM
Milestone description: Array hybridization with mouse RNA from virulent SCHU S4 infection
and RT PCR confirmation of candidates
Institution: UNM
1. Date started: 5/1/2007
2. Date completed: pending
Page 33 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
3. Work performed and progress including data and preliminary conclusions
a. Ftc64 study 2 (Notebook 115, pages 95-97)
i. The purpose of this experiment purpose of this experiment was to determine
the SCHU S4 gene expression pattern at early time points (1, 3, 5, 7, and 24
hr) after intranasal infection with SCHU S4 and to compare that with in vitro
SCHU S4 gene expression pattern in culture. By comparing the genes
expressed in vivo in mouse lungs (stressful conditions) and in vitro in liquid
Chmberlain’s culture (unstressful conditions), it may be possible to determine
the pathways that get turned on in response to the stresses of in vivo
exposure.
ii. We prepared RNA from SCHU S4 grown in Chamberlain’s broth and sent
them to ASU for analysis
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
6%
9. Work plan for upcoming month
UNM will provide RNA and DNA when needed by ASU
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 35-ASU
Milestone description: Array hybridizations with mouse RNAs from virulent Schu 4 infection &
RT PCR confirmation of candidates.
Institution: ASU-Johnston
1. Date started: 08-01-2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions


Previous Results: From the two initial dose-response challenge experiments at a single 4 hr
timepoint, two different amplifications were performed for each of the two experiments. Using all
the data for the challenge doses between 103 to 107 CFU, the data were averaged and we
identified 141 genes consistently elevated among the dose responses at 4 hours post challenge.
We received lung RNA samples from UNM of a time course after a 10 3 CFU challenge. Samples
were collected at 1, 3, 5, 7, and 24 hours after infection. Samples labeled T0 were from
uninfected animals. The LAPT process was performed and the expression data acquired. To
analyze the time course data, we took two pattern mapping approaches (Figure 1). The first was
to map responses that were increasing over time from 1 to 24 hours (Figure 1, left panel). The
Page 34 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
second approach was to identify expression patterns that were high early and decreased over
time from 1 to 24 hours (Figure 1, right panel). We next compared the gene lists from the
increasing and decreasing patterns over the 24 hr timecourse with the previously identified 141
identified in the dose-response challenge at the 4 hr timepoint (Figure 2). This Venn diagram
shows that there is minimal overlap between the gene lists. There were 6 genes identified that
map between the increasing and decreasing responses. However, these are primarily a result of
mapping the response so that the T0 samples were extremely low. Between the 141 4 hour dose
response data ,there were only two genes that were cross identified in the decreasing pattern.
Figure 1. Pattern mapping of Francisella
Figure 2. Venn diagram analysis of the gene lists
tularensis gene expression over time. The black identified with the Increasing and decreasing
line indicates the pattern to be mapped with
patterns over a 24 hrs timecourse (Figure 1) and
either an increasing expression over time or a
the previously identified 141 dose response data
decreasing expression over time.
at a 4 hr timepoint.
 Notebook/File locations
 R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-24 (time course NM samples 4-708)\Results\LAPT24.ppt Page 1 (Figure 1) and page 2 (Figure 2)

From the pattern maps, we identified the top three genes in either the decreasing or increasing
patterns (Table 1). In addition, we identified one gene that is the most stable across the time
course of infection for comparison. These genes will be part of the qPCR validation studies.
Pattern
Gene Name
Product
Increasing
FTT0130
glycerol kinase
FTT0109
Lipid A transport protein, ABC transporter,ATP-binding and membrane protein
FTT0548
DNA polymerase III, epsilon subunit
FTT0058
ATP synthase A chain
FTT0247
Transposase
FTT0815c
hypothetical protein
FTT256c
Lipopolysaccharide protein
Decreasing
Unchanged
Table 1. Top identified genes in the pattern maps of the increasing and decreasing pattern gene
patterns over time.
 Notebook/File locations
 R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-24 (time course NM samples 4-708)\Results\qPCR_gene_list.txt (Page 1)
Page 35 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam

We also assessed the expression patterns of genes of interest identified by literature as being
either potential vaccine candidates or significant for the pathogenicity of SCHU S4. For this first
round of selections we isolated the expression patterns for groEL, katG, dnaK as potential
antigens and the intracellular growth locus (igl) genes (Figure 3, left panel heatmap, right panel
raw signal values). There were no striking patterns of changes over time of these selected genes
with the exception of a trend of several genes (dnaK, katG, iglD) spiking at 3 hours post infection.
These need to be verified in repeat experiments and via qPCR analysis.
Figure 3. Expression patterns of selected potential vaccine candidates or virulence factors.
Expression values are presented as either a heatmap (left panel) or the signal intensities (right panel)
over time
 Notebook/File locations
 R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-24 (time course NM samples 4-708)\Results\LAPT24.ppt Page 3.

We next assessed two genes (FTT1616 - Cysteinyl-tRNA synthetase and FTT0031 - NADH
dehydrogenase I, A subunit) that had been identified in a separately funded research program of
vaccine candidate identification. The expression patterns over time of these two genes are
shown in Figure 4. The Cysteinyl-tRNA synthetase has essentially a stable expression over time
whereas the NADH dehydrogenase increases expression from T1 to T24.
Page 36 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Figure 4. Gene expression patterns of two genes identified in a separate program on vaccine
candidate identification
 Notebook/File locations
 R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-24 (time course NM samples 4-708)\Results\LAPT24.ppt Page 4.


Notebook/File locations …, Notebook 661, LAPT 24, pages 13-20.
R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-24 (Time course NM samples 47-08)
4. Significant decisions made or pending
We are working on a primer design strategy for qPCR validation.
5. Problems or concerns and strategies to address
A minor problem came up in the design of the qPCR primer sets. We were utilizing a primer
design service from Qiagen (we have an Eppendorf real time system) and were waiting for
technical assistance. After several weeks, they stated that there would not be able to help with
the FTU primer design. We will undertake a design process manually. We have been evaluating
several ways to perform the manual design and we will use a primer design program in house,
but manually adjust the primer design so that probe hybridization target is part of the amplicon
6. Deliverables completed
None
7. Quality of performance
Good
Page 37 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
8. Percentage completed
29%
9. Work plan for upcoming month and next 6 months



Compare the gene expression patterns of F. tularensis grown in culture medium to the in vivo
gene expression patterns which were received on April 27tgh.
Establish the Q-RT-PCR process for gene expression validation.
Assess gene expression levels of known potential antigens (tul4, katG, iglC, groEl) in the
current data set.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 41
Milestone description: Optimization of photochemical inactivation and characterization of
KBMA Ft. novicida; determine the amount of S-59 and UVA required to inactivate uvr mutants;
determine extent of metabolic activity of uvr mutants after S-59 and UVA inactivation; determine
the level of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
1. Date started: 3/2/06
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Summary: We have determined that all the NER-deficient strains of Ft. novicida are only slightly
more sensitive to photochemical inactivation than wild type Ft. novicida. We have optimized
photochemical inactivation conditions at a 3.5 mL scale and a 400mL scale and produced a lot of
KBMA uvrB Ft. novicida for potency testing in MS42. We have demonstrated that KBMA Ft.
novicida are highly attenuated for virulence. Frozen KBMA uvrB Ft. novicida maintain metabolic
activity at –80oC for at least 3 months. Inactivated NER-deficient strains have a similar degree of
metabolic activity as the wild-type Ft. novicida strain (which is different than has been seen with
L. monocytogenes or B. anthracis), and we have demonstrated that this lack of sensitivity to DNA
damage is universal to numerous DNA damaging agents.
1) This milestone is currently paused pending approval of modification #2 to subaward
agreement.
4. Significant decisions made or pending
All NER mutants (uvrA, uvrB, and uvrA uvrB) of Ft. novicida were equally sensitive to S-59
and had comparable metabolic activity after inactivation. We have chosen to use the uvrB
single mutant for further experimentation. We have selected 40M S-59 and 7J/cm 2 as the
conditions for making 400ml-scale KBMA lots, and have produced a lot of KBMA uvrB Ft
novicida vaccine that is sterile for further characterization. We have decided to open MS 42 in
order to determine whether KBMA Ft novicida can protect against a lethal wild-type Ft novicida
challenge.
5. Problems or concerns and strategies to address
The 2-fold difference in the concentration of S-59 required for complete inactivation of the
mutants compared to wild type is less than we have observed for other organisms. This appears
to hold true for other methods of induced DNA damage. One possible explanation for this is that
Page 38 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
there is a redundant DNA repair mechanism functioning in Ft novicida that may limit the
sensitivity of the NER-deficient mutants to DNA damage and thereby limit the metabolic activity
and potency of KBMA Ft novicida. If there is a redundant repair mechanism, we may not be able
to produce a highly potent KBMA vaccine utilizing Francisella species as a platform. A new
concern is that Cerus may no longer have enough human resources to complete this milestone in
a timely manner.
6. Deliverables completed
400mL-sacle photochemical inactivation process defined
7. Quality of performance
fair progress
8. Percentage completed
85% of scientific work completed on the milestone
9. Work plan for upcoming month
This milestone has been paused. Following approval of Modification #2 to subaward agreement,
this milestone will be halted and a milestone completion report will be written comprising the
progress to date.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
Modification #r2 to subaward agreement
Milestone 42
Milestone description: Determine whether KBMA F.t. novicida vaccine protects against wildtype F.t. novicida challenge in mice: Vaccination route and regimen optimization, measure
durability of protection against Ft ssp novicida , Evaluate whether Ft ssp novicida can function
as potent vaccine.
Institution: Cerus
1. Date started: 2/1/07
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Summary: KBMA Ft novicida uvrB vaccine stocks produced in MS41 have been tested in mice
for virulence and protection against a 100 x IP LD50 challenge of Wild-type Ft novicida. KBMA Ft
novicida uvrB were 100% protective when a single dose was administered at or near the LD 50 of
the KBMA vaccine (1 x 109 IP, 1 x 108 IV). 100% protection was also achieved by administration
of 1 x 107 KBMA particles IV when the vaccine was given twice separated by 3 weeks. Depletion
of CD4+ T cells prior to the challenge decreased the survival rate to 80%, depletion of C8+ T cells
had no effect, and depletion of both cell populations resulted in 90% survival. Together, these
data demonstrated that CD4 T cells contribute to a protective immune response in a non-CD8 T
cell-dependent manner. These data suggest that the CD4 T cells may be boosting humoral
immunity by stimulating B cells. This interpretation was supported by an adoptive transfer
experiment in which only the high-titer serum from CD8-depleted animals provided any protection
against a lethal U112 challenge. Together these data demonstrate that the protection we see
after vaccination with KBMA Ft novicida uvrB correlates with humoral immune responses and
explains why the KBMA vaccine does not perform better than heat killed vaccine. This also
makes it nearly impossible to rank attenuated Ft novicida mutants by their ability to protect mice
against a lethal challenge. We instead plan to evaluate the ability of KBMA vaccines to induce a
potent CD8 T-cell response to an introduced ovablumin epitope tag and are awaiting the
construction of this strain from UTSA.
Page 39 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
1) This milestone is currently paused pending approval of modification #2 to subaward
agreement.
4. Significant decisions made or pending
We have decided to evaluate the potency of the KBMA Ft novicida vaccine by measuring the
CD8 T cell response to an ovalbumin epitope tag.
5. Problems or concerns and strategies to address
Because humoral immunity plays a significant role in protection of mice against a lethal Ft
novicida challenge it is essentially impossible to rank KBMA vaccine candidates that elicit a
potent T cell response using survival after a lethal Ft novicida challenge in MS 43. We have
requested that Karl Klose construct an ovalbumin epitope-fusion protein to facilitate screening
strains of Ft novicida for their ability to elicit a T cell response to this well-defined epitope.
6. Deliverables completed
None
7. Quality of performance
fair progress
8. Percentage completed
25% of scientific work completed on the milestone
9. Work plan for upcoming month
This milestone has been paused. Following approval of Modification #r2 to subaward agreement,
this milestone will be halted and a milestone completion report will be written comprising the
progress to date.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
Modification #r2 to subaward agreement
Milestone 44
Milestone description: Formulation and evaluation of KBMA LVS: establish photochemical
inactivation regimen of selected uvr mutant of LVS and measure metabolic activity and virulence
of KBMA LVS.
Institution: Cerus
1. Date started: 6/18/2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Summary: using a small-scale inactivation procedure we have determined that the S-59 psoralen
concentration required to inactivate uvrB LVS is 5uM. This is the same concentration at which
we have been able to inactivate WT LVS. The uvrB LVS was also not more sensitive to DNA
damaging agents compared to WT. This suggests that there may be redundant DNA repair
mechanisms in LVS that may be functioning to repair photochemically induced crosslinks.
1) This milestone is currently paused pending approval of modification #2 to subaward
agreement.
4. Significant decisions made or pending
none
5. Problems or concerns and strategies to address
The uvrB mutant of LVS does not appear to be more sensitive to DNA damage induced by
photochemical inactivation with S-59 and UVA or by other chemical means. This suggests that
the potency of a KBMA uvrB LVS vaccine is likely to be the same as KBMA Wt LVS which failed
to protect mice against lethal a schuS4 challenge (see MS46). These results suggest that we
Page 40 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
reevaluate the KBMA tularemia vaccine strategy and we suggest comparing the efficacy of a
KBMA LVS vaccine to a KBMA Listeria monocytogenes vaccine that expresses Ft antigens.
6. Deliverables completed
none
7. Quality of performance
fair
8. Percentage completed
5%
9. Work plan for upcoming month
This milestone has been paused. Following approval of Modification #r2 to subaward agreement,
this milestone will be halted and a milestone completion report will be written comprising the
progress to date.
10. Anticipated travel
none
11. Upcoming Contract Authorization (COA) for subcontractors
Modification #r2 to subaward agreement
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale LVS
culture conditions, Establish 3L culture scale purification conditions, Optimize 3L scale
photochemical inactivation process, Verify protective immunogenicity of vaccine candidates
produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Summary: we have demonstrated that LVS grows robustly in Chamberlains Defined Media
(CDM) and have prepared expanded DVC lot 16 LVS cultures grown in CDM for 36 hours, and
stored at -80oC. We have determined that the minimum concentration of S-59 required for
complete inactivation of DVC lot 16 LVS is 5µM and that photochemically inactivated LVS
maintain metabolic activity for at least 12 hours. We produced a 3L lot of LVS in our fermentor
using .001% Sigma antifoam A in CDM and have demonstrated stability for 4 months at -80o in 2
cryopreservation medias. We have found that the LVS provided by DVC is greatly attenuated for
virulence in mice when administered IP compared to literature reports. We have demonstrated
that LVS replicate rapidly in livers and spleens of mice immediately following IV injection;
however, it appears that there is a lag that specifically affects growth in the lungs. We have also
demonstrated that LVS is nearly avirulent when administered by the SC route.
We have produced a 400mL lot of KBMA wild-type LVS using 10 uM S-59 and 6 J/cm 2 UVA for
initial proof of concept studies, and for later comparison with NER-deficient uvrB LVS and we
have demonstrated that the metabolic activity of this lot is stable for 3 months. We have
demonstrated that KBMA WT LVS IV LD50 is 6.8x108, which represents a 4-5 log attenuation
compared with live LVS. We have demonstrated that doses of KBMA WT LVS as low as 1 x107
provide protection against 100 x IP LD50 challenge of live LVS. However, none of the mice
vaccinated with the equivalent doses of HK LVS died either. This is consistent with protection
against an LVS challenge being largely humoral. b We recently attempted to measure the T-cell
response to a CD4 Tul4 epitope in mice vaccinated with live or KBMA LVS by intracellular
interferon-gamma (IFN-) cytokine staining (ICS) or ELISpot assay, but were unable to detect an
induced response to this epitope. This may be because this epitope does not bind the MHC
molecule with high affinity, or the T cell response elicited by LVS may actively suppress T cell
responses. We recently demonstrated that LVS does not induce IL-6 or MCP-1which are critical
Page 41 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
hallmarks of a protective inflammatory response. Furthermore, co-vaccination with LVS
decreased the innate inflammatory response to Lm. Administration of LVS decreased the ability
of the elicited T cells to produce the cytokine IL-2. Terry Wu at UNM completed a protection
study with KBMA WT LVS in which neither a (IV or IN) prime nor a prime and boost (separated by
3 weeks) vaccination regimen with KBMA WT LVS protected against a lethal SchuS4 challenge in
mice. KBMA WT LVS vaccine appears to be less potent than live attenuated LVS.
1) This milestone is currently paused pending approval of modification #r2 to subaward
agreement.
4. Significant decisions made or pending
Because wt Ft novicida is inactivated with S-59 concentrations that are only slightly higher than
uvrB mutant we have been investigating the efficacy of a wild-type KBMA LVS vaccine. Now
that we have received the uvrB mutant we will focus on producing a lot of KBMA uvrB LVS
5. Problems or concerns and strategies to address
The protection seen with the KBMA WT LVS against a lethal LVS challenge is independent of
metabolic activity. This suggests that comparison of various routes, regimens, or formulations will
be difficult to optimize by protective efficacy. The SchuS4 challenge model in mice is more
stringent, but KBMA LVS failed to protect after two doses. It is possible that the rat model may
allow a higher degree of sensitivity. The suppression of the innate inflammatory response and
the suppression of CD4 T cell cytokine production may potentially indicate that LVS is not a
potent inducer of protective T cell responses. We would like to screen for T-cell responses using
the peptides generated by ASU as an alternative method for optimization of vaccine potency or
construct an overlapping peptide library for IglC.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
53% of scientific work completed on the milestone
9. Work plan for upcoming months
This milestone has been paused. Following approval of Modification #2 to subaward agreement,
this milestone will be halted and a milestone completion report will be written comprising the
progress to date.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
Modification #r2 to subaward agreement
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
Page 42 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
In order to generate mutants in SCHU S4 we need to develop tools to generate successful deletions.
Therefore, our focus is twofold, one is cloning experiments to get our target deletions into vectors that
we can use in creating these deletions and experiments with SCHU S4 itself using constructs that we
believe will allow us to make deletions into SCHU S4.
I. Cloning:
a.
In order to delete an entire pathogenicity island (FPI) from Schu S4 we need to move the
pdpD deletion containing the flip recombinase recognition sites (Flp) from the pwsK30
plasmid into pUC118 vector. In the February report a ligation was done; once this
reaction was purified we transformed DH5α cells and plated these cells on LB ampicillin
plate using the pUC118 digested only (no pdpD::Flp::ErmC added to ligation) as a
control. Since we are using only one restriction site to clone this pdpD deletion construct
(pdpD::Flp::ErmC) we will have a high re-ligation rate. We had thousand of colonies on
the pUC+pdpD::Flp::ErmC and and about 40% less as many for the re-ligation pUC118
control. Therefore, we patched onto 250 ug/ml Erthromycin LB plates twenty randomly
selected colonies and incubated overnight at 37°C. This resulted in eight erythromycin
resistant colonies; these were used to isolate plasmid. The resulting plasmid preparation
were digested with EcoRI restriction endonuclease which will cut both pUC118 and
resulting pUC:pdpD::Flp::ErmC construct only once. The profile should show a visible
increase in size for the correct construct (to about 7.0 Kb). The control pUC118 will be
linearized at 3.2 Kb. (Figure 1).
Figure 1.
Legend:
1. 1 Kb Ladder
1
1 Kb
2
3 4
5
6
7
8
9 10 11 12
2. Uncut pUC118
3. pUC118
4. C1 pUC+pdpD::Flp::ErmC
5. C2 pUC+pdpD::Flp::ErmC
7.0
6. C3 pUC+pdpD::Flp::ErmC
7. C4 pUC+pdpD::Flp::ErmC
3.0
8. C5 pUC+pdpD::Flp::ErmC
9. C6 pUC+pdpD::Flp::ErmC
1.5
10. C7 pUC+pdpD::Flp::ErmC
11. C8 pUC+pdpD::Flp::ErmC
12. Uncut C8 pUC+pdpD::Flp::ErmC
This represents an EcoRI digestion profile of the resulting pUC118+pdpD::Flp::ErmC transformants (lanes
4-11) and the pUC118 cloning vector (lane 3). Lane 2 and 12 represent uncut plasmid profiles. All clones
showed an increase in plasmid size; indicating that we may have cloned in the expected pdpD::flp::ErmC
construct from pKEK1188. Data located in TVD UTSA Notebook 5, page 113.
All eight clones gave the same result so continued by using the oligos pdpD kpnI
forward and reverse oligos to see if we get the correct product size. (Figure 2). Using the
original pKEK1188 pwsK30 construct as a control we determined that the resulting
pUC118 candidates did have the cloned pdpD construct. We still need to prepare a
larger midi plasmid preparation to do further restriction analysis and send for sequencing
before attempting to use for transformation.
Page 43 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Figure 2.
Legend:
1
2
3
4 5
6 7 8 9 10 11
1 Kb
4.0
1.0
1. 1 Kb Ladder
2. KEK1188
3. pUC118
4. C1 pUC+pdpD::Flp::ErmC
5. C2 pUC+pdpD::Flp::ErmC
6. C3 pUC+pdpD::Flp::ErmC
7. C4 pUC+pdpD::Flp::ErmC
8. C5 pUC+pdpD::Flp::ErmC
9. C6 pUC+pdpD::Flp::ErmC
10. C7 pUC+pdpD::Flp::ErmC
11. C8 pUC+pdpD::Flp::ErmC
This represents the profile generated from a polymerase chain reaction using the described
plasmids as templates, respectively, with the oligos pdpD kpn I forward and pdpD kpn I rev. The
expected product size is ≈3800 bp and all the clones (lane 4-11) appear to have the sequence in
their plasmid. Lane 3 is the negative control pUC118 which is the cloning plasmid. Data located
in TVD UTSA Notebook 5, page 113
II. Experiments to generate mutants in Schu4:
a. Continued with additional vgrG screening by PCR of potential vgrG mutants in Schu4. Clone
10 (of last month) was taken and streaked for single colonies on a fresh TSA+++Kan plate at 30
degrees celsius. Isolated colonies were patched on to a TSA+++Kan plate. Chromosomal preps
were performed on 9 of the patched clones. This genomic DNA served as a template for PCR
with a primer specific to FTT1346 (FTT1346 fwd NdeI) and a primer specific to the vgrG stop
codon. Wildtype vgrG plus FTT1352 should yield a PCR product of ~900 bp whereas a mutant
should be shifted to ~1600 bp. Of the 9 clones screened, none showed a shift in sized compared
to wildtype, lane 1 (figure 3). This is an unexpected result since the derivative of these clones
showed a shift in the PCR product size (last month). Previous month’s clones should be
screened again, as well as streaked for singles to check for insertion in vgrG.
Figure 3.
1. ladder
2. WT
3. clone 1
4. clone 2
5. clone 3
6. clone 4
7. clone 5
8. clone 6
9. clone 7
10. clone 8
11. clone 9
Data is located in TVDC Notebook 1, page 28.
b.
The igLD tulatron transformants clones were plated on TSA+++ Kanamycin plates to
streak for more single colonies. We used the first passage clones 2D1G, 2D1H, 2D1J,
Page 44 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
2D2G, 2D2H, 2D2J, 2D3A, 2D3B, 2D4E, 2D4H and 2D4I (first singles). Some of the
resulting single colonies (second singles) were used to prepare chromosomal isolations
and used as templates to look for possible iglD mutants. Using at least three clones from
each group, seven possible candidates appeared to be correct. These “second single”
candidates were used in a repeat PCR reaction (using the same oligos) to confirm the
result (Figure 4). Data located in TVD UTSA Notebook 5, 125-127.
Figure 4.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
1 Kb
2.0
1.0
0.5
Legend:
1. 1 Kb Ladder
2. KKT1
3. 2D1G
4. 2D 1g2
5. 2D1H
6. 2D 1h1
7. 2D 1h2
8. 2D 1h3
9. 2D2 G
10. 2D 2g2
11. 2D 2g3
12. 2D3A
13. 2D3B
14. 2D3C
This represents a PCR screen using 255a igLD tulatron transformants’ genomic preparations as
templates in respective reactions (lanes 3-12). The 255a igLD tulatron transformants are designated as 2D
followed by their respective clone number; followed by the alphabet of the first cycle of single clones (eg.
2D1G); and finally a number indicating the second cycle clone pick (eg. 2D1g2). The oligo set used with
these genomic templates were igLD NdeI for and igLD NcoI rev which should generate ≈1100 bp band size
for the wild-type profile (lane 2) and ≈1900 bp for the correct igLD mutant. The lanes (3, 5, 9, 12, 13, and
14) that are showing both sizes indicates a mixed population or that only one igLD gene was interrupted.
Lanes 4, 6, 7, 8,10,and 11 look correct by this screen. Data located in TVD UTSA Notebook 5, page 127.
d.
Prepared these seven possible igLD mutants for SDS-PAGE analysis; that is, we will run
a protein gel and label with anti-igLD antibodies to verify that the igLD protein has been
disrupted. This would further verify that the “intron” entered both igLD genes in the
pathogenicity islands. This will be discussed on next report.
Did some ordering for enzymes and general supplies for ongoing experiments.
e.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
66%
9. Work plan for upcoming month
a. Will continue the screening for potential igLD mutants in KKT1 SCHU S4 strain. By
western blot analysis and sequencing of PCR products from potential correct candidates.
b. Will continue to screen for vgrG mutants in KKT1 SCHU S4 strain.
Page 45 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
c.
Will continue screening the pUC pdpD::Flp::ErmC candidates by restriction analysis and
sequencing. If verified correct will continue with transformation into the respective pdpA
deletion mutants created earlier. This will allow a complete pathogenicity island to be
removed if we can generate the pdpD deletion in these mutants using this resulting
construct (pUC pdpD::Flp::ErmC)
10. Anticipated travel
None
11.Upcoming Contract Authorization (COA) for subcontractors
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 05/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
50A: Evaluate the protective efficacy of intragastric F. novicida iglB vaccination (prime and
one boost) against SCHU S4 intranasal challenge in C57BL and BALB/c mice. (Note book
#1, page 156). We have boosted the mice intragastrically with the iglB (103 CFU) on April
15. Serum and fecal samples will be collected 3-week after the boost and assayed for
antibody titers. These mice will then be challenged intranasally with SCHU S4 and monitored
for weight loss and survival.
50B-1: Examine by PCR the presence or absence of bacteria in the lungs, livers and
spleens for the first three days following i.g. vaccination. (Note book #8, page 68-74,76, 8589). Mice were immunized intragastrically with LVS (103 CFU) and organs (lungs, liver, and
spleen) were collected from 3 mice everyday for the first 3 days after immunization. DNA was
prepared from each organ (a total of 30-40 mg sampled from 3 random sites) using a High
Pure PCR Template Preparation Kit (Roche). DNA concentration was determined with a UV
spectrophotometer, and 0.1 g of each DNA sample was used in a 20 l PCR reaction to
amplify a 859-bp fragment of LVS Tro gene , which encodes a periplasmic solute binding
family protein (FTL_1936) or a 239-bp mouse GAPDH (glyceraldehyde 3-phosphate
dehydrogenase) gene.
The nucleotide sequences of the primer pair used for Tro
amplification
are
5’-TTGCTAGCGAAAGTGATAAGCCCC
and
5’TCCTCGAGTTTTTGTACTTTATCC,
and
for
GAPDH
amplification
are
5’CTTCCGTGTTCCTACCC and 5’-CAACCTGGTCCTCAGT. PCR was performed using the
GoTag polymerase (Promega) for 35 cycles, and the amplified products of each reaction
were separated in a 1.2% agarose gel and stained with ethidium bromide. The results of two
independent experiments showed that GAPDH gene was amplified from all prepared DNA
samples, and the Tro gene can be detected in DNA prepared from naïve lung spiked with
LVS, however, no Tro gene expression was detected in any LVS-immunized organ (Fig. 1).
These results are in agreement with Emanuel et. al (Detection of Francisella tularensis within
infected mouse tissue by using a hand-held PCR thermocycler, 2003, J. Clin. Microbiol.
Page 46 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
41:689-693) showing that culturing of tissue homogenates is more sensitive than TaqMan
PCR
assays
to
detect
Francisella
in
infected
tissues.
Mouse 1
L V S
Mouse 2
L V S
Mouse 3
L V S
MP TGT GT G TG T G T G T G TG T G
Mouse 1
L V S
Mouse 2
L V S
Mouse 3
L V S
MP TGT GT G TG T G T G T G TG T G
Day1
kb
1.00
0.75
Day2
Day3
Fig. 1. Detection of LVS in mouse organs after intragastric immunization. DNA samples were
prepared from lungs (L), livers (V) and spleens (S) and used as templates (0.1g/reaction) in PCR to
amplify an LVS Tro gene (T, 859 bp) to detect the presence of LVS in the organs or a mouse GAPDH
gene (G, 239 bp) as a DNA quality control. DNA prepared from lung tissues spiked with LVS was
used as a positive control (lane P) for PCR amplification of the Tro gene. Results of two independent
experiments are shown.
50B-2. Analyze the serum and fecal antibody isotypes of mice intragastrically immunized with
F. holarctica LVS at 8 weeks after vaccination. (Note book #8, pages 7, 15, 28, 55-56, 82-84).
Mice were vaccinated iintragastrically with 103 CFU LVS or mock immunized with PBS alone.
At 8 weeks after inoculation, blood and feces were collected. Some mice received a second
booster dose of 103 CFU LVS I.G. Blood and feces were collected from these mice three
weeks after booster vaccination dose. Specific anti-LVS total antibody titers, as well as IgG1,
IgG2a, and IgA isotypes for serum and Ig (H+L), IgA and IgM isotypes for fecal samples,
were determined by ELISA. Antigens, either UV-irradiated LVS (106/well) or HEL (Hen Egg
Lysozyme, 100ng/well, an unrelated antigen as control), were coated onto 96-well
microplates and reacted with serial dilutions of sera or undiluted fecal samples. Goat anti
mouse Ig(H+L), IgG1, IgG2a, IgA and IgM antibody conjugated with horseradish peroxidase
were used as the secondary antibodies to determine antibody isotypes and titers. As shown
in Fig. 2, mice immunized with LVS i.g. retain high total antibody titers 8 weeks after
vaccination and mice which received a second dose of LVS at 8 weeks after initial
vaccination had slightly elevated titers. Mice also retained a predominantly Th1 response
similar to serum analyzed at 3 weeks after vaccination with mice which received a booster
vaccination having relatively higher titers. No LVS-specific antibody was detected in mice
mock-vaccinated with PBS. All tested serum samples showed no reactivity to the unrelated
HEL protein. . As shown in Fig. 3, LVS-specific IgA in the G.I. tract decreases by 8 weeks
after vaccination when compared to samples taken at 3 weeks. However, mice which were
given a booster vaccination (103 LVS) regained a high level of IgA. Similar to the three week
time point, there were minimal amounts of LVS-specific total antibody and almost no IgM
isotype. Little to no LVS-specific antibody was detected in mice mock-vaccinated with PBS.
All tested fecal samples showed no reactivity to the unrelated HEL protein.
Page 47 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
20000
LVS 8 wk
10000
LVS 8 wk + Boost
Mock (PBS)
50% Binding Titer
LVS/ HEL
Mock (PBS)/ HEL
1000
100
Total Ab
IgG1
IgG2a
IgA
Fig. 2. Humoral responses to intragastric LVS immunization at 8 week timepoint.
Groups of BALB/c mice were vaccinated i.g. with 103 CFU of LVS or PBS as a
control. Sera were collected 8 weeks later and analyzed to determine titers for antiLVS specific antibodies. Some mice were given a second boost dose of LVS i.g. at 8
weeks and sera was collected 3 weeks later.
Page 48 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
LVS 8 wk
LVS 8 wk + Boos t
Moc k (PBS)
LVS/HEL
M oc k (PBS)/HEL
O.D. (630 nm)
0.80
Ig (H+L)
2.00
IgA
0.20
0.60
1.50
0.15
0.40
1.00
0.10
0.20
0.50
0.05
0.00
0.00
0.00
IgM
Fig. 3. Humoral responses to intragastric LVS immunization at 8 week timepoint.
Groups of BALB/c mice were vaccinated i.g. with 103 CFU of LVS or PBS as a
control. Fecal samples were collected 3 weeks later and analyzed to determine
titers for anti-LVS specific antibodies. Some mice were given a second boost dose
of LVS i.g. at 8 weeks and fecal samples were collected 3 weeks later.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
68% of scientific work completed on milestone 50A (original plans) Normalizes to34% this month
50% of scientific work completed on milestone 50B (intragastric plan)Normalizes to 25% this
month; so overall normalized combined in the MS is 59%; however, Dr. Arulanadam points out
that the A is a 3 year milestone and the B is a one year milestone. Combining the two portions of
the milestone will not be accurate after the B (GI) milestone is completed in 1 year.
9. Work plan for upcoming month
50A-1: Evaluate the protective efficacy of intragastric F. novicida iglB vaccination (prime
and one boost) against SCHU S4 intranasal challenge in C57BL and BALB/c mice.
50A-2: Measure humoral responses in the iglB-primed and boosted mice.
50B: Analyze the complete antibody profiles for serum and fecal samples taken at twelve
weeks after LVS i.g. immunization either with or without a second booster dose of LVS i.g.
10. Anticipated Travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Page 49 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Milestone 52
Milestone description: Construction of Ft ssp tularensis recA mutant; A: Construct RecA mutants in
F. tularensis subsp. tularensis(Schu S4); B: Construct reA plus beset attenuating mutation(s) determined
in MS49 F. tularensis ssp tularensis.
Institution: UTSA
1. Date started: 9/15/2007
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
To inactivate RecA in Schu S4, we were in the process of constructing a Targetron vector for
targeting and inactivating the RecA gene. The Targetron vector was designed to be constructed
with the intron expression vector pKEK1140 for the backbone, and a 350bp PCR product for the
insertion to mutate intron RNA.
a. In the technical report for last month, it was reported that two colony PCR were amplified to screen
the transformants, and the PCR result indicated that the insertion was in recA of Schu S4. The PCR
product using the primers “RecA Schus4 for” (in recA gene) and “EBS Universal“(in intron RNA) was
purified using gel purification kit. Then the gel purified DNA was sent for sequencing with the same
primers as PCR, and the sequencing data confirmed that the intron RNA was inserted at 720/721bp
in RecA of Schu S4.
b. Even if the PCR showed no evidence that wild type Schu S4 was mixed in recA mutant Schu S4
(See Figure1 in last month report), it was still necessary to continue the procedure of isolating the
wild type Schu S4 from the recA mutants. The isolation was performed in 30C. Colony1 and 2 were
streaked onto TSA++/Kanamycin(30ug/ml) plates and incubated at 30C for 2-3 days to get single
colonies.
c. The single colonies were screened by colony PCR to determine if the wild type Schu S4 were
separated from the mutants. The PCR was set up as follows:
ddH2O
34.6 ul
10X Buffer
5.0 ul
MgCl2
2.0 ul
dNTPs
5.0 ul
RecA Schus4 For (25pmol/ul)
1.0 ul
RecA Schus4 Rev (25pmol/ul)
1.0 ul
KOD DNA polymerase
0.4ul
DNA
1.0 ul
At 98C 1minute, 98C 15sec/ 57C 15sec/ 72C 2min// 30 cycles
Figure1: on 1% agarose gel
Page 50 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Each of the colonies (lane2-6 and lane9-13) had only one band at 1500bp the same size as the
positive control (lane7), and no second band with the same size as wild type Schu S4
(lane8, about 630bp) presented. This indicated that the colonies (recA mutant Schu S4) were
not mixed with wild type strains. Those colonies could be continued for next step--- removal of the
plasmid.
d. The colony 5 and 11 shown on Fig.1 were streaked onto TSA++/Ampicillin(100ug/ml) plates and
incubated at 37C for about 3-4 days to remove the plasmid from the strain. This procedure was
based on the tulatron vector’s sensitivity to temperature, so it could be removed when the
incubation
temperature was changed from 30C to 37C.
e. To determine if the plasmid had been removed, patched the single colonies onto TSA++/Kanamycin
(30ug/ml) agar medium and incubated at 37C for 2-3 days to select Kanamycin sensitive colonies.
About 27 colonies were observed sensitive to Kanamycin.
Data recorded on UTSA TVDC notebook #6, page17-18 for Figure1.
4 Significant decisions made or pending
None.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed.
About 22% of scientific work completed.
9. Work plan for upcoming month
i Screen the Kanamycin sensitive colonies by PCR
ii Make the frozen stocks for the correct mutants.
10. Anticipated travel
None.
11. Upcoming Contract Authorization (COA) for subcontractors
None.
Milestone 55
Milestone description: Compare Cellular Immunogenicity of Francisella and Listeria-Based
Vaccine Platforms. Measure cellular immunogenicity of live-attenuated vaccine platforms.
Compare immunogenicity of KBMA tularemia vaccine platforms
Institution: Cerus/Anza
1. Date started: 4/1/2008
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Page 51 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
Summary of objectives: We will construct and prepare live and KBMA Listeria monocytogenes
(Lm) vaccines expressing Ft antigens. To directly compare the cellular immunogenicity of Lm
and Ft-based vaccines, each Lm vaccine candidate will express an antigen fused with a model
ovalbumin epitope SIINFEKL (SL8) and these will be compared to Ft vaccines expressing pepOSL8 fusions (provided by UTSA). We will measure the ability of each vaccine to stimulate a CD8
T cell response in vitro using a B3Z assay. We will measure the cytokine responses elicited by
vaccination with each platform in mice, compare the CD8 T cell response to SL8 after prime and
boost vaccinations in mice using intracellular cytokine staining (ICS) and ELIspot assays and
measure the potency the T cells elicited by use of an in vivo cytotoxicity assay.
1) Modification #r2 to the Cerus subaward agreement was submitted to NIAID and authorization
is pending. This modification will allow for changing the scope of work to include evaluation of
Listeria monocytogenes-based tularemia vaccines and will allow Anza Therapeutics Inc to
provide the services necessary for Cerus to achieve these milestones. A draft service agreement
was written between Cerus Corporation and Anza Therapeutics Inc., and is currently being
reviewed. An MTA that will facilitate the transfer of materials between Cerus, Anza, UNM and
other TVDC members has been drafted and revised by the UNM tech transfer office and is
currently under review. An MTA that will facilitate the transfer of materials Between UCLA (and
their collaborators), Anza, UNM and LBERI has been drafted and will be sent to technology
transfer offices of each site in the coming month.
2) Cloning of Listeria monocytogenes (Lm) tularemia vaccine strains. The following live
attenuated SL8-tagged tularemia vaccine strains have been constructed: BH1222:
LmactAinlBIglCSL8, BH1226:LmactAinlBKatGSL8 (NB# 977-p.52). The nucleotide
sequence of BH1222 was confirmed, however there was a single base substitution in the katG
sequence resulting in a single amino acid substitution in strain BH1226 and thus this construct
will be re-cloned. The following KBMA vaccine strains have been constructed and sequence
verified: BH1228:LmactAinlBuvrABIglCSL8 and BH1398:LmactAinlBuvrABKatGSL8 (NB#
977-p52 and 977-p152, respectively). We have recently demonstrated enhanced immunogenicity
of KBMA vaccines when the platform strain has a constitutively activated prfA transcriptional
regulator LmactAinlBuvrABprfAG155S (manuscript submitted). In order to produce KBMA
vaccine strains with the highest potency we have begun the process of introducing the IglCSL8
and the KatGSL8 expression cassettes into this enhanced KBMA platform strain.
To improve the performance of in vivo cytotoxicity studies, the iglC antigen will also be
constructed as a fusion protein to our “quatrotope tag”. This tag encodes 4 epitopes from
vaccinia virus of varying strengths as well as the SL8 epitope. This range of epitope strengths
allows for more dynamic range in the in vivo cytotoxicity assay. PCR primers to fuse the IglC
antigen with the quatrotope tag were ordered and the DNA has been amplified and cloned into E.
coli strains. This expression cassette will be introduced in the live-attenuated LmactAinlB and
KBMA LmactAinlBuvrABprfAG155S platforms.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
2%
Page 52 of 53
Tularemia Vaccine Development Contract: Technical Report
Period: 4/01/2008 to 4/30/2008
Due Date: 5/15/2008 and Prepared by: C. Rick Lyons, Barbara Griffith,Terry Wu, Kathryn
Sykes, Stephen Johnston, Mitch Magee, Justin Skoble, Bob Sherwood, Trevor Brasel, Julie
Wilder, Karl Klose, Bernard Arulanandam
9. Work plan for upcoming month




Construction of Lm vaccine candidates expressing IglCSL8 and KatGSL8 fusion proteins
in the enhanced KBMA background will be completed.
Construction of Lm vaccine candidates expressing quatrotope-taqged IglC will be
completed.
The ability of Lm vaccine candidates to deliver proteins to the cytosol of antigen
presenting cells will be determined using the B3Z assay.
The effects of the quatrotope tag will be compared with the SL8 tag. Mice will be
vaccinated with live-attenuated vaccine strains expressing IglC and KatG and the ability
to induce a CD8 T cell response against the SL8 tag will be measured by ICS and
ELISpot.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
Modification #r2 to subaward agreement
Page 53 of 53