Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2(UNM/LBERI),3, 4, 5, 12/13 (UNM/LBERI), 19, 21, 26, 27, 28, 33,
34(UNM/ASU), 35, 41, 42, 44, 46, 49, 50, 52
Completed milestones: 1, 16, 25, 32, 39, 40, 43, 48, 51
Inactive milestones: Working Group, 6, 7, 8, 9, 10, 11, 14, 15, 17, 18, 20, 22, 23, 24,
29, 30,36, 37, 38,, 45, 47, 53, 54
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/1005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. First group of 7 LBERI participants received the LVS vaccination on 9/11/07and their Day
7 to 28 day follow-up completed.
b. Second group of 8 LBERI participants received LVS vaccination on 10/2/2007 and their
day 7 to 28 day follow-up should be completed.
c. Third group of 7 LBERI participants received LVS vaccination on 10/23/07 and their day
7-14 follow-up is completed.
d. Fourth group of 6 LBERI participants are scheduled to travel to Washington DC on
11/12/07 to be vaccinated on 11/13/07.
e. Fifth group of 6 LBERI participants being scheduled to travel to Washington DC on 1/7/08
to be vaccinated on 1/8/08.
f. UNM and USAMRIID are actively using the LVS vaccine web database to track Risk
Assessment form submission and acceptance, Informed Consent submission and
acceptance, Health screening appointments, planned dates for receipt of LVS
vaccinations, dates of medical clearance, and travel arrangements
4. Significant decisions made or pending
a. UNM and LBERI will use their biobubbles as additional physical protective equipment
b. The LBERI work stoppage has been lifted for SCHU S4 aerosols as of 11/7/07.
c. In approximately 1 month, UNM may have access to a local source of human cells from
LVS vaccinated individuals.
d. Dr. Lyons is requesting UNM IRB approval to allow blood draws on the vaccinated LBERI
and UNM scientists after their LVS vaccinations. The LBERI and UNM scientists and
Page 1 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
staff will be offered the opportunity to volunteer to donate bloods for the development of
immunoassays, approximately 2 months after receiving the LVS vaccination.
e. UNM and LBERI are offering the LVS vaccinations to 24 more scientists to total 46;
USAMRIID will continue to provide the LVS vaccinations over the next 5-6 months.
5. Problems or concerns and strategies to address
a. Within approximately 1 month, UNM may have access to the blood of UNM and LBERI
scientists who have been vaccinated with LVS at USAMRIID. This is dependent on
UNM’s IRB approval
6. Deliverables completed
22 LBERI scientists and staff have received the LVS vaccination between 9/11/07 and 10/23/07.
7. Quality of performance
Excellent
8. Percentage completed
35%
9. Work plan for the next month
a. Submit Health screening test results to USAMRIID and obtain USAMRIID medical review
b. Make travel arrangements for medically eligible participants to enter LVS Vaccination
program at USAMRIID on 10/2/07 (2nd group) and 10/23/07 (3rd group) Participants will
be at USAMRIID for 2 days following the vaccinations
c. Start Risk Assessments, SIP informed consent teleconference, and health screenings for
the next group of participants.
d. Maintain excellent communications with UNM EOHS, LBERI and USAMRIID
10. Anticipated travel
LVS vaccination participants will be traveling to USAMRIID on 11/12/07 and on 1/7/2008.
11. Upcoming Contract Authorization (COA) for subcontractors
UNM received a signed COA letter for COA 15 on 9/11/07.
Milestone 3
Milestone description: Bioaerosol technique selected and optimized
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
Data were summarized at the annual TVDC meeting. This report details all experiments
performed from August 1 to October 31, 2007, in order to provide a cumulative presentation of
the results, specifically with regard to the Aeromist nebulizer. Please note that data from August
were presented in the 9/15/07 LBERI Technical report.

August-October 2007 work continued to focus primarily on Aeromist nebulizer testing
using LVS:
i. Two days of bioaerosol testing were completed incorporating dilutions of fresh
LVS stock (48h culture) in the generator. Focus was placed on the pressure
delivered to the generator as it was hypothesized that lower delivered pressures
would result in increased viability retention.
1. 15 total sprays with fresh LVS
a. 10AUG: 9 sprays conducted at 3 target concentrations (1x105,
1x106, and 1x107 cfu/mL) and a delivered pressure of 20 psi
Page 2 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
b. 17AUG: 6 sprays conducted at 1 target concentration (1x106
cfu/mL) and 3 delivered pressures (10, 15 and 20 psi); generator
suspensions were cultured pre- and post-bioaerosol runs to
observe the effects of the nebulization process on the viability of
bacteria in the Aeromist.
2. Results (Figures 1 and 2)
a. 10AUG

Actual vs. Target cfu/mL values were 0.5-1.0 log10
lower than desired. It was hypothesized that this was
due to the high delivered pressure (20 psi) to the
generator (i.e., high shear forces were generated).

Spray factor values indicated increased efficiency
versus the Collison nebulizer tested with similar
bacterial concentrations. This, however, may be
misleading as the spray factor is based on the
generator suspension concentration. Specifically, the
decrease in viability observed in the bacterial
suspension following the bioaerosol run led to an
improved spray factor. This points toward the
importance of measuring pre- and post-bioaerosol
bacterial concentrations in the generator suspension.
b. 17AUG

Actual vs. Target cfu/mL values decreased
approximately 0.5 log10 at 15 and 20 psi but were very
similar at 10 psi demonstrating that increased
delivered pressures negatively impact the viability of
the bacterial suspension during generation in the
Aeromist.

Spray factor values were markedly different between
the three delivered pressures in context of the
calculations performed with the pre- and postbioaerosol generator suspension concentrations. At
15 and 20 psi, the post-bioaerosol spray factors were
significantly different than the pre-bioaerosol values;
this was due to the decreased viability observed in the
suspensions following the nebulization process. This
difference at a delivered pressure of 10 psi was not as
dramatic demonstrating an increased retention of
viability and ultimately a more accurate spray factor
value. This indicates the importance of lower
delivered pressures to the Aeromist during bioaerosols
with LVS.
Page 3 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
ii. Four days of bioaerosol testing were completed incorporating dilutions of frozen
LVS stock using the Aeromist and Collison generators (3 days for the Aeromist, 1
day for the Collison). Focus was again placed on the pressure delivered to the
generators.
1. 24 total sprays with frozen LVS
a. 8AUG: 9 sprays conducted using the Aeromist at 3 target
concentrations (1x105, 1x106, and 1x107 cfu/mL) and a delivered
pressure of 20 psi
b. 16AUG: 6 sprays conducted using the Aeromist at 1 target
concentration (1x106 cfu/mL) and 3 delivered pressures (10, 15
and 20 psi); generator suspensions were cultured pre- and postbioaerosol runs to observe the effects of the nebulization
process on the viability of bacteria in the nebulizer.
c.
30AUG: 3 sprays conducted using the Collison at 1 target
concentration (1x106 cfu/mL) and the normal operating delivered
pressure of 20-30 psi; generator suspensions were cultured preand post-bioaerosol runs to observe the effects of the
nebulization process on the viability of bacteria in the nebulizer
d. 26OCT: 6 sprays conducted using the Aeromist at 3 target
concentrations (1x105, 1x106, and 1x107 cfu/mL) and a delivered
pressure of 5 psi.
2. Results (Figures 3 and 4)
a. 8AUG

Target cfu/mL values were 0.5-1.0 log10 lower than
desired. It was hypothesized that this was due to the
high delivered pressure (20 psi) to the generator (i.e.,
high shear forces were generated).

Spray factor values indicated increased efficiency
versus the Collison nebulizer tested with similar
bacterial concentrations. This, however, may be
misleading as already described for fresh cultures
above.
b. 16AUG

Actual vs. Target cfu/mL values decreased following
the bioaerosol run approximately 0.5 log10 at 15 and
20 psi but were very similar at 10 psi demonstrating
that increased delivered pressures negatively impact
the viability of the bacterial suspension during
generation in the Aeromist.

Spray factor trends were similar to those already
Page 4 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
described for fresh cultures though values were less
efficient with the frozen cultures.
c.
30AUG (Collison testing)

Actual vs. Target cfu/mL were similar pre- and postbioaerosol demonstrating a retention of viability in the
Collison nebulizer under normal operating conditions
of 20-30 psi. This may be due to the distribution of
pressure over the 3 jets in the nebulizing head of the
generator (as compared to the one jet present in the
Aeromist).

Spray factor values and trends were similar to those
observed with the Aeromist operated at 10 psi. This is
logical in that it can be assumed that 7-10 psi is
delivered to each jet of the Collison.
d. 26OCT

No difference was observed between the pre- and
post-bioaerosol Actual vs. Target cfu/mL values
indicating that viability was maintained in the Aeromist
at a delivered pressure of 5 psi.

Though spray factor values were essentially the same
pre- and post-bioaerosol, data indicate a significantly
lower bacterial aerosol output at 5 psi (i.e., less
bacteria were generated at this delivered pressure). It
is likely that 5 psi is below the required efficient
generating pressure for the Aeromist. These, and
other data, indicate that the optimal operating pressure
for the Aeromist (with regard to F. tularensis LVS) is
greater than 5 psi and less than or equal to 10 psi.
3. Aeromist nebulizers are low cost at $15 each and have the advantage
that the spray solution can be prepared in the Aeromist and then
transported to the testing location.
4. Data filed in the following folders:
a. 8AUG: \\Saturn\absl3\Agent and Study Specific Data and
Miscellaneous Documents\STUDY SPECIFIC DATA\FY06078_TUL-03\TUL-03\Aeromist nebulizer\8Aug07
b. 10AUG: \\Saturn\absl3\Agent and Study Specific Data and
Miscellaneous Documents\STUDY SPECIFIC DATA\FY06078_TUL-03\TUL-03\Aeromist nebulizer\10Aug07
c.
16AUG: \\Saturn\absl3\Agent and Study Specific Data and
Miscellaneous Documents\STUDY SPECIFIC DATA\FY06-
Page 5 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
078_TUL-03\TUL-03\Aeromist nebulizer\16Aug07
d. 17AUG: \\Saturn\absl3\Agent and Study Specific Data and
Miscellaneous Documents\STUDY SPECIFIC DATA\FY06078_TUL-03\TUL-03\Aeromist nebulizer\170Aug07
e. 30AUG: \\Saturn\absl3\Agent and Study Specific Data and
Miscellaneous Documents\STUDY SPECIFIC DATA\FY06078_TUL-03\TUL-03\Collison Generator\Frozen LVS\30Aug2007
f.
26OCT: \\Saturn\absl3\Agent and Study Specific Data and
Miscellaneous Documents\STUDY SPECIFIC DATA\FY06078_TUL-03\TUL-03\Aeromist nebulizer\26Oct07
Aeromist: Target vs. Actual CFU/mL (Fresh)
8.00
Actual CFU/ml (Log10)
7.50
7.00
6.50
6.00
5.50
5.00
4.50
4.00
3.50
3.00
3.00
3.50
4.00
4.50
5.00
5.50
6.00
6.50
7.00
7.50
Target CFU/ml (Log10)
7/19/2007 (Aeromist)
7/19/2007 (Collison)
8/10/2007
8/17/2007 (Pre; 10psi)
8/17/2007 (Pre; 20psi)
8/17/2007 (Post; 10psi)
8/17/2007 (Post; 15psi)
8/17/2007 (Post; 20psi)
8/17/2007 (Pre; 15psi)
Figure 1. Target vs. Actual CFU/mL at three target concentrations of fresh LVS using the Aeromist and Collison generators
Page 6 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Aeromist: Actual CFU/mL vs. Spray Factor (Fresh)
-4.60
0.00
-4.80
1.00
2.00
3.00
4.00
5.00
6.00
7.00
8.00
Spray Factor (Log10)
-5.00
-5.20
-5.40
-5.60
-5.80
-6.00
-6.20
-6.40
-6.60
Actual CFU/mL (Log10)
7/19/2007 (Aeromist)
7/19/2007 (Collison)
8/10/2007
8/17/2007 (Pre; 10psi)
8/17/2007 (Pre; 20psi)
8/17/2007 (Post; 10psi)
8/17/2007 (Post; 15psi)
8/17/2007 (Post; 20psi)
8/17/2007 (Pre; 15psi)
Figure 2. Actual CFU/mL vs. Spray Factor at three target concentrations of fresh LVS using the Aeromist and Collison generators
Page 7 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Aeromist: Target vs. Actual CFU/mL (Frozen)
8.00
Actual CFU/ml (Log10)
7.50
7.00
6.50
6.00
5.50
5.00
4.50
4.00
3.00
3.50
4.00
4.50
5.00
5.50
6.00
6.50
7.00
7.50
Target CFU/ml (Log10)
4/13/2007
6/21/2007
6/26/2007
8/8/2007
8/16/2007 (Pre; 10psi)
8/16/2007 (Pre; 15psi)
8/16/2007 (Pre; 20psi)
8/16/2007 (Post; 10psi)
8/16/2007 (Post; 15psi)
8/16/2007 (Post; 20psi)
8/30/2007 (Collison, Pre; 20psi)
8/30/2007 (Collison, Post; 20psi)
10/26/2007 (Pre; 5psi)
10/26/2007 (Post; 5psi)
Figure 3. Target vs. Actual CFU/mL at three target concentrations of frozen LVS using the Aeromist and Collison generators
Page 8 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Aeromist: Actual CFU/mL vs. Spray Factor (Frozen)
-5.00
3.50
4.00
4.50
5.00
5.50
6.00
6.50
7.00
7.50
8.00
8.50
Spray Factor (Log10)
-5.50
-6.00
-6.50
-7.00
-7.50
-8.00
Actual CFU/ml (Log10)
4/13/2007
6/21/2007
6/26/2007
8/8/2007
8/16/2007 (Pre; 10psi)
8/16/2007 (Pre; 15psi)
8/16/2007 (Pre; 20psi)
8/16/2007 (Post; 10psi)
8/16/2007 (Post; 15psi)
8/16/2007 (Post; 20psi)
8/30/2007 (Collison, Pre; 20psi)
8/30/2007 (Collison, Post; 20psi)
10/26/2007 (Pre; 5psi)
10/26/2007 (Post; 5psi)
Figure 4. Target vs. Actual CFU/mL at three target concentrations of frozen LVS using the Aeromist and Collison generators
4. Significant decisions made or pending
We have narrowed down the aerosol technologies to be used for animal exposures to the
Collison nebulizer (as the industry standard) and the Aeromist nebulizer (used at a low delivered
pressure of 7.5-10 psi). Additionally, cumulative data indicate that fresh cultures (48h) should be
used for future bioaerosols. Upon completion of several bioaerosols with Schu4, MS3 is set to be
completed by the end of November.
5. Problems or concerns and strategies to address
Our Chamberlain’s powdered media has gone bad: it appears to have drawn in moisture from
the air and, for other reasons unknown, will not support growth of LVS or Schu4. The next batch
will be stored refrigerated in the dark with desiccant (likely a small desicator). It is recommended
to advise the company who prepares the media to include these storage parameters and to
include an expiration date of 6 months to 1 year; additionally, it would be beneficial to be able to
order batches smaller than 1 kg.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
92%
Page 9 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
9. Work plan for upcoming month





Determine whether SCHU S4 aerosols from Collison and Aeromist nebulizers are similar
to the LVS aerosols previously achieved.
7NOV: 9 bioaerosols using frozen Schu4 (cannot use fresh due to the Chamberlain’s
problems).
i. 3 with Collison at 1 x 106 cfu/mL and normal operating parameters
ii. 3 with Aeromist at 1 x 106 cfu/mL and 7.5 psi delivered
iii. 3 with Aeromist at 1 x 106 cfu/mL and 10 psi delivered
12NOV (tentative): LVS and Schu4 mouse pathogenecity exposure using the Collison
nebulizer; 2 exposures with 20 mice each; high dose to be used to demonstrate infectivity
and pathogenesis of both organisms in the mouse model.
16NOV: Fresh Schu4 bioaerosol; testing parameters TBD
1-2 additional days in Nov: Fresh Schu4 bioaerosol; testing parameters TBD
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Milestone 4
Milestone description: Confirmation of aerosol in vivo in NHP
Institution: LBERI
1. Date started: 11/1/06
2. Date completed: in progress, (2/1/08 target date of completion)
3. Work performed and progress including data and preliminary conclusions:
No new work on this milestone was completed in the last month. We are currently scheduling
ABSL-3 move-in and exposure dates.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
12.5%
9. Work plan for upcoming month
a. These NHPs will continue to be bled as a source of cells for Milestone 12/13; however,
no work is anticipated on these NHPs until they are challenged with aerosol Schu4
sometime after January 2008.
10. Anticipated travel
None anticipated at the present time
11. Upcoming Contract Authorization (COA) for subcontractors
None anticipated
Page 10 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Milestone 5
Milestone description: Small species tested for sensitivity to LVS & generation of immunity
against a pulmonary challenge of SCHU S4
Institution: UNM
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Fischer 344 rats
a. Experiment Ftc47 study 3 (Notebook 104, pages 107-110, 113, 118-124)
i. The purpose of this experiment was to determine the kinetics of SCHU S4
proliferation and dissemination in s.c. LVS-vaccinated rats after i.t. challenge.
This is a repeat of Ftc40 study 1 and Ftc47 study 1
ii. Naïve Fischer 344 rats were vaccinated s.c. with 2.9 x 107 LVS
iii. 35 days after vaccination, the vaccinated rats were challenged i.t. with 2.0 x
104 SCHU S4. This dose is 55x the LD50 and was similar to the one used in
the previous two experiments
iv. The number of SCHU S4 in the lungs increased by almost 4 logs within the
first three days of challenge and then appeared to either plateau or decline
thereafter
v. Systemic dissemination to the liver and spleen was observed one day after
challenge and grew to 105 in both organs by day 5.
vi. 21 days after challenge, SCHU S4 was detected only in the lungs of 3 of 5
rats but not in the spleen or liver. Interestingly, even after 42 days SCHU S4
was not completely cleared and was found in the lungs of 1 of 5 rats
vii. These results are very similar to those from Ftc47 study 1, also shown in
Table 1
Table 1. Kinetics of SCHU S4 proliferation and dissemination in naïve and s.c. LVS vaccinated
ratsa
Log10 mean bacterial load ± SD (No. tissues with bacteria/total)
Ftc47 study 3
Ftc47 study 1
Day
Lungs
Liver
Spleen
Lungs
Liver
Spleen
0
4.3 ± 0.3
4.2 ± 0.1
1
6.6 ± 0.2
2.2 ± 0.6 (3/5) 1.6 ± 0.3 (3/5)
ND
2.2 ± 0.3
0
2
7.4 ± 0.1
3.5 ± 0.1 (3/4) 3.1 ± 0.1 (3/4)
7.4 ± 0.1
4.5 ± 0.3
ND
3
8.0 ± 0.1
4.8 ± 0.4
4.7 ± 0.4
7.4 ± 0.1
4.5 ± 1.0
ND
4
7.0 ± 0.3
4.7 ± 0.6
4.7 ± 0.7
7.7 ± 0.7
5.1 ± 0.3
ND
5
7.5 ± 0.4
5.0 ± 0.4
5.1 ± 0.3
6.8 ± 0.4
5.0 ± 0.2
4.6 ± 0.3
6
6.0 ± 0.8
3.9 ± 0.7
4.1 ± 0.8
21
2.8 ± 0.2 (3/5)
ND
ND
2.9 ± 0.3
ND
ND
42
8.0 (1/5)
ND
ND
ND
ND
ND
a n = 3-5/group
b ND = not detected; below detection level.
4. Significant decisions made or pending
None
Page 11 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
5. Problems or concerns and strategies to address
None
6. Deliverables completed
a. Mouse model completed
b. Guinea pig model completed
7. Quality of performance
Good
8. Percentage completed
67%
9. Work plan for upcoming month
a. Characterization of the Fischer 344 rat model
i. Determine the effects of T cell depletion on the protective immunity induced
by LVS vaccination
ii. Determine whether passive immunization with convalescent sera will protect
naïve Fischer 344 rats from i.t. SCHU S4 challenge
b. Determine whether QD655-luc8 can be used to track pulmonary deliver
i. Determine whether QD655-luc8 and its substrate are toxic to SCHU S4
ii. Determine whether QD655-luc8 signal and SCHU S4 co-localize in vivo
iii. Determine whether co-administration of QD655-luc8 affects the virulence of
SCHU S4 in naïve Fischer 344 rats
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 12/13-LBERI
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and compared to those in other species.
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Update on NHP PBMC Freezing protocols
1. Issue: We were originally testing 3 different protocols (CTL: 90% human A/B
serum/10% DMSO/10 x 106/ml; CERUS: 80% FBS/20% DMSO/5 x 106/ml; and
Lyons: Frozen in Gibco Recovery Cell Culture Freezing Media (contains optimal
ratio of fetal bovine serum:bovine serum and 10% DMSO)/5 – 10 x
106/ml/thawed in presence of DNAse and left in 37o incubator for 30 – 60 minutes
before use) with the aim to choose the protocol that spares the most viable cells
that remain functional after thawing
2. We have discontinued testing the Lyons protocol as it spares the fewest viable
cells of the three protocols
3. A summary comparing the Cerus and CTL protocols follows in Tables 1 – 3
Page 12 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Table 1: Freeze/Thaw Summary using Cerus Protocol
Expt
Day
#
Avg.
Avg. %
post
NHPs Cell
Recovery of
Vacc.
Recovery Con A Prolif.
(by absolute
counts
/Stimulation
Index)***
Avg.
Recovery of
LVSff- Prolif.
(by absolute
counts
/Stimulation
Index)***
Avg.
Recovery of
LVShkProlif. (by
absolute
counts
/Stimulation
Index)***
NA
TUL 8
0
3
60%
>203%/45.3% NA
(11/16/06)* (ID)
TUL 9
28
2
60%
53%/95.2%
39.5%/70.8% 33%/59.6%
(12/17/06) (SC)
TUL 11
117
1
108%
64.4%/34.8% 166%/89.7% 163%/87.7%
(3/26/07)** (SC)
TUL 14
203
3
83.4%
43.0%/327% 59.9%/45.2% 15.2%/115%
(6/11/07)
(ID)
TUL 15
195
1
82.6%
67.3%/65.7% 105.4%/102% 78.3%/75.9%
(6/12/07)
(SC)
TUL 16
238
1
63.5%
509%/202%
72.4%/28.7% 139.6%/55.3%
(7/16/07)* (ID)
TUL 17
237
3
68.9%
120%/16.8% 98.4%/13.4% 99.4%/13.8%
(7/24/07)* (SC)
TUL 18
278
1
7.5%
NA
70.2%/51.5% 128%/94.7%
(8/23/07)** (ID)
*Background proliferation of frozen cells greater than fresh cells
**Proliferation to LVS not great even using fresh cells
***Absolute counts = Relative light units (RLU) Frozen/RLU Fresh for each stimulus;
Stimulation index = RLU stimulus/RLU media for fresh and frozen cells
Page 13 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Table 2: Freeze/Thaw Summary using CTL Protocol
Expt.
Day post
#
Avg.
Avg. Recovery
Vaccination NHPs Cell
of Con A
Recovery Prolif. (by
absolute counts
/Stimulation
Index) ***
Avg. %
Recovery of
LVSff-Prolif.
(by absolute
counts
/Stimulation
Index) ***
Avg. %
Recovery of
LVShkProlif. (by
absolute
counts
/Stimulation
Index) ***
NA
TUL 8
28 (ID)
2
70%
214.4%/116.3% NA
(12/18/06)
TUL 11
117 (SC)
1
38.5%
148%/55.2%
362%/135%
215%/79.8%
(3/26/07)**
TUL 12
140 (ID)
1
54.4%
NA
98.0%/114%
NA
(4/9/07)
TUL 14
203 (ID)
3
89.6%
119%/45.5%
47%/179%
17.7%/67%
(6/11/07)
TUL 15
195 (SC)
1
75%
70.6%/342.7% 10.2%/49.8% 5.8%/28.2%
(6/12/07)
TUL 16
238 (ID)
2
69.6%
461%/68.8%
96.7%/14.4% 106.8%/15.9%
(7/16/07)*
TUL 17
237 (SC)
2
69.4%
146%/89.0%
143.4%/86.6% 56%/34.1%
(7/24/07)*
TUL 18
278 (ID)
1
10%
NA
25.7%/18.0% 49.2%34.5%
(8/23/07)**
*Background proliferation of frozen cells greater than fresh cells
**Proliferation to LVS not great even using fresh cells
***Absolute counts = Relative light units (RLU) Frozen/RLU Fresh for each stimulus;
Stimulation index = RLU stimulus/RLU media for fresh and frozen cells
Table 3: Comparison of CTL and Cerus Protocols
Page 14 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Freeze/Thaw Avg.
Avg. Recovery
Protocol
Cell
of Con A Prolif
Recovery (by absolute
counts
/Stimulation
Index) ***
Avg.
Recovery of
LVSff- Prolif.
(by absolute
counts
/Stimulation
Index) ***
Avg.
Recovery of
LVShkProlif. (by
absolute
counts
/Stimulation
Index) ***
CERUS
66.7%
151.3%/112.4% 87.4%/57.3% 93.8%/71.7
CTL
59.6%
193.2%/119.6% 111.9%/85.3% 64.4%/37.1%
***Absolute counts = Relative light units (RLU) Frozen/RLU Fresh for each stimulus;
Stimulation index = RLU stimulus/RLU media for fresh and frozen cells
4. Data Interpretation
i. In 30 – 40% of the experiments, the frozen cells had higher background
(unstimulated) proliferation than did the fresh cells
ii. The Cerus protocol seems to spare HK-LVS specific proliferation better
than the CTL protocol; but the situation is reversed for FF-LVS
proliferation
iii. The two protocols are relatively equivalent in sparing cell viability and
function but the Cerus protocol is more straightforward and less
cumbersome in that it only uses one freezing medium rather than two
and also does not require human AB serum
Data storage:
Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assay 110707.svd;
N:MyDocuments\Tularemia Contract\Statview Data\PBMC assay 110707.svd and in the TVDC 1 Binder
(under the experimental tabs TUL 8, 9, 11 and 12) and TVDC 1 bound notebook: TUL 14 (pages 30 – 40,
49, 74 – 77), TUL 15 (pps. 41 – 48, 50, 78 – 80, 119 – 20), TUL 16 (pps. 51 – 62, 92 – 98), TUL 17 (pps.
63 – 70, 112 – 116), and TUL 18 (81 – 91, 124 – 125)
Summary Data: N:MyDocuments\Tularemia Contract\Summary Data\freezethawsummary.doc
b. Update on IFN detection by ELISPOT analysis
1.
We have been attempting to optimize the ELISPOT assay that detects
IFN secretion by LVS-stimulated PBMCs from previously vaccinated
NHPs; we have previously determined that:
i. 200,000 cells/well is optimal (1.33 x 106 cells/ml),
ii. the capture antibody provided in the MAbtech kit should be used to
coat that plates at 15 µg/ml (kit recommends this concentration
and we tested it experimentally at 7.5 and 30 µg/ml and found no
effect)
iii. RBC, and associated platelet, contamination should be less than
1% to avoid small background spots that show up in the
unstimulated wells
2.
We have begun to test the effects of the freeze/thaw process on IFN
secretion as detected by ELISPOT
i. Figure 1 shows the results of TUL 16 and TUL 17, 1 – 2
NHPs/group
Page 15 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
896
896
937
70
60
50
40
30
868
659
868
None, SC
CTL, ID
None, ID
896
937
NT
Cerus, SC
20
10
0
Media
LVS hk Hi
LVS ff Hi
CTL, SC
100
90
80
Cerus, ID
Cell Mean for IFNg Spots
Both CERUS and CTL Freeze/Thaw protocols appear to spare IFN secretion
Figure 1: PBMCs from vaccinated NHPs were plated at 1.33 x 106 cells/ml and stimulated with either HK
or FF LVS (1 x 105 cells/ml); intradermally vaccinated NHPs were tested in TUL 16 (A00896 and A00937;
both were plated fresh (None), A00896 was plated after freezing and thawing with both the Cerus and
CTL protocols, while A00937 was plated after freezing and thawing with the CTL protocol only; subcutaneous vaccinated NHPs were tested in TUL 17 (A00868 and A00659) plated fresh and A00868 was
tested after freezing and thawing with the CTL protocol; NT = not tested
3.
4.
Data interpretation: Both freezing and thawing protocols appear to
spare IFNγ secretion
It is possible that PBMCs from NHPs vaccinated via the ID route are
less able to secrete IFNγ, as shown comparing the fresh cells in Figure
1, however this needs to be investigated more thoroughly before this
conclusion can be made; a comparison of all of the IFNγ ELISPOT
data thus far collected on ID and SC-vaccinated NHPs is shown in
Figure 2
Page 16 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Cell Mean for IFNg Spots
25
20
Media
LVS hk Hi
LVS ff Hi
A
TUL 16
896
937
15
10
TUL 14
896
908
TUL 18
896
937
5
0
Day 203
Day 238
Day 278
Cell Mean for IFNg Spots
250
200
LVS ff Hi
150
100
B
Media
LVS hk Hi
TUL 17
659
868
TUL 15
868
902
TUL 19
896
908
50
0
Day 195
Day 237
Day 297
Figure 2: PBMCs from vaccinated NHPs (Panel A, ID; Panel B, SC) were plated at 1.33 x 106/ml on IFN
ELISPOT plates and stimulated with either HK or FF LVS (1 x 105 cells/ml). Experiments and individual
NHPs are indicated. Note the difference in scale on the Y axes.
5.
We tested naïve NHPs for their ability to both secrete IFNγ (Figure 3)
and proliferate (Figure 4) in response to LVS
Page 17 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Cell Mean for IFNg Spots
160
Media
LVS hk Hi
LVS ff Hi
120
80
40
0
A04274
A04344
A04367
Figure 3: PBMCs from naive NHPs were plated at 1.33 x 106/ml on IFN ELISPOT plates and stimulated
with either HK or FF LVS (1 x 105 cells/ml).
2500000
2000000
Media
LVS hk Hi
LVS ff Hi
1500000
1000000
A04367
A04344
A04274
A00937
0
A00908
500000
A00896
Cell Mean for RLU normal
3000000
Figure 4: PBMCs from naive NHPs were plated at 1x 106/ml and stimulated with either HK or FF LVS (1 x
105 cells/ml). Individual NHPs are shown. A00896, 908 and 937 were later vaccinated with LVS via the
ID route.
6.
Data Interpretation: Although our initial studies initiated in November
2006 with 6 naïve NHPs suggested that they had little proliferative
response to LVS, the last three naïve NHPs have been more
responsive. Two of three naïve NHPs (A04274 and A04367) appear to
react to HK LVS by proliferating and FF LVS by secreting IFNγ (TUL
18 and 19). These data are preliminary and need to be confirmed by
re-bleeding these naïve NHPs and others.
Data storage:
Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assay 110707.svd; N:My
Documents\Tularemia Contract\Statview Data\PBMC assay 110707.svd and TVDC 1 bound notebook:
Page 18 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
TUL 14 (pages 30 – 40, 49, 74 – 77), TUL 15 (pps. 41 – 48, 50, 78 – 80, 119 – 20), TUL 16 (pps. 51 – 62,
92 – 98), TUL 17 (pps. 63 – 70, 112 – 116), TUL 18 (pps. 81 – 91, 124 – 125) and TUL 19 (pps. 99 – 108)
c.
Update on IgA anti-LVS ELISA
1. We had thus far been able to detect any IgA anti-LVS by LVS ELISA despite
attempting to titrate the LVS coating concentration as we successfully did for
the IgG anti-LVS ELISA development
2. Two possibilities for the failure of the IgA anti-LVS ELISA to work
a. The plasma could contain no IgA
b. The detection antibody (Goat anti-monkey IgA) could be defective
3. To test the second possibility, we coated an ELISA plate with serial dilutions of
human IgA (purified monkey IgA was not available) and used the goat antimonkey IgA-HRP in an attempt to detect it
a. This strategy worked (data not shown); suggesting that indeed the
detection antibody was capable of detecting human IgA and most likely
monkey IgA – although we have not tested this directly
4. Data interpretation: The detection antibody is functioning and if there were
IgA specific for LVS in the plasma of the LVS-vaccinated NHPs, we should be
able to detect it; as we are not able to detect it, we preliminarily conclude that
there is no IgA anti-LVS in the plasma samples
Data storage:
Raw Data \\Saturn\Group\Wilder Lab\TVDC\LVS ELISA data and TVDC 1 bound notebook pages 121 122
4. Significant decisions made or pending
We propose to use the Cerus protocol for all further freezing and thawing of PBMCs.
5. Problems or concerns and strategies to address
We need to test more naïve NHPs to determine the extent of their reactivity to LVS by proliferation
and IFNγ secretion.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
90% of scientific work has been completed
9. Work plan for upcoming month
1. Test more naïve NHPs in the proliferation and ELISPOT assays.
2. Test PBMCs from ID and SC vaccinated NHPs on the same day to determine if there are
actual differences in IFNγ secretion using both HK and FF LVS as antigens.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Page 19 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Milestone 12/13-UNM
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and Compare assays in animal models (sensitivity)
Institution: UNM
1. Date started: 7/15/06 (MS12) and 12/06 (MS13)
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc54 study 1 (Notebook 103, pages 32-41) and Experiment Ftc54 study
2 (Notebook 103, pages 42- 45)
i. The purpose of this experiment was to optimize the conditions for measuring
antigen-specific responses in the Fischer 344 rat model using IFN Elispot
ii. Splenocytes from naïve and vaccinated Fischer 344 rats were titrated from
104 to 106 cell/well and stimulated with formalin-fixed or heat-killed LVS.
iii. 105 cells/well produced the best combination of high specificity and low
background, whereas 104 cells/well was not sensitive enough and 106
cells/well resulted in high non-antigen specific IFN production
Figure 1. Titration of rat splenocytes for IFN Elispot. The indicated numbers of naïve (top) and
LVS-vaccinated (bottom) BALB/c splenocytes were simulated with formalin-fixed (FF) LVS, heatkilled (HK) LVS, or Con A, as a positive control
Page 20 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
b. Experiment Ftc54 study 2 (Notebook 103, pages 42- 45)
i. The purpose of this experiment was to determine the maximum number of
cells/well that can be used in the rat IFN Elispot in order to maximize the
assay sensitivity.
ii. Splenocytes from naïve and vaccinated Fischer 344 rats were titrated in twofold increments from 1 x 105 to 8 x 105 cells/well and stimulated with formalinfixed or heat-killed LVS.
iii. 2 x 105 cells/well appeared to be the maximum number of splenocytes that
can be used in the IFN Elispot. With higher numbers, there was nonspecific proliferation by naïve splenocytes.
Figure 2. Titration of rat splenocytes for IFN Elispot. The indicated numbers of naïve (top) and
LVS-vaccinated (bottom) BALB/c splenocytes were simulated with formalin-fixed (FF) LVS, heatkilled (HK) LVS, or Con A, as a positive control
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
Page 21 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
55%
9. Work plan for upcoming month
a. The IFN Elispot assay has been optimized as much as possible. Therefore, we will
now move on to Milestone 27 and apply this assay to screening proteins and
peptides for ASU
b. The IL-2 Elispot assay has been proposed as a less rigorous assay for antigenspecific T cells since all responding T cells should produce IL-2 whereas only a
subset will produce IFN. Thus, we will evaluate the suitability of the IL-2 Elispot
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
Milestone 19-UNM
Milestone description: Interaction between human alveolar macrophages and F. tularensis
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc53 study 3 (Notebook 104, pages 114-117)
i. The purpose of this experiment was to determine how long does gentamicin
take to kill SCHU S4 and LVS
ii. The protocol developed by Karen Elkins to measure intracellular LVS
proliferation specified that, at the beginning of the study, macrophage
cultures are treated with 50 g/ml Gentamicin for 45-60 minutes to kill all
extracellular bacteria. However, we had some indications that this treatment
is not effective against extracellular SCHU S4 and the bacteria we recovered
from the culture medium may have never been phagocytosed and escaped
from the macrophages.
iii. LVS and SCHU S4 were diluted in RPMI 1640 with 50 g/ml Gentamicin
iv. Samples were taken every 30 min for 3 h and plated on cystine heart agar
plates
v. As shown in Table 2, LVS was reduced at a faster rate than SCHU S4.
However, we found LVS and SCHU S4 even after 150 and 180 min of
Gentamicin treatment, respectively.
vi. These results suggested that a longer incubation may be required for 50
g/ml Gentamicin to be effective against LVS and that a higher Gentamicin
dose may be required for SCHU S4
Table 2. Kinetics of Gentamicin killing of SCHU S4 and LVS
SCHU S4
Time (min)
Sample 1
Sample 2
Sample 3
0
3.2 x 105
30
7.7 x 104
7.5 x 104
6.1 x 104
3
3
60
6.7 x 10
8.5 x 10
6.7 x 103
3
3
90
4.8 x 10
2.0 x 10
2.6 x 103
3
2
120
1.0 x 10
8.0 x 10
2.0 x 102
150
2.0 x 102
0
2.0 x 102
180
2.0 x 102
2.0 x 102
1.0 x 103
Sample 1
2.5 x 105
7.5 x 103
6.1 x 101
4.0 x 101
0
0
0
LVS
Sample 2
Sample 3
8.1 x 102
1.0 x 102
0
0
2.0 x 102
0
8.1 x 102
4.0 x 101
2.0 x 101
4.0 x 101
0
0
Page 22 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
To improve the killing of extracellular LVS and SCHU S4 for the macrophage killing assays,
we will determine the optimal gentamicin concentration and exposure time
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
8.5%
9. Work plan for upcoming month
a. Optimize the gentamicin concentration and time for killing LVS and SCHU S4
b. Determine the optimal MOI for infecting human alveolar macrophages with LVS and
SCHU S4
c. Determine kinetics of bacterial proliferation after infection
d. Determine whether recombinant IFN would inhibit SCHU S4 and LVS intracellular
growth
e. Determine macrophage viability by lactate dehydrogenase (LDH) release and trypan
blue exclusion after infection
f. Measure cytokine production by macrophages infected with SCHU S4 or LVS
g. Determine whether PBMC from vaccinated human volunteers can induce infected
macrophages to kill intracellular bacteria
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 21-UNM
Milestone description: T cell-induced macrophage killing of intracellular bacteria
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc30.15b (Notebook 109, pages 24-27)
i. The purpose of this experiment was to determine the number of murine
splenocytes that should be added to SCHU S4-infected BMM T cell function
assays to induce macrophage killing of SCHU S4
ii. BMM were infected with SCHU S4 at MOI of 1:500 (2 x 104/well)
iii. 105 and 106 splenocytes from naïve and vaccinated BALB/c mice were added
to the infected BMM and cultured for 3 days
iv. 10 ng/ml IFN was used a positive control to induce macrophage killing
v. As shown Figure 3, there was a measurable difference between naïve and
vaccinated splenocytes only when 106 cells/well was added.
vi. There were a couple of problems in this experiment.
Page 23 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
1. The first is that IFN did not reduce the number of SCHU S4
recovered. It is possible that we did not use enough IFN or IFN
does not induce macrophage killing, so we will titrate IFN in future
experiments.
2. There were variability in a few replicate samples that have to be
reduced in future experiments
Figure 3. Titration of splenocytes for macrophage killing assay with SCHU S4. BMM
infected with SCHU S4 were cultured with naïve and vaccinated splenocytes for 3 days.
The data show the mean of triplicates ± SD
b. Experiment Ftc30.15d (Notebook 101, pages 36-39)
i. The purpose of this experiment was to determine the MOI for infecting BMM
with SCHU S4 for the macrophage killing assay. This was a repeat of
Ft30.15b
ii. BMM were infected with SCHU S4 at MOI of 1:500 (2 x 104/well) and 1:1000
(1 x 104/well)
iii. 106 splenocytes from naïve and vaccinated BALB/c mice were added to the
infected BMM and cultured for 3 days. This number of splenocytes was
shown in Ftc30.15b to produce a measurable difference between naïve and
vaccinated T cells
iv. IFN was used a positive control to induce macrophage killing
v. As shown in Figure 4, the 1 log difference between naïve and vaccinated
splenocytes at MOI = 500 seen in Experiment Ftc30.15b was reproduced
here.
vi. There was a bigger difference between naïve and vaccinated splenocytes at
MOI = 1:1,000 than at 1:500.
vii. Interestingly, the majority of SCHU S4 was found in the medium at MOI =
1:1,000, but in the cell fraction at MOI = 1:500
viii. Moreover, IFN enhanced killing at MOI = 1:500 but not at MOI = 1:1,000
Page 24 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
ix. The results of Ftc30.15b and Ftc30.15d suggest that the optimal condition is
MOI = 1:1,000 and 106 splenocytes/well
Figure 4. Titration of MOI for macrophage killing assay with SCHU S4. BMM infected
with SCHU S4 were cultured with naïve and vaccinated splenocytes for 3 days. The data
show the mean of triplicates ± SD
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
25%
9. Work plan for upcoming month
a. Develop the macrophage killing assay using T cells from vaccinated Fischer 344 rats
i. Develop procedures for isolating and culturing macrophages from rats
ii. Develop procedures for isolating T cells from naïve and vaccinated rats
iii. Determine the optimal MOI for infecting rat macrophages
iv. Determine the kinetics of LVS and SCHU S4 proliferation in infected
macrophages
v. Determine whether T cells from vaccinated rats can induce infected
macrophages to kill intracellular bacteria
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
NA
Page 25 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Milestone 26
Milestone description: Confirmation of gene expression (design HTP SOPs, test HTP SOP,
ORF library production and confirm gene expression)
Description: Prepare a high-throughput protein production system
 Select and test ORF expression constructs
 Select and test IVT Protocols
 Select and test protocols for protein purification
Institution: ASU-Sykes
1. Date started: 3/02/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions:
A. Select and test ORF expression constructs
1. As previously presented, the selection of an IVT template design, and its optimization and
testing are as complete as possible at this point. Ongoing experiments in NM will solidify
this plan in the near future. For HTP application we have selected a linear modular
template with His tag incorporated at the C-terminus of the in vitro synthesized
polypeptide. We have generated sufficient amounts of synthetic promoter and terminator
fragments to complete the entire project. These single batches should maximize sample
consistency.
2. As a potential alternative to the E.coli based IVT system we have designed alternative
promoter and terminator cassettes optimized for eukaryotic expression. New cassettes
could be used in the rabbit reticulocyte or wheat germ based IVT system.
B. Select and test IVT Protocols
1. As previously reported we have found that shaking efficiency has a large impact on IVT
yield. We have found that HiGrow apparatus that we have in the lab can be used as an
alternative to the ProteoMaster. A rate of shaking provided by HiGrow and yield of IVT
reaction are highly comparable with those of the ProteoMaster. In contrast to the
ProteoMaster which can handle only one plate at the time, HiGrow can handle 32.
Table 1. IVT efficiency. Hi-Grow vs. ProteoMaster.
MW
ug prot
Proteomaster
1
CalM3
19469
26.42
2
FTU 1419
15704
57.42
3
FTU 1695
14185
24.05
Hi-grow
1
CalM3
19469
23.95
2
FTU 1419
15704
56.86
3
FTU 1695
14185
22.57
Page 26 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Data location: R:\GeneVac\FTU\Contract\Proteome\Hetal's data\Hetal IVT data\FTU
Scintillation results
2. We looked for alternatives to E.coli based IVT systems as a way to avoid the crossreactivity issues detected in the cellular assays at UNM rabbit reticulocyte and wheat
germ systems are the two IVT alternatives; however, both provide significantly lower
yields and incur higher costs than with the E.coli lysates and system.
Table 2. Comparison of commercially available IVT systems
Linear
template Promoter RBS
Yield (per reaction) Cost (per Cost
reaction)
~$20
(per
ug protein)
~$1
E. coli
Yes
T7
SD
15-25 µg
Wheat germ
Yes
T7
Kozak
50-200 ng
~$10
~$100
Rabbit reticulocyte
No
NA
Kozak
5-50 ng
~$3
~$100
Note: this table was prepared specifically for this report and is not stored in another location
C. Select and test protocols for protein purification
1. We found our results on His tag based purification of IVT synthesized proteins consistent with
results reported by others. In brief: use of His tag is associated with significant loses (from 50
to 100%) and great variability of the purification rate (from 0 to 90%). This questions
feasibility of the His tag based purification approach, especially in light of reactivity of the IVT
components in the T-cell assays.
2. Literature search for more efficient alternative tags was inconclusive. We dismissed large
tags and fusion proteins because of the earlier demonstrated detrimental effect of the protein
size on IVT yield. User of the small commonly used tags described similar or even bigger
problems in respect of loses and purity of the purified products (see Terpe,
Appl.Microbiol.Biotech:2003:60:523 for review).
3. As an alternative to purification we are assessing feasibility of depletion of IVT components
reacting with lysate stimulated T-cells. A set of IVT samples free from E.coli polyribosomal
complexes has been sent to UNM for evaluation in T-cell assay. If unsuccessful we will
attempt to remove E.coli ribosomes with polyclonal antibodies.
4. Significant decisions made or pending
A final decision on expression cassette format, IVT system and needs for
depletion/purification are still pending. The results of the T-cell stimulation experiments,
being carefully worked out at UNM, will direct our decision. ASU will complete MS 26 after
UNM develops the T cell stimulation assays.
5. Problems or concerns and strategies to address
Purification of IVT products will be unavoidably associated with at least some losses and
cause variability from sample to sample due to different levels of purity and yield. IVT lysate
protein removal/depletion is a possible alternative. Feasibility testing is in progress.
6. Deliverables completed
None
7. Quality of performance
Page 27 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Very good
8. Percentage completed
99%
9. Work plan for upcoming month
Depending on the results of the ongoing T cell experiments (UNM) we will initiate a polyclonal
IgG based depletion of the E.coli ribosomes from the IVT lysates or other depletion
experiments.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 27-UNM
Milestone description: Optimization of T cell assays and endpoints in mice. UNM will use
ASU’s protein fragments in lymph node proliferation assays to define vaccine candidates
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc59 study 1 (Notebook 106, pages 62-70) and Ftc59 study 2 (Notebook
106, pages 71-76)
i. The purpose of these experiments was to screen in vitro translated proteins
from ASU by mouse IFN Elispot. The goal is to determine which ivt proteins
stimulate a T cell response in vitro.
ii. 1 to 2 x 105 splenocytes from naïve and LVS-vaccinated BALB/c mice were
stimulated with 5 l of 54 different in vitro translation (ivt) reactions. Heatkilled (HK) and formalin-fixed (FF) LVS were used as positive controls and
medium was used as negative control
iii. As shown in Figure 5, all of the ivt reactions stimulated IFN production in an
antigen specific manner, i.e. the vaccinated splenocytes, but not the naïve
splenocytes, responded to HK- and FF-LVS by vaccinated splenocytes and
not to medium
Page 28 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
iv. This was quite surprising because we were expecting only a few antigenic
proteins from all of the translated F. tularensis proteins
Figure 5. Frequency of IFN-producing mouse splenocytes responding to ivt proteins.
Naïve (top) and LVS-vaccinated (bottom) BALB/c splenocytes were simulated with 5 l of
54 different ivt reactions.
Page 29 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
b. Experiment Ftc59 study 3 (Notebook 106, pages 77-79)
i. The purpose of this experiment was to determine whether the broad
spectrum response observed in Ftc59 studies 1 and 2 can also be observed
in vaccinated Fischer 344 rats.
ii. 2 x 105 splenocytes from naïve and LVS-vaccinated Fischer 344 rats were
stimulated with 5 l from 54 different ivt reactions. Heat-killed (HK) and
formalin-fixed (FF) LVS were used as positive controls and medium was
used as negative control
iii. The Fischer 344 rats showed the same broad spectrum responses observed
in the mouse (Fig. 6)
iv. It is possible that the vaccinated splenocytes were responding to
homologous proteins in the E. coli lysate used for the ivt reactions.




















Page 30 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Figure 6. Frequency of rat IFN-producing rat splenocytes responding to ivt proteins. Naïve (top)
and LVS-vaccinated (bottom) Fischer 344 splenocytes were simulated with 5 l of 54 different ivt
reactions.
c.
Experiment Ftc59 study 4 (Notebook 106, pages 80-85) and Ftc59 study 5 (Notebook
106, pages 86-90)
i. The purpose of these experiments were to determine whether the broad
spectrum response observed in Ftc59 studies 1, 2, 3 were due to
crossreactivity with proteins in the E. coli lysate used in the in vitro translation
Page 31 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
reaction. If there is crossreactivity to E. coli proteins, then we would expect
that eukaryotic in vitro translation systems, such as wheat germ extract and
rabbit reticulocyte lysate should not have this problem.
ii. Peripheral blood mononuclear cells (PBMC) from naïve and LVS-vaccinated
NHP (Ftc59 study 4, from Dr. Wilder at LRRI) and splenocytes from naïve
and LVS-vaccinated BALB/c mice were stimulated with E. coli lysate, rabbit
reticulocyte lysate and wheat germ extract. Heat-killed (HK) and formalinfixed (FF) LVS were used as positive controls and medium was used as
negative control
iii. Figure 7 shows that vaccinated mouse splenocytes indeed crossreact with
proteins in the E. coli lysate but not to rabbit reticulocyte lysate and wheat
germ extracts. The frequency of crossreactive cells is very low,
approximately 1 in 104 cells. Similar results were obtained with PBMC from
NHP (data not shown)
iv. Alex Borovkov at ASU subsequently indicated that the rabbit reticulocyte
lysate and wheat germ extracts are not efficient enough to replace the E. coli
lysate system and therefore alternative methods have to be explored to
remove the crossreactive proteins, most likely ribosomal proteins.
Figure 7. Frequency of IFN-producing mouse splenocytes responding to crossreactive
proteins in wheat germ extract (WG), rabbit reticulocyte lysate (RR) and E. coli lysate
(EC).
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
a. LVS vaccinated T cells cross react with proteins in the E. coli ivt reactions.
i. Since the level of crossreactivity was relatively low, we will try to bind the ivt
proteins to magnetic beads via the His-tag, wash extensively to remove the
crossreactive proteins and then stimulate T cells with bead-bound proteins
ii. ASU will also try various strategies to remove the crossreactive proteins. For
example, they will try different centrifugation and filtration procedures to
remove E.coli ribosomes, which they believe are causing the crossreactivity
Page 32 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
iii. Anders Sjostedt report similar crossreactivity when measuring T cell
proliferation but not IL-2 production. We will determine whether IL-2 Elispot
would circumvent this problem
6. Deliverables completed
NA
7. Quality of performance
Fair
8. Percentage completed
13%; no change because we encountered the problem with crossreactivity
9. Work plan for upcoming month
See discussion in the section “Problems or concerns and strategies to address”
10. Anticipated travel
NA
11. Upcoming Contract Authorization (COA) for subcontractors
NA
Milestone 28
Milestone description: Generation of peptide libraries (Optimize IVT protein-fragment
production, Develop IVT protocol for high-throughput production, Validate immunogenicity of
protein-fragments, Full scale production of protein-fragment library, Purification of proteinfragment library, Array protein-fragment into overlapping pools, Ship to UNM)
Milestone description: Build SCHU4 proteome
 Build ORF expression library corresponding to proteome
 Generate complete protein-fragment library (inactive)
 Array protein-fragments into measurable pools for T cell stimulation
(inactive)
Institution: ASU-Sykes
1. Date started: 03-01-2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
1. We are ready to start generation of peptide library in E.coli based IVT system, as soon as a
final decision on the system, yield, format, pooling, and purification is set.
2. To help UNM with protocol development and optimization we:
a. Constructed two plasmids encoding the chicken OVA SIINFEKLIVT epitope. One for
genetic immunization and one for use as an IVT template. The initial idea was that these
reagents might serve as irrelevant negative or positive controls for measuring T cell
stimulations. However, during our last phone conference with UNM we dismissed this
pathway. .
b. Cloned groES (FTT1695), groEL (FTT1696), IglC2 (FTT1712c), katG (FTT0721c), Tul4
(FTT0901) into recombinant E.coli expression plasmid (pEXP5-NT) and genetic
immunization vector.(pCMViLS). The purpose was to prepare large batches of protein for
E. coli depletion studies, and to prepare antibodies as protocol development tools.
Data location: R:\GeneVac\FTU\Contract\Proteome\Tien's data\DNA gels
Page 33 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
c.
Initiated E.coli recombinant in vivo or in vitro production of the FTU proteins listed above.
4. Significant decisions made or pending.
Final decision on expression cassette format, IVT system and needs for depletion/purification
are pending further T cell assay development results.
5. Problems or concerns and strategies to address
GroES and GroEL are toxic in E.coli. We will proceed with production of the other proteins
recombinantly in cells. UNM already has GroEL and GroES proteins that we earlier generated as
in vitro samples.
6. Deliverables completed
None
7. Quality of performance
Very Good
8. Percentage completed
26%
9. Work plan for upcoming month
DNA-coated-Gold microprojectiles (gene gun bullets) and recombinant proteins for mouse
immunizations, and IVT protein samples for T-cell assay development will be made and sent to
UNM.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 33
Milestone description: Microarrays constructed and confirmed; First printing of arrays,
Testing with DNA from Ft, Arrays GDPs validated at ASU.
Institution: ASU-Johnston
1. Date started: 08-01-2006
2. Date completed: 10-31-2007
3. Work performed and progress including data and preliminary conclusions

Additional experiments were performed with dose titrations of SCHU S4 RNA into normal
mouse lungs. Corresponding data from two independent experiments were averaged and
are reported in Figure 1. Overall signal intensities drop slightly through from 1 g through to
0.0001 g. A major drop in signal intensity was observed after 0.0001 g. Correlation
analysis confirmed the visual trend of the data (Table 1). Sequentially stepping down the
concentration gradient and comparing the complete microarray dataset between doses
revealed a high level of correlation. For, example, between 1 g and 0.5 g the correlation
was 0.764. This level of correlation maintained until the comparison of 0.0001 g to 0.00001
g with a level of correlation at -0.007.
Page 34 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Figure 1. Reconstitution samples of SCHU S4 diluted into 10 micrograms of normal mouse lung RNA
were amplified with the LAPT process, labeled and hybridized to the ASU microarray of SCHU S4
sequences.
SCHU S4 RNA in g
1
SCHU S4 RNA in g
0.5
0.1 0.05 0.01 0.001 0.0001
0.5 0.764
0.1
0.05
0.01
0.001
0.0001
0.00001
0.756
0.776
0.751
0.898
0.794
-0.007
Table 1. Correlation analysis of the complete genome microarray data set comparing sequential doses of
SCHU S4 RNA in normal mouse lung RNA.
Page 35 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam


Notebook/File locations …Notebook 514, page 101-106
Electronic file locations…
R:\GeneVac\FTU\Contract\Microarray\Milestones\33\LAPT-13 RE-DO
4. Significant decisions made or pending.
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
A validated microarray consisting of 1804 genes for SCHU S4 and a set of 183 genome directed
primers for amplification down to 0.0001 g of SCHU S4 genome in the context of mouse RNA.
So the expression of as little as 0.0001ug of SCHU S4 RNA can be detected in the presence of
10ug of mouse RNA .
7. Quality of performance
Good
8. Percentage completed
100%
9. Work plan for upcoming month
Create the Milestone 33 Completion Report
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 34-UNM
Milestone description: Pilot Studies for the optimization of RNA isolation and hybridization
conditions
Institution: UNM
1. Date started: 03/01/2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
UNM sent 3.2 mg SCHU S4 RNA and 960 ug SCHU S4 DNA to ASU on 9/27/07
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
14%
9. Work plan for upcoming month
Page 36 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
UNM will isolate RNAs from LVS, SCHU S4, and infected mouse organs, as needed by ASU.
ASU and UNM will discuss setting up a continuous stream of RNAs needed by ASU for
MS35.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 34-ASU
Milestone description: Pilot studies for optimization of RNA isolation & hybridization
conditions done.
Institution: UNM/ASU-Johnston
1. Date started: 03-01-2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions

As a quality control measure, specificity analyses were performed by amplifying a known
gene from F. tularensis SCHU S4 to determine binding to homologous probe on microarrays.
PCR products were generated from genomic DNA with primers for specific genes. These
genes were randomly selected from a set of PCR primer plates used for the proteome project
and were kindly provided to use by Dr. Kathryn Sykes. Ten PCR products were generated
with products of the appropriately predicted size were gel purified and indirectly labeled with
Alexafluor 555 fluorescent dye. Each product was hybridized to an individual array and the
data acquired and analyzed. Table 2 shows the determination of whether the targeted probe
bound to its corresponding gene. On the ASU array, two of the probes did not selectively
bind to their cognate probe (713B and 897A). ASU will be reviewing the data on these two
probes to determine whether the probe sequence is included in the region of the amplified
gene. Of the remaining 8 probes, 6 bound their cognate gene with the highest intensity. The
remaining two FTT890c and FTT1365C) had some off-target interactions with other genes. It
was not readily discernible why these genes had off-target interactions, but it was determined
that these two genes were not part of any large gene families that could account for the offtarget binding. A second experiment was done with a smaller subset of the PCR products
and these 4 bound the cognate gene on the ASU array but did not bind to the TIGR array.
FTU0242A
FTU0457A
FTU0580A
FTU0713B
FTU0890A
FTU0897A
FTU0988A
FTU1295B
FTU1365B
FTU1658A
Exp 1
ASU Array
Y
Y
Y
N
Y
N
Y
Y
Y
Y
Exp 2
ASU Array
TIGR
Y
N
Y
N
Y
Y
N
N
Table 2. Hybridization of indirectly labeled PCR products of known genes to ASU and TIGR arrays.
Page 37 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam


Notebook/File locations …, Notebook 404, page 117-120.
Electronic file locations…
R:\GeneVac\FTU\Contract\Microarray\Milestones\34\Testing Arrays

We utilized SCHU S4 purified RNA and processed 10 micrograms of total SCHU S4 RNA
through the LAPT process. We hypothesized that using excess input SCHU S4 RNA we
should be able to amplify most of the SCHU S4 gene set. This would help validate the probe
sets for each gene and if the samples were highly representative of the complete genome,
we could more effectively compare the ASU and TIGR arrays. The raw signal intensities of
replicate arrays of SCHU S4 RNA hybridized to two ASU and two TIGR arrays are shown in
Figure 2. The overall signal intensities had a higher dynamic range on the ASU arrays as
compared to the TIGR arrays. In addition, the mean background signal was less on the ASU
arrays (372 mean, 278 SD) as compared to the TIGR arrays (565 mean, SD 723). Further,
1753 of the 1804 probes were detected at two standard deviations above background on the
ASU array. This represents 97% of the genome. On the TIGR arrays only 507 genes were
detected in the same samples at two standard deviations above background representing
only 28% of the genome.
Figure 2. Histogram analysis of two independent microarrays of amplified SCHU S4 on either the ASU or
TIGR array.


Notebook/File locations …, Notebook 404, page 117-120.
Electronic file locations…
R:\GeneVac\FTU\Contract\Microarray\Milestones\34\Testing Arrays
Page 38 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
4. Significant decisions made or pending.
The ASU arrays have higher dynamic range and the probes can detect greater than 95% of the
genome in a highly amplified SCHU S4 RNA sample. The TIGR arrays have a lower dynamic
range and only detect 28% of the genome.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
85%
9. Work plan for upcoming month


Perform additional hybridizations between ASU and TIGR arrays with unamplified and
amplified SCHU S4 RNA.
Perform QPCR verification of differences to verify microarray results of selected genes.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 35
Milestone description: Array hybridizations with mouse RNAs from virulent Schu 4
infection & RT PCR confirmation of candidates.
Institution: UNM/ASU-Johnston
1. Date started: 06-01-2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Initial studies of the mouse lungs harvested after a dose response challenge of SCHU S4
(103-107 organisms) was done with pooled samples of each lung. We have subsequently
performed LAPT analysis on the individual lung samples of each animal individually. Each
sample amplified well and microarrays were performed on the individual animal sample.
Each of the animal responses within a dose response were highly correlated at > 0.70and the
average of the individual data correlated highly with the previously analyzed pooled samples.
Totalg after LAPT
Mouse Number
1
2
Dose of SCHU S4

3
3
77.8
60.5
77.7
4
94.5
102.2
106.1
5
108.1
88.6
82.8
6
139.1
163.4
169.7
7
169.7
139.6
162.7
10
10
10
10
10
Table 2. Total micrograms of amplified RNA generated after LAPT
Page 39 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam


Notebook/File locations … Notebook 514, pages 67-81;
Electronic file locations… R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-11LAPT-12
Figure 3. Raw signal intensities of amplified RNA from individual mouse samples receiving gradient dose
challenges of Francisella tularensis SCHU S4.
4. Significant decisions made or pending.
Biological replicates can be pooled before microarray analyses to minimize mouse to mouse
variability.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
Page 40 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
6%
9. Work plan for upcoming month
Initial studies will be performed to repeat the early dose response studies and include a lower
dose down to 10 organisms per animal to validate the dose response detection limit. Work with
UNM to establish a continuous sample stream for this milestone.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 41
Milestone description: Optimization of photochemical inactivation and characterization of
KBMA Ft. novicida; determine the amount of S-59 and UVA required to inactivate uvr mutants;
determine extent of metabolic activity of uvr mutants after S-59 and UVA inactivation; determine
the level of virulence attenuation of KBMA uvr strains in mice
Institution: Cerus
1. Date started: 3/2/06
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Summary: We have determined that all the NER-deficient strains of Ft. novicida are slightly
more sensitive to photochemical inactivation than wild type Ft. novicida. We have optimized
photochemical inactivation conditions at a 3.5 mL scale and a 400mL scale and produced a
lot of KBMA uvrB Ft. novicida for potency testing in MS42. We have demonstrated that
KBMA Ft. novicida are highly attenuated for virulence. Frozen KBMA uvrB Ft. novicida are
maintain metabolic activity at –80oC for at least 3 months.
Because the inactivated NER-deficient strains have a similar degree of metabolic
activity as the wild-type Ft. novicida strain (which is different than has been seen with L.
monocytogenes or B. anthracis) we have initiated a series of experiments to determine the
cause of this observation. There are 2 obvious and distinct possibilities 1) is that the NER
genes are not turned on during photochemical inactivation with S-59 and UVA light or 2)
there may be a redundant mechanism for repair of DNA damage that prevents inactivation of
the uvr mutants at low S-59 concentrations. We previously evaluated the sensitivity of the
uvrB mutant and U112 to 6 alternative DNA damaging agents: S-303 (a nitrogen mustard
crosslinking agent that is not activated with UV-light), mitomycin C, cisplatin, doxorubicin
hydrochloride, benzo[a]pyrene, and 4 nitroquinoline-N-oxide using a 96-well format minimum
inhibitory concentration (MIC) assay. 4 of the DNA damaging agents inhibited growth of the
bacteria. Of the 4 agents that inhibited growth of Ft novicida, only 2 inhibited growth of the
uvrB mutant at lower concentrations (S-303 and 4 nitroquinoline-N-oxide).
1) This month, no new progress was achieved on this milestone as we have been working work
towards modification of the Cerus milestones as presented at the annual TVDC meeting in
Santa Fe.
4. Significant decisions made or pending
All NER mutants (uvrA, uvrB, and uvrA uvrB) of Ft. novicida were equally sensitive to S-59
and had comparable metabolic activity after inactivation. We have chosen to use the uvrB
single mutant for further experimentation. We have selected 40M S-59 and 7J/cm2 as the
conditions for making 400ml-scale KBMA lots, and have produced a lot of KBMA uvrB Ft
novicida vaccine that is sterile for further characterization. We have decided to open MS 42 in
Page 41 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
order to determine whether KBMA Ft novicida can protect against a lethal wild-type Ft novicida
challenge.
5. Problems or concerns and strategies to address
The 2-fold difference in the concentration of S-59 required for complete inactivation of the
mutants compared to wild type is less than we have observed for other organisms. This
appears to hold true for other methods of induced DNA damage. One possible explanation
for this is that there is a redundant DNA repair mechanism functioning in Ft novicida that may
limit the sensitivity of the NER-deficient mutants to DNA damage and thereby limit the
metabolic activity and potency of KBMA Ft novicida. If there is a redundant repair
mechanism, we may not be able to produce a highly potent KBMA vaccine utilizing
Francisella species as a platform. A new concern is that Cerus may no longer have enough
human resources to complete this milestone in a timely manner.
6. Deliverables completed
400mL-sacle photochemical inactivation process defined
7. Quality of performance
fair progress
8. Percentage completed
85% of scientific work completed on the milestone
9. Work plan for upcoming month
We will work to generate a modified set of milestones that are scientifically appropriate and
achievable.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 42
Milestone description: Determine whether KBMA F.t. novicida vaccine protects against wildtype F.t. novicida challenge in mice: Vaccination route and regimen optimization, measure
durability of protection
Institution: Cerus
1. Date started: 2/1/07
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Summary: KBMA Ft novicida uvrB vaccine stocks produced in MS41 have been tested in
mice for virulence and protection against a 100 x IP LD50 challenge of Wild-type Ft novicida.
KBMA Ft novicida uvrB were 100% protective when a single dose was administered at or
near the LD50 of the KBMA vaccine (1 x 109 IP, 1 x 108 IV). 100% protection was also
achieved by administration of 1 x 107 KBMA particles IV when the vaccine was given twice
separated by 3 weeks. Depletion of CD4+ T cells prior to the challenge decreased the
survival rate to 80%, depletion of C8+ T cells had no effect, and depletion of both cell
populations resulted in 90% survival. Together, these data demonstrated that CD4 T cells
contribute to a protective immune response in a non-CD8 T cell-dependent manner. These
data suggest that the CD4 T cells may be boosting humoral immunity by stimulating B cells.
This interpretation was supported by an adoptive transfer experiment in which only the hightiter serum from CD8-depleted animals provided any protection against a lethal U112
challenge. Together these data demonstrate that the protection we see after vaccination with
KBMA Ft novicida uvrB correlates with humoral immune responses and explains why the
KBMA vaccine does not perform better than heat killed vaccine. This also makes it nearly
impossible to rank attenuated Ft novicida mutants by their ability to protect mice against a
Page 42 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
lethal challenge. We instead plan to evaluate the ability of KBMA vaccines to induce a potent
CD8 T-cell response to an introduced ovablumin epitope tag and are awaiting the
construction of this strain from UTSA.
1) This month, no new progress was achieved on this milestone as we work towards modification
of the milestones.
4. Significant decisions made or pending
We have decided to evaluate the potency of the KBMA Ft novicida vaccine by measuring the
CD8 T cell response to an ovalbumin epitope tag.
5. Problems or concerns and strategies to address
Because humoral immunity plays a significant role in protection of mice against a lethal Ft
novicida challenge it is essentially impossible to rank KBMA vaccine candidates that elicit a
potent T cell response using survival after a lethal Ft novicida challenge in MS 43. We have
requested that Karl Klose construct an ovalbumin epitope-fusion protein to facilitate screening
strains of Ft novicida for their ability to elicit a T cell response to this well-defined epitope.
6. Deliverables completed
None
7. Quality of performance
fair progress
8. Percentage completed
25% of scientific work completed on the milestone
9. Work plan for upcoming month
We will work to generate a modified set of milestones that are scientifically appropriate and
achievable.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 44
Milestone description: Formulation and evaluation of KBMA LVS: establish photochemical
inactivation regimen of selected uvr mutant of LVS and measure metabolic activity and virulence
of KBMA LVS.
Institution: Cerus
1. Date started: 6/18/2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Summary: using a small-scale inactivation procedure we have determined that the S-59 psoralen
concentration required to inactivate uvrB LVS is 5uM. This is the same concentration at which
we have been able to inactivate WT LVS. The uvrB LVS was also not more sensitive to DNA
damaging agents compared to WT. This suggests that there may be redundant DNA repair
mechanisms in LVS that may be functioning to repair photochemically induced crosslinks.
1) This month, no new progress was achieved on this milestone as we work towards modification
of the milestones.
4. Significant decisions made or pending
none
Page 43 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
5. Problems or concerns and strategies to address
The uvrB mutant of LVS does not appear to be more sensitive to DNA damage induced by
photochemical inactivation with S-59 and UVA or by other chemical means. This suggests that
the potency of a KBMA uvrB LVS vaccine is likely to be the same as KBMA Wt LVS which failed
to protect mice against lethal a schuS4 challenge (see MS46). These results suggest that we
reevaluate the KBMA tularemia vaccine strategy and we suggest comparing the efficacy of a
KBMA LVS vaccine to a KBMA Listeria monocytogenes vaccine that expresses Ft antigens.
6. Deliverables completed
none
7. Quality of performance
fair
8. Percentage completed
5%
9. Work plan for upcoming month
We will work to generate a modified set of milestones that are scientifically appropriate and
achievable.
10. Anticipated travel
none
11. Upcoming Contract Authorization (COA) for subcontractors
none
Milestone 46
Milestone description: Scale up of KBMA LVS vaccine production; Optimize large–scale LVS
culture conditions, Establish 3L culture scale purification conditions, Optimize 3L scale
photochemical inactivation process, Verify protective immunogenicity of vaccine candidates
produced by optimized large-scale process
Institution: Cerus
1. Date started: 3/2/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
Summary: we have demonstrated that LVS grows robustly in Chamberlains Defined Media
(CDM) and have prepared expanded DVC lot 16 LVS cultures grown in CDM for 36 hours,
and stored at -80oC. We have determined that the minimum concentration of S-59 required
for complete inactivation of DVC lot 16 LVS is 5µM and that photochemically inactivated LVS
maintain metabolic activity for at least 12 hours. We produced a 3L lot of LVS in our
fermentor using .001% Sigma antifoam A in CDM and have demonstrated stability for 4
months at -80o in 2 cryopreservation medias. We have found that the LVS provided by DVC
is greatly attenuated for virulence in mice when administered IP compared to literature
reports. We have demonstrated that LVS replicate rapidly in livers and spleens of mice
immediately following IV injection; however, it appears that there is a lag that specifically
affects growth in the lungs. We have also demonstrated that LVS is nearly avirulent when
administered by the SC route.
We have produced a 400mL lot of KBMA wild-type LVS using 10 uM S-59 and 6 J/cm 2 UVA
for initial proof of concept studies, and for later comparison with NER-deficient uvrB LVS
and we have demonstrated that the metabolic activity of this lot is stable for 3 months. We
have demonstrated that KBMA WT LVS IV LD50 is 6.8x108, which represents a 4-5 log
attenuation compared with live LVS. We have demonstrated that doses of KBMA WT LVS as
low as 1 x107 provide protection against 100 x IP LD50 challenge of live LVS. However, none
of the mice vaccinated with the equivalent doses of HK LVS died either. This is consistent
with protection against an LVS challenge being largely humoral. b We recently attempted to
Page 44 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
measure the T-cell response to a CD4 Tul4 epitope in mice vaccinated with live or KBMA
LVS by intracellular interferon-gamma (IFN-) cytokine staining (ICS) or ELISpot assay, but
were unable to detect an induced response to this epitope. This may be because this epitope
does not bind the MHC molecule with high affinity, or the T cell response elicited by LVS may
actively suppress T cell responses. We recently demonstrated that LVS does not induce IL-6
or MCP-1which are critical hallmarks of a protective inflammatory response. Furthermore,
co-vaccination with LVS decreased the innate inflammatory response to Lm. Administration
of LVS decreased the ability of the elicited T cells to produce the cytokine IL-2. Terry Wu at
UNM completed a protection study with KBMA WT LVS in which neither a (IV or IN) prime
nor a prime and boost (separated by 3 weeks) vaccination regimen with KBMA WT LVS
protected against a lethal SchuS4 challenge in mice. KBMA WT LVS vaccine appears to be
less potent than live attenuated LVS.
1) This month, no new progress was achieved on this milestone as we work towards
modification of the milestones.
4. Significant decisions made or pending
Because wt Ft novicida is inactivated with S-59 concentrations that are only slightly higher than
uvrB mutant we have been investigating the efficacy of a wild-type KBMA LVS vaccine. Now
that we have received the uvrB mutant we will focus on producing a lot of KBMA uvrB LVS
5. Problems or concerns and strategies to address
The protection seen with the KBMA WT LVS against a lethal LVS challenge is independent of
metabolic activity. This suggests that comparison of various routes, regimens, or formulations will
be difficult to optimize by protective efficacy. The SchuS4 challenge model in mice is more
stringent, but KBMA LVS failed to protect after two doses. It is possible that the rat model may
allow a higher degree of sensitivity. The suppression of the innate inflammatory response and
the suppression of CD4 T cell cytokine production may potentially indicate that LVS is not a
potent inducer of protective T cell responses. We would like to screen for T-cell responses using
the peptides generated by ASU as an alternative method for optimization of vaccine potency or
construct an overlapping peptide library for IglC.
6. Deliverables completed
None
7. Quality of performance
Good progress
8. Percentage completed
53% of scientific work completed on the milestone
9. Work plan for upcoming months
We will work to generate a modified set of milestones that are scientifically appropriate and
achievable.
10. Anticipated travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
Page 45 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
In order to generate mutants in SCHU S4 we need to develop tools to generate successful deletions.
Therefore, our focus is two fold, one is cloning experiments to get our target deletions into vectors that
we can use in creating these deletions and experiments with SCHU S4 itself using constructs that we
believe will allow us to make deletions into SCHU S4.
I.
Cloning:
a. The newly developed Tulatron system was created to allow specific gene knockouts in
Francisella tularensis. The plasmid created for this system, pKEK1140 (fig. 1), allows
one to target any gene in any subspecies of Francisella. Our goal was to knockout the
Francisella Pathogenicity Island (FPI) gene vgrG in the Type A strain Schu4. In the
UTSA work plan, this gene was substituted for pdpD, a gene that has been shown to not
be essential for virulence by multiple labs. In order to do this, we first had to order
primers that would efficiently target the gene of interest, in this case, vgrG. The entire
gene sequence was sent to Sigma for them to use their computer algorithm in order to
generate a series of primers that can be used to target vgrG. We chose two separate
sets of primers that target two different gene locations in vgrG in hopes of generating at
least one amplification for further cloning into pKEK1140. The first primer set and its
target base pair (30/31) is shown in Figure 2. These three primers were used in a PCR
reaction that would amplify the intron retargeted to our gene of interest. Figure 3 shows
the results of the PCR reaction with the two different sets of primers. Primer set 1, lane
1, targets vgrG at base pair 81 and 82. Whereas, primer set 2, lane 2, targets base pairs
30 and 31. The 350 base pair PCR product from Primer set 1(faint) and 2 on the gel
was cut out of the gel and purified. The primers used to amplify these products contain
restriction sites XhoI and BsrGI to allow efficient cloning into pKEK1140 (fig. 1). I will cut
the PCR products with these two enzymes and ligate into pKEK1140, cut with XhoI and
BsrGI as well. This will give us the Tulatron vector (fig. 1) retargeted to knock out vgrG.
Data located in TVD UTSA Notebook 1, page 20 and 21.
Figure 1.
Page 46 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Figure 2.
FTT1347_30/31a-IBS
AAAACTCGAGATAATTATCCTTAGCTGCCGTGATGGTGCGCCCAGATAGGGTG
FTT1347_30/31a-EBS1d
CAGATTGTACAAATGTGGTGATAACAGATAAGTCGTGATGATTAACTTACCTTTCTTT
GT
FTT1347_30/31a-EBS2
TGAACGCAAGTTTCTAATTTCGATTGCAGCTCGATAGAGAAAGTGTCT
Figure 3.
Lane 1 (80/981)
Lane2 (30/31)
Ladder
400bp
300bp
200bp
100bp
b. Continued with the igLD cloning by preparing the KEK1140 for ligation reaction by
digesting this plasmid with Xho I restriction endonuclease and subsequently, with BrsGI
restriction endonuclease. In addition the oligo sets mentioned in an earlier report
(30/31a set and 255/256a set) were used to generate new igLD PCR (“intron”) products
which were also digested with the same enzymes and prepared for ligation. Basically,
the lacZ gene in the KEK1140 vector will be replaced with the desired igLD “intron
products” generated with the specific igLD oligos. The plasmid and the specific igLD
“introns” have been purified and are ready for ligation. The ligation will be done this
week will report on results in next report. Data located in TVD UTSA Notebook 5,
page 81-83, and 86.
II.
Experiments to generate deletions in Schu4:
a The last Schu4 experiments involved the pdpA gene which is being used to attempt to
knock out one complete “pathogenicity island” (FPI-I and FPI-II) in Schu4. This requires
a multi-step process and the first step is to obtain this deletion in each of the
pathogenicity islands. As discussed in the earlier report we located a gene from each of
the FPIs which will be used to differentiate between these gene locations in our PCR
screen. These genes, described earlier, are FTT1343 (≈8 kb product, FPI-I) and
FTT1696 (≈10 kb product, FPI-II). Pairing these oligos with the Kan specific oligo
(KanIdentifUp) we generated the PCR products and these were purified this month.
b. Based on the initial screens from July month the chromosomal DNA used to do the above
mentioned PCRs were 1B (which is believed to be the FPI-I clone) and 4B clones 1 and 2
(which are believed to be the FPI-II clones). The resulting PCR products are being sent
Page 47 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
for sequencing this week. (See figure 4 for the screen of the purified PCR products.)
Hopefully, we will have sequence confirmation for each of these FPI clones.
Figure 4.
This represents 2 ul (of 30 ul elution) profile of the integrity of the purified PCR products generated with
oligo sets FTT1696 + KanIdentifUp (FPI-II, panel A) and FTT1343 + KanIdentiUp (FPI-I, panel B). Lanes
2 and 3 are two clones believed to be in the FPI-II (the 4B2 sample is weak but, should be enough for
sequencing). Lanes 4 thru 7 are samples (1B and 131-9) that may be possible clones in the FPI-I these
were prepared in duplicate (a and b). Just a note, this gel was not run very long to resolve the true size of
these products the highest molecular marker is 12.5 Kb and these products are between 8 Kb and 10 Kb.
Data located in TVD UTSA Notebook 5, page 84.
c.
In last report polymerase chain reactions were performed with various oligo sets directed
to igLC, the cloned intron, in order to determine that both FPI-I and FPI-II igLC genes
have been deleted. The oligo pairs are listed by name below:
i.
Mod.Methylase Forward 3’ :: iglC NdeI Rev ( ≈10 kb product)
ii.
Mod.Methylase Forward 3’ :: EBS2 427 igLC ( ≈10 kb product)
iii.
FTL1152 (LVS)* :: EBS2 427 igLC (expect ≈10 kb product)
iv.
FTL1152 (LVS)* :: iglC NdeI Rev (expect ≈10 kb product)
v.
EBS2 427 igLC :: igLC Nco I For (expect 900 bp product)
*This gene has a homolog with the Schu S4 FTT1364, our lab had this oligo on hand and it will work for
our purposes in this screen.
d. The various products generated were purified and are ready to send to sequencing. This
will be done and should have IglC sequence confirmation data to report on next report.
Figure 5 is a representative of part of purified PCR products sent for sequencing. Data
located in TVD UTSA Notebook 5, page 79 and 80.
Page 48 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Figure 5.
This represents 2ul (of 30 ul elution) profiles of the purified PCR products that will be sent for sequencing
to confirm both FPIs have been deleted in the igLC clone generated in August. Lanes 2 thru 5 are
products generated with the FTL1152(LVS) + IgLC NdeI rev oligo set (panel A) and lanes 7 thru 11 are
products generated with FTL1152(LVS) + EBS2 427 igLC (panel B). Lane 2 is the wild type product that
can be generated only with this set of oligos this will be sequenced for comparison. Lanes 3-5 and 7-11
are representative igLC clones that may all be correct. The T-IgLC (lane 3 and 7) and T-igLC single
(lane 8) were the clones used in the immunoblot data presented in August report. The T-igL C clone is the
original single colony clone believed to be correct. This was grown onto another TSA+++ plate and a
secondary single colony was isolated from that plate (hence, T-IgLC single). With the resolution of this
gel, it appears that the wild type (lane 2) and all other lanes give the same size product around 12kb. Is
this a correct statement? Did you expect all lanes to have the same product size ? Yes, this gel system
will not be able to resolve a 800 bp difference between the mutant and wild-type products when the PCR
product is greater than 8 Kb. In addition, the expected product sizes will run at 10 Kb which will not be
resolved from the 12.5 kb on this gel photo.
e. Previously, the mice experiment to check the igLC mutant (used T-igLC clone) were
found to be attenuated and after one month, we challenged these surviving mice with
the wild type strain of Schu4. There were five mice per group and we used a inoculum of
404 CFU in this experiment and none of the mice survived; there was a delay of death in
the set of mice primed with the higher igLC deletion doses of 1 E +4 and 1 E +5,
respectively (See figure 6).
Figure 6.
This represents the results for the wild type SCHU S4 challenge given to the surviving mice from the initial
igLC mutant immunized mice from August. PBS represents the control mice which are considered naïve
and which should yield the normal death rate of Schu4. The experiment showed that the igLC mutant did
Page 49 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
not generate enough immune response from these mice to be protective. All mice in the control set died
on day 4 and the highest igLC inoculated group (1 E+5) had a two day delay before all mice died. Data
located in TVD UTSA Notebook 5, page 76. .
f.
Various events regarding the BSL3 lab were addressed this past month.
i. Had to do annual training required by CDC and NIH regulations.
ii. Had to prepare lab for inspections by internal safety personnel.
iii. The main – 85 C freezer where our Schu4 strains were kept is leaking oil and I
arranged for a refrigeration company to go in and diagnose the problem. The
strains were moved to the second – 85 C freezer until this freezer is repaired.
iv. Had to participate in the escorting of personnel in the re-certifications and repairs
to the BSL3 lab.
v. We are hoping that all repairs will be done in the BSL3 lab by Monday, November
12, 2007 but this will depend on repairs being done and any unforeseen delays.
g. Did some ordering for enzymes and purification kits need for ongoing experiments.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
52%
9. Work plan for upcoming month
a.
b.
c.
d.
Will analyze sequence data received from PCR igLC and pdpA DNA samples
Will continue with the vgrG cloning into vector KEK1140
Will continue with the igLD cloning into vector KEK1140
Order supplies as required.
10.Anticipated travel
None
11.Upcoming Contract Authorization (COA) for subcontractors
None
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB; LVS
uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) pdpD,
iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4) iglA,
iglB strains
Institution: UTSA
1. Date started: 05/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
Page 50 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
a. Evaluate the protective efficacy of the Ft subsp. novicida uvrBiglA double mutant as a
vaccine candidate (Note book #4, page 134-135). Groups of BALB/c mice (female, 4-6
weeks) were intranasally (i.n.) immunized with 105, 106 or 107 CFU of ΔuvrBiglA. Mice
treated with PBS were used as a mock-control. The immunized mice were challenged
with 1000 CFU of F. novicida (~100 LD50) by the i.n. route after 30 days of vaccination.
As shown in Fig. 1, ΔuvrBiglA-vaccinated mice were highly protected against subsequent
pulmonary challenge with F. novicida.
No significant loss of body weight was also
observed in the protected animals. As expected PBS-treated mock-vaccinated mice
succumbed by day 5.
100
% Survival
80
10 5
10 6
10 7
PBS
60
40
20
0
% Body weight
110
0
4
8
12
16
20
105
100
95
90
85
80
0
2
4
6
8
10
12
14
Days after challenge
Fig. 1. Protective efficacy of ΔuvrBiglA immunization against F. novicida infection.
BALB/c mice were immunized intra-nasally with 3 doses (105, 106, and 107 CFU) of
ΔuvrBiglA or PBS and i.n. challenged with lethal dose of F. novicida (1000CFU). Mice
were monitored for survival rate and weight change.
b. Analyze the antibody profiles of mice immunized with the Ft novicida uvrBiglA mutant
after vaccination (Note book #4, page 129-133). Blood was collected from the PBS- and
ΔuvrBiglA- immunized mice (as described above in a) at day 14 and Day 28 after
priming. Specific anti-ΔuvrBiglA total antibody titer as well as IgG1 and IgG2a isotypes
were determined by ELISA. Antigens, either UV-irradiated ΔuvrBiglA (106/well) or HEL
(Hen Egg Lysozyme, 50ng/well, an unrelated antigen as control), were coated onto 96well microplates and reacted with serial dilutions of sera. Goat anti mouse Ig(H+L), IgG1
and IgG2a antibody conjugated with peroxidase were used as the secondary antibody to
determine serum antibody isotypes and titers. As shown in Fig. 2, mice immunized with
ΔuvrBiglA produced measurable amounts of specific serum total antibody (at day 14 after
priming with the two higher vaccination doses). The titers were increased at day 28 after
priming with all three doses (2 days before bacterial challenge). Isotyping analyses
indicated both Th1 (IgG2a) and Th2 (IgG1)- type antibodies were produced in mice after
the ΔuvrBiglA immunization. No ΔuvrBiglA - specific antibody was detected in mice
mock-vaccinated with PBS at day 28 after immunization. All tested serum samples
showed no reactivity to the unrelated HEL protein
Page 51 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
3
Total Ab
Day 14
Titer (x1000)
2
Day 28
1
500
0
0
3
3
IgG1
2
2
1
1
500
500
0
0
IgG2a
PBS
105
106
107
0
0
PBS
ΔuvrBiglA
105
106
107
ΔuvrBiglA
Fig. 2. Humoral response to ΔuvrBiglA immunization. BALB/c mice were
intranasally immunized with 105, 106 or 107 CFU of the ΔuvrBiglA mutant or PBS
alone as mock vaccination. Sera were collected 2 weeks and 4 weeks after
immunization and used to determine titers of anti- ΔuvrBiglA specific antibody.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
50 % of scientific work completed on the milestone
9. Work plan for upcoming month
a. Determine the LD50 of Ft subsp. novicida uvrBpdpD double mutant.
b. Monitor Ft subsp. novicida ΔuvrBpdpD replication and dissemination in mice via
intranasal inoculation.
c. Monitor LVS replication and dissemination in mice via intragastric inoculation.
10. Anticipated Travel
None
11. Upcoming Contract Authorization (COA) for subcontractors
None
Page 52 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
Milestone 52
Milestone description: Create RecA mutants in F. tularensis subsp. tularensis(Schu S4)
Institution: UTSA
1. Date started: 9/15/2007
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
To inactivate RecA in Schu S4, we were in the process of constructing a Targetron vector for
targeting and inactivating the RecA gene. The Targetron vector was designed to be constructed
with the intron expression vector pKEK1140 for the backbone, and a 350bp PCR product for the
insertion to mutate intron RNA.
3.1
Two DNA target sites (720/721s and 840/841s) were selected from Targetron Design Web site
based on RecA sequence of Schu S4 and two sets of primers for the sites were ordered. There
are three unique primers IBS, EBS2 and EBS1d for each target site.
3.2 Made 4-primer master mixes for PCR with IBS, EBS1d, EBS2, and EBS Universal primers.
3.3 Performed PCR to get the expected 350bp product with 4-primer mix for both 720/721s and
840/841s target sites. Set PCR as follows:
23ul ddH2O
1.0ul 4-primer mix
1.0ul Intron PCR template
25.0ul JumpStart RED taq Ready mix
AT 94C 30sec, 94C 15sec/55C 30sec/72C 30sec//30 cycles, then 72C 2min .
Figure1: The largest, intense band( about 350bp) was the expected PCR product.
3.4 Double digested gel purified 350bp PCR product and pKEK1140 with restriction enzyme XhoI
3.5
and BsrGI to generate the correct fragment ends to allow insertion of the digested PCR product
into the pKEK1140 vector.
Performed gel purification for both double digested products with QIAquick Gel Extraction Kit.
Data recorded on UTSA TVDC notebook #6, page1-3.
4 Significant decisions made or pending
None.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None.
7. Quality of performance
Good
8. Percentage completed.
Page 53 of 54
Tularemia Vaccine Development Contract: Technical Report
Period: 10/01/2007 to 10/31/2007
Due Date: 11/7/2007 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Bob
Sherwood, Trevor Brasel, Julie Wilder, Justin Skoble, Kathryn Sykes, Stephen Johnston, Mitch
Magee, Karl Klose, Bernard Arulanandam
About 5% of scientific work completed.
9. Work plan for upcoming month
i. Ligate two digestion products of 350bp RecA ”Intron” ( step3.5 above) into pKEK1140 vector
ii. Transform the ligation product into DH5 cells.
iii. Screen the colonies to find the pKEK1140 construct which contains the 350 bp RecA “intron”.
10. Anticipated travel
None.
11. Upcoming Contract Authorization (COA) for subcontractors
None.
Page 54 of 54