Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 8, 9, 10, 11(UNM &LBERI), 12/13 (UNM &LBERI), 14, 17, 18, 19, 21(UNM
29 (UNM &LBERI), 35 (UNM/ASU), 36, 49, 52, 53
Completed milestones: 1, 3, 4, 5, 6, 7, 16, 25, 26, 27, 28, 32, 33, 34, 39, 40, 43, 48, 50, 51
Inactive milestones: 15, 20, 22, 23, 24, 30, 37, 38, 54
&LBERI),
Milestones terminated after initiation: 41, 42, 44, 46, 55, 56, and 57 (MSCR will be written)
Milestones terminated before initiation: 43 (Cerus) 45, 47, 58, and 59 (MSCR will not be written)
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/2005
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. Three UNM and possibly 6 LBERI scientists will receive LVS vaccinations in 2009.
b. USAMRIID (United States Army Medical Research Institute for Infectious Disease) tentative
vaccination date is September 2009, pending FDA (Federal Drug Administration) approval
4. Significant decisions made or pending
a. USAMRIID tentatively will resume offering vaccinations to UNM and LBERI in September 2009 if
FDA approval is given.
b. UNM (4) and LBERI (33) are vaccinated; UNM and LBERI will offer the LVS vaccinations to 9 more
scientists to total up to 46.
c.Dr. Lyons received UNM IRB re-approval to allow blood draws on the vaccinated LBERI and UNM
scientists after their LVS vaccinations
d.UNM, True, LBERI, USAMMDA and USAMRIID fully executed the CRDA modification #1 to extend
the termination date from 6/29/09 to September 29, 2010.
5. Problems or concerns and strategies to address
a. Nine scientists could be vaccinated in 2009 if USAMRIID receives FDA approval for the new
Tularemia vaccination protocol.
b. USAMRIID may restart LVS vaccinations in September 2009 pending FDA approval
6. Deliverables completed
a. A total of 37 participants (33 LBERI and 4 UNM participants) have received the LVS vaccination
since 9/11/07.
b. 37 participants have terminated from the USAMRIID SIP, after completing the one year health
follow-up at UNM EOH (Employee Occupational Health).
Page 1 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
7. Quality of performance
Excellent
8. Percentage completed
76% of the scientific work is complete
9. Work plan for upcoming month
Schedule LVS vaccinations for 9 remaining LBERI and UNM scientists in September 2009, if
USAMRIID has FDA approval to reopen the SIP (Special Immunizations Program).
Milestone 7
Milestone description: SCHU S4 ED50 in primates determined from selection of challenge
dosing
Institution: LBERI
1. Date started: 2/25/08
2. Date completed: Completed 6/30/2009
3. Work performed and progress including data and preliminary conclusions:
a. Respiratory rates and temperatures previously reported were modified as per the format
provided by Kristin DeBord. These endpoints will be reported in the milestone completion
report in the new format.
b. The pathology report was finalized and submitted to UNM on 6/12/09
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
LD50 is 1.26 CFU of SCHU S4. The LD99 is 4.23 CFU.
UNM received LBERI’s final pathology report on 6/12/09 and results were discussed in the 6/15/009
monthly tech report.
7. Quality of performance
Good
8. Percentage completed
100% of the scientific work is complete. (This is the first report of 100% completed on MS 7 in a
monthly technical report)
9. Work plan for upcoming month
The milestone completion report will be updated with the pathology data and sent to UNM by July 31,
2009.
Milestone 8
Milestone description: LVS vaccination protection of aerosol Schu S4 confirmed in primates
Institution: LBERI
1. Date started: 8/15/2008
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions
a. LBERI is repeating an LVS vaccination and SCHU S4 challenge study in NHP to demonstrate
that DVC Lot#16 LVS vaccine protects against a lethal SCHU S4 aerosol challenge.
Page 2 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
b. For this repeat vaccination/challenge study, NHPs were LVS vaccinated via subcutaneous or
scarification in May 2009 according to the schedule outlined in Table 1. Group1, Group 2, and
Group 3 were vaccinated with 1.1 x 107, 1.2 x107 and 1 x 106 CFU LVS, respectively. Blood
draws were completed on Days 7 (previous month), 14, 21, 28 and 35 post-LVS vaccination for
assessment of immune response. The immune response was assessed by IFNγ production by
PBMC in response to Ft antigens in vitro, by PBMC proliferation in response to Ft antigens in
vitro, and by IgG anti-LVS antibody titers in plasma.
LVS Route
Group 1 (5/18/09
7
Group 2 (5/20/09
7
Group 3 (5/22/09
6
1.1 x 10 )
1.2 x10 )
1 x 10 )
Scarification
A06873 (F)
A06674 (M)
A06693 (M)
Scarification
A07386 (F)
A07682 (F)
A07686 (F)
Sub-cutaneous
A07395 (F)
A06675 (M)
A06702 (M)
Sub-cutaneous
A07418 (F)
A07566 (F)
A07610 (F)
c.
Peripheral blood mononuclear cells (PBMCs) were prepared from these animals and
subsequently analyzed for immune response against LVS and SCHU S4 antigens.
i.The ability of PBMC from vaccinated NHP to produce IFNγ in response to LVS and
SCHU S4 antigens in vitro is presented in Figures 1 and 2, respectively.
Page 3 of 41
IFNγ Spots (Mean +/- S.D.)
0
x
A07686, Day 0
A07686, Day 7
A07686, Day 14
A07686, Day 21
A07686, Day 28
200
A07686, Day 28
80
A07686, Day 21
A07682, Day 0
A07682, Day 7
A07682, Day 14
A07682, Day 21
A07682, Day 28
400
A07686, Day 14
A07686, Day 7
A07386, Day 0
A07386, Day 7
A07386, Day 14
A07386, Day 21
A07386, Day 28
Group 1
A07686, Day 0
A06873, Day 0
A06873, Day 7
A06873, Day 14
A06873, Day 21
A06873, Day 28
Group 2
A06693, Day 28
120
A06693, Day 21
100
A06693, Day 0
A06693, Day 7
A06693, Day 14
A06693, Day 21
A06693, Day 28
300
A06693, Day 14
A06693, Day 7
0
A06674, Day 0
A06674, Day 7
A06674, Day 14
A06674, Day 21
A06674, Day 28
700
A06693, Day 0
IFNγ Spots (Mean +/- S.D.)
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
A- Scarification
Group 1
600
500
Media
LVS hk Hi
LVS ff Hi
Group 2
Group 3
Group 3
x
B- Scarification
160
140
Media
Group 3
LVS hk Hi
100
LVS ff Hi
Group 3
60
40
20
Page 4 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
C- Subcutaneous
700
Group 2
Group 1
Group 1
Media
LVS hk Hi
LVS ff Hi
600
500
Group 3
400
Group 2
Group 3
300
200
A07610, Day 0
A07610, Day 7
A07610, Day 14
A07610, Day 21
A07610, Day 28
A07566, Day 0
A07566, Day 7
A07566, Day 14
A07566, Day 21
A07566, Day 28
A07418, Day 0
A07418, Day 7
A07418, Day 14
A07418, Day 21
A07418, Day 28
A07395, Day 0
A07395, Day 7
A07395, Day 14
A07395, Day 21
A07395, Day 28
A06702, Day 0
A06702, Day 7
A06702, Day 14
A06702, Day 21
A06702, Day 28
0
A06675, Day 0
A06675, Day 7
A06675, Day 14
A06675, Day 21
A06675, Day 28
100
Animal/Day Post-LVS Vaccination
Figure 1: IFNγ production by PBMCs from LVS-vaccinated NHPs (receiving the LVS by scarification (A
and B) or subcutaneous route (C)) pre-SCHU S4 aerosol exposure. PBMCs were cultured at 200,000
cells/well (Panels A and C) and stimulated with either heat-killed (HK) or formalin-fixed (FF) LVS or were
left unstimulated (Media). Antigen doses were 1 x 105/ml (Hi). Wells in which the spots were too
numerous to count (TNTC) were represented as having 600 spots in order to graph the data. Not all
stimuli were used in every case due to insufficiency of PBMCs and thus missing bars represent instances
where no testing was done using those stimuli Also, “X” represent instances where no testing was done
using those stimuli.
Panel B represents a repeat of the assay for samples A06693 and A07686 with 100,000 PBMCs/well.
Page 5 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
A- Scarification
120
Group 1
Media
SCHUS4 hk Hi
SCHUS4 ff Hi
Group 3
80
Group 1
60
40
X
A07686, Day 28
X
A07686, Day 7
A07682, Day 28
A07682, Day 21
X
A07682, Day 7
A07682, Day 14
A07386, Day 7
X
A07386, Day 28
X
A07386, Day 21
X
A07386, Day 14
A06873, Day 28
A06873, Day 7
A06873, Day 21
X
A06873, Day 14
A06693, Day 21
A06693, Day 28
A06693, Day 7
A06693, Day 14
A06674, Day 28
A06674, Day 7
X
B- Subcutaneous
Group 1
180
160
140
120
Group 1
Media
SCHUS4 hk Hi
SCHUS4 ff Hi
Group 2
100
80
Group 3
A07610, Day 28
A07610, Day 7
A07566, Day 28
A07566, Day 21
A07566, Day 7
A07566, Day 14
A07418, Day 7
X
X
A07418, Day 28
X
A07418, Day 21
X
A07418, Day 14
X
A07395, Day 28
X
A07395, Day 21
X
A07395, Day 7
X
X
A07395, Day 14
X
Group 3
A06702, Day 21
A06702, Day 28
X
A06675, Day 28
0
A06675, Day 7
20
A06702, Day 7
40
A07610, Day 14
A07610, Day 21
Group 2
A06702, Day 14
60
A06675, Day 14
A06675, Day 21
IFNγ Spots (Mean +/- S.D.)
0
X
X
A06674, Day 14
A06674, Day 21
20
Group 3
A07686, Day 14
A07686, Day 21
100
Group 2
Group 2
Animal/Day Post-LVS Vaccination
Figure 2: IFNγ production by PBMCs from LVS-vaccinated NHPs (receiving the LVS by scarification (A)
or subcutaneous route (B) pre-SCHU S4 aerosol exposure. PBMCs were cultured at 200,000 cells/well
and stimulated with either heat-killed (HK) or formalin-fixed (FF) SCHU S4 or were left unstimulated
(Media). Antigen dose was 1 x 105/ml (Hi). Not all stimuli were used in every case due to insufficiency of
PBMCs and thus “X” represent instances where no testing was done using those stimuli.
ii.The ability of PBMCs to proliferate in response to LVS and SCHU S4 antigens is
presented in Figures 3 and 4, respectively.
Page 6 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
A- Scarification
Group 2
180000
Media
LVS hk Hi
LVS ff Hi
160000
140000
Group 2
Group 1
Group 1
120000
100000
80000
Group 3
60000
Group 3
40000
x
x
x
x
A07686, Day 0
A07686, Day 7
A07686, Day 14
A07686, Day 21
A07686, Day 28
A07386, Day 0
A07386, Day 7
A07386, Day 14
A07386, Day 21
A07386, Day 28
A06873, Day 0
A06873, Day 7
A06873, Day 14
A06873, Day 21
A06873, Day 28
A06693, Day 0
A06693, Day 7
A06693, Day 14
A06693, Day 21
A06693, Day 28
x
A07682, Day 0
A07682, Day 7
A07682, Day 14
A07682, Day 21
A07682, Day 28
x
x
A06674, Day 0
A06674, Day 7
A06674, Day 14
A06674, Day 21
A06674, Day 28
0
B-Subcutaneous
250000
Media
LVS hk Hi
Group 1
200000
LVS ff Hi
Group 2
Group 1
150000
Group 2
Group 3
100000
Group 3
50000
X
X
X X
A07610, Day 0
A07610, Day 7
A07610, Day 14
A07610, Day 21
A07610, Day 28
X
A07566, Day 0
A07566, Day 7
A07566, Day 14
A07566, Day 21
A07566, Day 28
X
A07418, Day 0
A07418, Day 7
A07418, Day 14
A07418, Day 21
A07418, Day 28
X X
A07395, Day 0
A07395, Day 7
A07395, Day 14
A07395, Day 21
A07395, Day 28
0
X
A06702, Day 0
A06702, Day 7
A06702, Day 14
A06702, Day 21
A06702, Day 28
X
A06675, Day 0
A06675, Day 7
A06675, Day 14
A06675, Day 21
A06675, Day 28
Relative Light Units (Mean +/- S.D.)
20000
Animal, Day Post-LVS Vaccination
Figure 3: Proliferation of PBMCs from LVS-vaccinated NHPs (receiving the LVS by scarification (A) or
subcutaneous route (B) pre-SCHU S4 aerosol exposure. PBMCs were cultured at 200,000 cells/well and
stimulated with either heat-killed (HK) or formalin-fixed (FF) LVS or were left unstimulated (Media).
Antigen doses were 1 x 105/ml (Hi). Not all stimuli were used in every case due to insufficiency of
PBMCs and thus “X” represents those instances where no testing was done using those stimuli.
Page 7 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
A- Scarification
250000
Media
SCHUS4 hk Hi
SCHUS4 ff Hi
200000
Group 2
Group 2
Group 1
150000
Group 1
Group 3
Group 3
50000
x
x
x
A07686, Day 0
A07686, Day 7
A07686, Day 14
A07686, Day 21
A07686, Day 28
A07386, Day 0
A07386, Day 7
A07386, Day 14
A07386, Day 21
A07386, Day 28
x
A07682, Day 0
A07682, Day 7
A07682, Day 14
A07682, Day 21
A07682, Day 28
x x
x
A06873, Day 0
A06873, Day 7
A06873, Day 14
A06873, Day 21
A06873, Day 28
x
A06693, Day 0
A06693, Day 7
A06693, Day 14
A06693, Day 21
A06693, Day 28
0
A06674, Day 0
A06674, Day 7
A06674, Day 14
A06674, Day 21
A06674, Day 28
x
B- Subcutaneous
200000
175000
150000
Group 1
Media
SCHUS4 hk Hi
SCHUS4 ff Hi
Group 2
Group 2
125000
Group 1
100000
Group 3
75000
Group 3
50000
X
X
X X
X
X
X
X X
X
A07610, Day 0
A07610, Day 7
A07610, Day 14
A07610, Day 21
A07610, Day 28
X
A07566, Day 0
A07566, Day 7
A07566, Day 14
A07566, Day 21
A07566, Day 28
X
A07418, Day 0
A07418, Day 7
A07418, Day 14
A07418, Day 21
A07418, Day 28
X
A07395, Day 0
A07395, Day 7
A07395, Day 14
A07395, Day 21
A07395, Day 28
0
X
A06702, Day 0
A06702, Day 7
A06702, Day 14
A06702, Day 21
A06702, Day 28
25000
A06675, Day 0
A06675, Day 7
A06675, Day 14
A06675, Day 21
A06675, Day 28
Relative Light Units (Mean +/- S.D.)
100000
Animal, Day Post-LVS Vaccination
Figure 4: Proliferation of PBMCs from LVS-vaccinated NHPs (receiving the LVS by scarification (A) or
subcutaneous route (B) pre-SCHU S4 aerosol exposure. PBMCs were cultured at 200,000 cells/well and
stimulated with either heat-killed (HK) or formalin-fixed (FF) SCHU S4 or were left unstimulated (Media).
Antigen doses were 1 x 105/ml (Hi). Not all stimuli were used in every case due to insufficiency of
PBMCs and thus “X” represent instances where no testing was done using those stimuli.
Page 8 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Data storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assays
06262009.svd, in the TVDC 7 (9633) bound notebook pages 48 – 90 and in the TVDC 8 (9621) bound
notebook pages 1 – 21.
Data interpretation:
iii. Each LVS-vaccinated NHP responded at some point post-vaccination (Day 7, 14,
21, or 28) by secreting more IFNγ in response to either HK or FF LVS than it
secreted prior to LVS vaccination (Day 0).
iv. Most LVS-vaccinated NHPs responded to SCHU S4 antigens by secretion of
IFNγ; although this is difficult to interpret as some NHPs were not tested at all
time points post-vaccination and no animals were tested prior to vaccination for
responses to SCHU S4 antigens.
v. The ability of Group 3 NHPs to produce IFNγ in response to LVS or SCHU S4
antigens appears lower than the other two groups (although this has not been
tested formally by the appropriate statistical test) and may reflect the
approximately 1 log lower LVS vaccination dose used for Group 3 NHPs than for
Groups 1 and 2.
vi. Some LVS-vaccinated NHPs responded to either LVS or SCHU S4 antigens by
proliferation; although this is difficult to interpret as some NHPs were not tested at
all time points post-vaccination and some animals were not tested prior to
vaccination.
d. Plasma was obtained from each primate. The ability of each animal to produce IgG antiLVS on Day 0 through 28 post-LVS vaccination is presented in Figure 5.
A- Scarification
2000
200
A06674
20
A06693
2
A06873
.2
A07386
A07682
.02
A07686
2E-3
Day 0
Day 7
Day 14
Day 21
Day 28
Page 9 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
B- Subcutaneous
IgG anti-LVS Units
20000.01
2000
200
A06675
A06702
A07395
A07418
A07566
A07610
20
2
.2
.02
2E-3
Day 0
Day 7 Day 14 Day 21 Day 28
Figure 5: Production of IgG anti-LVS by LVS-vaccinated NHPs (receiving the LVS by scarification (A) or
subcutaneous route (B)pre-SCHU S4 aerosol exposure. Plasma was collected at each of the indicated
time points and tested for IgG anti-LVS activity by ELISA. A positive control reference plasma, made up
of pooled plasma from LVS-vaccinated NHPs, was used as a standard curve and assigned an arbitrary
concentration of 1000 Units/ml.
Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assays
06262009.svd,
Data interpretation:
i. All LVS-vaccinated NHPs increased their plasma levels of IgG anti-LVS post-LVS vaccination.
a. NHPs were conditioned to pole and collaring, as well as, chairing procedures.
b. NHPs were moved into the ABSL3 and underwent (or are currently undergoing) 1 week of
pre-exposure clinical observations (temperatures and respiratory rates 3 times daily).
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good this month
8. Percentage completed
60% of the scientific work is complete.
9. Work plan for upcoming month
12 LVS vaccinated NHPs and 3 naïve controls will be challenged with 1000 CFU SCHU S4 by aerosol.
Page 10 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
i.Post-SCHU S4 challenge observations (three times daily) will be initiated along with
temperatures and respirations.
ii.Blood will be collected for bacteriology and clinical chemistry on Day 3, Day 10 and
Day 17 post-aerosol exposure.
iii.Moribund animals will undergo a complete necropsy with tissues being collected for
histology and bacteriological burden.
iv.NHPs surviving to day 21 post-SCHU S4 challenge will be euthanized and undergo
a complete necropsy; spleen and PBMCs will be collected for immunological
assessment.
Milestone 9
Milestone description: Aerosol SOP developed for GLP transition
Institution: LBERI
1. Date started: 8/13/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
No new work was performed during the month of June.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
LBERI needs to determine what will be considered an acceptable range of delivered SCHU S4 in the
aerosol (keeping in mind that pulmonary disease is established at or above 89 CFU).
6. Deliverables completed
None
7. Quality of performance
None
8. Percentage completed
40% of the scientific work is complete.
9. Work plan for upcoming month
a.Establish a broader acceptable challenge dose range (with input from the UNM TVDC team and
NIAID) and conduct an additional day of mock-qualification runs.
b.Revise and complete qualification plan for the aerosol and submit to UNM for review. New data
from the mock qualification runs and NHP exposures will be incorporated into the prequalification data. This will alter (i.e., improve) the acceptable criteria (e.g., spray factors, preversus post-bioaerosol values, etc.) and change the current draft version. All target challenge
dose values will change since the challenge dose has been revised from 500 to 1000 CFU
presented.
Milestone 10
Milestone description: Efficacy testing of vaccine candidates (LBERI) and Characterization of
selected small animal model (UNM)
Institution: LBERI /UNM
1. Date started: 1/1/2009
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
No new work was performed during the month of June.
Page 11 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
The first proposed vaccine candidate is the USAMMDA IND 157 LVS vaccine, which has been used
in humans at USAMRIID. Testing of this vaccine candidate is dependent on MS8 demonstrating that
DVC LVS lot#16 vaccine can protect NHP from SCHU S4 aerosol challenge.
6. Deliverables completed
None
7. Quality of performance
None
8. Percentage completed
2%
9. Work plan for upcoming month
Animals are scheduled to arrive at LBERI on July 14, 2009. Currently, vaccinations are planned for
late August or early September and challenges for this study have been scheduled to begin on
October 19, 2009.
Milestone 11
Milestone description: In vivo GLP NHP model efficacy SOP and efficacy testing of vaccine
candidates
Institution: LBERI
1. Date started: 1/16/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a.Pathology slide preparation was completed for the non-telemetered arm of the study.
b.For the telemetered arm of the study, NHP were received and quarantined. The primates
received 2 out of 3 TB tests and were pole and collar trained.
c. Final clinical chemistry and hematology data for the non-telemetered arm of the study was
plotted and results will be analyzed and reported in the August monthly report.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
In-life non-telemetered arm of the SCHU S4 natural history study is completed.
7. Quality of performance
Good
8. Percentage completed
50% of the scientific work is complete.
9. Work plan for upcoming month
a.Animals will be released from quarantine and undergo surgeries to implant the telemeters from
July 20, 2009 thru July 24, 2009. Additionally animals will be chair trained.
b.Histopathology slides for lungs, spleen, liver, kidney, nasal cavity, oropharynx with tonsils, brain,
bone with marrow (rib/femur), lymph nodes (tracheobronchial, retropharyngeal,
submandibular, mesenteric, axillary and inguinal), and representative lesions will be read for
the non-telemetered arm of the study. It is expected that LBERI will read the slides and
prepare a histopathology report by the end of September.
Page 12 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 11
Milestone description: In vivo GLP model efficacy SOPS developed in one small species
and primate and efficacy testing of vaccine candidates
Institution: UNM
1. Date started: 1/16/2008
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. This milestone examines the cellular and humoral immunity involved in protecting LVS
vaccinated rats against i.t. SCHU S4 challenge.
i. UNM focused on characterizing the role of antibodies by passively
transferring LVS immune rat serum into naïve rats before i.t. SCHU S4
challenge.
ii. UNM has performed most of the critical experiments at least once and is now
in the process of repeating these experiments and performing additional
experiments to fill in knowledge gaps.
b. Experiment Pdose4 (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Gopi's experiments\Pdose 3)
i. The purpose of this experiment was to repeat Experiment Pdose2, which showed that
an i.t. challenge dose of 10,000 SCHU S4 broke through the protection provided by
passive immunization with 250 l LVS immune serum. The currently reported
experiment is the last of this series designed to determine the limit of protection by
titering both the volume of immune serum transferred and the i.t. SCHU S4 challenge
dose
ii. In this experiment, rats were passively immunized with 250 l immune rat serum and
challenged one day later with 3525 CFU of SCHU S4. The results from this
experiment and Pdose2 together showed that the break-through challenge dose for
250 l immune serum is no more than 3-10,000 SCHU S4 (Fig.1).
3525 CFU SCHU S4
Percent survival
100
NRS 250ul
IRS 250ul
75
50
25
0
0
5
10
15
20
Days Postchallenge
Page 13 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 1. Break-through SCHU S4 challenge dose for 250 l immune serum. Fischer
344 rats (n = 6) were passively immunized i.p. with 250 l immune rat serum (IRS) or
normal rat serum (NRS) 1 day before i.t. challenge with 3525 CFU SCHU S4. Survival
was monitored daily.
c.Experiment PtrIgG (Notebook 138 pages 120-121)
i. The purpose of this experiment was to optimize the procedure for enriching IgG from rat
serum, which will be used to determine whether passive transfer of LVS immune IgG
is sufficient to protect rats against SCHU S4 challenge.
ii. The Melon Gel IgG Purification kit uses negative selection to enrich for IgG. Our
preliminary experiments suggested that the yield and purity of the IgG may depend on
the ratio of the Melon Gel resin to serum volume
iii. In this experiment, serum IgG was purified from a fixed volume of serum using increasing
amount of resin. The objective was to identify the optimal ratio that achieves the best
balance between IgG yield and purity. As shown in Fig 2A, the purity of the samples
improved as the amount the resin increased from 0.5X to 1.25X; using additional did
not further improve the purity. Fig 2B shows that sample recovery is inversely
proportional to the amount of resin used. Based on these results, the optimal ratio of
resin to sample is 1.25X
A
B
Figure 2. Purification of IgG from normal rat serum. Normal rat serum was precipitated with
ammonium sulfate and a volume equivalent to 1 ml serum was applied to purification columns
packed with the indicated amount of Melon gel resin. After elution, the IgG purity was analyzed by
reducing SDS-PAGE (A) and the IgG yield was analyzed by ELISA using killed LVS as the
capture antigen (B).
d. Experiment Iso1 (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Gopi’s experiments\Iso 1)
i. The purpose of this experiment was to identify the antibody isotypes in the immune rat
serum. The presence of IgG2a and IgG1 would reflect a Th1 and a Th2 response,
respectively.
Page 14 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
ii. Serum immunoglobulin was typed using BD Pharmingen’s Rat Immunoglobulin isotyping
ELISA kit and heat killed LVS as the capture antigen.
iii. All antibody isotypes, except IgA was detected in the LVS immune serum (Fig 3). There
appeared to be no predominance of type 1 (IgG2a) or type 2 (IgG1) responses.
Figure 3. Isotype of immunoglobulins found in LVS immune rat serum. Serum immunoglobulin
was typed using BD Pharmingen’s Rat Immunoglobulin isotyping ELISA kit and heat killed LVS as
the capture antigen. IgA not detected (data not shown).
a.
Experiment Ptran12D (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments
and Results\Gopi’s experiments\Ptran\Ptran 12D)
i. The purpose of this experiment was to determine whether the second peak of SCHU S4
bacterial growth occurring 10 days after SCHU S4 challenge of passively immunized
rats is due to depletion of transferred immune antibodies. To address this question, the
rats were either given a single antibody treatment one day before infection to reproduce
previous experiments or multiple antibody treatments throughout the infection period.
ii. In contrast to the two previous experiments (Ptran 12B and Ptran 12C), we did not find
the second peak of bacterial growth in the control group given a single antibody
treatment. The bacterial growth kinetics was not changed by the multiple treatments.
Page 15 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Lungs
10
10
8
6
CFU (log 10)
8
CFU (log 10)
CFU (log 10)
8
Liver
Spleen
10
6
6
4
4
4
2
2
2
0
3
6
9
12 15
Days Post-challenge
18
21
0
3
6
9
12 15
Days Post-challenge
18
Ptran 12D (day -1)
Ptran 12D (day -1 3 6 9 12)
Ptran-12B (day -1)
0
21
3
6
9
12 15
Days Post-challenge
18
21
Figure 4. Comparison of SCHU S4 growth in rats given a single or multiple antibody treatments.
Fischer 344 rats (n = 4) were given either a single (day -1; ▼) or multiple (day -1, 3, 6, 9, and 12;
♦) treatments of LVS immune serum. One day after the first treatment (day 0), rats were
challenged i.t. with 420 SCHU S4. Bacterial burden was determined on days 7, 10 and 15. Data
from a previous experiment, Ptran 12B (■) is used to show the second peak in bacterial growth on
day 10 post challenge.
iii. To determine why the pattern of bacteria growth in this experiment appear to be different
from the previous experiments even though the infection doses were similar, individual
animals from all four experiments in this series were plotted together (Fig 5).
iv. This analysis showed that the results from all 4 experiments were similar. The day 10
results from all three tissues appeared to have a particularly wide distribution, raising
the possibility that the 2nd peak observed on day 10 in Ptran 12B may not be significant.
This will be confirmed with our biostatistician.
Lungs
Spleen
10
8
10
8
6
8
CFU (log10)
CFU (log 10)
CFU (log 10)
Liver
10
6
Ptran12B (day -1)
Ptran12C (day -1)
Ptran 12D (day -1)
Ptran 12D (day -1 3 6 9 12)
4
4
4
2
2
2
0
3
6
9
12 15
Days Post-challenge
18
21
0
3
6
9
12 15
Days Post-challenge
18
21
Ptran12 (day -1)
6
0
3
6
9
12 15 18
Days Post-challenge
21
Figure 5. Comparison of the SCHU S4 burden in individual rats from 4 experiments. The inoculation
doses in the 4 experiments were 240, 260, 330, and 420 CFU. Each symbol represents the bacteria
burden in an individual animal.
Page 16 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
UNM will consult with biostatistician on the statistical significance of the 2 nd peak of bacterial growth
observed 10 days after SCHU S4 challenge of passively immunized rats in Experiment Ptran12. UNM
will also consult with biostatistician on best way to present log bacterial growth.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
52%
9. Work plan for upcoming month
a. Humoral immunity
i. Determine the antibody level after passive immunization and just before SCHU S4
challenge
ii. Purify IgG from normal and LVS immune sera and passively immunize rats with
purified IgG to determine whether it is sufficient to mediate protection
iii. Consult with biostatistician whether the second peak of bacterial growth is significant
iv. Analyze cytokine profiles associated with passive immunization
b. Cellular immunity
i. Determine the importance of CD4 and/or CD8 T cells in the protection of LVS
vaccinated rats.
ii. Develop procedures for adoptive transfer of immune T cells into naïve rats.
Milestone 12/13
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and compared to those in other species.
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a.Reagents were ordered to set up the microagglutination assay.
b.Positive control rabbit sera and test antigens were requested from Dr. Sztein and USAMRIID
respectively.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Protein assays are being developed in order to compare antigen preparation CFU to protein mass.
LBERI and UNM wish to standardize the quantitation of antigen preparations.
Freyja Lynn will obtain a new contact at USAMRIID for the Ft antigen used in the microagglutination
assay. The former contact is no longer at USAMRIID.
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8. Percentage completed
Page 17 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
91% of the scientific work is complete.
9. Work plan for upcoming month
a. Repeat the LVS CFU:Protein content assay
i. Make 1:1 dilutions rather than 1:9 dilutions
ii. Sonicate the LVS in lysis buffer to possibly elaborate more protein from the HK and FF
preparations
b. Construct a pooled negative control plasma sample for use in IgG anti-LVS ELISAs; this would
be used in conjunction with the positive control sample reported on in April.
c. Initiate the development of the microagglutination assay, per the procedure provided by Freyja
Lynn at NIAID. The procedure was from Dr. Marcelo Sztein of the University of Maryland
Milestone 12/13-UNM
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and Compare assays in animal models (sensitivity)
Institution: UNM
1. Date started: 7/15/06 (MS12) and 12/06 (MS13)
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
No new work done this period
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Need to correlate the amount of protein in heat killed or formalin fixed bacterial preparations to the
number of bacteria so that we can normalize responses to different antigen preparations across
experiments.
6. Deliverables completed
None
7. Quality of performance
NA
8. Percentage completed
78%
9.Work plan for upcoming month
a. Repeat IFN ELISpot assay and ELISA with additional human samples in order to establish
robustness of assay and to generate distinguishing profiles of vaccinated individuals. UNM is
aiming to test plasma/sera from approximately 20 unvaccinated humans and 20 LVS vaccinated
humans.
b. Repeat experiment to correlate amount of protein to number of LVS in the antigen preparations
c.Establish the microagglutination assay to measure humoral immune responses, per Freyja Lynn’s
request
Milestone 14
Milestone description: Assays in vaccinated humans validated (sensitivity)
Institution: UNM/LBERI
1. Date started: 2/29/2008
2. Date completed: in progress
Page 18 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
3. Work performed and progress including data and preliminary conclusions
No work was done
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
None
7. Quality of performance
NA
8. Percentage completed
5%
9. Work plan for upcoming month
a. All work is contingent on the availability of assays and reagents described in MS21
b. Determine the titer of anti-Ft antibodies in sera from convalescent tularemia patients on
Martha’s Vineyard
c.Quantify the number of IFN producing cells in PBMCs from convalescent tularemia patients
on Martha’s Vineyard
Milestone 17
Milestone description: In vitro assay for analysis of cellular and humoral elements of the
immune response in vaccinated human and animal’s response to F. tularensis established
Institution: UNM
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
No work was done during this month.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
No work was done during this month because UNM is developing human and rat assays to selectively
deplete effector subsets in vitro , under Milestone 11.
6. Deliverables completed
None
7. Quality of performance
NA
8. Percentage completed
0%
9. Work plan for upcoming month
No work planned
Page 19 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 18
Milestone description: Role of specific  T cells in protection
Institution: UNM/LBERI
1. Date started: 7/1/08
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
No work was done
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
UNM cannot start this milestone until a human assay is developed in MS21.
6. Deliverables completed
None
7. Quality of performance
NA
8. Percentage completed
5%
9. Work plan for upcoming month
No work planned
Milestone 19
Milestone description: Interaction between human alveolar macrophages and F. tularensis
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment FT-AH-24 (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Gopi’s experiments\Ptran\Ptran 12D)
i. The purpose of this experiment was to determine the cytokine response of human alveolar
macrophages to SCHU S4. UNM has considerable data on the in vitro uptake and growth kinetics
of SCHU S4 in human AM as well as the ability of human AM to be activated by IFN and TNF to
control SCHU S4 infection. The cytokine response will be a third parameter in characterizing the
interaction between human AM and SCHU S4.
ii. Human alveolar macrophages were incubated with F. tularensis strain SCHU S4 or LVS at
MOI=10 (previously determined to maintain macrophage viability) for 2 hours and the culture
supernatants were collected 24 hours post-infection and analyzed for TNF production
iii. The results show that human AM responded to LVS and SCHU S4 infection by producing TNFα,
similar to several earlier experiments with different individuals (Ftc36, studies 9, 10, and 11). This
cytokine level is similar to that reported for human alveolar macrophages stimulated with LPS or
Mycobacterium tuberculosis, another intracellular pathogen
Page 20 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
1000
pg/mL
750
500
250
LV
S-
in
fe
c
te
d
ed
Sc
hu
4in
fe
ct
U
ni
nf
e
ct
ed
0
Figure 6. TNFα production by human alveolar macrophages infected with SCHU S4 or
LVS. 106 human alveolar macrophages isolated by bronchoalveolar lavage were
incubated with F. tularensis strain SCHU S4 or LVS at MOI=10 for 2 hours, followed by a
45 minute gentamicin pulse. Supernatants collected 24 hours post-infection were
analyzed for TNFα production
4. Significant decisions made or pending
UNM will try to prepare a manuscript for publication based on these findings. No additional experiments
with human alveolar macrophages will be performed unless needed for manuscript.
5. Problems or concerns and strategies to address
The numbers of human alveolar macrophages obtained by bronchoalveolar lavage are limited. The
recruitment of human donors is limited.
6. Deliverables completed
None
7. Quality of performance
Fair
8. Percentage completed
27%
9. Work plan for upcoming month
Compile data to determine how to publish the human alveolar macrophage results and whether
additional experiments are needed
Page 21 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 21
Milestone description: Correlates of protection: in vitro assay or other readout of effector
function of Ft developed for multiple species.
Institution: LBERI
1. Date started: 4/8/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a.
The goal of this milestone is to develop a correlate of protection assay that differentiates
unvaccinated from vaccinated individuals in multiple species LBERI used flow cytometry to
detect cell surface markers or secretion of intracellular cytokines from PBMC from two LVS
vaccinated NHPs The intracellular staining was for IFNγ, TNFα and IL2, LBERI will develop
the flow cytometry assay to enhance sensitivity for the intracellular staining with the goal of
distinguishing vaccinated from unvaccinated individuals by expression of intracellular
cytokines
b. Performed two more attempts at detecting intracellular cytokine expression in NHP PBMCs
by flow cytometry.
i.Day 27 post-LVS vaccination, PBMC from A06693 (group 3) re-stimulated in tubes at
2x105/ml and Hi FF LVS, or, as positive control, 2.5 ug/ml PHA for 18h (4h with Golgi
plug). Cells were stained for either CD4 or CD8 together with ICS (intracellular
staining) stain mix for IFNγ, TNFα and IL2. Surface staining for CD4+ and CD8+ was
successful. No cytokines could be detected above media control background. Note
that NHP A06693 had a very low response in proliferation assay and ELISpot for
IFNγ. NHP A06693 was vaccinated with 1x106 CFU of LVS, which was approximately
one log lower vaccination dose that NHPs from group 1 and 2 in the study. This
particular animal was chosen due to the fact that there were extra PBMC available on
the day of preparation. The ELISPOT results were not known until after initiation of
the ICS assay.
ii.Day 35 post-LVS vaccination, PBMC from A07395 (group 1) re-stimulated for 19h (4h
Golgi plug) in 96-well plate at 4x105 cells/well with HK Hi LVS or FF Hi LVS at
2x105/well, 4x104/well or 800/well, or, as positive controls, PHA or Con A at 1ug/well.
Cells were stained for CD3 and ICS for IFNγ, TNFα and IL2. Surface staining was
successful and a CD3 positive population could be identified. In the PHA control
approx 2.8% of the CD3 cells were making IFNγ compared to 1.9% in the media
control. No cytokines above media control could be detected after LVS stimulation.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
LBERI will troubleshoot the ICS assay, per the work plan outlined below.
6. Deliverables completed
None
7. Quality of performance
Fair
8. Percentage completed
6% of the scientific work is complete
9. Work plan for upcoming month
a. Repeat ICS assay and optimize the conditions that will lead to detection of intracellular
cytokines.
i. Try frozen cells from early time points post-LVS vaccination (day 7 or 14) in order to
correlate with peak time points of IFNγ secretion by ELISPOT.
Page 22 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
ii. Try early time points of restimulation (6 h) which have been successful in detecting
cytokines from CD4 cells from lung homogenate in NHPs with active disease
(Amanda DuBois, UNM) and later time points (48 h) of restimulation which were
successful for detection of IFNγ by ICS in human T cells from LVS vaccinated
donors.
iii. Try PMA + Ionomycin as the positive control as well as a cytokine positive cell line
ordered from BD (HiCK cells, Human Intracellular CytoKine).
iv. New antibody conjugates have been ordered to move the assay from 4 color FACS
Calibur to the 6 color BD Canto, where T cells can be identified as CD3+CD4+ or
CD3+CD8+. Additionally 3 cytokines (IFNγ, TNFα and IL2) can be detected in the
same staining tubes. Compensation Beads have also been ordered from BD for
automatic compensation calculation by BD FACSDiva on the Canto.
Milestone 21
Milestone description: T cell-induced macrophage killing of intracellular bacteria
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment FT-AH-21 (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Andrew's experiments\FT-AH-21), Experiment FT-AH-22
((L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and Results\Andrew's
experiments\FT-AH-22) and FT-AH-26 (L:\Lyonslab\Tularemia\Tularemia Contract
Folder\Experiments and Results\Andrew's experiments\FT-AH-26)
i. The purpose of these experiments was to define the factors required for LVS
vaccinated PBMC to control SCHU S4 growth. UNM showed previously that 48 h
pre-stimulation of vaccinated PBMC with formalin fixed LVS resulted in 1 to 1.5
log reduction in SCHU S4 burden; unvaccinated PBMC did not show a reduction.
UNM also showed that LVS vaccinated PBMC produced IFN within 24 h of prestimulation, but a similar study had not been performed with unvaccinated PBMC.
ii. IFN secretion was measured from PBMC from two different unvaccinated individuals
after stimulation with formalin-fixed or heat-killed LVS. In contrast to the earlier
finding that vaccinated PBMC secreted 2 ,000-30,000 pg/ml IFN within 24-48 h
of FF-LVS stimulation (data not shown but reported previously), the two
unvaccinated (untreated) PBMC produced < 80 pg/ml IFN (Fig 7).
Page 23 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
#70: Uninfected
# 79: Uninfected
20000
UNTREATED
FF-LVS
IFN + TNF
30000
UNTREATED
FF-LVS
IFN + TNF
15000
pg/mL
pg/mL
20000
10000
10000
5000
0
0
-24
0
24
48
72
-24
HOURS POST-INFECTION
0
24
48
72
HOURS POST-INFECTION
Figure 7. Kinetics of cytokine production by unvaccinated human PBMC pre-stimulated
with FF-LVS or recombinant TNFα and IFNγ. PBMC from two unvaccinated human
donors #70 and #79) were pre-stimulated with IFN and TNFα or with FF-LVS 48 h
before SCHU S4 infection. At 0 h, the FF-LVS was washed away and the culture was
maintained without antigen stimulation. Culture supernatants were collected daily and
analyzed for cytokine levels. 
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
68 %
9. Work plan for upcoming month
a.Repeat experiment with LVS vaccinated and unvaccinated human PBMC to 1) measure IFN
production in response to FF-LVS pre-stimulation 2) control of SCHU S4 growth after FF-LVS prestimulation
b.Determine whether addition of anti-IFN antibody prevents LVS vaccinated PBMC control of SCHU
S4 growth.
Milestone 29
Milestone description: Analysis of T cells from lymph nodes & T cell epitopes
Institution: LBERI
1. Date started: 8/7/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
No new work was performed during the month of June.
4. Significant decisions made or pending
Page 24 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
None
8. Percentage completed
16% of the scientific work is complete
9. Work plan for upcoming month
LBERI is waiting for the UNM team to request the tissues from this animal. The NHP will be exposed
to LVS by bronchoscopy when UNM is ready to test the lymph node tissues in the peptide array assay
again.
Milestone 29
Milestone description: Analysis of T cells from NHP lymph nodes and T cell epitopes
Institution: UNM
1. Date started: 10/1/08
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a.
Experiment Ftc82.3 (Notebook 139, pages 99-100)
i. In Ftc82, UNM showed that the vaccinated NHP lymph node cells and splenocytes
frozen during the 1st round screening of ASU polypeptide library had lost their
reactivity to formalin fixed LVS. To determine whether the lost reactivity can be
compensated by increasing the number of thawed cells per well, UNM repeated the
IFN ELISpot assay with 1.5 x 105 to 6 x 105 cells/well. As shown in Table 1, the
reduced reactivity of lymph node cells but not splenocytes was compensated by
increasing the number of thawed cells per well. Based on these results, the
confirmation experiment will be performed using 6.0 x 105 lymph node cells/well.
Table 1. Reactivity of frozen NHP lymph node cells and splenocytes to formalin fixed
LVS*
Cell Source
Cell number/well
Spots/well
Lymph nodes
1.5 x 105
5, 4
5
3.0 x 10
26, 36
6.0 x105
94, 77
5
Spleen
1.5 x 10
3, 1
5
3.0 x 10
6, 13
6.0 x105
16, 24
* Values in the table are numbers of spots detected
4. Significant decisions made or pending
Perform repeat screen of polypeptide library with 6.0 x 105 frozen lymph node cells per well
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
None
Page 25 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
7. Quality of performance
Good
8. Percentage completed
22%
9. Work plan for upcoming month
Perform repeat screen with individual polypeptides identified by Phil Stafford using 6 x 10 5 frozen NHP
lymph node cells per well.
Milestone 35
Milestone description: Array hybridization with mouse RNA from virulent SCHU S4
infection and RT PCR confirmation of candidates
Institution: UNM/ASU Johnston
1. Date started: 8/1/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a.Experiment Ftc64,8 (Notebook 130 page 100)
i.The purpose of these experiments was to isolate lung RNAs from Fischer 344 rats 1, 3, 5, 7, and
24 h after i.t. infection with 104 CFU SCHU S4.
ii.The RNAs have been isolated and shipped to ASU for usage on Milestone 35 at ASU
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
33%
9. Work plan for upcoming month
No work planned unless ASU requests more RNAs from SCHU S4 infected mouse or rat lungs
Milestone 35
Milestone description: Array hybridizations with mouse RNAs from virulent Schu 4 infection &
RT PCR confirmation of candidates.
Institution: UNM/ ASU-Johnston
1. Date started: 04-01-2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
 The early time course kinetic experimental design includes two mouse challenge level groups
(low-dose (~200-500 CFU/lung at 1 hour post challenge) and high dose (~4-5,000 CFU/lung at 1
hour post challenge) and a rat challenge (~2,000 CFU/lung at 1 hour post challenge). Each
challenge dose time course has been performed twice at UNM. Time course samples were taken
at 1, 3, 5, 7, and 24 hours post challenge. There are multiple animals per sample time, a pool of
RNA was prepared for each time point and the pool of RNA was purified over RNAeasy columns.
After purification, the RNA pools are processed using the Linear Amplification of Procaryotic
Page 26 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Transcript (LAPT) protocol. The amplified RNA is processed into cDNA, fluorescently labeled,
and allowed to hybridize to the Francisella tularensis 70-mer oligonucleotides microarray printed
on slides.
 ASU will create two LAPT samples per time point RNA and perform two independent labelings
per LAPT. ASU has completed the hybridizations of the two low-dose mouse and one rat sample
set. Of the high dose mouse samples, only one of the hybridizations of one LAPT is complete.
The second LAPT amplifications for the high dose mouse samples are complete but the labeling
and hybridizations need to be performed. For the last rat experiment, the LAPT amplifications are
underway and hybridizations will ensue.
Figure 1. Experimental design from RNA sample sets to slides.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
 ASU encountered microarray printing problems. Since April 2009, the print runs have not passed quality
control checks because of low signals on the probes. The first quality check utilizes a hybridization
with labeled genomic DNA which should detect each probe. A second check is performed with
labeled SCHU S4 cDNA. We have not experienced any labeling problems for the targets and we
have concluded that the problem must reside in the slide preparation. The problem was most likely
associated with a change in lots of Poly-L Lysine which is used to coat the slides. ASU obtained two
sets of commercial Poly-L-Lysine slides and a new lot of Poly-L Lysine for our in house production.
These new slides were used to produce a test array which yielded significantly better signals with the
genomic DNA. In-house coated slides with the new lot of Poly-L Lysine are being produced and
validated. These test arrays are being produced on our back-up microarray printer. Our main printer
(Nanoprint 60) has had a head malfunction and a number of the printing pins have been damaged.
The unit is under repair and should be fully functional within 1-2 weeks.
6. Deliverables completed
None
Page 27 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
7. Quality of performance
Fair
8. Percentage completed
87%
9. Work plan for upcoming month
Once FT printed microarray slides are available and pass quality control, ASU will finish the labeling
and hybridizations of the high-dose mouse experiments. In addition, the LAPT amplifications of the last
rat experiment and the subsequent labelings and microarray hybridizations will be completed.
Milestone 36
Milestone description: Final integration of expression data and informatics analysis
Institution: UNM/ ASU-Johnston
1. Date started: 03-01-2009
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
 The strategy for gene selection utilizes pattern mapping algorithms to determine any one of
three basic patterns of gene expression (Up, Down, and Flat) over the time course of
infection (Figure 1). ASU assigns the pattern in the GeneSpring analysis software so that
any signals will be low in the uninfected lung (T0) and then progress across the time course
with the defined patterns.
Figure 1. Pattern map strategies for gene expression patterns that increase over time (Up),
decrease over time (Down), or remain flat across the time course (Flat). ASU assigns a pattern
map and perform a correlation analysis to identify the top 2-300 genes that correlate with the
assigned pattern (the red lines show the pattern map styles).
File locations …R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-182009\Pattern_Mapping_Strategies.JPG.
Page 28 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
 With the gene lists identified by the pattern maps in each of the experimental
datasets, the genes that are restricted to any one pattern are identified by
Venn diagram analysis. Examples of these Venn analyses of the three
experimental data sets (Mouse Low-Dose, Mouse High Dose, and Rat
Challenge) are shown in Figure 2. Removing the genes that are in the
intersections between the patterns identifies the sets of genes that are
restricted to the Up, Down, and Flat patterns. For example, in the Mouse
Low-Dose Venn analysis (graph on the left) there are 116 Down-restricted,
100 Flat-restricted, and 185 up restricted genes. This analysis was
completed for each of the experimental groups.
Figure 4. Venn diagram analysis of the three gene expression patterns (Up, Down, Flat)
across the three sample sets of data. The top approximately 200 genes correlating with the
pattern mapping algorithm were used in the Venn analyses.
File locations …R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-182009\Mouse_Low_Dose.JPG; R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-182009\Mouse_High_Dose.JPG; R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-182009\Rat.JPG
 The next comparison utilized Venn analyses to identify the gene sets that are
intersecting between experimental data sets. For example, using the UpRestricted lists (graph on the left), the genes that are cross identified in
between the experimental groups can be determined. In this case there
were 10 genes in common between the two mouse challenge doses; 2
genes in common between the Mouse High-Dose and Rat experiments; and
6 genes in common between the Mouse Low-Dose and Rat experiments.
Page 29 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 4. Venn diagram analysis of the three gene expression patterns (Up, Down, Flat) across the
three sample sets of data. The top approximately 200 genes correlation with the pattern mapping
algorithm were
File locations …R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-18-2009\Up_Restricted.JPG;
R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-18-2009\Flat_Restricted.JPG;
R:\GeneVac\FTU\Contract\Microarray\Milestones\36\6-18-2009\Down_Restricted.JPG
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Analysis is delayed due to troubleshooting with the microarray printing under ASU MS35.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
15%
9. Work plan for upcoming month
As new data sets are completed, ASU will add these to the current data to average the
experimental groups for each time point. As genes of interest are identified either from
experiments in the TVDC consortium or from literature reports, these will be incorporated
into the comparison gene lists.
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4)
(iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis
subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis
subsp. tularensis (SCHU S4)
Institution: UTSA
1.
2.
Date started: April 1, 2006
Date completed: in progress
Page 30 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
3.
Work performed and progress including data and preliminary conclusions
In order to generate mutants in SCHU S4, UTSA develops tools to generate successful deletions.
Therefore, UTSA’s focus is two fold, one is cloning experiments to get our target deletions into vectors
that are used to create these deletions and second are experiments with SCHU S4 itself using
constructs that will allow UTSA to make deletions into SCHU S4.
I.
Cloning:
a. The pJC84+T20NadM C5 plasmid was sent for sequencing and determined to be correct.
UTSA assigned this plasmid the identification of pKEK1305. This approach involves moving the F
novicida mutant NadM gene into SCHU S4. Data located in TVD UTSA Notebook 7, pages 105
and 106.
II. Experiments to generate mutants in SCHU S4:
a. In the prior report, an intron (tulatron plasmid) generated, potential NadM mutant, N7-6, 5-3D,
4B4 was selected for further passaging to generate more isolated clones. This parent clone is
abbreviated “4B4” and its resulting single clones from the passage will be referred to as 4B4-a,
4B4-b, etc. These single colonies were used to prepare genomic isolations and used in a
polymerase chain reaction using the earlier mentioned oligos:
nadM-NcoI: 5’- cgcgcgccatgggcatgtatgatatttcagtttttataggaagatttcag -3’
nadM-EcoR1: 5’- cggaattcttatagtttcttaccacattcctctaataaaatc -3”
These oligos will yield the mutant profile of ≈1900 bp for the complete correct NadM mutant and
the wild type profile with be ≈1000 bp (Figure 2). Figure 2 represents a few of the screened
genomic isolations performed this month. UTSA actually screened a total of 34 single colonies
this past month all of which yield results similar to the figure presented below.
Figure 1.
Legend
1 Kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14
2.0
1.0
1.
2.
3.
4.
5.
6.
7.
1 Kb ladder
KKT1
4B4
4B4-c
4B4-d
4B4-e
4B4-f
8.
9.
10.
11.
12.
13.
14.
4B4-g
4B4-h
4B4-i
4B4-j
4B4-k
4B4-l
4B4-m
Figure 1 represents the PCR profiles of various single picks from the cycled NadM Schu S4 mutant N7-6, 53D,4B4 (4B4) using the forward and reverse NadM oligos. The correct Schu S4 NadM mutant should yield
only one pcr product of ≈1900 bp. The wild type profile (lane2) will show ≈1000 bp pcr product. Lane 3 is
the parent 4B4 which looked correct in last screening. The remaining lanes represent isolated Schu S4
NadM clones from the passaged 4B4 clone. Comparison to the respective parent (lane 3) shows that the
NadM mutant has not been recovered based on the presence of both parent and mutant products. Thus the
parent NadM mutant was not stable and the NadM mutant was lost during subsequent passaging. The intron
II (tulatron plasmid) approach to NadM is terminated Data located in TVD UTSA Notebook 7, page 109.
b. The clone N7-6, 5-3D4B4 was a slow growing clone and apparently was a mixed population
of wild type and mutant. The subsequent passage of this mutant resulted in all mixed single
clones. Thus the parent NadM mutant was not stable and the NadM mutant was lost during
subsequent passaging. The intron II (tulatron plasmid) approach to NadM is terminated
Page 31 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
c.
The new intron II FTT0748 construct, pKEK1261 was used a cryotransformation experiment
and resulted in transformants. 5 of 10 randomly selected isolates were correct from the last
report. Clones 7 and 8 were passaged to verify a single clone and correct profile. Single
clones were collected from these passaged clones and genomic DNA was isolated. Using
forward and reverse oligos (*) directed to the FTT0748 we perform PCR on these genomics.
In addition, we used (internal oligos) the FTT0748 Nco I F (forward primer) with the universal
EBS oligo which is directed to the intron portion on the insertion which will verify that this
intron is inserted at the correct location on the chromosome (Figure 2).
a.
b.
FTT0748 Nco I F: 5’-gcgcccatgggtgaagacaaaagaattcaagtaat-3’
FTT0748 Xho I R: 5’-gcgcctcgagttatttaatcccaatctcatctat-3’
Figure 2.
Internal oligos
1 Kb
1
2
3
4
5
6
0.8
0.2
7
8
Legend
1. 1 Kb ladder
2. KKT1
3. FTT0748 C7
4. FTT0748 C7a
5. FTT0748 C7b
6. FTT0748 C7c
7. FTT0748 C7d
8. FTT0748 C7e
1.5
0.6
FTT0748 For & Rev oligos
Figure 2 represents the PCR profiles of various passaged FTT0748 Schu S4 mutant candidates of clone 7
from previous report. The lower panel is the pcr profile resulting from using the forward and reverse
FTT0748 oligos with the various genomic templates. The correct Schu S4 FTT0748 mutant should yield
only one pcr product of ≈1700 bp and wild type profile (lane2) will show ≈700 bp pcr product. All the
selected single clones from this passage appear correct by pcr. In the upper panel, the forward FTT0748
with universal EBS intron specific oligos were used in PCR to look for the correct insertion of the FTT0748
intron into the SchuS4 chromosome. The expected size for this PCR product is ≈800 bp which represents
the intron portion of the FTT0748 intron II construct with a 5’ end of the FTT0748 gene located on the Schu
S4 chromosome. The wild type will not yield a product with this oligo set (lane 2). All the selected FTT0748
Schu S4 mutant candidates have the intron II at the correct location. Data located in TVD UTSA Notebook
7, page 111.
d.
This coming month UTSA will cure the plasmid from the FTT0748 clone (will use clone C7c)
by passaging this mutant onto non-select TSA+++ plates to generate single colonies and
these colonies will be verified for loss of plasmid by patching on 60 ug/ml kanamycin TSA+++
plates and look for sensitivity (no growth) on these plates. The sensitive kanamycin clone
which results will again be screened by PCR using the previously mentioned oligos then
subsequently sent for sequencing to confirm this FTT0748 clone.
Page 32 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
e.
4.
Since the pJC84-T20 NadM plasmid was correct, UTSA is preparing for an electroporation
into SCHU S4. UTSA is ordering ferric pyrophosphate and isovitalex which is needed to
supplement modified Mueller Hinton broth for this transformation.
Significant decisions made or pending
UTSA terminated the transposon/tulatron approach to generating the NadM mutant in SCHU S4.
5. Problems or concerns and strategies to address
The NadM strain is very elusive using the tulatron method. UTSA terminated the tulatron approach to
the NadM mutant. UTSA will pursue the Nad M SCHU S4 mutant using the confirmed pJC84 + T20
NadM plasmid construct.
6. Deliverables completed
KKF5: igLC1 IgLC2 Schuh4: KKF10: iglD1 igLD2 Schuh4; and KKF13: VgrG1 VgrG2 Schuh4 mutants
are completed Schuh4 strains to date.
7. Quality of performance
Good
8. Percentage completed
95%
9. Work plan for upcoming month
a. Will continue with second strategy for generating NadM Schu S4 mutant via the pJC84 mating
vector from Dr. Celli’s lab at the Rocky Mountain labs. UTSA will follow a protocol designed by Dr.
Celli’s lab which utilizes special media preparations and electroporation rather than
cryotransformation.
b. In addition, UTSA with clone in the “mob” gene into the existing pJC84 NadM construct
(pKEK1305) in order to also facilitate the integration of the plasmid into the SCHU S4 chromosome
via mating technique (just as a back up).
c. Will continue with the FTT0748 Schu S4 mutant; by curing the correct mutant from the plasmid.
The kanamycin sensitive clones will be screened by PCR using FTT0748 gene specific oligos and
also oligos specific to the intron II region of this mutant
Milestone 52
Milestone description: Create RecA mutants in F. tularensis subsp. tularensis(Schu S4)
Institution: UTSA
1. Date started: 9/15/2007
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 Creation of FTT1579 and FTT0523 gene mutants in Schu S4. FTT1579 functions as a Type III
restriction enzyme, and FTT0523 is the hypothetical protein that is similar to Q89Z57 Type I
restriction enzyme Coati specificity protein. Both of FTT1579 and FTT0523 genes limit the entrance
of plasmid DNA into the Schu S4 strain. The goal is to break down the restriction barriers (FTT1579
and FTT0523) of Schu S4. The method allows us to retarget these two restriction enzymes and
inactivate certain gene(s) to facilitate introduction of foreign plasmid DNA into Schu S4 strain.
3.1.1 UTSA initiated the mutants in F novicida, due to temporary restricted access to the BSL3
laboratory. Since the colony PCR using FTN1487 gene primers “FTN1487 for” and “FTN1487
rev” didn’t show that the intron insertion was in FTN1487 gene of any of 60 potential
transformants screened last month, UTSA performed the colony PCR using the insertion primer
“EBS Universal” and the gene primer “FTN1487 for” or “FTN1487 rev” to search for the evidence
of the existence of the intron insertion in FTN1487 gene. Figure 1 shows the colony PCR .
Page 33 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure1: The gel image of colony PCR using the FTN 1487gene primer and the insertion primer.
Figure 1. legend, results and data location: lane8 and lane22 represent wild type U112 with no bands present, as
expected with PCR using the insertion primer. Lane2-7, 9-13 or lane16-21, 23-27 represent colonies 1-11. Lane2-13
were PCR amplified using the insertion primer “EBS Universal” and the gene primer “FTN1487 for” and no PCR
product is produced. Lane16-27 were PCR amplified using the same insertion primer and the gene primer “FTN1487
rev” and 10/11 colonies (not colony1) produced the expected DNA band of ~900bp. This indicated that the intron
insertion was in FTN1487 gene of colony2-11 and the orientation of the insertion primer “EBS Universal” was in the
reverse of the gene primer “FTN1487 rev”. Data recorded on UTSA TVDC notebook #6, page84 for Figure1.
3.1.2 Colonies 2-11 were PCR confirmed for the insertion in FTN1487 gene using one set of primers (
insertion primer “EBS Universal” and the gene primer “FTN1487 rev”), but not the other set of gene
primers ( “FTN1487 for” and “FTN1487 rev”). This potential discrepancy, indicated the possibility of large
amount of wild type U112 colonies being mixed with a few mutants. To obtain the pure FTN1487 gene
mutants, the single colonies from the original colonies 2-11 were selected on TSA++ agar medium with
50ug/ml Kanamycin and screened using both sets of primers. After screening for four cycles of single
colonies, about 20 colonies (lane2,3,4,5,6,8,9,11,16,18,20,22,23,24 on Figure 2 and lane3,4,5,8,12,13 on
Figure3) now screened positive using the gene primers FTN1487 for” and “FTN1487 rev”. Figure 2 and
Figure3 show this colony PCR.
Figure 2: The gel image of colony PCR using “FTN1487 for” and “FTN1487 rev”.
Page 34 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 3: The gel picture of colony PCR using “FTN1487 for” and “FTN1487 rev”.
Figure2, 3 legend, results and data location: In Figure2, lane7 and 21 were wild type U112, lane2-6, 8-13, 16-20,
and22-27 was colony1-22. On Figure3, lane7 was the wild type U112, lane2-6, 8-13 was colony23-33. Lanes with the
~ 1890bp band indicated the insertion in FTN1487 gene , compared to wild type U112 with a band of ~ 990bp). Data
recorded on UTSA TVDC notebook #6, page88 for Figure2 and 3.
4. Significant decisions made or pending
After the mutants are made in F novicida, UTSA will make the same mutants in SCHU S4
5. Problems or concerns and strategies to address
The BSL3 lab is available now. The wild type Schu S4 will be recovered from the frozen stock on
TSA++ agar medium for making FTT1579 mutants in Schu S4.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed.
About 64% of scientific work completed.
9. Work plan for upcoming month
i. Send the gel purified PCR products (using the insertion primer “EBS Universal “and the gene
primer “FTN1487 rev”) for sequencing as a second method to confirm the intron insertion.
ii. Remove the plasmid from the mutant strain by incubation of the strain at 37C.
iii Screen the colonies after the plasmid being removed from the mutant strain.
iv Make the frozen stocks of the FTN1487 mutant strain.
v. Recover the wild type Schu S4 on TSA++ plate from the frozen stock for the cryotransformation of
the tulatron vector into Schu S4.
Milestone 53A
Milestone description Phenotyping and vaccine efficacy demonstration of recA, other subsp.
tularensis mutants.
53.1: phenotyping and immunologic characterization of Ft subsp. tularensis recA and recAiglC
strains, as well as strains generated in milestone #54.
53.2: phenotyping and immunologic characterization of Ft subsp. tularensis recA plus best
attenuating mutation(s) strains (generated in milestone #52), as well as strains generated in
milestone #54.
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: In progress
Page 35 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
3. Work performed and progress including data and preliminary conclusions
Analyze the antibody profiles of mice intranasally immunized with KKT23 (Ft subsp.
tularensis recAiglC) (Note book #9, pages 35-37). Blood was collected from the PBS- and
KKT23 (3X103, 3X104, 3X105, 3X106 CFU) - immunized mice at day 28 after vaccination. AntiKKT23 specific total serum antibody, as well as IgG1 and IgG2a isotype titers was
determined by ELISA. Antigens, either UV-irradiated KKT23 (106/well) or HEL (Hen Egg
Lysozyme, 1µg/well, an unrelated antigen as control), were coated onto 96-well microplates
and reacted with serial dilutions of sera samples. Goat anti mouse Ig(H+L), IgG1 and IgG2a
antibody conjugated with horseradish peroxidase were used as the secondary antibodies to
determine antibody isotypes and titers. As shown in Fig. 1, mice immunized i.n. with KKT23
produced high titers of KKT23-specific total, IgG1 and IgG2a antibodies in all of the four
different vaccination groups. The comparable titer of IgG1 and IgG2a isotype suggest that i.n.
immunization with KKT23 induced both Th1 and Th2 immune response. KKT23-specific
antibody was not detected in mice mock-vaccinated with PBS (data not shown). All tested
serum samples showed no reactivity to the unrelated HEL protein (data not shown).
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
15% of scientific work completed on milestone 53A.
9. Work plan for upcoming month
Evaluate the protective efficacy of i.n. KKF23 vaccination against pulmonary Schu S4 challenge.
Page 36 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 53B
Milestone description: Examining the protective efficacy of LVS and two attenuated SCHU S4
mutant strains via oral vs. intradermal inoculations in the rat model;
50.1: replication of LVS, Schuh4, iglC Schuh4, and one additional attenuated Schuh4 mutant
derived in milestone 49 in rat macrophages .
50.2: protective efficacy of LVS, iglC Schuh4, and one additional attenuated Schuh4 mutant
derived in milestone 49 against Schuh4 intratracheal challenge (oral vs. intradermal
vaccinations in rats)
50.3: antigen specific cellular and humoral responses of rats following vaccination with LVS,
iglC Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49
50.4: bacterial dissemination and lung pathology of rats following vaccination with LVS, iglC
Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49
Institution: UTSA
1. Date started: 12/01/2008
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
a: Protective efficacy of LVS vaccination followed by F. tularensis SCHU S4 pulmonary
challenge in Fisher 344 rats. (Notebook # 10, pages 40, 53). Groups of F344 rats (6 rats per
group) were vaccinated either orally or intradermally (I.D.) with 107 CFU of LVS in PBS or
mock vaccinated orally with PBS alone and rested for four weeks. Rats were then challenged
intratracheally (I.T.) with 104 CFU of SCHU S4 and monitored daily for weight loss and
survival. As shown in Figure 1, both routes of vaccination conferred 100% survival against a
SCHU S4 challenge of this dose. Furthermore, LVS vaccinated rats from both groups
exhibited no outward signs of illness and maintained their full body weight throughout the
course of infection. As expected, all but one mock vaccinated rat succumbed to challenge
within eight days and exhibited weight loss of up to 20% their original body weight. These
results show that both oral and I.D. vaccination with LVS are able to confer protective
immunity to Fisher 344 rats against a pulmonary SCHU S4 challenge
Page 37 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
b: UTSA previously showed that Fisher 344 rats are highly resistant to F novicida challenge
(LD50 >105 CFU). This month, UTSA determined the antigen-specific serum antibody profile
following intratracheal (I.T.) challenge of Fisher 344 rats with F. novicida U112 (Notebook #
10, pages 49, 60). Groups of F344 rats (6 rats per group) were challenged I.T. with either 10 2
or 105 CFU of U112 or mock challenged with PBS and rested for 4 weeks. Blood was
collected and sera were prepared for determination of U112-specific total antibody, IgG1 and
IgG2a by ELISA. As shown in Figure 2, both doses of U112 elicited high antigen-specific total
antibody and IgG2a. As reported earlier with LVS vaccination (April, 2009), this data indicates
that I.T. challenge with as low as 100 CFU of U112 is able to induce a high humoral response
which is Th1 biased.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
24%
9. Work plan for upcoming month
Determine cellular response of Fisher 344 rats following both oral and intradermal LVS vaccination
Page 38 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Acronym List updated 7/13/09
ABSL3: Animal Biosafety Level 3 lab
AM: alveolar macrophages
ASU: Arizona State University
BLD: below limit of detection
BMDM: bone marrow derived macrophages
BP: base pair
BSL2: Biosafety Level 2 lab
BSL3: Biosafety Level 3 lab
C: centigrade
cDNA: complimentary deoxyribonucleic acid
CDA: confidentiality and disclosure agreement
CDM: Chamberlains defined media
CFU: colony forming units
COA: contract officers authorization
CRDA: Cooperative research and development agreement
C-term: Carboxy terminus
DNA: deoxyribonucleic acid
DVC: Dynport Vaccine Company
ED50: Effective Dose, 50 % dead
ELISA: enzyme-linked immunosorbent assay
ELISpot: enzyme-linked immunospot assay
EOH: Employee Occupational Health
FDA: Federal Drug Administration
FF: formalin fixed
FT or Ft or F. tularensis: Francisella tularensis
GDP: genome directed primers
GI: gastrointestinal
GLP: good laboratory practice
KBMA: killed but metabolically active
HK: heat killed
HTP: high through put
IAA: interagency agreement
IACUC: Institutional animal care and use committee
ICS: Intracellular staining
ID: intradermal
IFNγ: interferon gamma
Page 39 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
IL2: interleukin 2
IN: intranasal
IND: investigational new drug
IP: intraperitoneal
IRB: institutional review board
IRS: immune rat sera
IT: intratracheal
IVT: in vitro translation/transcription
KB: kilobase
L: liter
LAPT: Linear Amplification of Procaryotic Transpcript
LBERI: Lovelace Biomedical and Environmental Research Institute
LD50: Lethal dose 50% dead
LD99: lethal dose, 99% dead
LN: lymph node
LPS: lipopolysaccharide
LRRI: Lovelace Respiratory Research Institute
LVS: Live vaccine strain (tularemia)
NHP: nonhuman primate
MDM: monocyte derived macrophages
mL: milliliter
MLN: mesenteric lymph node
mM: millimolar
MOI: multiplicity of infection
MS: Milestone
MSCR: Milestone Completion Report
MTA: material transfer agreement
MTS reagent: (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2Htetrazolium, inner salt
N: number
NIAID: National Institute of Allergy and Infectious Disease
NRS: normal rat sera
N-term: amino- terminus
OD: optical density
ORF: open reading frame
PBMC: peripheral blood mononuclear cells
PBS: phosphate buffered saline
pM: pico Molar
Page 40 of 41
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 6/01/2009 to 6/30/2009
Due Date: 7/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
pmol: picomole
PCR: polymerase chain reaction
QA: quality assurance
QC: quality control
qPCR: quantitative polymerase chain reaction
RNA: ribonucleic acid
SC: subcutaneous
SDS: sodium dodecyl sulfate
SCHU S4: virulent strain of Francisella tularensis
SOP: standard operating procedure
TBLN: tracheobronchial lymph node
Tn: transposon
TNFα: tumor necrosis factor alpha
TVDC: Tularemia vaccine development contract
uL: microliter
UNM: University of New Mexico
USAMMDA: United States Army Medical Materiel Development Activity
USAMRIID: United States Army Medical Research Institute for Infectious Disease
UTSA: University of Texas at San Antonio
WT: wild type
Page 41 of 41